DNA library construction kit and application thereof

By optimizing the adapter ligation reaction solution and adapter design in the DNA library construction kit, the problems of low library yield and low template conversion rate were solved, achieving more efficient library construction and simplified operation.

CN121992071APending Publication Date: 2026-05-08JIYINJIA BIOMEDICAL TECHNOLOGY (SHAOXING) CO LTD +2
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202512001129.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-26
Publication Date
2026-05-08

AI Technical Summary

Technical Problem

Existing DNA library construction methods suffer from low library yield and/or low template conversion rate.

Method used

A ligation reaction solution containing buffer, magnesium ions, thiol reducing agent, adenine nucleoside triphosphate (ATP), and propylene glycol was used instead of polyethylene glycol (PEG), and a specific molecular tag adapter and ligase were employed to optimize the adapter ligation process.

Benefits of technology

It improves the efficiency of joint connection, reduces the generation of interlocking bodies, simplifies automated operation, and increases template recycling rate and library output.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention belongs to the technical field of library construction, and particularly relates to a DNA library construction kit and application thereof. The invention provides a DNA library construction kit, which comprises a reagent combination or kit for linker connection, and the reagent combination or kit for linker connection comprises a connection reaction liquid; the ligation reaction liquid comprises a buffer solution, magnesium ions, a thiol reducing agent, adenosine triphosphate (ATP) and propylene glycol; the ligation reaction liquid does not contain polyethylene glycol (PEG), and propylene glycol is adopted to replace polyethylene glycol, so that the content of PEG in the ligation reaction system is reduced, and the generation of chimera can be reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of library construction technology, specifically relating to DNA library construction kits and their applications. Background Technology

[0002] The clinical significance of high-throughput sequencing data is mainly reflected in two aspects: one is that it can directly serve as a diagnostic tool for the tested individuals, and the other is that, as part of big data, it accumulates data to help humanity understand previously unknown diseases. This part plays a supporting and reference role.

[0003] Next-generation sequencing (NGS) is the most commonly used technique in modern molecular biology high-throughput sequencing research. NGS DNA sequencing mainly involves two processes: library construction and sequencing. The library construction process typically includes: (1) fragmenting unfragmented genomic DNA with ultrasound or enzymatic fragmentation (this step can be omitted if using cell-free plasma DNA or other fragmented DNA); (2) repairing the DNA fragments by filling in the end gaps; (3) phosphorylating the 5' end of the repaired DNA fragments and adding a single base A (adenine) to the 3' end to obtain sticky ends with a single base; (4) ligating the DNA fragments with sticky A ends to adapters designed for different sequencing platforms (the adapters can be tagged with samples) to obtain ligation products; (5) if sequencing is performed on a targeted enriched region (such as whole exome sequencing or NGS panel sequencing), PCR is performed on the ligation products using universal primers for each sequencing platform on the adapters to obtain a sufficient amount of amplified DNA library (sample tags can also be introduced at this step); optionally, (6) enriching the target region of the amplified DNA library using probe capture or targeted primer methods to prepare sequencing libraries. Current DNA library construction methods still suffer from problems such as low library yield and / or low template conversion rate. Summary of the Invention

[0004] The first aspect of the present invention is to provide a DNA library construction kit.

[0005] The second aspect of this invention aims to provide an application of the reagent kit of the first aspect of this invention.

[0006] The third objective of this invention is to provide a method for constructing a DNA library.

[0007] The fourth aspect of this invention is to provide a DNA library.

[0008] The fifth aspect of this invention aims to provide a sequencing method.

[0009] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a DNA library construction kit comprising: a reagent combination or kit for adapter ligation, wherein the reagent combination or kit for adapter ligation comprises: a ligation reaction solution; wherein the ligation reaction solution comprises: a buffer, magnesium ions, a thiol reducing agent, adenine triphosphate (ATP), and propylene glycol; wherein the ligation reaction solution does not contain polyethylene glycol (PEG).

[0010] In this invention, propylene glycol is used to replace polyethylene glycol, thereby reducing the PEG content in the linkage reaction system and thus reducing the generation of chimeras.

[0011] In some embodiments, the buffer solution comprises at least one of: citrate buffer, MES buffer solution, phosphate buffer, Bis-tris buffer, and Tris hydrochloric acid buffer; more particularly, Tris hydrochloric acid buffer.

[0012] In some embodiments, the concentration of the buffer solution in the ligation reaction solution is 0.1-1 M; further, 0.1-0.4 M; and even further, 0.1-0.2 M.

[0013] In some embodiments, the pH of the buffer solution is 7-9; more specifically, it is 7.4-7.8.

[0014] In some embodiments, the magnesium ions are derived from MgCl2.

[0015] In some embodiments, the concentration of magnesium ions in the bonding reaction solution is 0.01-1 M; further, 0.01-0.04 M; and even further, 0.01-0.02 M.

[0016] In some embodiments, the thiol reducing agent comprises at least one of tris(2-formylethyl)phosphonic acid hydrochloride (TCEP), dithiothreitol (DTT), and glutathione reduced (GSH); more specifically, TCEP.

[0017] In some embodiments, the concentration of the thiol reducing agent in the connecting reaction solution is 0.01-1 M; further, 0.01-0.04 M; and even further, 0.012-0.014 M.

[0018] In some embodiments, the concentration of ATP in the ligation reaction solution is 0.001-0.1 M; more specifically, 0.001-0.01 M; more specifically, 0.001-0.002 M.

[0019] In some embodiments, the concentration of propylene glycol in the bonding reaction solution is 40%-80% by volume; further, 50%-70%; and even further, 55%-65%.

[0020] In some embodiments, the reagent combination or kit for connector ligation further comprises: a ligase.

[0021] In some embodiments, the ligase comprises at least one of: T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, Pfu DNA ligase, HiFi DNA ligase, and Quick Ligase; more particularly, it is T4 DNA ligase.

[0022] In some embodiments, the reagent combination or kit for connector connection further comprises: a connector.

[0023] In some embodiments, the connector is the hybrid specific molecular tag connector in patent document CN 114317528 A, specifically as follows: both the sense and antisense molecular tags of the connector use a specific molecular tag UMI group, which includes: a first specific molecular tag UMI with a sequence length of 5 bp, a second specific molecular tag UMI with a sequence length of 6 bp, a third specific molecular tag UMI with a sequence length of 7 bp, and a fourth specific molecular tag UMI with a sequence length of 8 bp.

[0024] In some embodiments, the sequences of the sense molecular tags of the specific molecular tag UMI group are shown in Table 2 of CN114317528 A, and the sequences of the antisense molecular tags are shown in Table 2 of CN 114317528 A.

[0025] In some embodiments, the first specific molecular tag UMI, the second specific molecular tag UMI, the third specific molecular tag UMI, and the fourth specific molecular tag UMI are present in the same number of moles in the connector.

[0026] In some embodiments, the linker comprises two partially complementary linker oligonucleotide chains: The linker oligonucleotide chain 1 includes, from the 5' end to the 3' end, an index2 primer binding region, a positive linker complementary region, a positive molecule tag, at least one base S with base balancing function, and one prominent fixed base T. Linker oligonucleotide chain 2, from the 5' end to the 3' end, includes a base complementary to base S in linker oligonucleotide chain 1, an antisense molecular tag anticomplementing to the sense molecular tag in linker oligonucleotide chain 1, an antisense linker complementary region anticomplementing to the sense linker complementary region in linker oligonucleotide chain 1, and an index1 primer binding region.

[0027] In some implementations, "S" represents either the G or C base.

