Engineered exosome drug delivery system with enhanced membrane fluidity and preparation method and application thereof

By inserting unsaturated phospholipids into the exosome membrane to enhance membrane fluidity, the problems of low loading efficiency and limited penetration ability of exosomes in intestinal delivery are solved, enabling efficient oral delivery of multiple types of drugs and significantly improving bioavailability and delivery efficiency.

CN122005498APending Publication Date: 2026-05-12SICHUAN UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202610306525.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-13
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

In existing technologies, polypeptide and nucleic acid drugs are easily degraded in the gastrointestinal tract and have difficulty crossing the intestinal epithelial barrier. Small molecule chemical drugs have problems such as low solubility, poor targeting, and high systemic toxicity, resulting in unsatisfactory oral bioavailability. Exosomes have low loading efficiency for various drugs and limited ability to cross the complex intestinal barrier.

Method used

By inserting unsaturated phospholipids, such as dioleoylphosphatidylcholine (DOPC), into natural exosome membranes to enhance their fluidity, engineered exosome drug delivery systems are prepared for the efficient encapsulation and oral delivery of biomacromolecules and small molecule chemical drugs.

Benefits of technology

It significantly improved the drug loading efficiency and intestinal penetration of exosomes for various drugs, enhanced oral bioavailability, increased the diffusion capacity of drugs in intestinal mucus and the uptake efficiency of epithelial cells, and achieved a significant improvement in transepithelial transport.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122005498A_ABST
    Figure CN122005498A_ABST
Patent Text Reader

Abstract

The invention relates to an engineered exosome drug delivery system with enhanced membrane fluidity as well as a preparation method and application of the engineered exosome drug delivery system. According to the system, unsaturated phospholipid is inserted into an exosome membrane, so that the membrane flowability of the exosome is enhanced on the premise of not damaging a natural structure and protein composition, and the entrapment efficiency of polypeptide proteins, nucleic acid and small-molecule chemical drugs is remarkably improved. The membrane fluidity is enhanced, the diffusivity, the cellular uptake efficiency and the transepithelial transport performance of the exosome in intestinal mucus are improved, and the physiological barrier of oral delivery can be effectively overcome. In type I and type II diabetes animal models, the system significantly improves the oral bioavailability of insulin and semaglutide, and shows an excellent blood sugar regulation effect. The preparation method is simple and convenient, the biocompatibility is good, and a novel delivery strategy with a good transformation prospect is provided for oral biological macromolecular and micromolecular chemical drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical formulation, specifically relating to an engineered exosome drug delivery system based on membrane fluidity regulation, its preparation method, and its application. Background Technology

[0002] Exosomes are nanoscale extracellular vesicles actively secreted by cells. They possess excellent biocompatibility, low immunogenicity, and the natural ability to cross biological barriers, making them a promising drug delivery carrier in recent years. Among various sources, milk exosomes exhibit unique industrialization and clinical application potential due to their readily available raw materials, low cost, large-scale production capabilities, and proven oral absorption.

[0003] Peptide and protein drugs, nucleic acid drugs, and some small molecule chemical drugs play significant roles in disease treatment. However, their oral delivery faces enormous challenges: peptide and protein drugs and nucleic acid drugs are easily degraded in the gastrointestinal tract and have difficulty crossing the intestinal epithelial barrier; while small molecule chemical drugs can be partially absorbed, they often suffer from low solubility, poor targeting, and high systemic toxicity. These factors collectively lead to unsatisfactory oral bioavailability, and many drugs still heavily rely on injection administration, greatly affecting patient compliance and treatment efficacy.

