Baculovirus expression vector and construction method and application thereof
By inserting multiple repetitive burst sequences and overexpressing the very late transcription factor VLF-1 in the baculovirus expression system, the transcriptional activity of the polh promoter was optimized, solving the problem of low protein expression efficiency in existing technologies and achieving efficient exogenous protein expression, which is suitable for biopharmaceutical and vaccine production.
Patent Information
- Application Number
- CN202610204933.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-12
- Publication Date
- 2026-05-12
AI Technical Summary
In existing baculovirus expression systems, the transcriptional activity regulation of the polh promoter is unclear, resulting in low protein expression efficiency. Furthermore, the lack of a synergistic approach to optimize burst sequence copy number and overexpress the very late transcription factor VLF-1 leads to insufficient protein expression, limiting its application in biopharmaceutical and vaccine production.
Multiple repeating burst sequences (BS) were inserted downstream of the polh promoter, and the very late transcription factor VLF-1 was overexpressed in the baculovirus expression vector. By optimizing the copy number of the BS sequence and the synergistic effect of VLF-1, recombinant baculovirus expression vectors pBSX-eV and pBSX-GV were constructed, with BamHI and EcoRI restriction sites reserved to facilitate the cloning and replacement of different target genes.
The optimized vector significantly improved the expression level of exogenous proteins, achieved efficient expression in insect cells, reduced production costs, and is suitable for large-scale protein preparation in the fields of biopharmaceutical and vaccine research and development, avoiding the inclusion body refolding problem in prokaryotic systems.
Smart Images

Figure CN122012622A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a baculovirus expression vector, its construction method, and its application, belonging to the field of genetic engineering. Background Technology
[0002] Baculovirus expression vector systems (BEVS) are commonly used eukaryotic expression tools in biopharmaceutical, vaccine development, and recombinant protein production. Their core advantages lie in their ability to ensure correct folding of recombinant proteins, enabling post-translational modifications and allowing for large-scale industrial cultivation, thus holding broad application prospects in related fields. The polh promoter, as a very late-stage strong promoter for baculoviruses, can efficiently drive the expression of exogenous proteins and is a core component in the construction of BEVS.
[0003] However, current baculovirus expression systems based on the polh promoter still suffer from low protein expression efficiency, which limits their further application in industrial production. Studies have found that the transcriptional activity of the polh promoter depends on the burst sequence (BS) upstream of its open reading frame, and the integrity of this sequence directly affects transcription efficiency. Mutations or deletions in the BS sequence significantly reduce the protein expression level driven by the polh promoter. However, the regulatory mechanism of BS sequence copy number on polh promoter activity remains unclear, and whether increasing the number of BS sequences can continuously improve transcription efficiency also lacks systematic experimental verification.
[0004] Furthermore, the very late transcription factor VLF-1 is a key protein regulating polh promoter activity. It can specifically bind to the BS sequence, jointly enhancing the transcriptional capacity of the polh promoter. However, current technologies have not yet combined "overexpression of VLF-1" with "optimization of BS sequence copy number," lacking a mature method to maximize polh promoter expression efficiency through their synergistic effect. Simultaneously, inserting too many BS sequences may lead to abnormal spacer sequences between the promoter and the target gene, thereby inhibiting transcriptional activity.
[0005] Therefore, given the current lack of clarity regarding the regulatory mechanism of the baculovirus polh promoter and its limited expression efficiency, there is an urgent need to develop a new synergistic regulatory method. This method involves optimizing the copy number of the BS sequence and combining it with VLF-1 overexpression to construct a highly active polh promoter, thereby significantly increasing the expression level of exogenous proteins in BEVS and meeting the demand for efficient protein expression systems in fields such as biopharmaceuticals and vaccine production. Summary of the Invention
[0006] Purpose of the invention: The purpose of this invention is to provide a baculovirus expression vector, its construction method, and its application.
[0007] Technical solution: This invention provides a recombinant baculovirus expression vector pBSX-eGFP (containing multiple repeat BS sequences and the eGFP target gene), based on the pFastBacDual plasmid as the backbone, with multiple repeat burst sequences inserted downstream of the polh promoter. The nucleotide sequences of the burst sequences are shown in SEQ ID No. 1, and the nucleotide sequences of the two repeat BS sequences are shown in SEQ ID No. 2. The eGFP target gene is inserted into the vector through restriction enzyme sites, where X = 2, 3, 5, 7, 9.
[0008] This invention also provides a method for constructing the recombinant baculovirus expression vector pBSX-eGFP, comprising the following steps: (1) First, the fragment containing the multiple repeat BS sequence was digested with XhoⅠ and HindⅢ and then ligated with pFastBacDual plasmid, followed by T4 DNA ligase and transformation to obtain the recombinant plasmid pBS2 containing the multiple repeat BS sequence. (2) The pBS2 plasmid was double-digested with XhoⅠ / XbaⅠ and XhoⅠ / SpeⅠ respectively and the target fragment was recovered. After enzyme ligation, the plasmid was transformed and the recombinant plasmid was extracted to obtain pBS3. (3) Repeat the above steps to construct pBS5, pBS7, and pBS9; (4) Then, pBSX and pBD-eGFP plasmid containing the eGFP gene were digested with XhoⅠ and BamHI, the fragments were recovered and ligated to obtain the recombinant plasmid pBSX-eGFP.