[0028] In some embodiments, in the linker oligonucleotide chain 1, the length of the index2 primer-binding region is 15-42 bp. The length of the positive linker complementary region is 8-10 bp, and the length of the positive molecular tag is 5-8 bp; the positive linker complementary region is wholly or partially overlapped with the 3' end sequence of the index2 primer binding region; In some embodiments, in the linker oligonucleotide chain 2, the antisense molecular tag is 5-8 bp in length, the antisense linker complementary region is 8-10 bp in length, and the index1 primer binding region is 15-30 bp in length; the antisense linker complementary region is wholly or partially overlapped with the 5' end sequence of the index1 primer binding region.

[0029] In some embodiments, in the linker oligonucleotide chain 1, the number of each of the four bases A / T / G / C in the sequence composed of the positive molecule tag, the balancing base S, and the fixed base T accounts for 6.25% to 43.75% of the total number of bases in the positive molecule tag. In some embodiments, in the linker oligonucleotide chain 2, the number of each of the four bases A / T / G / C in the sequence composed of the antisense molecular tag and the complementary base S accounts for 6.25%-43.75% of the total number of bases in the antisense molecular tag.

[0030] In some implementations, the 5' end of the linker oligonucleotide chain 2 is phosphorylated.

[0031] In some embodiments, the connector is a Y-type hybrid specific molecular tag connector.

[0032] In some implementations, the index1 and index2 sequences are selected from Table 1 of CN 114317528 A, which ensures the amplification efficiency of the constructed library.

[0033] In some embodiments, the connector is the connector shown in Table 2 of patent document CN 114317528 A.

[0034] In some embodiments, the DNA library construction kit further comprises: a reagent combination or kit for end repair and adding "A".

[0035] In some embodiments, the reagent combination or kit for end repair and adding "A" comprises: an end repair reaction solution; the end repair reaction solution comprises: a buffer solution, magnesium ions, potassium ions, a thiol reducing agent, adenine nucleoside triphosphate (ATP), dNTPs, and a nonionic surfactant.

[0036] In some embodiments, the buffer solution comprises at least one of: citrate buffer, MES buffer solution, phosphate buffer, Bis-tris buffer, and Tris hydrochloric acid buffer; more particularly, Tris hydrochloric acid buffer.

[0037] In some embodiments, the concentration of the buffer solution in the end-repair reaction solution is 0.1-1 M; more specifically, 0.4-0.5 M.

[0038] In some embodiments, the pH of the buffer solution is 7-9; more specifically, it is 7.8-8.2.

[0039] In some embodiments, the magnesium ions are derived from MgCl2.

[0040] In some embodiments, the concentration of magnesium ions in the end-repair reaction solution is 0.01-1M; further, 0.05-0.1M; and even further, 0.08-0.09M.

[0041] In some embodiments, the potassium ions are derived from KCl.

[0042] In some embodiments, the concentration of potassium ions in the end-repair reaction solution is 0.01-1 M; further, 0.05-0.1 M; and even further, 0.08-0.09 M.

[0043] In some embodiments, the thiol reducing agent comprises at least one of tris(2-formylethyl)phosphonic acid hydrochloride (TCEP), dithiothreitol (DTT), and glutathione reduced (GSH); more specifically, TCEP.

[0044] In some embodiments, the concentration of the thiol reducing agent in the end-repair reaction solution is 0.01-1M; further, 0.01-0.03M; and even further, 0.01-0.02M.

[0045] In some embodiments, the concentration of ATP in the terminal repair reaction solution is 0.001-0.1 M; further, 0.001-0.01 M; and even further, 0.006-0.008 M.

[0046] In some embodiments, the concentration of the dNTP in the end-repair reaction solution is 0.001-0.1 M; further, 0.001-0.02 M; and even further, 0.008-0.012 M.

[0047] In some embodiments, the nonionic surfactant comprises at least one of Tween 20, Triton X-100, NP-40, and Pluronic F-68; more specifically, Tween 20.

[0048] In some embodiments, the concentration of the nonionic surfactant in the end-repair reaction solution is 0.01%-1% by volume; further, 0.05%-0.15%; and even further, 0.08%-0.12%.

[0049] In some embodiments, the reagent combination or kit for end repair and adding "A" further comprises: end repair enzyme.

[0050] In some embodiments, the terminal repair enzyme comprises a polymerase.

[0051] In some embodiments, the terminal repair enzyme further comprises a polynucleotide kinase, which is used to dephosphorylate and phosphorylate the DNA fragment at the 3' end when the end of the DNA fragment is not 5' phosphate and / or 3' hydroxyl.

[0052] In some embodiments, the polynucleotide kinase comprises T4 polynucleotide kinase.

[0053] In some embodiments, the polymerase comprises at least one of T4 DNA polymerase, Klenow enzyme, T7 DNA polymerase, DNA polymerase I, and Taq DNA polymerase; and further comprises at least one of T4 DNA polymerase, Taq DNA polymerase, and Klenow enzyme.

[0054] In some embodiments, the terminal repair enzyme comprises: T4 polynucleotide kinase, T4 DNA polymerase, Klenow enzyme, and Taq DNA polymerase.

[0055] In some embodiments, the DNA library construction kit further comprises: a reagent combination or kit for library amplification.

[0056] In some embodiments, the reagent combination or kit for library amplification comprises: library preparation primers and DNA polymerase reaction solution.

[0057] In some embodiments, the primers used for library construction are the primers of Example 3 in patent document CN 114317528 A.

[0058] In some embodiments, the DNA polymerase reaction solution comprises: DNA polymerase, buffer solution, magnesium ions, and dNTPs.

[0059] In some embodiments, the DNA library construction kit further comprises magnetic beads for purifying adapter ligation products and / or library amplification products.

[0060] In some embodiments, the magnetic beads comprise PEG.

[0061] In some embodiments, the DNA library construction kit further includes a substance for breaking down DNA.

[0062] In some embodiments, the DNA-breaking substance is selected from one or more of the following methods: chemical breaking methods (e.g., acid hydrolysis, metal ion catalysis), biological breaking methods (e.g., enzyme digestion), and physical breaking methods (e.g., ultrasonic disruption, high-pressure homogenization).

[0063] In some embodiments, the DNA library construction kit further includes: an instruction manual describing a DNA library construction method (preferably the DNA library construction method of the third aspect of the present invention).

[0064] In some embodiments, the DNA library construction kit further comprises: a combination of nucleic acid extraction reagents or a kit.

[0065] In some embodiments, the nucleic acid extraction reagent combination or kit is a nucleic acid extraction reagent combination selected from any of the following methods: alkaline lysis, phenol-chloroform extraction, chelating resin method, centrifugal column membrane adsorption method, and magnetic bead method; further, it is a nucleic acid extraction reagent combination for the magnetic bead method.

[0066] In some embodiments, the DNA library construction kit may further include reagents for obtaining a targeted library.

[0067] In some embodiments, the reagents used to obtain the targeted library are reagents selected from any of the following methods: probe capture method, targeted primer method.

[0068] In some embodiments, the DNA is derived from biological samples such as cells, fresh tissues, fresh organs, decaying tissues, formalin-fixed tissues, paraffin-embedded tissues, forensic samples, paleontological fossils, and biological materials containing cfDNA or RNA.

[0069] In some embodiments, the biological material includes, but is not limited to: peripheral blood, plasma, serum, urine, feces, saliva, cerebrospinal fluid, lymph, bronchoalveolar lavage fluid, amniotic fluid, blastocyst cavity fluid, cell culture medium, embryo culture medium, microbial culture medium, soil leachate, and bone meal leachate.

[0070] More specifically, The DNA can be isolated from a biological sample obtained from an individual (e.g., a test individual). The individual can be any living or non-living organism, including but not limited to humans, non-human animals, plants, bacteria, fungi, protozoa, or pathogens.

[0071] DNA can be isolated or obtained from any type of suitable biological sample. Nucleic acids can be isolated or obtained from single cells, multiple cells (e.g., cultured cells), cell culture media, conditioned media, tissues, organs, or organisms (e.g., bacteria, yeast, etc.).