[0004] Utilizing natural exosomes as oral carriers offers a novel approach to addressing the delivery challenges of various drug classes. However, exosomes generally exhibit low drug loading efficiency and limited ability to cross the complex intestinal barrier, hindering their practical application. Studies have shown that exosome function is closely related to its membrane physical properties, with membrane fluidity being a key physical parameter determining membrane fusion, transmembrane transport, and cell interaction efficiency. However, current technologies primarily focus on chemically modifying exosome membranes or targeting ligand conjugation. Systematic research reports and effective technical solutions are still lacking regarding how to precisely control exosome membrane fluidity through engineering methods to simultaneously achieve efficient loading of peptides, nucleic acids, and small molecule drugs and enhance their oral delivery efficacy.

[0005] Therefore, developing a new strategy that can significantly improve the drug loading efficiency, intestinal penetration and oral bioavailability of various drugs by physically regulating the membrane fluidity of exosomes without destroying their natural structure and function is of great innovative significance and broad application value. Summary of the Invention

[0006] In view of the problems that existing technologies have made it easy for polypeptide and nucleic acid drugs to be degraded in the gastrointestinal tract and difficult to cross the intestinal epithelial barrier; and that small molecule chemical drugs, although partially absorbed, often have problems such as low solubility, poor targeting and high systemic toxicity, this invention provides an exosome oral drug delivery system based on membrane fluidity regulation, its preparation method and application.

[0007] One objective of this invention is to provide an engineered exosome drug delivery system with enhanced membrane fluidity, comprising: extracted natural exosomes, the source of which is selected from at least one of milk, human milk, goat milk or macrophages; unsaturated phospholipids inserted into the phospholipid bilayer membrane of the exosome; and a drug loaded inside the exosome or bound to its membrane.

[0008] The unsaturated phospholipids, due to the presence of unsaturated double bonds in their molecular chains, can effectively enhance the fluidity between lipid molecules, thereby significantly improving the dynamic disorder of exosome membranes. In contrast, structurally similar saturated phospholipids (such as distearate phosphatidylcholine (DSPC)) lack unsaturated double bonds and cannot achieve the same membrane fluidity enhancement effect. The unsaturated phospholipids are dioleoylphospholipids, including but not limited to: dioleoyl lecithin (DOPC), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylglycerol (DOPG), dioleoyl phosphatidic acid (DOPA), and dioleoyl phosphatidylserine (DOPS). The engineered exosomes possess tunable membrane fluidity and can be used for the efficient encapsulation and oral delivery of macromolecular and small molecule chemical drugs, with dioleoyl lecithin (DOPC) being the preferred unsaturated phospholipid.

[0009] Further, the drug includes (1) a biological macromolecular drug, including: ① a protein polypeptide drug, selected from at least one of insulin, insulin analogs, semaglutide, glucagon-like peptide-1 receptor agonists, growth hormone, octreotide acetate, antibody or antibody fragment, preferably insulin or semaglutide or TNF-α nanobody; ② a nucleic acid drug, selected from at least one of small interfering RNA, microRNA, messenger RNA, deoxyribonucleic acid or plasmid deoxyribonucleic acid, preferably microRNA, preferably the miRNA sequence is CAGUACUUUUGUGUAGUACAA (SEQ ID NO. 1); (2) a small molecule chemical drug, selected from at least one of 5-fluorouracil, paclitaxel, colchicine, carbamazepine, celecoxib, glimepiride, doxorubicin or curcumin, preferably 5-fluorouracil or paclitaxel.

[0010] A second objective of this invention is to provide a method for preparing the engineered exosome drug delivery system, comprising the following steps: (1) Exosomes were extracted by ultracentrifugation; (2) Incubate unsaturated phospholipids and extracted exosomes at 35–40°C for 1–5 hours to allow unsaturated phospholipids to insert into the exosome membrane, wherein the mass ratio of exosomes to unsaturated phospholipids is 10:1, 8:1, 4:1 or 1:1. (3) The engineered exosomes with enhanced membrane fluidity were purified by ultracentrifugation or size exclusion chromatography. (4) The drug solution is mixed with the engineered exosome dispersion in proportion, and the drug is encapsulated inside the exosome or bound to the exosome membrane by incubation, and then the unencapsulated free drug is removed by ultrafiltration.