[0009] This invention also provides a recombinant baculovirus expression vector pBSX-eV (containing a multiple repeat BS sequence, the eGFP target gene, and the VLF-1 gene), which introduces the coding gene of the very late transcription factor VLF-1 into pBSX-eGFP. VLF-1 specifically binds to the BS sequence and synergistically enhances promoter transcriptional activity, which is used to verify the synergistic regulatory effect between BS sequence copy number and VLF-1 overexpression; the nucleotide sequence of the VLF-1 is shown in SEQ ID No. 3; X=2, 3, 5, 7, 9.
[0010] The present invention also provides a method for constructing the recombinant baculovirus expression vector pBSX-eV, comprising the following steps: (1) Using AcMNPV as a template, VLF-1 gene fragment was amplified by PCR using VLF-1F and VLF-1R as primers, and the intermediate vector pBD-IE2-VLF-1 containing VLF-1 was constructed. (2) The IE2-VLF-1 fragment was ligated to the pBD-eGFP vector by double digestion with XbaⅠ and HindⅢ to obtain pBD-eV; finally, pBD-eV and pBSX were double digested with XhoⅠ / BamHⅠ, and fragments with different BS numbers were ligated to the vector fragment. After transformation and screening, the recombinant baculovirus expression vector pBSX-eV was obtained.
[0011] The present invention also provides a recombinant baculovirus expression vector pBSX-GV that can insert exogenous target genes, integrating two repeat BS sequences and a VLF-1 coding gene, introducing an SV40-IE1-GFP fusion fragment as a marker element, and reserving BamHI and EcoRI restriction sites. The nucleotide sequence of the VLF-1 coding gene is shown in SEQ ID No. 3, and the nucleotide sequences of the two repeat BS sequences are shown in SEQ ID No. 2, where X=2, 3, and 5.
[0012] The present invention also provides a method for constructing the recombinant baculovirus expression vector pBSX-GV as described in claim 5, comprising the following steps: (1) The SV40-IE1-GFP fusion fragment was amplified by overlapping PCR, ligated into the pMD19-T vector, and then recovered by double digestion with SalⅠ and NotⅠ. (2) The fusion fragment was ligated with the enzyme-digested pBD-eV vector to obtain pBD-GV; (3) pBD-GV and pBSX as described in claim 1 were digested with XhoⅠ / BamHⅠ double enzymes, and pBSX-GV was obtained after enzyme ligation and screening.
[0013] The present invention also provides the application of the recombinant baculovirus expression vector pBSX-GV in the efficient expression of heterologous proteins.
[0014] In this study, exogenous target genes (such as BoCD8 gene) were inserted into pBSX-GV through BamHⅠ and EcoRⅠ restriction sites to construct a recombinant expression vector, which was then transfected into Sf9 insect cells to achieve high-efficiency expression of exogenous target genes, with expression levels significantly higher than those of the unoptimized control vector.
[0015] The present invention also provides a recombinant baculovirus containing the recombinant plasmid pBSX-eGFP, pBSX-eV, or pBSX-GV.
[0016] This invention clarifies the optimal construction conditions for recombinant plasmids through experimental results analysis, namely, containing two repetitive BS sequences and overexpressing the VLF-1 gene.
[0017] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. This invention addresses the problem of insufficient promoter efficiency in baculovirus expression systems (polh) by establishing an improved scheme for synergistic optimization of the promoter sequence and transcription factors. Experimental data show that inserting two copies of the burst sequence (BS) downstream of the polh promoter and co-expressing the very late transcription factor VLF-1 significantly increases the yield of exogenous proteins compared to the control vector. This increase was validated in both eGFP and BoCD8 proteins, indicating the universality of the optimization strategy.
[0018] 2. Using pFastBacDual as the backbone, the BS sequence and VLF-1 gene were inserted through conventional restriction enzyme sites, resulting in the pBSX-GV vector with reserved space for... BamH I and EcoR I. Double restriction enzyme sites facilitate the cloning and substitution of different target genes. The entire construction process is standardized and reproducible, from plasmid assembly to virus packaging.
[0019] 3. Western blot and SDS-PAGE results showed that the protein bands were strongest when the BS copy number was 2 or 3, with the 2-copy combination showing the best effect. Vectors co-expressing VLF-1 generally outperformed controls that did not express VLF-1, demonstrating a synergistic effect between transcription factors and promoter sequences.