[0072] In some cases, DNA can be obtained as part of forensic analysis. In some implementations, the kits described herein are applied to forensic samples or specimens. Forensic samples or specimens may include any biological material containing DNA. For example, forensic samples or specimens may include blood, semen, hair, skin, sweat, saliva, decomposed tissue, bone, nail scraps, licked stamps / envelopes, sluff, contact DNA, razor residue, etc. Specimens may be formalin-fixed tissue and / or paraffin-embedded tissue.

[0073] Biological samples can be any sample isolated from or obtained from an individual or a part thereof (e.g., a human individual, a pregnant female, a cancer patient, a patient with an infection or infectious disease, a transplant recipient, a fetus, a tumor, an infected organ or tissue, a transplanted organ or tissue, or a microbiome). In some embodiments, the biological sample is a cervical swab from an individual. Liquid or tissue samples from which nucleic acids are extracted can be cell-free (e.g., cell-free). In some embodiments, the biological sample may contain cellular components or cellular remnants. In some embodiments, the biological sample may include fetal cells or cancer cells.

[0074] Biological samples can be liquid samples. Liquid samples may contain extracellular nucleic acids (e.g., circulating cell-free DNA). Examples of liquid samples include, but are not limited to, blood or blood products (e.g., serum, plasma, etc.), urine, cerebrospinal fluid, saliva, sputum, biopsy samples (e.g., liquid biopsies for cancer detection), the above liquid samples, analogues, or combinations thereof. In some embodiments, a biological sample is a liquid biopsy, which generally refers to an assessment of a liquid sample from an individual regarding the presence, absence, progression, or remission of a disease (e.g., cancer). Liquid biopsies may be used in conjunction with commercially available biopsies (e.g., tumor biopsies) or as a substitute for them. In some cases, extracellular nucleic acids are analyzed in liquid biopsies.

[0075] Biological samples can be tumor nucleic acid samples (i.e. nucleic acid samples isolated from tumors).

[0076] A second aspect of the invention provides the application of the kit of the first aspect of the invention in any one of a1)-a3): a1) DNA library construction; a2) Prepare sequencing reagent kits; a3) Sequencing.

[0077] A third aspect of the present invention provides a method for constructing a DNA library, comprising the steps of using a DNA library construction kit according to the first aspect of the present invention.

[0078] In some implementations, the method includes the following steps: b1) Perform end repair and add "A" to the DNA fragment; b2) Connect the product obtained in b1) with a joint; b3) Purify the product obtained in b2); b4) Perform library amplification on the product obtained in b3); The connector connection uses the reagent combination or kit for connector connection as described in the first aspect of the present invention.

[0079] In some embodiments, the method for connecting the connector is as follows: the product obtained in b1), the connector, the connector ligation reaction solution, and the ligase are mixed and reacted.

[0080] The connector bonding reaction solution of the present invention uses propylene glycol instead of polyethylene glycol, thereby reducing the PEG content in the bonding reaction system and thus reducing the generation of chimeras.

[0081] In some embodiments, the concentration of the buffer solution in the ligation reaction system is 0.03-0.3 M; further, 0.03-0.12 M; and even further, 0.03-0.06 M.

[0082] In some embodiments, the concentration of magnesium ions in the bonding reaction system is 0.003-0.3 M; further, 0.003-0.012 M; and even further, 0.003-0.006 M.

[0083] In some embodiments, the concentration of the thiol reducing agent in the linkage reaction system is 0.003-0.3 M; further, 0.003-0.012 M; and even further, 0.0036-0.0042 M.

[0084] In some embodiments, the concentration of ATP in the ligation reaction system is 0.0003-0.03M; more specifically, 0.0003-0.003M; more specifically, 0.0003-0.0006M.

[0085] In some embodiments, the concentration of propylene glycol in the linkage reaction system is 12%-24%; further, 15%-21%; and even further, 16.5%-19.5%.

[0086] In some embodiments, the concentration of the ligase in the ligation reaction system is 1-5 U / μL; more commonly, it is 2-3 U / μL.

[0087] In some embodiments, the molar ratio of the joint obtained in the joint-connecting reaction system (b1) to the product is 50-1000; more specifically, it is 74.25-742.5.

[0088] In some implementations, by increasing the molar ratio of the joint to the product obtained in b1), the joint connection efficiency can be significantly improved, while simplifying automated operation.

[0089] In some embodiments, the reaction time is 10-25 min; further, 14-21 min; and even further, 14-16 min.

[0090] Based on the above-mentioned connector connection system, higher connection efficiency can be achieved with a shorter response time, and the time for library construction can be further shortened.

[0091] In some embodiments, the reaction temperature is 15-25°C; further, 18-22°C; and even further, 19-21°C.

[0092] In some embodiments, the method for purifying the product obtained in b2) is as follows: the product obtained in b2) is mixed with magnetic beads (preferably the magnetic beads in the first aspect of the present invention), incubated, washed with ethanol, dried, and eluted.

[0093] The connector connection reaction solution of the present invention uses propylene glycol instead of polyethylene glycol, thereby reducing the PEG content in the product obtained in b2). Therefore, when the PEG concentration in the mixed system is fixed, the content of magnetic beads can be increased, thereby reducing purification losses and improving template recovery rate.

[0094] In some embodiments, the volume ratio of the product obtained in step b2) to the magnetic beads is 1:(1-1.4); more specifically, it is 1:(1.1-1.3).

[0095] In some embodiments, the mixing is homogenization.

[0096] In some embodiments, the incubation time is 5-15 min; further, 8-12 min; and even further, 9-11 min.

[0097] In some embodiments, the concentration of the ethanol is 70-90%; more particularly, it is 75-85%.

[0098] In some implementations, the cleaning is performed 1-3 times.

[0099] In some embodiments, the elution is performed using water; further, enzyme-free water is used.

[0100] In some embodiments, the elution specifically involves adding water, mixing, and incubating (preferably incubating for 4-6 minutes).

[0101] In some embodiments, the library amplification employs the reagent combination or kit for library amplification as described in the first aspect of the present invention.

[0102] In some embodiments, the library amplification method is as follows: the product obtained from b3), the library construction primers, and the DNA polymerase reaction solution are mixed, and a PCR reaction is performed.

[0103] In some embodiments, the concentration of the library preparation primers in the PCR reaction system is 1-3 µM; more specifically, it is 1.5-2.5 µM.

[0104] This invention increases library yield while avoiding over-amplification by limiting the concentration of primers used for library construction.

[0105] In some embodiments, the PCR reaction is programmed as follows: 97-99℃ for 43-47s; 97-99℃ for 14-16s, 57-63℃ for 28-32s, 70-74℃ for 28-32s, 7-11 cycles; 70-74℃ for 56-64s.

[0106] In some embodiments, the end repair and addition of "A" employs the reagent combination or kit for end repair and addition of "A" as described in the first aspect of the present invention.

[0107] In some embodiments, the method for end repair and adding "A" is as follows: mixing DNA fragments, end repair reaction solution, and end repair enzyme, and reacting.

[0108] In some embodiments, the reaction conditions are: 28-32°C for 18-22 min, or 70-74°C for 18-22 min.

[0109] In some embodiments, the DNA fragment is 100-400 bp in size.

[0110] In some embodiments, the DNA fragment is prepared using a substance for breaking DNA as described in the first aspect of the invention.

[0111] In some implementations, the library amplification process further includes a library purification step.

[0112] In some embodiments, the library purification steps are as follows: mixing the library amplification product with magnetic beads (preferably the magnetic beads in the first aspect of the present invention), incubating, washing with ethanol, drying, and eluting.

[0113] In some embodiments, the volume ratio of the library amplification to the magnetic beads is 1:(0.7-1.1); more specifically, it is 1:(0.8-1).