[0011] A third objective of this invention is to provide an oral drug delivery system comprising the aforementioned engineered exosome drug delivery system and a pharmaceutically acceptable carrier or excipient. The system can be further formulated into oral dosage forms, including solutions, capsules, tablets, or granules.

[0012] A fourth objective of this invention is to provide the application of the engineered exosome drug delivery system or oral drug delivery system in the preparation of pharmaceutical formulations for oral administration.

[0013] Beneficial effects Compared to unmodified unsaturated phospholipids, the insertion of unsaturated phospholipids precisely regulates the fluidity of exosome membranes, significantly improving the encapsulation efficiency of exosomes for large biological molecules such as insulin, semaglutide, nanobody drugs, and microRNAs, as well as small molecule chemical drugs such as 5-fluorouracil and paclitaxel, without damaging their natural structure and protein composition, with a maximum efficiency of over 97%.

[0014] This invention systematically optimizes the efficiency of exosome oral delivery by enhancing exosome membrane fluidity. Specifically, the enhanced membrane fluidity significantly improves the diffusion dynamics of exosomes in intestinal mucus, allowing them to penetrate the viscous mucus layer more rapidly and fully, thus reaching the surface of intestinal epithelial cells more effectively. Simultaneously, the improved membrane fluidity optimizes the interaction between exosomes and cell membranes, promoting their uptake by epithelial cells, with both the amount and rate of uptake significantly increased. This synergistic enhancement of mucus penetration and epithelial cell uptake further translates into a significant improvement in transepithelial transport efficiency, manifested as a multiple increase in apparent permeability and cumulative transport volume. This series of progressive efficiency improvements from "mucus diffusion" to "cellular uptake" and then to "transmembrane transport" collectively constitutes a breakthrough in the multiple absorption barriers of the intestine, ultimately fundamentally improving the oral delivery efficiency of the loaded drug and providing a key solution for the efficient absorption of orally administered biopharmaceuticals and small molecule chemical drugs.

[0015] The engineered exosome drug delivery system with enhanced membrane fluidity prepared in this invention exhibited significantly improved oral bioavailability and glycemic regulation in diabetic animal models. The oral relative bioavailability of insulin was 6.77%, representing an 8.0-fold and 1.4-fold increase compared to oral free insulin and unmodified unsaturated phospholipid exosomes, respectively. The oral relative bioavailability of semaglutide was increased to 4.18%, representing a 417.5-fold and 3.1-fold increase compared to oral free semaglutide and unmodified unsaturated phospholipid exosomes, respectively. Furthermore, the glycemic regulation efficacy was significantly superior to the original oral exosome delivery system using free drugs and unmodified unsaturated phospholipids. This system is simple to prepare, uses widely available raw materials, and has good biocompatibility, showing promising prospects for large-scale production and clinical translation. Attached Figure Description

[0016] Figure 1 This diagram illustrates how milk exosomes enhance membrane fluidity through the insertion of DOPC to achieve efficient drug loading and oral delivery. (A) shows the construction of engineered exosomes with enhanced membrane fluidity: by inserting unsaturated phospholipid dioleoyl lecithin (DOPC) into the phospholipid bilayer membrane of milk exosomes, engineered exosomes with enhanced membrane fluidity (DOPC-mEVs) are obtained; (B) illustrates the mechanism by which enhanced membrane fluidity promotes oral drug absorption: DOPC-mEVs, with their enhanced membrane fluidity, can efficiently load drugs and, after oral administration, systematically improve their diffusion capacity in intestinal mucus, intestinal epithelial cell uptake efficiency, and transepithelial transport performance, thereby significantly improving the absorption efficiency of oral drugs.