[0020] 4. This vector retains the advantages of the baculovirus expression platform, allowing recombinant proteins to complete correct folding and post-translational modifications within insect cells, avoiding the inclusion body refolding problem common in prokaryotic systems. Due to increased expression levels and simplified post-processing, overall production costs are reduced, making it suitable for large-scale protein preparation in biopharmaceutical and vaccine development fields. Attached Figure Description
[0021] Figure 1 The construction process for pBS2 and pBS3; Figure 2 The gene structure of pBSX (X=5, 7, 9); Figure 3 The image shows the PCR identification results of plasmid pBSX. M: DNA Marker (DL5000); 1: PCR electrophoresis results of pBS2; 2: PCR electrophoresis results of pBS3; 3: PCR electrophoresis results of pBS5; 4: PCR electrophoresis results of pBS7; 5: PCR electrophoresis results of pBS9. Figure 4 for Xho Ⅰ / BamHFigure Ⅰ shows the identification results of the double-enzyme digestion plasmid pBD-eGFP. M: DNA Marker (DL5000); 1: Double digestion result of pBS2-eGFP; 2: Double digestion result of pBS3-eGFP; 3: Double digestion result of pBS5-eGFP; 4: Double digestion result of pBS7-eGFP; 5: Double digestion result of pBS9-eGFP. Figure 5 The image shows the identification results of VLF-1 gene PCR amplification. M: DNA Marker (DL5000); 1 and 2 are the PCR electrophoresis results of the target gene VLF-1. Figure 6 for Xba I and Hind Figure 3 shows the identification results of the double enzyme digestion plasmid pBD-eV. M: DNA Marker (DL5000); 1, 2: double enzyme digestion results of pBD-eV. Figure 7 for Xho Ⅰ / BamH Figure Ⅰ shows the identification results of the double-enzyme digestion plasmid pBSX-eV. M: DNA Marker (DL5000); 1: Double digestion result of pBS2-eV; 2: Double digestion result of pBS3-eV; 3: Double digestion result of pBS5-eV; 4: Double digestion result of pBS7-eV; 5: Double digestion result of pBS9-eV. Figure 8 The image shows the PCR identification results of recombinant Bacmid containing eGFP. M: DNA Marker (DL5000); 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21: PCR electrophoresis results using M13F / R primers; 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22: PCR electrophoresis results using M13F / Gen primers; from left to right, the following were identified: Bacmid-BSX-eGFP (X=2, 3, 5, 7, 9) and Bacmid-BSX-GV (X=1, 2, 3, 5, 7, 9). Figure 9 Fluorescence images of Sf9 cells transfected with recombinant Bacmid-BSX-eGFP (X=2, 3, 5, 7, 9) and Bacmid-BSX-GV (X=1, 2, 3, 5, 7, 9); Figure 10 For flow cytometry analysis of GFP expression, A: Flow cytometry analysis results of BSX-eGFP (X=1, 2, 3, 5, 7, 9); B: Flow cytometry analysis results of BSX-eV (X=1, 2, 3, 5, 7, 9). Figure 11For Western blot detection of eGFP expression at 4d and 5d, M: pre-stained protein marker (15-120kDa); A: protein expression of BSX-eGFP at 4d; B: protein expression of BSX-eV at 4d; C: protein expression of BSX-eGFP at 5d; D: protein expression of BSX-eV at 5d. Figure 12 The image shows the SDS-PAGE detection results of eGFP in BSX-eGFP and BSX-eV. M: Color-stained protein marker (15-120kDa). Figure 13 The image shows the Western blot results of eGFP detection in BSX-eGFP and BSX-eV. M: Color-stained protein marker (15-120 kDa). Figure 14 Figure showing the grayscale normalization analysis results of eGFP and β-actin proteins; Figure 15 for Sal Ⅰ / Not Figure Ⅰ shows the results of double enzyme digestion identification of plasmid T-SV40-IE1-GFP. M: DL5000 DNA Marker; 1, 2: Double enzyme digestion results of T-SV40-IE1-GFP. Figure 16 Figure 1 shows the PCR identification results of plasmid pBD-GV bacterial culture. M: DL5000 DNA Marker; 1: PCR electrophoresis results using primers 1-SV40-IE1-F / 4-IE1-GFP-R; 2: PCR electrophoresis results using primers VLF-1-F / VLF-1-R. Figure 17 Figure 1 shows the PCR identification results of plasmid pBSX-GV bacterial culture. M: DL5000 DNA Marker; 1: PCR electrophoresis results of pBS2-GV; 2: PCR electrophoresis results of pBS3-GV; 3: PCR electrophoresis results of pBS5-GV. Figure 18 The diagrams show the structures of pBSX-GV and pBSX-IE2-eGFP plasmids. A: Schematic diagram of pBSX-GV; B: Schematic diagram of pBSX-IE2-eGFP. Figure 19 Here are schematic diagrams of the structures of plasmids pBSX-CD8-GV and pBSX-CD8-eGFP: A: Schematic diagram of the structure of pBSX-CD8-GV; B: Schematic diagram of the structure of pBSX-CD8-eGFP. Figure 20 for BamH Ⅰ / EcoRFigure Ⅰ shows the results of double enzyme digestion identification of plasmids pBSX-CD8-GV and pBSX-CD8-eGFP. A: pBSX-CD8-GV: M: DL5000 DNA Marker; 1, 2: Double enzyme digestion results of pBS1-CD8-GV; 3, 4: Double enzyme digestion results of pBS2-CD8-GV; 5, 6: Double enzyme digestion