[0114] In some embodiments, the mixing is homogenization.

[0115] In some embodiments, the incubation time is 5-15 min; further, 8-12 min; and even further, 9-11 min.

[0116] In some embodiments, the concentration of the ethanol is 70-90%; more particularly, it is 75-85%.

[0117] In some implementations, the cleaning is performed 1-3 times.

[0118] In some implementations, the elution is performed using Low TE.

[0119] In some embodiments, the elution specifically involves adding Low TE, mixing, and incubating (preferably incubating for 4-6 minutes).

[0120] In some implementations, the purification of the library further includes a step of obtaining a target library.

[0121] In some embodiments, the method for obtaining the targeted library is a probe capture method or a targeted primer method (preferably including the step of using the reagents for obtaining the targeted library in the first aspect of the invention).

[0122] A fourth aspect of the present invention provides a DNA library obtained by the construction method of the third aspect of the present invention.

[0123] A fifth aspect of the present invention provides a sequencing method for sequencing a DNA library according to a fourth aspect of the present invention.

[0124] The beneficial effects of this invention are: This invention provides a DNA library construction kit, comprising: a reagent combination or kit for adapter ligation, wherein the reagent combination or kit for adapter ligation comprises: a ligation reaction solution; the ligation reaction solution comprises: buffer, magnesium ions, a thiol reducing agent, adenine triphosphate (ATP), and propylene glycol; the ligation reaction solution does not contain polyethylene glycol (PEG), and propylene glycol is used to replace PEG, thereby reducing the PEG content in the ligation reaction system and thus reducing the generation of chimeras.

[0125] This invention provides a method for constructing a DNA library. By using the above-mentioned adapter ligation reaction solution, the content of PEG in the ligation reaction system can be reduced, thereby reducing the generation of chimeras.

[0126] Furthermore, by increasing the molar / mass ratio of end-repair and "A"-added joints to products, joint connection efficiency can be significantly improved, while simplifying automated operations.

[0127] Furthermore, based on a specific connector connection system, higher connection efficiency can be achieved with a shorter response time, and the time for library construction can be further shortened.

[0128] Furthermore, based on the above-mentioned connector connection reaction solution, which reduces the PEG content in the connector connection product, the content of magnetic beads can be increased when the PEG concentration in the mixed system is fixed, thereby reducing purification losses and improving template recovery rate.

[0129] Furthermore, by limiting the concentration of primers used for library construction, the library yield can be increased while avoiding over-amplification. Attached Figure Description

[0130] Figure 1 The library yields for Example 6 (FFPE V4 9 cycles), Example 8 (cfDNA V4 7 cycles), Comparative Example 1 (FFPE V3 10 cycles), and Comparative Example 2 (cfDNA V3 8 cycles) are shown.

[0131] Figure 2 The library peak chromatograms of Example 1 (FFPE 30ng), Example 2 (FFPE 200ng), Example 3 (cfDNA 15ng), and Example 4 (cfDNA 80ng) are shown.

[0132] Figure 3 The yield of intermediate libraries and the effective depth of hybridization are shown under different starting amounts.

[0133] Figure 4 The performance of the embodiments and comparative examples is shown. Detailed Implementation

[0134] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly used in the field to which this invention pertains. For the purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural forms, and vice versa.

[0135] The present invention will be further described in detail below through specific embodiments.

[0136] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0137] Unless otherwise specified, experimental methods in the following examples are generally performed under standard conditions or as recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in these examples are commercially available. For reagents whose manufacturers are listed, similar products from other manufacturers are substituted.

[0138] The preparation methods of FFPE DNA samples in the following examples / comparative examples are as follows: paraffin-embedded tumor tissue samples were collected from lung cancer patients, and FFPE DNA samples were extracted using a tissue paraffin section DNA extraction kit (Fanzhi, FG1103D-02).

[0139] The preparation methods for cfDNA samples in the following examples / comparative examples are as follows: 10 mL of whole blood was collected from lung cancer patients. The sample was collected using a cfDNA sample preservation tube (Kangwei Century, CW2815M). After centrifugation at 1600g for 10 min, the supernatant was collected, followed by centrifugation at 16000g for 10 min, and the supernatant was collected again to obtain a plasma sample. The separated plasma was then used to extract cfDNA samples using a nucleic acid extraction or purification kit (GenePlus, 120011304).

[0140] Example 1: A method for constructing an FFPE DNA library ( Figure 2 30ng FFPE; Figure 3 30ng 9Cycles A method for constructing an FFPE DNA library includes the following steps: 1. DNA fragmentation: Add 30 ng of FFPE DNA sample to the fragmentation tube of the DNA fragmentation instrument, and use TE to bring the volume to 55 μL; use the fragmentation instrument (Bioruptor Pico) for fragmentation with the parameters 30s on / 30s off, 30 cycles; use a biological fragment analyzer (Qsep100 from Taiwan) to control the fragment size. If the main peak of the fragment is too large, repeat the fragmentation until the main peak size is between 100-400 bp. 2. End-stage repair and adding "A" Prepare the reaction system in the PCR tubes according to Table 1. Place the PCR tubes in the PCR instrument and run the program as shown in Table 2.

[0141] Table 1. End-stage repair and "A" addition system

[0142] Note: The end-of-life repair reaction solution consists of the following components: 428mM Tris-HCl (pH 8), 85mM MgCl2, 85mM M KCl, 17mM TCEP, 7mM ATP, 10mM dNTP, and 0.1% Tween 20 (volume percentage). The terminal repair enzyme consists of four enzymes: T4 DNA polymerase (400 ng / μL, Novizan, T4 DNA polymerase, N101-01), T4 polynucleotide kinase (27 ng / μL, Novizan, T4 Polynucleotide Kinase, N102-01), Klenow enzyme (167 ng / μL, Novizan, DNA polymerase I Klenow fragment, N104-01), and Taq DNA polymerase (2 ng / μL, Takara, TaKaRa Taq). ™ (R001A).

[0143] Table 2. End-stage repair and "A" addition procedures

[0144] 3. Connector connection Prepare the reaction system in the PCR tubes according to Table 3. Place the PCR tubes in the PCR instrument and run the following program: without heat cap; 20℃ for 15 min; 4℃ Hold.

[0145] Table 3 Connector Connection System

[0146] Note: The connector is the connector in Table 2 of patent document CN 114317528 A; the molar ratio of connector to product is approximately 495; The ligation reaction solution consists of the following components: 133mM Tris-HCl (pH 7.6), 10mM MgCl2, 13mM TCEP, 1.67mM ATP, and 60% propylene glycol (volume percentage).

[0147] 4. Purification after adapter connection 4.1 Take out magnetic bead A (Yisheng, item number: 12601ES56) in advance, vortex thoroughly, equilibrate at room temperature for 30 minutes, and vortex again before use.

[0148] 4.2 Pipette 120 µL of magnetic bead A into a PCR tube containing the adapter ligation product, vortex for 10 s to mix, and incubate at room temperature for 10 min.

[0149] 4.3 After incubation, centrifuge the PCR tube briefly and place it on a magnetic rack for 5 minutes until the liquid is completely clear. Carefully remove the supernatant, being careful not to pick up the magnetic beads.

[0150] 4.4 Keep the PCR tube fixed on the magnetic rack, add 200 μL of freshly prepared 80% ethanol, rotate the tube wall 180 degrees and let it stand for 2 min, then carefully remove the supernatant.

[0151] 4.5 Repeat step 4.4 once.

[0152] 4.6 After briefly centrifuging the PCR tubes, place them on a magnetic rack and use a 10 µL pipette tip to remove any residual ethanol.

[0153] 4.7 Open the PCR tube cap and let it stand at room temperature for 5 minutes until the surface of the magnetic beads is no longer reflective.