[0017] Figure 2 The extraction and characterization results of exosomes in the examples are as follows: A is a particle size distribution diagram of exosomes; B is a potential diagram of exosomes; C is a concentration diagram of exosomes determined by a nanoparticle analyzer (NTA); D is a transmission electron microscopy image of exosomes; E is a Western blot (WB) image of exosome marker proteins (TSG101 and CD63) and miscellaneous proteins (casein); F is a particle size stability diagram of exosomes after 8 hours in phosphate-buffered saline (PBS), simulated gastric juice (SGF), and simulated intestinal juice (SIF); G is a table showing the particle size, polydispersity index, and potential of milk exosomes and macrophage exosomes, as well as those with different unsaturated phospholipids inserted.

[0018] Figure 3The following graphs illustrate the relationship between exosome membrane fluidity and drug loading efficiency after DOPC insertion: A is a fluorescence energy transfer (FRET) study of DOPC insertion in exosomes; B is a study of exosome membrane fluidity after DOPC insertion in exosomes; C is a transmission electron microscopy image of exosomes after 50% DOPC insertion; D is a sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) image of protein composition after DOPC insertion in exosomes; E is a table showing the encapsulation efficiency of insulin and semaglutide in exosomes after DOPC insertion; F is a table showing the encapsulation efficiency of insulin and semaglutide in exosomes after saturated phospholipids and distearate phosphatidylcholine (DSPC) insertion; and G is a table showing the encapsulation efficiency of small molecule chemical drugs, antibody drugs, and nucleic acid drugs in exosomes after DOPC insertion.

[0019] Figure 4 For the evaluation of the ability to cross the intestinal mucosal barrier: A is a diagram of the mucus penetration study of exosomes and exosomes with different DOPC insertion ratios; B is a diagram of the cellular uptake study of exosomes and exosomes with different DOPC insertion ratios; C is a schematic diagram of the transmembrane efficiency study of exosomes and exosomes with different DOPC insertion ratios; D is a diagram showing the results of the transmembrane efficiency study.

[0020] Figure 5 The pharmacodynamic results of the drug delivery system in a type 1 diabetes model are as follows: A is a graph showing the percentage reduction in blood glucose after oral administration of exosome-loaded insulin to type 1 diabetic mice; B is a graph showing the absolute reduction in blood glucose after oral administration of exosome-loaded insulin to type 1 diabetic mice; and C is a graph showing the pharmacological bioavailability of oral administration of exosome-loaded insulin to type 1 diabetic mice.

[0021] Figure 6 The pharmacodynamic results of the drug delivery system in a type 2 diabetes model are as follows: A is the pharmacokinetic study of semaglutide loaded on exosomes; B is the pharmacokinetic calculation of bioavailability of semaglutide loaded on exosomes; and C is the glucose tolerance study of type 2 diabetic mice after oral administration of semaglutide loaded on exosomes. Detailed Implementation

[0022] The present invention will be further illustrated by the following embodiments, but the scope of protection of the present invention is not limited to these embodiments. Those skilled in the art can make equivalent substitutions, combinations, improvements, or modifications to the present invention based on the description thereof, and all such modifications will be included within the scope of the present invention.

[0023] Example 1: Standardized extraction and characterization of exosomes Take 250 mL of commercial skim milk, preheat it to 37℃, add glacial acetic acid at a volume ratio of 100:1, mix gently, and let stand at room temperature for 5 minutes. Then centrifuge at 4℃ and 12000×g for 15 minutes to remove the precipitate. Filter the supernatant through a 0.22 μm filter membrane to obtain clear whey. Ultracentrifuge the whey (4℃, 210000×g, 70 minutes), discard the supernatant, resuspend the precipitate in pre-cooled PBS, and repeat the ultracentrifugation washing once. Finally, resuspend in 1 mL of PBS to obtain the concentrated exosome (mEVs) solution, aliquot and store at -80℃. The hydrodynamic diameter of mEVs was determined by nanoparticle size and Zeta potential analysis. The polydispersity index (PDI) was 0.137, and the Zeta potential was -12.6 mV. Transmission electron microscopy showed that it had a typical cup-shaped vesicle structure. Western blotting confirmed that the mEVs were rich in exosome marker proteins CD63 and TSG101, while impurity proteins such as casein showed extremely weak signals, indicating that the extracted exosomes had high purity. Stability tests showed that the mEVs maintained stable particle size after 8 hours of incubation in PBS, simulated gastric juice (SGF), and simulated intestinal juice (SIF), demonstrating good colloidal stability and enzyme resistance. Results are attached. Figure 2 As shown in AF.