results of pBS3-CD8-GV; 7, 8: Double enzyme digestion results of pBS5-CD8-GV; B: Double enzyme digestion results of pBSX-CD8-eGFP: M: DL5000 DNA Marker; 9, 10: Double enzyme digestion results of pBS2-CD8-eGFP; 11, 12: Double enzyme digestion results of pBS3-CD8-eGFP; 13, 14: Double enzyme digestion results of pBS5-CD8-eGFP. Figure 21 The images show the PCR identification results of Bacmid-BSX-CD8-eGFP and Bacmid-BSX-CD8-GV. M: DL5000 DNA Marker; 1, 3, 5, 7, 9, 11, 13: PCR electrophoresis results using M13F / R primers; 2, 4, 6, 8, 10, 12, 14: PCR electrophoresis results using M13F / Gen primers; Bacmid-BS2-CD8-eGFP, Bacmid-BS3-CD8-eGFP, Bacmid-BS5-CD8-eGFP, Bacmid-BS1-CD8-GV, Bacmid-BS2-CD8-GV, Bacmid-BS3-CD8-GV, and Bacmid-BS5-CD8-GV were identified sequentially. Figure 22 The image shows the green fluorescence expression results of recombinant Bacmid containing multiple BS and BoCD8 transfected into Sf9 cells; Figure 23 The image shows the results of Western blot detection of BoCD8 expression. M: Color-stained protein marker (15-120 kDa). Detailed Implementation
[0022] The technical solution of the present invention will be further described below with reference to the accompanying drawings.
[0023] Example 1: Construction of a plasmid containing a multiple repeat BS sequence, the eGFP target gene, and the VLF-1 gene. 1. Gene and primer design and synthesis Using Genesnap software, the BS sequence (SEQ ID NO.1: TATTTTACTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATAT) 50 bp downstream of the polh promoter in the pFastBacDual plasmid was retrieved. Adding to both ends of this BS sequence... Spe I and Xba I. Restriction sites were used to construct a plasmid containing two repeating BS nucleotide sequences (SEQ ID NO.2: CTCGAGATCCCGGGTGATCAAGTCTTCGTCGAGTGATTGTAAATAAAATGTAATTTACAGTATAGTATTTTAATTAATATACAAATGATTTGATAATAATTCTTATTTAACTATAATATATTGTGTTGGGTTGAATTAAAGGTCCGTATACTCCGGAATATTAATAGATCATGGAGATAATTAAAATGATAACCATCTCGCAAATAAATAAGTATTTTACTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATATTCCGGATTATTCATACCGTCCCACCACTAGTTATTTTACTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATATTCTAGATTCGGATCCGCGGCCAAGCTT), which was then sent to Sangon Biotech (Shanghai) Co., Ltd. for synthesis.
[0024] 2. Construction of recombinant plasmid pBSX (X=2, 3, 5, 7, 9) containing multiple repeating BS sequences First, use restriction endonucleases. Xho I and HindIII. The plasmid containing two BS sequences synthesized in the previous step and the pFastBacDual plasmid were double-digested and recovered respectively (50 μL double digestion and recovery system: 10 μL each of recombinant plasmid and vector plasmid, 1 μL each of restriction endonuclease, 5 μL of 10×T buffer, 33 μL of ddH2O, mixed well and incubated at 37℃ for 3 h). The sequence containing two BS fragments and the vector fragment were ligated using T4 DNA ligase (target gene ligation linear vector system: 6.5 μL target DNA fragment, 1.0 μL 10×T4 Ligase buffer, 1.0 μL T4 DNA Ligase, 1.5 μL linear vector, incubated overnight at 4°C; this system was used for all ligation processes except those involving pMD19-T vector). The ligation was then transformed into DH5α competent cells, plated on LB solid medium containing ampicillin (50 μg / mL), and incubated overnight at 37°C inverted. Single clones were picked and amplified, identified by double enzyme digestion, and the recombinant plasmid pBS2 containing two BS fragments was obtained.
[0025] use Xho Ⅰ / Xba I and Xho Ⅰ / Spe I. The pBS2 plasmid was double-digested and recovered, yielding two fragments, one long and one short. (The following text appears to be unrelated and possibly a separate instruction: "Use...") Xho Ⅰ / Xba The short fragment obtained after enzyme digestion is used as the target fragment. This fragment contains two promoters (p10 and polh, with one BS sequence on the polh promoter) and another BS sequence. Xho Ⅰ / Spe The long fragment obtained after enzyme digestion was used as another target fragment. This fragment was a vector fragment without two promoters and containing one BS sequence. The two target fragments were ligated using T4 DNA ligase to form a complete plasmid containing three BS sequences. This plasmid was transformed into DH5α, single clones were picked, amplified, and the recombinant plasmid was extracted. After double enzyme digestion and confirmation, pBS3 was obtained (construction process as follows). Figure 1 Repeat the above "enzyme digestion-recovery-enzyme ligation-transformation-identification" process to construct pBS5, pBS7, and pBS9 sequentially. Figure 2 The plasmids pBS1, pFastBacDual (containing 5, 7, and 9 BS sequences respectively), were used as control plasmids, with the pFastBacDual vector (containing no additional BS sequences) as the control plasmid.