[0154] 4.8 Remove the PCR tube from the magnetic rack, add 22 µL of enzyme-free water to the PCR tube, vortex for 10 s to mix, and incubate at room temperature for 5 min.

[0155] 4.9 After briefly centrifuging the PCR tube, place it on a magnetic rack and let it stand for 5 min until the liquid is completely clear. Then, carefully transfer 20 μL of the supernatant into a new PCR tube.

[0156] 5. Library amplification Prepare the reaction system in the PCR tubes according to Table 4. Place the PCR tubes in the PCR instrument and run the program as shown in Table 5.

[0157] Table 4 Library amplification system

[0158] Note: The primers used for library construction are those used in Example 3 of patent document CN 114317528 A.

[0159] Table 5 Library amplification procedures

[0160] 6. Library purification 6.1 Take out magnetic bead A (Yisheng, item number: 12601ES56) in advance, vortex thoroughly, equilibrate at room temperature for 30 minutes, and vortex again before use.

[0161] 6.2 Pipette 45 µL of magnetic bead A into a PCR tube containing the amplification product, vortex for 10 s to mix, and incubate at room temperature for 10 min.

[0162] 6.3 After incubation, centrifuge the PCR tube briefly and place it on a magnetic rack for 5 minutes until the liquid is completely clear. Carefully remove the supernatant, being careful not to pick up the magnetic beads.

[0163] 6.4 Keep the PCR tube fixed on the magnetic rack, add 200 µL of freshly prepared 80% ethanol, rotate the tube wall 180° and let it stand for 2 min, then carefully remove the supernatant.

[0164] 6.5 Repeat step 6.4 once.

[0165] 6.6 After briefly centrifuging the PCR tubes, place them on a magnetic rack and use a 10 µL pipette tip to remove any residual ethanol.

[0166] 6.7 Open the PCR tube cap and let it stand at room temperature for 5 minutes until the surface of the magnetic beads is no longer reflective.

[0167] 6.8 Remove the PCR tube from the magnetic rack, add 60 µL of Low TE to the PCR tube, vortex for 10 s to mix, and incubate at room temperature for 5 min.

[0168] 6.9 After the PCR tube is briefly centrifuged, place it on a magnetic rack and let it stand for 5 min until the liquid is completely clear. Then carefully transfer 59 μL of supernatant into a new 1.5 mL centrifuge tube.

[0169] Example 2: A method for constructing an FFPE DNA library ( Figure 2 200ng FFPE; Figure 3 200ng 7Cycles A method for constructing an FFPE DNA library is the same as in Example 1, except that the FFPE DNA sample is 200 ng, the number of cycles for "denaturation-renaturation-extension" in Table 5 is 7, and the molar ratio of adapter to product in Table 3 is approximately 74.25.

[0170] Example 3 A method for constructing a cf DNA library ( Figure 2 15 ng of cfDNA; Figure 3 15ng (8 Cycles) A method for constructing a cf DNA library is the same as in Example 1, except that the FFPE DNA sample is replaced with a 15 ng cf DNA sample, and the sample does not need to be fragmented. The number of cycles for "denaturation-renaturation-extension" in Table 5 is 8; the molar ratio of adapter to product in Table 3 is approximately 56:1.

[0171] Example 4: A method for constructing a cf DNA library ( Figure 2 80 ng of cfDNA; Figure 3 80ng 7Cycles) A method for constructing a cf DNA library is the same as in Example 3, except that the cf DNA sample is 80 ng, the number of cycles for "denaturation-renaturation-extension" in Table 5 is 7, and the molar ratio of adapter to product in Table 3 is approximately 105.1875.

[0172] Example 5: A method for constructing an FFPE DNA library ( Figure 3 20ng 9Cycles A method for constructing an FFPE DNA library is the same as in Example 1, except that the FFPE DNA sample is 20 ng; the molar ratio of adapter to product in Table 3 is approximately 742.5.

[0173] Example 6: A method for constructing an FFPE DNA library ( Figure 1 V4 9cycle; Figure 3 50ng 9Cycles A method for constructing an FFPE DNA library is the same as in Example 1, except that the FFPE DNA sample is 50 ng; the molar ratio of adapter to product in Table 3 is approximately 297.

[0174] Example 7 A method for constructing a cf DNA library ( Figure 3 30ng 7Cycles A method for constructing a cf DNA library is the same as in Example 3, except that the cf DNA sample is 30 ng, the number of cycles for "denaturation-renaturation-extension" in Table 5 is 7, and the molar ratio of adapter to product in Table 3 is approximately 280.5.

[0175] Example 8: A method for constructing a cf DNA library ( Figure 1 V4 7cycle; Figure 3 50ng 7Cycles A method for constructing a cf DNA library is the same as in Example 3, except that the cf DNA sample is 50 ng, the number of cycles for "denaturation-renaturation-extension" in Table 5 is 7, and the molar ratio of adapter to product in Table 3 is approximately 168.3.

[0176] Example 9: A method for constructing an FFPE DNA-targeting library ( Figure 3 (20ng) A method for constructing an FFPE DNA targeting library includes the following steps: 1. Hybridization Prepare the library concentration system in centrifuge tubes according to Table 6. Open the tube caps and place them in a vacuum concentrator. Concentrate and dry at 60°C. After the liquid is completely evaporated, remove the tubes and centrifuge briefly. Do not over-dry.

[0177] Table 6 Library Condensation System

[0178] Prepare the hybridization reaction solution in centrifuge tubes according to Table 7. After mixing the hybridization reaction solution thoroughly, add it to the bottom of the vacuum-concentrated and dried centrifuge tube, vortex to mix, and centrifuge briefly. Incubate at room temperature for 10 min. Vortex the incubated product and centrifuge briefly. Transfer all 17 µL of product from the centrifuge tube to a new 0.2 mL PCR tube and centrifuge briefly. Place the PCR tube in a PCR instrument and run the program shown in Table 8.

[0179] Table 7 Hybridization reaction solution

[0180] Note: Hybridization reaction solution 1 (hyb#1) contains: betaine (3M), tetramethylammonium chloride (2M), Mg 2+ (Magnesium acetate, 30mM), Triton X-100 (0.01%, volume percentage); Hybridization reaction solution 2 (hyb#2) contains: formamide (77.78%, volume percentage) and N-methylpyrrolidone (22.22%, volume percentage).

[0181] Table 8 Hybridization Procedure

[0182] 2. Washing the magnetic beads 2.1 Remove magnetic bead B (Invitrogen part number: 35302) in advance, vortex thoroughly, and equilibrate at room temperature for at least 30 minutes. Vortex thoroughly again before use.

[0183] 2.2 Pipette 10 μL of magnetic bead B into a new 1.5 mL centrifuge tube. The three magnetic beads (30 μL) from the capture reaction can be resuspended simultaneously in a 1.5 mL centrifuge tube.

[0184] 2.3 Add 100 μL of magnetic bead cleaning solution to the centrifuge tube (300 μL for 3 capture reactions), vortex for 15 s, centrifuge briefly, place on a magnetic rack for 1 min, and wait until the liquid is completely clear. Carefully discard the supernatant, being careful not to aspirate the magnetic beads. Remove the centrifuge tube from the magnetic rack. The magnetic bead cleaning solution contains: 5 mM Tris-HCl, 0.5 mM EDTA, 1 M NaCl, and 0.1% Tween 20.

[0185] 2.4 Repeat step 2.3 twice.

[0186] 2.5 After briefly centrifuging the centrifuge tubes, place them on a magnetic rack and remove any residual liquid using a 10 µL pipette tip.

[0187] 2.6 Add 17 μL of magnetic bead suspension to each centrifuge tube (the total amount for 3 capture reactions should be 51 μL), vortex to mix for 15 s, and transfer all the magnetic bead suspension to a new 0.2 mL PCR tube, 17 μL / tube. The magnetic bead suspension contains 8.5 μL of the above hybridization reaction solution 1 (hyb#1), 2.7 μL of the above hybridization reaction solution 2 (hyb#2), and 5.8 μL of enzyme-free water.