[0024] To investigate the applicability of exosomes from different sources, macrophage-derived exosomes were extracted. Specifically, RAW 264.7 cells were cultured in DMEM medium containing 10% fetal bovine serum to a density of 70-80%, then replaced with medium containing 10% exosomes and deserialized, and cultured for another 48 hours. The cell supernatant was collected, and cell debris was removed by centrifugation at 300×g for 10 minutes, followed by further clarification at 10000×g for 30 minutes. The filtrate was then filtered through a 0.22 μm filter. The filtrate was ultracentrifuged at 4°C (150000×g, 120 minutes), the precipitate was resuspended in PBS, and washed again by centrifugation under the same conditions to obtain macrophage-derived exosomes (RAW-EVs). Systematic characterization of the exosomes from both sources was performed. The hydrodynamic diameter of milk exosomes was 122.1 nm, the polydispersity index (PDI) was 0.151, and the zeta potential was -13.81 mV, as determined by a nanoparticle size and zeta potential analyzer. The hydrodynamic diameter of macrophage exosomes was 231.1 nm, the PDI was 0.271, and the zeta potential was -12.21 mV.

[0025] Example 2: Engineering Modification of Membrane Flowability – Insertion and Optimization of DOPC Dioleoyl lecithin (DOPC) was dissolved in chloroform, and a lipid film was formed by rotary evaporation. PBS was then added, followed by vortexing and sonication to prepare DOPC-SUV suspensions. mEVs (1 mg based on protein) were mixed with different mass ratios of DOPC-SUV (10:1, 8:1, 4:1, and 1:1, respectively), and incubated with gentle shaking at 37°C for 2 hours. After incubation, the mixture was purified by ultracentrifugation (4°C, 210000×g, 70 min) to obtain DOPC-modified mEVs (DOPC-mEVs). Successful insertion of DOPC into the exosome membrane was verified by fluorescence resonance energy transfer (FRET). The generalized polarization (GP) of the membrane was measured using a Laurdan fluorescent probe. The results showed that the GP values ​​of DOPC-mEVs at each ratio were significantly lower than those of unmodified mEVs (p<0.05), indicating a dose-dependent increase in membrane fluidity. Transmission electron microscopy and SDS-PAGE analysis confirmed that the modified exosomes retained their intact vesicle structure, and their protein composition did not change significantly. Results are attached. Figure 3 As shown in AD. Through systematic screening and evaluation of DOPC insertion at different mass ratios (10:1, 8:1, 4:1, and 1:1), the results showed a positive correlation between the improvement in membrane fluidity and the DOPC insertion ratio. The 1:1 DOPC modification group exhibited the most significant enhancement of membrane fluidity, with the most pronounced decrease in generalized polarization, indicating that the dynamic disorder and fluidity of the exosome membrane reached their optimal state at this ratio. Simultaneously, the modification process at this ratio did not disrupt the intact vesicle structure of the exosomes, and the protein composition was maintained, demonstrating that this condition significantly improved membrane fluidity while preserving the integrity of the exosome structure. Therefore, considering the magnitude of membrane fluidity enhancement, structural preservation, and process feasibility, 1:1 was determined to be the optimal modification ratio.