[0026] Using pBSX (X=2, 3, 5, 7, 9) as templates, PCR identification was performed using polhF and polhR primers (25 μL identification system: 10 μL rTaq enzyme, 1 μL template DNA, 1 μL each of 10 μM forward and reverse primers, 7 μL ddH2O; PCR reaction conditions: 95℃ pre-denaturation for 5 min, followed by 30 cycles of 95℃ for 30 s, 56℃ for 40 s, and 72℃ for 1 min, with a final extension at 72℃ for 5 min; this system was used for all subsequent PCR identifications). The results showed ( Figure 3 Bands of 368bp, 417bp, 515bp, 613bp, and 711bp appeared in lanes 1, 2, 3, 4, and 5, respectively, indicating that the plasmid pBSX containing the polh promoter modified with multiple repeat BS sequences was successfully constructed.
[0027] PCR cloning primer sequence listing (single underscores indicate restriction endonuclease cleavage sites): Table 1 Primer sequences
[0028] 3. Construction of plasmid pBSX-eGFP containing multiple repeat BS sequences and the eGFP target gene use Xho I and BamH I. pBSX (X=2, 3, 5, 7, 9) and pBD-eGFP (laboratory-preserved, obtained by...) were tested separately. Sal I and Not I. The eGFP fragment was inserted into pFastBacDual via enzyme digestion sites, using the same construction method as patent application number 2024106443083, entitled "A Method for Constructing a Recombinant Baculovirus Expression Vector and Its Products and Applications." The plasmid was then subjected to double enzyme digestion and recovery. Separation was achieved by 1% agarose gel electrophoresis, and the multiple BS sequence fragment on pBSX and the pBD-eGFP vector fragment were recovered from the gel. The two were mixed and ligated using T4 DNA ligase. The ligation product was transformed into DH5α competent cells, and single colonies were picked, amplified, and the plasmid was extracted. Xho I and BamH I. Double enzyme digestion identification, the results showed ( Figure 4 Each plasmid could be excised to yield a vector fragment of approximately 5600 bp and a corresponding BS sequence fragment of the same size, indicating that the recombinant plasmid pBSX-eGFP containing the eGFP gene was successfully constructed.
[0029] 4. VLF-1 gene amplification and cloning Figure 5 A specific band appeared at 1140 bp, consistent with expectations. The recovered fragment was ligated into the pMD19-T vector (pMD19-T ligation system: 4.5 μL recovered fragment, 0.5 μL pMD19-T vector, 5 μL Solution I, overnight at 4°C), transformed into DH5α competent cells, cultured overnight, and after picking single colonies for amplification and plasmid extraction, it was used... Pst I and Hind III. Double enzyme digestion identification: The plasmid that yielded an 1140bp fragment was named T-VLF-1.
[0030] 5. Construction of recombinant plasmid pBSX-eGFP-VLF-1 use Pst I and Hind III. The T-IE2-eGFP (IE2 containing the transcription terminator SV40 poly(A), referred to as SV40 in this paper, preserved in the laboratory, used in the study of the interaction between DnaJ and Purα proteins of the planthopper and RSV and their function in vector transmission, Pan Wenyu) and T-VLF-1 plasmids were double-digested with enzymes. The eGFP-free pBD-IE2 vector fragment and VLF-1 fragment were recovered by gel electrophoresis, ligated with T4 DNA ligase, transformed, and amplified to extract the recombinant plasmid pBD-IE2-VLF-1. Using… Xba I and Hind III. The pBD-IE2-VLF-1 and pBD-eGFP plasmids were double-digested, and the IE2-VLF-1 fragment and pBD-eGFP vector fragment were recovered by gel electrophoresis. After ligation, they were transformed into DH5α, and single colonies were picked for amplification and extraction of recombinant plasmids. Xba I and Hin dⅢ double digestion identification. The results showed ( Figure 6 The recombinant plasmid was digested with enzymes into a 6400bp vector fragment and an 1850bp target fragment, indicating that pBD-eGFP-IE2-VLF-1 (abbreviated as pBD-eV) was successfully constructed.
[0031] use Xho I and BamH I. The pBD-eV vector was double-digested, and the 8000 bp fragment was recovered via gel electrophoresis. The pBSX-eGFP (X=2, 3, 5, 7, 9) vectors constructed above were then digested with the same enzymes, and fragments containing different amounts of BS were recovered. The former and the latter fragments with different amounts of BS were ligated separately and then transformed. Xho I and Bam HⅠ double enzyme digestion identification ( Figure 7The corresponding size vector fragments and BS fragments can be cut out, indicating that the recombinant plasmid pBSX-eGFP-SV40-IE2-VLF-1-SV40 (X=2, 3, 5, 7, 9) containing multiple BS sequences, eGFP and VLF-1 was successfully constructed (hereinafter referred to as pBSX-eV).