[0188] 2.7 Place the PCR tube containing the magnetic bead suspension into the PCR instrument and incubate at 65°C for 5 min.

[0189] 3. Capture 3.1 Immediately after the hybridization reaction, add the preheated magnetic bead B (product of step 2) to the hybridization system (product of step 1), vortex for 3 seconds to mix thoroughly, and place in a PCR instrument to start the hybridization capture program as follows: heated cap 70℃; reaction conditions: 65℃ for 15 min; 65℃ Hold. Vortex rapidly for 3 seconds at 7.5 min intervals to ensure complete resuspension of the magnetic beads and avoid liquid splashing onto the tube cap as much as possible.

[0190] 4. Washing 4.1 Hot washing 4.1.1 After the sample and magnetic beads have been incubated, add 100 μL of preheated elution reaction solution I (1×SSC, 0.01%SDS) to the PCR tube containing magnetic beads B and hybridization products from step 3, and mix thoroughly by pipetting twice.

[0191] 4.1.2 Place the PCR tube on a magnetic rack for 4 seconds. Once the liquid has completely clarified, discard the supernatant.

[0192] 4.1.3 Transfer the PCR tube from the magnetic rack to a 65°C constant temperature mixer, add 150 μL of preheated elution reaction solution S (1×SSC, 0.1% Tween20), and incubate at 1200 rpm for 5 min.

[0193] 4.1.4 After briefly centrifuging the PCR tube, place it on a magnetic rack for 4 seconds. Once the liquid is completely clear, discard the supernatant.

[0194] 4.1.5 Repeat the above steps, adding 150 μL of preheated elution reaction solution S to wash once.

[0195] 4.2 Elution at room temperature 4.2.1 Set the constant temperature mixer to 1200 rpm and 25℃; 4.2.2 Add 150 μL of room temperature elution reaction solution I, place it on a constant temperature mixer and mix at 1200 rpm and 25°C for 2 min (vortex for 30 s, let stand for 30 s). After the PCR tube is briefly centrifuged, place it on a magnetic rack for 1 min. After the liquid is completely clear, discard the supernatant.

[0196] 4.2.3 Add 150 μL of room temperature elution reaction solution II (0.5×SSC, 0.1% Tween20), place it on a constant temperature mixer and oscillate at 1200 rpm and 25°C for 2 min. After the PCR tube is briefly centrifuged, place it on a magnetic rack for 1 min. After the liquid is completely clear, discard the supernatant.

[0197] 4.2.4 Add 150 μL of room temperature elution reaction solution III (0.2×SSC), place it on a constant temperature mixer and oscillate at 1200 rpm and 25°C for 2 min. After the PCR tube is briefly centrifuged, place it on a magnetic rack for 1 min. After the liquid is completely clear, discard the supernatant.

[0198] 4.2.5 After briefly centrifuging the PCR tube, remove the residual liquid using a 10 µL pipette tip.

[0199] 4.2.6 Remove the PCR tube from the magnetic rack, add 20 μL of enzyme-free water, vortex for 10 s, and centrifuge briefly.

[0200] 5. Capture Library Amplification Prepare the capture library amplification system in centrifuge tubes according to Table 9. Add the obtained system to the DNA suspension containing magnetic beads (product of step 4), vortex to mix and then briefly centrifuge. Place the above PCR tubes in a PCR instrument, and the reaction program is shown in Table 10.

[0201] Table 9 Capture Library Amplification System

[0202] Note: The amplification primers are as follows: MGI-Du-F: TCTCAGTTACGTCAGCAGTT, SEQ ID NO:1; MGI-Du-R: GGCATGGCGACCTTATCAG, SEQ ID NO:2.

[0203] Table 10 Reaction Procedure

[0204] 6. Capture library purification 6.1 Remove magnetic bead A in advance, vortex thoroughly, and equilibrate at room temperature for at least 30 min. Vortex again before use. Transfer 60 μL of magnetic bead A to a new PCR tube.

[0205] 6.2 After PCR amplification is complete, the PCR tube is briefly centrifuged and then placed on a magnetic rack to stand for 5 minutes until the solution becomes clear.

[0206] 6.3 Transfer the supernatant to a PCR tube containing magnetic bead A, vortex for 10 s to mix, and incubate at room temperature for 10 min.

[0207] 6.4 After incubation, centrifuge the PCR tube briefly and place it on a magnetic rack for 5 minutes. Once the liquid is completely clear, carefully remove the supernatant, being careful not to pick up the magnetic beads.

[0208] 6.5 Keep the PCR tube fixed on the magnetic rack, add 200 μL of freshly prepared 80% ethanol, let stand for 30 s, and carefully remove the supernatant.

[0209] 6.6 Repeat step 6.5 once.

[0210] 6.7 After briefly centrifuging the PCR tubes, place them on a magnetic rack and use a 10 µL pipette tip to remove any residual ethanol.

[0211] 6.8 Open the PCR tube cap and let it stand at room temperature for 5 minutes until the surface of the magnetic beads is no longer reflective.

[0212] 6.9 Remove the PCR tube from the magnetic rack, add 22 µL of DNA dissolving solution to the PCR tube, vortex for 10 s to mix, and incubate at room temperature for 5 min.

[0213] 6.10 After the PCR tube is briefly centrifuged, place it on a magnetic rack and let it stand for 5 min until the liquid is completely clear. Then carefully transfer 20 μL of the supernatant into a new 1.5 mL centrifuge tube.

[0214] 7. Library quantification and sequencing The above-mentioned library was quantitatively analyzed using Qubit and then sent to Geneplus Medical Laboratory sequencing facility for sequencing.

[0215] Example 10: A method for constructing an FFPE DNA-targeting library ( Figure 3 30ng) A method for constructing an FFPE DNA-targeting library is the same as in Example 9, except that the library in Table 6 is the library obtained in Example 1.

[0216] Example 11: A method for constructing an FFPE DNA-targeting library ( Figure 3 50ng) A method for constructing an FFPE DNA-targeting library is the same as in Example 9, except that the libraries in Table 6 are the libraries obtained in Example 6.

[0217] Example 12: A method for constructing an FFPE DNA-targeting library ( Figure 3 (200ng) A method for constructing an FFPE DNA-targeting library is the same as in Example 9, except that the library in Table 6 is the library obtained in Example 2.

[0218] Example 13 A method for constructing a cf DNA targeted library ( Figure 3 15ng) A method for constructing a cf DNA targeted library is the same as in Example 9, except that the library in Table 6 is the library obtained in Example 3.

[0219] Example 14 A method for constructing a cf DNA targeted library ( Figure 3 30ng) A method for constructing a cf DNA targeted library is the same as in Example 9, except that the library in Table 6 is the library obtained in Example 7.

[0220] Example 15: A method for constructing a cf DNA targeted library ( Figure 3 50ng) A method for constructing a cf DNA targeted library is the same as in Example 9, except that the library in Table 6 is the library obtained in Example 8.

[0221] Example 16: A method for constructing a cf DNA targeted library ( Figure 3 (80ng) A method for constructing a cf DNA targeted library is the same as in Example 9, except that the library in Table 6 is the library obtained in Example 4.

[0222] Example 17 A method for constructing an FFPE DNA library ( Figure 4 V4 sample 1) A method for constructing an FFPE DNA library is the same as in Example 6, except that the FFPE DNA sample is different.

[0223] Example 18: A method for constructing an FFPE DNA library ( Figure 4 V4 sample 2) A method for constructing an FFPE DNA library is the same as in Example 6, except that the FFPE DNA sample is different.