[0026] Furthermore, unsaturated phospholipids DOPC and DOPE were inserted into the two types of exosome membranes to investigate the effect of phospholipid insertion on the physical properties of exosomes. mEVs and RAW-EVs were mixed with DOPC or DOPE liposomes at a 1:1 mass ratio, incubated at 37°C for 2 hours, and purified by ultracentrifugation. Nanoparticle size analysis showed that after DOPC modification, the mEV particle size was 122.1 nm (PDI 0.241, potential -2.41 mV), and the RAW-EV particle size was 227.1 nm (PDI 0.261, potential -2.61 mV); after DOPE modification, the mEV particle size was 121.1 nm (PDI 0.111, potential -13.01 mV), and the RAW-EV particle size was 235.1 nm (PDI 0.271, potential -11.31 mV). The results showed that exosomes from different sources, after modification with different unsaturated phospholipids, maintained good nanoparticle characteristics, with uniform particle size distribution and stable potential. Furthermore, the influence of different phospholipid types on the basic physical properties of exosomes showed a consistent trend, indicating that this membrane fluidity regulation strategy has good source universality. The results are attached. Figure 3 As shown in E.

[0027] To verify the key role of unsaturated double bonds, the same method as in Example 2 was used, but DOPC was replaced with saturated phospholipid distearate lecithin (DSPC), and mEVs (DSPC-mEVs) with different DSPC modification ratios (10:1, 8:1, 4:1 and 1:1, respectively) were prepared.

[0028] Example 3: Drug loading efficiency study A passive drug loading method was used. mEVs, DSPC-mEVs, and DOPC-mEVs were mixed with insulin or semaglutide solution in PBS, incubated at 37°C for 1 hour, and then purified by ultracentrifugation. Drug concentration in exosomes was determined by high-performance liquid chromatography (HPLC), and encapsulation efficiency was calculated. Results showed that for insulin, the encapsulation efficiency of the mEVs group was 24.59±1.84%, the DSPC-mEVs (1:1) group was 24.92±1.80%, while the DOPC-mEVs (1:1) group was as high as 98.08±0.67%. For semaglutide, the encapsulation efficiency of the DOPC-mEVs (1:1) group reached 97.74±1.19%, significantly higher than that of the mEVs group (22.48±0.44%) and the DSPC-mEVs group (24.19±0.48%). These results indicate that enhanced membrane fluidity is a key factor in significantly improving the encapsulation efficiency of peptide drugs.

[0029] Furthermore, using nanobodies as model drugs, this invention explored the encapsulation capacity of the system for antibody-based drugs using TNF-α nanobodies (Chinese invention patent application 202211499337.2), PD1 nanobodies (Chinese invention patent ZL202210011915.7), and PD-L1 nanobodies (Chinese invention patent application 202210182455.4). mEVs or DOPC-mEVs (1:1) were mixed with the nanobodies solution, incubated at 37°C for 1 hour, and then purified by ultracentrifugation to collect the nanobodies-loaded exosomes. The encapsulation efficiency was calculated by measuring the total protein content of the exosomes and subtracting the background protein of the blank exosomes. The results showed that different nanobodies (TNF-α nanobodies, PD1 nanobodies, and PD-L1 nanobodies) exhibited similar effects. Taking TNF-α nanobodies as an example, the encapsulation efficiency of the mEVs group was 14.90±0.62%, while that of the DOPC-mEVs group increased to 49.36±1.49%. This indicates that the insertion of unsaturated phospholipids can significantly enhance the encapsulation capacity of exosomes for antibody drugs.

[0030] For nucleic acid drugs, miRNA (sequence: CAGUACUUUUGUGUAGUACAA, Gemma gene) was selected as a representative and encapsulated using the same passive drug loading method. RNA extraction and quantification were performed, and the encapsulation efficiency was calculated after deducting the RNA content inherent in the exosomes themselves. The results showed that the encapsulation efficiency of miRNA in the mEVs group was 82.80±1.11%, while the DOPC-mEVs group further improved to 97.54±0.21%, confirming that the insertion of unsaturated phospholipids can also improve the encapsulation performance of nucleic acid drugs on exosomes.