[0032] Example 2: Preparation of Recombinant Baculovirus and Screening of Optimal Vector 1. Construction and identification of recombinant Bacmid 5 μL of plasmids pBSX-eGFP (X=2, 3, 5, 7, 9) and pBSX-eV (X=1, 2, 3, 5, 7, 9) were transformed into 50 μL of LDH10Bac competent cells. The cells were then plated on LB solid medium containing kanamycin, gentamicin, tetracycline, isopropyl-β-D-thiogalactoside (IPTG), and 5-bromo-4-chloro-3-indole-β-D-galactoside (X-gal) resistance (final concentrations: kanamycin 50 μg / mL, gentamicin 7 μg / mL, tetracycline 10 μg / mL, IPTG 25 μg / mL, X-gal 25 μg / mL). The medium was incubated at 37°C inverted until blue-white colonies appeared. Single white colonies were picked and amplified using culture PCR for identification. Identification with primers M13F and M13R showed that the absence of a band at 330 bp indicated a single colony without wild-type Bacmid contamination; the presence of a 330 bp band required streaking purification. Identification with primers M13F and Gen showed that the plasmid successfully transposed to Bacmid. Electrophoresis results showed ( Figure 8 None of the colonies showed a 330bp band, and the expected band appeared at 880bp, indicating that the recombinant Bacmid (Bacmid-BSX-eGFP, Bacmid-BSX-eV) was successfully constructed. The correctly identified bacterial cultures were then amplified in large quantities, and the recombinant Bacmid was extracted using an alkaline lysis method.
[0033] 2. Recombinant Bacmid transfection and virus preparation Add an appropriate amount of Sf9 insect cells to a 6-well plate. After the cells adhere, add recombinant Bacmid according to the LipoInsect protocol. TM Transfect cells according to the instructions for the transfection reagent (Beyotime, C0551). After incubating at 26°C for 5 days, observe under an inverted fluorescence microscope. If strong green fluorescence appears in the field of view ( Figure 9 If the result is positive, it indicates that Bacmid has successfully transfected Sf9 cells. When all cells show green fluorescence, the supernatant is collected as the P1 generation recombinant virus. New Sf9 cells are infected with the P1 generation virus particles and cultured at 26°C for 5 days. The P2 generation supernatant is collected, and this process is repeated to collect the P3 generation virus supernatant. These are named vAc... BSX-eGFP vAcBSX-eV .
[0034] 3. Flow cytometry analysis of eGFP expression Sf9 cells were infected with P3 generation virus at an MOI of 1. After culturing at 26°C for 3 days, the cells were collected and 3 × 10⁶ cells were collected using flow cytometry (Partec) under 488 nm excitation light. 4 Cells were analyzed using the 530nm FL1 channel to detect eGFP fluorescence intensity, and the data were analyzed using FlowJo 10.8 software. Results showed ( Figure 10 A): In vectors without VLF-1, compared with BS1-eGFP, BS2-eGFP and BS3-eGFP showed significantly enhanced fluorescence intensity, BS5-eGFP showed no significant difference, and BS7-eGFP and BS9-eGFP showed significantly decreased fluorescence intensity; in BSX-eV vectors containing VLF-1 ( Figure 10 In B), the fluorescence intensity of each vector was higher than that of the corresponding vector without VLF-1. Among them, BS2-eV and BS3-eV were significantly higher than the control BS1-eV, BS5-eV and BS7-eV had no significant difference, and BS9-eV was significantly lower than the control.
[0035] 4. SDS-PAGE and Western blot analysis of eGFP expression The P3 generation virus (vAc) is classified with an infection multiplicity of MOI=1. BSX-eGFP vAc BSX-eV Sf9 cells were infected and cultured at 26°C for 4 and 5 days. Cells were collected and lysed using Western blotting and IP cell lysis buffer (Beyotime, P0013). The supernatant was collected by centrifugation, and 2× protein loading buffer was added. The cells were boiled in water for 5 minutes to prepare protein samples.
[0036] The specificity of expressed eGFP was detected using Western blotting. GFP Rabbit Monoclonal Antibody (Beyotime, AF1483) was used as the primary antibody, and alkaline phosphatase-labeled goat anti-rabbit IgG (H+L) (Beyotime, A0239) was used as the secondary antibody. The expression of eGFP protein at different time points was detected. Western blot results showed ( Figure 11 A, C): Among vectors without VLF-1, compared with wild type, eGFP expression was highest at BS=2, followed by BS=3 and 5, both higher than the control, while expression was lower at BS=7 and 9 than the control; BSX-eV vector containing VLF-1 ( Figure 11In B and D), the eGFP expression levels corresponding to each number of BS were higher than those of the vector without VLF-1, with the highest expression levels observed at BS=2 and 3. There was no significant difference in protein expression levels between 4 and 5 days of culture. (SDS-PAGE results) Figure 12 ) and Western blot results ( Figure 13 Consistent with the previous results, the brightness of the carrier protein band containing VLF-1 was generally higher than that of the carrier without VLF-1, and the bands were brightest when BS=2 and 3.