[0224] Example 19: A method for constructing an FFPE DNA library ( Figure 4 (V4 sample 3) A method for constructing an FFPE DNA library is the same as in Example 6, except that the FFPE DNA sample is different.

[0225] Example 20: A method for constructing an FFPE DNA library ( Figure 4 (V4 sample 4) A method for constructing an FFPE DNA library is the same as in Example 6, except that the FFPE DNA sample is different.

[0226] Example 21: A method for constructing a cf DNA library ( Figure 4 (V4 1021-MRD plasma template conversion rate) A method for constructing a cfDNA library is the same as in Example 7, except that the cfDNA sample is different.

[0227] Example 22: A method for constructing an FFPE DNA-targeting library ( Figure 4 V4 sample 1) A method for constructing an FFPE DNA-targeting library is the same as in Example 9, except that the library in Table 6 is the library obtained in Example 17.

[0228] Example 23: A method for constructing an FFPE DNA-targeting library ( Figure 4 V4 sample 2) A method for constructing an FFPE DNA-targeting library is the same as in Example 9, except that the library in Table 6 is the library obtained in Example 18.

[0229] Example 24: A method for constructing an FFPE DNA-targeting library ( Figure 4 (V4 sample 3) A method for constructing an FFPE DNA-targeting library is the same as in Example 9, except that the library in Table 6 is the library obtained in Example 19.

[0230] Example 25: A method for constructing an FFPE DNA-targeting library ( Figure 4(V4 sample 4) A method for constructing an FFPE DNA-targeting library is the same as in Example 9, except that the library in Table 6 is the library obtained in Example 20.

[0231] Example 26: A method for constructing a cfDNA targeted library ( Figure 4 (V4 1021-MRD plasma template conversion rate) A method for constructing a cfDNA targeted library is the same as in Example 9, except that the library in Table 6 is the library obtained in Example 21, the probe is an MRD probe (GenePlus catalog number: B0759-48), and the number of cycles for "denaturation-annealing-extension" in the program in Table 10 is 19.

[0232] Comparative Example 1: A method for constructing an FFPE DNA library ( Figure 1 (V3 10cycle) A method for constructing an FFPE DNA library was disclosed. The library was constructed using the Yisheng Bio All-Purpose DNA Library Construction Kit (CatNo. 12201), following the instructions. The differences were: the sample was the FFPE DNA sample from Example 1; the fragmentation method was the same as in Example 1; the adapters used in the adapter ligation system were those listed in Table 2 of patent document CN 114317528 A (2 μL, 15 μM concentration for each adapter); the adapter ligation program was: no heat cap; 20℃ for 15 min; 4℃ Hold; 69 μL of magnetic beads were used for purification after adapter ligation; the primers used for library construction were those from Example 3 of patent document CN 114317528 A (5 μM concentration); and the number of cycles for "denaturation-annealing-extension" in the library amplification program was 10.

[0233] Comparative Example 2: A method for constructing a cf DNA library ( Figure 1 (V3 8cycle) A method for constructing a cf DNA library is disclosed. The library is constructed using the Yisheng Bio All-Purpose DNA Library Construction Kit (Cat No. 12201), following the instructions. The difference lies in the following: the sample is the cf DNA sample from Example 3, which does not require fragmentation; the adapters used in the adapter ligation system are the adapters listed in Table 2 of patent document CN 114317528 A (4 μL); the adapter ligation program is: no heat cap; 20℃ for 15 min; 4℃ Hold; purification after adapter ligation uses 69 μL of magnetic beads; the library construction primers are the primers from Example 3 of patent document CN 114317528 A (5 μM concentration); and the number of cycles for "denaturation-annealing-extension" in the library amplification program is 8.

[0234] Comparative Example 3: A method for constructing an FFPE DNA library ( Figure 4 V3 sample 1) A method for constructing an FFPE DNA library is the same as that for Comparative Example 1, except that the FFPE DNA sample is different; the FFPE DNA sample is the sample from Example 17.

[0235] Comparative Example 4: A method for constructing an FFPE DNA library ( Figure 4 V3 sample 2) A method for constructing an FFPE DNA library is the same as that in Comparative Example 1, except that the FFPE DNA sample is different; the FFPE DNA sample is the sample in Example 18.

[0236] Comparative Example 5: A method for constructing an FFPE DNA library ( Figure 4 V3 sample 3) A method for constructing an FFPE DNA library is the same as that in Comparative Example 1, except that the FFPE DNA sample is different; the FFPE DNA sample is the sample in Example 19.

[0237] Comparative Example 6: A method for constructing an FFPE DNA library ( Figure 4 (V3 sample 4) A method for constructing an FFPE DNA library is the same as that in Comparative Example 1, except that the FFPE DNA sample is different; the FFPE DNA sample is the sample in Example 20.

[0238] Comparative Example 7: A method for constructing a cfDNA library ( Figure 4 (V3 1021-MRD plasma template conversion rate) A method for constructing a cfDNA library is the same as that in Comparative Example 2, except that the cfDNA sample is 30 ng, the number of cycles of "denaturation-annealing-extension" in the library amplification program is 9, and the cfDNA sample is the sample in Example 20.

[0239] Comparative Example 8: A method for constructing an FFPE DNA-targeting library ( Figure 4 V3 sample 1) A method for constructing an FFPE DNA targeted library is the same as in Example 9, except that the library in Table 6 is the library obtained in Comparative Example 3, and the hybridization reagent used is V3 hybridization reagent (GenePlus catalog number: KB0040024). The method is described in the instruction manual.

[0240] Comparative Example 9: A method for constructing an FFPE DNA-targeting library ( Figure 4 V3 sample 2) A method for constructing an FFPE DNA-targeting library is the same as that for Comparative Example 8, except that the library in Table 6 is the library obtained in Comparative Example 4.

[0241] Comparative Example 10: A method for constructing an FFPE DNA-targeting library ( Figure 4 V3 sample 3) A method for constructing an FFPE DNA-targeting library is the same as that for Comparative Example 8, except that the library in Table 6 is the library obtained in Comparative Example 5.

[0242] Comparative Example 11: A method for constructing an FFPE DNA-targeting library ( Figure 4 (V3 sample 4) A method for constructing an FFPE DNA-targeting library is the same as that for Comparative Example 8, except that the library in Table 6 is the library obtained in Comparative Example 6.

[0243] Comparative Example 12: A method for constructing a cfDNA targeted library ( Figure 4 (V3 1021-MRD plasma template conversion rate) A method for constructing a cfDNA targeted library is the same as that for Comparative Example 8, except that the library in Table 6 is the same as that obtained in Comparative Example 6, the probe is an MRD probe (GenePlus catalog number: B0759-48), and the number of cycles for "denaturation-annealing-extension" in the program in Table 10 is 19.

[0244] The libraries of Example 6 (FFPE V4 9 cycles), Example 8 (cfDNA V4 7 cycles), Comparative Example 1 (FFPE V3 10 cycles), and Comparative Example 2 (cfDNA V3 8 cycles) were quantified using the Qubit® dsDNA HS Assay Kit with a Qubit fluorescence quantitative analyzer. The fragment sizes of the libraries of Example 1 (FFPE 30 ng), Example 2 (FFPE 200 ng), Example 3 (cfDNA 15 ng), and Example 4 (cfDNA 80 ng) were analyzed using a biological fragment analyzer (Qsep100 from Guangding Biotechnology, Taiwan). The results are as follows: Figure 1 , 2 As shown, the library yields of Example 6 (FFPE V4 9 cycles) and Example 8 (cfDNA V4 7 cycles) were higher than those of Comparative Example 1 (FFPE V3 10 cycles) and Comparative Example 2 (cfDNA V3 8 cycles), achieving higher yields with fewer PCR cycles; and the peak patterns of different types of samples were normal at different starting amounts, with no or very few adapters or primers remaining.