[0031] Furthermore, this invention also investigated its applicability to small molecule chemical drugs, using 5-fluorouracil and paclitaxel as models. Experimental results showed that for paclitaxel, the encapsulation efficiency of the mEVs group was only 6.90±4.46%, while the DOPC-mEVs group improved to 20.95±1.26%; for 5-fluorouracil, the encapsulation efficiency of the mEVs group was 13.94±0.02%, while the DOPC-mEVs group improved to 53.77±0.01%. These data indicate that by inserting unsaturated phospholipids to enhance membrane fluidity, the encapsulation efficiency of exosomes for small molecule chemical drugs can be effectively improved.

[0032] As can be seen, this embodiment, through systematic research, confirms that the membrane fluidity regulation strategy based on unsaturated phospholipid insertion proposed in this invention can significantly improve the encapsulation capacity of engineered exosomes for a variety of drugs with vastly different physicochemical properties. Whether it is hydrophilic peptides (such as insulin and semaglutide), nanobodies, nucleic acids, or small molecule chemical drugs, the encapsulation efficiency is significantly improved after DOPC modification to enhance membrane fluidity. This indicates that the drug delivery system constructed in this invention has broad drug compatibility and good universality, rather than being limited to a single drug type. This characteristic enables the technical solution provided by this invention to serve as a universal and efficient drug delivery platform.

[0033] The results are attached. Figure 3 As shown in FH.

[0034] Example 4: Evaluation of transintestinal mucosal barrier capacity Natural mucus was extracted from porcine colon. Fluorescently labeled mEVs and DOPC-mEVs were mixed with the mucus, and their movement trajectories were analyzed using multiple particle tracking (MPT) technology. Mean square displacement (MSD) was calculated, and the results showed that the MSD value of the DOPC-mEVs group was significantly higher than that of the mEVs group (p<0.001), indicating its stronger ability to diffuse through mucus. Using human colon adenocarcinoma cells (Caco-2) as a model, confocal microscopy and flow cytometry analysis showed that the cellular uptake of DOPC-mEVs was 2.74 times that of the mEVs group. In a Transwell-cultured Caco-2 monolayer cell model (TEER>500 Ω·cm²), the apparent permeability coefficient (Papp) of the DOPC-mEVs-loaded group was significantly higher than that of the mEVs group. Results are attached. Figure 4 As shown.

[0035] Example 5: Pharmacodynamic Study of Type 1 Diabetes A type 1 diabetic mouse model (blood glucose >16.7 mmol / L) was established by streptozotocin induction. Mice were randomly divided into a saline group, an oral free insulin group, a mEVs-loaded insulin group, a DOPC-mEVs-loaded insulin group, and a subcutaneous insulin injection positive control group. The oral dosage was calculated based on 50 IU / kg of insulin. Results showed that the DOPC-mEVs-loaded insulin group achieved the lowest blood glucose level (70%) 2 hours after administration, significantly stronger than the mEVs-loaded group (approximately 55%) and the oral free insulin group, and this effect lasted for more than 8 hours. Using the area under the plasma concentration-time curve (AUC) of the subcutaneous injection group as 100%, the relative pharmacological bioavailability of the DOPC-mEVs-loaded insulin group was 6.77 ± 0.85%, significantly higher than the 4.92 ± 0.90% of the mEVs-loaded group and the 0.85 ± 1.06% of the oral free insulin group. Results are attached. Figure 5 As shown.