[0037] Gray-level normalization analysis was performed on the bands of eGFP and the internal reference β-actin (approximately 42 kDa) in the Western blot results. Figure 14 (Each group was repeated 3 times, and the average value was taken): The eGFP expression levels of BS2-eV, BS3-eV, and BS5-eV were 2.7 times, 2.5 times, and 2.0 times that of the control BS1-eGFP, respectively. Based on this, the optimal conditions for polh promoter optimization were determined to be: containing two repeating BS sequences and overexpressing the VLF-1 gene.
[0038] Example 3: Optimized Carrier Application Verification 1. Construction of plasmid pBSX-GV containing BSs, GFP and VLF-1
[0039] use Sal I and Not I. The T-SV40-IE1-GFP plasmid was double-digested and the 1464 bp fusion fragment was recovered by gel extraction. Figure 15 The fragment was ligated with the same enzyme-digested pBD-eV vector using T4 DNA ligase and transformed into DH5α competent cells. Single colonies were picked and amplified to extract plasmids, yielding plasmid pBD-SV40-IE1-GFP-SV0-IE2-VLF-1-SV40 (hereinafter referred to as pBD-GV). PCR identification was performed using 1-SV40-IE1-F and 4-IE1-GFP-R (resulting in 1464 bp), and VLF-1-F and VLF-1-R (resulting in 1140 bp). Figure 16 ).
[0040] use Xho I and BamH I. pBD-GV and pBSX (X=2, 3, 5) were double-digested, and the 7970 bp pBD-GV vector fragment and BSX (X=2, 3, 5) sequence fragment were recovered by gel electrophoresis. After ligation with T4 DNA ligase, the fragments were transformed into DH5α competent cells, and PCR identification was performed using polhF and polhR (pBS2-GV was 368 bp, pBS3-GV was 417 bp, and pBS5-GV was 515 bp). Figure 17 ), to obtain pBSX-GV plasmid ( Figure 18 A). Using the same method, the BSX sequence fragment was ligated into the pBD-IE2-eGFP vector using T4 DNA ligase to obtain pBSX-IE2-eGFP (…). Figure 18 (B) The method is described in Example 1.
[0041] 2. Construction of recombinant plasmids containing BoCD8 use BamH I and EcoR I. Plasmid T-BoCD8 (containing the bovine CD8α-chain messenger ribonucleic acid (BoCD8) sequence, 729 bp, NCBI accession number: X59416.1) was analyzed using... BamH I and EcoR I. The pMD19-T vector (preserved in the lab), pBSX-GV (X=1, 2, 3, 5), and pBSX-IE2-eGFP (X=2, 3, 5) were double-digested, and the 729bp BoCD8 fragment and each linear vector fragment were recovered by gel extraction. The fragments were then ligated overnight at 4°C using T4 DNA ligase to obtain the plasmid pBSX-CD8-GV (…). Figure 19 A), pBSX-CD8-eGFP ( Figure 19B), transform DH5α competent cells. Pick single colonies, amplify and extract plasmids, and use... BamH I and EcoR I. Double enzyme digestion identification yielded a 729bp BoCD8 target fragment and its corresponding vector fragment ( Figure 20 This indicates that the plasmids pBSX-CD8-GV and pBSX-CD8-eGFP were successfully constructed.
[0042] 3. Construction of recombinant Bacmid and preparation of virus pBSX-CD8-GV (X=1, 2, 3, 5) and pBSX-CD8-eGFP (X=2, 3, 5) were transformed into DH10Bac competent cells, respectively. The cells were plated on LB solid medium containing kanamycin, gentamicin, tetracycline, IPTG, and X-gal (kanamycin 50 μg / mL, gentamicin 7 μg / mL, tetracycline 10 μg / mL, IPTG 25 μg / mL, X-gal 25 μg / mL) and incubated upside down at 37°C for 48 h. White single colonies were picked, amplified, and identified by PCR using the same method as in Example 2. The identification results are shown in the figure. Figure 21 The results showed that recombinant Bacmid-BSX-CD8-GV and Bacmid-BSX-CD8-eGFP were successfully constructed. Sf9 cells were transfected with recombinant Bacmid according to the method in Example 2, and green fluorescence was observed under an inverted fluorescence microscope. Figure 22 Collect the supernatant, and repeatedly infect to collect P3 generation virus particles.