[0245] The libraries of Example 1 (30 ng 9 cycles), Example 4 (80 ng 7 cycles), Example 5 (20 ng 9 cycles), Example 6 (50 ng 9 cycles), Example 2 (200 ng 7 cycles), Example 3 (15 ng 8 cycles), Example 7 (30 ng 7 cycles), and Example 8 (50 ng 7 cycles) were quantified using the Qubit® dsDNA HS Assay Kit with the Qubit qPCR instrument. The libraries of Example 9 (20 ng), Example 10 (30 ng), Example 11 (50 ng), Example 12 (200 ng), Example 13 (15 ng), Example 14 (30 ng), Example 15 (50 ng), Example 22 (V4 Sample 1), Example 23 (V4 Sample 2), Example 24 (V4 Sample 3), Example 25 (V4 Sample 4), and Example 26 (V4 1021-MRD) were quantified using the Qubit® dsDNA HS Assay Kit with the Qubit qPCR instrument. The plasma template conversion rate was calculated for Comparative Examples 8 (V3 Sample 1), 9 (V3 Sample 2), 10 (V3 Sample 3), 11 (V3 Sample 4), and 12 (V3 1021-MRD plasma template conversion rate). The effective depth in the hybridization results was analyzed, and the template conversion rate was calculated. The results are as follows: Figure 3 , 4 As shown, the significantly improved conversion rate of V4 template allows for higher depths to be achieved with low starting amounts, meeting detection requirements. For V3 tissue, 200 ng (≥50 ng) is recommended, and for plasma, 50-80 ng (≥15 ng) is recommended. With a starting amount of 20 ng for V4 tissue, an effective depth of over 500× can be achieved; with a starting amount of 15 ng for plasma, an effective depth of over 3000× can be achieved, meeting detection requirements. The recommended number of PCR cycles for library construction with different sample input amounts is shown in Table 11.

[0246] Table 11 Library construction PCR cycle number

[0247] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.

Claims

1. A DNA library construction kit comprising: a reagent combination or kit for adapter ligation, wherein the reagent combination or kit for adapter ligation comprises: a ligation reaction solution; wherein the ligation reaction solution comprises: a buffer, magnesium ions, a thiol reducing agent, adenine triphosphate (ATP), and propylene glycol; wherein the ligation reaction solution does not contain polyethylene glycol (PEG).

2. The reagent kit according to claim 1, characterized in that, The buffer solution comprises at least one of: citrate buffer, MES buffer solution, phosphate buffer, Bis-tris buffer, and Tris hydrochloric acid buffer; further comprising Tris hydrochloric acid buffer. Preferably, the concentration of the buffer solution in the ligation reaction solution is 0.1-1M; Preferably, the concentration of magnesium ions in the bonding reaction solution is 0.01-1M; Preferably, the thiol reducing agent comprises at least one of: tris(2-formylethyl)phosphine hydrochloride (TCEP), dithiothreitol (DTT), and glutathione reduced (GSH); Preferably, the concentration of the thiol reducing agent in the connecting reaction solution is 0.01-1M; Preferably, the concentration of ATP in the ligation reaction solution is 0.001-0.1M; Preferably, the concentration of propylene glycol in the bonding reaction solution is 40%-80% by volume. Preferably, the reagent combination or kit for connector ligation further comprises: a ligase; Preferably, the ligase comprises at least one of: T4 DNA ligase, T3 DNA ligase, T7 DNA ligase, Pfu DNA ligase, HiFi DNA ligase, and Quick Ligase; Preferably, the reagent combination or kit for connector connection further comprises: a connector.

3. The reagent kit according to any one of claims 1-2, characterized in that, The DNA library construction kit also includes: a reagent combination or kit for end repair and adding "A"; Preferably, the reagent combination or kit for end repair and adding "A" comprises: end repair reaction solution; the end repair reaction solution comprises: buffer solution, magnesium ions, potassium ions, thiol reducing agent, adenine nucleoside triphosphate (ATP), dNTP, and nonionic surfactant; Preferably, the buffer solution comprises at least one of: citrate buffer, MES buffer solution, phosphate buffer, Bis-tris buffer, and Tris hydrochloric acid buffer; Preferably, the concentration of the buffer solution in the end-repair reaction solution is 0.1-1M; Preferably, the concentration of magnesium ions in the end-repair reaction solution is 0.01-1M; Preferably, the concentration of potassium ions in the end-repair reaction solution is 0.01-1M; Preferably, the thiol reducing agent comprises at least one of: tris(2-formylethyl)phosphine hydrochloride (TCEP), dithiothreitol (DTT), and glutathione reduced (GSH); Preferably, the concentration of the thiol reducing agent in the end-repair reaction solution is 0.01-1M; Preferably, the concentration of ATP in the terminal repair reaction solution is 0.001-0.1M; Preferably, the concentration of dNTP in the end-repair reaction solution is 0.001-0.1M; Preferably, the nonionic surfactant comprises at least one of Tween 20, Triton X-100, NP-40, and Pluronic F-68; Preferably, the concentration of the nonionic surfactant in the end-repair reaction solution is 0.01%-1% by volume. Preferably, the reagent combination or kit for end repair and adding "A" further comprises: end repair enzyme; Preferably, the terminal repair enzyme comprises: polymerase; Preferably, the terminal repair enzyme further comprises a polynucleotide kinase.

4. The reagent kit according to any one of claims 1-3, characterized in that, The DNA library construction kit also includes: a reagent combination or kit for library amplification; Preferably, the reagent combination or kit for library amplification comprises: library preparation primers and DNA polymerase reaction solution; Preferably, the DNA library construction kit further comprises: magnetic beads; Preferably, the DNA library construction kit further comprises: a substance for breaking down DNA; Preferably, the DNA library construction kit further comprises: a nucleic acid extraction reagent combination or kit; Preferably, the DNA library construction kit may further include reagents for obtaining a targeted library.

5. The use of the kit according to any one of claims 1-4 in any one of a1)-a3): a1) DNA library construction; a2) Prepare sequencing reagent kits; a3) Sequencing.

6. A method for constructing a DNA library, comprising the step of using the DNA library construction kit according to any one of claims 1-4.

7. The method according to claim 6, characterized in that, The method includes the following steps: b1) Perform end repair and add "A" to the DNA fragment; b2) Connect the product obtained in b1) with a joint; b3) Purify the product obtained in b2); b4) Perform library amplification on the product obtained in b3); The connector connection uses the reagent combination or kit for connector connection as described in any one of claims 1-4; Preferably, the method for connecting the connector is as follows: the product obtained in b1), the connector, the connector ligation reaction solution, and the ligase are mixed and reacted; Preferably, the reaction time is 10-25 min; Preferably, the method for purifying the product obtained in b2) is as follows: mixing the product obtained in b2) with magnetic beads, incubating, washing with ethanol, drying, and eluting; Preferably, the volume ratio of the product obtained in step b2) to the magnetic beads is 1:(1-1.4).

8. The method according to claim 7, characterized in that, The library amplification uses the reagent combination or kit for library amplification as described in claim 4; Preferably, the method for library amplification is as follows: the product obtained from b3), the library construction primers, and the DNA polymerase reaction solution are mixed, and a PCR reaction is performed; Preferably, the concentration of the library preparation primers in the PCR reaction system is 1-3 µM; Preferably, the end repair and addition of "A" adopt the reagent combination or kit for end repair and addition of "A" as described in any one of claims 3-4; Preferably, the method for end repair and adding "A" is as follows: mix the DNA fragment, end repair reaction solution, and end repair enzyme, and react.

9. A DNA library obtained by the construction method according to any one of claims 6-8.

10. A sequencing method for sequencing the DNA library of claim 9.

Citation Information

Patent Citations

  • Specific molecular tag UMI group, mixed specific molecular tag linker and application

    CN114317528A