[0036] Example 6: Pharmacodynamic Study of Type II Diabetes A type II diabetic C57 mouse model induced by a high-fat diet was used. Mice were randomly divided into a model control group, an oral free semaglutide group, a mEVs-loaded semaglutide group, and different doses of DOPC-mEVs-loaded semaglutide groups. A single oral glucose tolerance test showed that the area under the blood glucose curve in the high-dose DOPC-mEVs-loaded group was more than 2.98 times smaller than that in the oral free drug control group, demonstrating significantly better efficacy than the mEVs-loaded group. Oral pharmacokinetic studies showed that the relative bioavailability of the DOPC-mEVs (5 mg / kg)-loaded semaglutide group was 4.1751 ± 0.871%, which was 3.1 times that of the mEVs-loaded group (1.3531 ± 0.591%) and 417.5 times that of the oral free semaglutide group (0.01 ± 0.0071%). Results are attached. Figure 6 As shown.

Claims

1. An engineered exosome drug delivery system with enhanced membrane fluidity, characterized in that, The drug delivery system includes extracted natural exosomes, unsaturated phospholipids inserted into the phospholipid bilayer membrane of the exosomes, and a drug encapsulated thereon. The exosomes are derived from at least one of the following: milk, human milk, goat milk, or macrophages. The unsaturated phospholipids are dioleoylphospholipids. The encapsulated drug is located inside the exosome or bound to the exosome membrane.

2. The engineered exosome drug delivery system according to claim 1, characterized in that, The dioleoyl phospholipids include: dioleoyl lecithin (DOPC), dioleoyl phosphatidylethanolamine (DOPE), dioleoyl phosphatidylglycerol (DOPG), dioleoyl phosphatidic acid (DOPA), and dioleoyl phosphatidylserine (DOPS), preferably dioleoyl lecithin (DOPC).

3. The engineered exosome drug delivery system according to claim 1, characterized in that, The drug is selected from at least one of the following categories: (1) biological macromolecular drugs, including: ① protein polypeptide drugs, selected from at least one of insulin, insulin analogs, semaglutide, glucagon-like peptide-1 receptor agonists, growth hormone, octreotide acetate, antibodies or antibody fragments, preferably insulin or semaglutide or TNF-α nanobody; ② nucleic acid drugs, selected from at least one of small interfering ribonucleic acid, microRNA, messenger ribonucleic acid, deoxyribonucleic acid or plasmid deoxyribonucleic acid, preferably microRNA; (2) small molecule chemical drugs, selected from at least one of 5-fluorouracil, paclitaxel, colchicine, carbamazepine, celecoxib, glimepiride, doxorubicin or curcumin, preferably 5-fluorouracil or paclitaxel.

4. The engineered exosome drug delivery system according to claim 1, characterized in that, The mass ratio of the extracted natural exosomes to the unsaturated phospholipids inserted into their phospholipid bilayer membrane is 10:1, 8:1, 4:1 and 1:1 (w / w), preferably 1:1 (w / w).

5. A method for preparing claim 1 4. The method of the engineered exosome drug delivery system according to any one of the claims, characterized in that, Includes the following steps: (1) Exosomes were extracted by ultracentrifugation; (2) Unsaturated phospholipids were co-incubated with the extracted exosomes to allow the unsaturated phospholipids to insert into the exosome membrane. The mass ratio of exosomes to unsaturated phospholipids was 10:1, 8:1, 4:1 and 1:1 (w / w). (3) Engineered exosomes with enhanced membrane fluidity were obtained by purification by ultracentrifugation or size exclusion chromatography; (4) The drug solution and the engineered exosome dispersion with enhanced membrane fluidity are mixed evenly in a certain proportion, and the drug is encapsulated inside the exosome or bound to the exosome membrane by incubation, and the unencapsulated free drug is removed by ultrafiltration.

6. The method according to claim 5, characterized in that, The incubation temperature for step (2) is 35-40℃, and the incubation time is 1-5h.

7. An oral drug delivery system, characterized in that, It includes the engineered exosome drug delivery system according to any one of claims 1-4, and a pharmaceutically acceptable carrier or excipient.

8. The use of the engineered exosome drug delivery system according to any one of claims 1-4 or the oral drug delivery system according to claim 7 in the preparation of formulations for oral administration.

9. The application according to claim 8, wherein the formulation is a solution, capsule, tablet or granule.