[0043] 4. Western blot analysis of BoCD8 expression Sf9 cells were infected with P3 generation virus at an MOI of 1 and cultured at 26°C for 4 days. Cells were then collected, and total protein was extracted. The protein was detected using Western blot as described in Example 2. The primary antibody was His Tag Mouse Monoclonal Antibody (Beyotime, AF2876) (1:1000), and the secondary antibody was AP-labeled goat anti-mouse IgG (H+L) (Beyotime, A0258) (1:5000). The results were analyzed using grayscale. The results showed (…). Figure 23Regarding the influence of the number of BS sequences, BoCD8 expression first increased and then stabilized with the increase of the number of BS sequences. BS2-CD8-eGFP showed the highest expression efficiency, significantly higher than BS1-CD8-GV, followed by BS3-CD8-eGFP and BS5-CD8-eGFP. Regarding the role of VLF-1, the expression levels of BSX-CD8-GV vectors containing VLF-1 were all higher than those of the corresponding vectors without VLF-1. Among them, BS2-CD8-GV and BS3-CD8-GV showed the best expression efficiency, which is consistent with the conclusion of high eGFP expression in Example 2. This further demonstrates the high efficiency of the optimized vector "2 BS sequences + VLF-1 overexpression" in heterologous protein expression.
Claims
1. A recombinant baculovirus expression vector pBSX-eGFP, characterized in that, Using pFastBacDual plasmid as the basic backbone, X repeating BS sequences are inserted downstream of the polh promoter. The nucleotide sequence of the burst sequence is shown in SEQ ID No.
1. The eGFP target gene is inserted into the vector through the XhoⅠ and BamHⅠ restriction sites; where X = 2, 3, 5, 7, 9.
2. A method for constructing the recombinant baculovirus expression vector pBSX-eGFP as described in claim 1, characterized in that, Includes the following steps: (1) The fragment containing the multiple repeat BS sequence was digested with double enzymes and ligated with pFastBacDual plasmid, and transformed to obtain the recombinant plasmid pBS2 containing the multiple repeat BS sequence. (2) The pBS2 plasmid was then double-digested and the target fragment was recovered. After enzyme ligation, the plasmid was transformed and the recombinant plasmid was extracted to obtain pBS3. (3) Repeat the above steps to construct pBS5, pBS7, and pBS9; (4) Then, pBSX and pBD-eGFP plasmid containing the eGFP gene were digested with XhoⅠ and BamHI, the fragments were recovered and ligated to obtain the recombinant plasmid pBSX-eGFP.
3. A recombinant baculovirus expression vector pBSX-eV, characterized in that, Based on the pBSX-eGFP of claim 1, the encoding gene of the very late transcription factor VLF-1 is introduced, and VLF-1 specifically binds to the BS sequence; the nucleotide sequence of the VLF-1 is shown in SEQ ID No. 3; X=2, 3, 5.
4. A method for constructing the recombinant baculovirus expression vector pBSX-eV as described in claim 3, characterized in that, Includes the following steps: (1) Using AcMNPV as a template, VLF-1 gene fragment was amplified by PCR using VLF-1F and VLF-1R as primers, and the intermediate vector pBD-IE2-VLF-1 containing VLF-1 was constructed. (2) The IE2-VLF-1 fragment was ligated to the pBD-eGFP vector by double digestion with XbaⅠ and HindⅢ to obtain pBD-eV; finally, pBD-eV and pBSX were double digested with XhoⅠ / BamHⅠ, and fragments with different BS numbers were ligated to the vector fragment. After transformation and screening, the recombinant baculovirus expression vector pBSX-eV was obtained.
5. A recombinant baculovirus expression vector pBSX-GV, characterized in that, Two repeating BS sequences and the VLF-1 encoding gene were integrated, and the SV40-IE1-GFP fusion fragment was introduced as a marker element. BamHI and EcoRI restriction sites were reserved. The nucleotide sequence of the VLF-1 encoding gene is shown in SEQ ID No. 3, and the nucleotide sequences of the two repeating BS sequences are shown in SEQ ID No. 2, where X=2, 3, and 5.
6. A method for constructing the recombinant baculovirus expression vector pBSX-GV as described in claim 5, characterized in that, Includes the following steps: (1) Using pFastBacDual as a template, the SV40 fragment was amplified by PCR; Using pFastBac-PH-GFP as a template, the IE1-GFP fragment was amplified by PCR; after mixing, the SV40-IE1-GFP fusion fragment was amplified by overlap PCR, ligated into the pMD19-T vector, and then recovered by double digestion with SalⅠ and NotⅠ. (2) The fusion fragment was enzyme-ligated with the pBD-eV vector of claim 4 after enzyme digestion to obtain pBD-GV; (3) pBD-GV and pBSX as described in claim 1 were digested with XhoⅠ / BamHⅠ double enzymes, and pBSX-GV was obtained after enzyme ligation and screening.
7. The application of the recombinant baculovirus expression vector pBSX-GV as described in claim 5 in the efficient expression of heterologous proteins.
8. The application according to claim 7, characterized in that, The exogenous target gene was inserted into pBSX-GV via BamHⅠ and EcoRⅠ restriction sites to construct a recombinant expression vector, which was then transfected into Sf9 insect cells to achieve efficient expression of the exogenous target gene.
9. A recombinant baculovirus, characterized in that, It contains the recombinant plasmid pBSX-eGFP, pBSX-eV, or pBSX-GV as described in claim 1.