MRNA quality control product of human papilloma virus as well as preparation method and application of mRNA quality control product

By preparing freeze-dried HPV mRNA quality control products, the problems of incomplete product variety and easy missed detection in existing quality control products are solved, achieving accuracy and safety of multi-target detection, applicable to multiple detection platforms, and reducing the risk of false positives.

CN122038422APending Publication Date: 2026-05-15SHENZHEN YILIFANG BIOTECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511894531.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-16
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

The existing HPV quality control products lack E6/E7 mRNA quality control products in RNA form, which makes it easy to miss detection and poses a risk of false positives. In addition, the existing quality control products are not comprehensive enough to meet the needs of multi-target detection.

Method used

HPV mRNA quality control products were prepared in lyophilized form by synthesizing the CDS region sequences of HPV E6 and E7 in vitro. These products contained HPV E6/E7 mRNA fragments of various high-risk types and were subjected to absolute quantification. Human cervical cancer cell line RNA was mixed in to ensure the stability and accurate quantification of the quality control products.

Benefits of technology

We offer a variety of HPV type E6/E7 mRNA quality control products to ensure the accuracy and safety of testing, reduce the risk of false positives, and are suitable for various testing platforms. The quality control products are highly stable at room temperature and are easy to transport and store.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122038422A_ABST
    Figure CN122038422A_ABST
Patent Text Reader

Abstract

The invention discloses an mRNA (messenger Ribonucleic Acid) quality control product of human papilloma virus as well as a preparation method and application thereof, and belongs to the technical field of in-vitro diagnosis quality control. The method comprises the following steps: chemically synthesizing an HPV E6 / E7 gene DNA sequence, respectively cloning the HPV E6 / E7 gene DNA sequence into a cloning vector to construct a synthetic plasmid template, further preparing a nucleic acid fragment containing E6 / E7 mRNA through in-vitro transcription, carrying out absolute quantification through a digital PCR technology, mixing the nucleic acid fragment with human cervical cancer cell line RNA without any HPV sequence, and screening to obtain the HPV E6 / E7 gene DNA sequence. And the mRNA quality control product with stable structure and accurate value is prepared through a vacuum freeze drying technology. The quality control product can simulate HPV E6 / E7 mRNA in a clinical sample, has comprehensive types, is suitable for accurate evaluation of sensitivity, specificity, precision and other analysis performances of an HPV E6 / E7 mRNA detection kit, provides a key quality control tool for accurate risk stratification of cervical cancer, and is suitable for various detection platforms.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of in vitro diagnostic quality control technology, specifically relating to a human papillomavirus mRNA quality control product, its preparation method, and its application. Background Technology

[0002] Human papillomavirus (HPV) is a non-enveloped circular double-stranded DNA virus. Its genome consists of approximately 8,000 base pairs and is enclosed by a capsid protein mainly composed of L1 and L2 proteins. The HPV genome has clearly defined functional regions: the early region (E region) encodes multiple proteins, including E6 and E7, which are mainly responsible for viral replication, transcriptional regulation, and cell transformation; the late region (L region) encodes viral capsid structural proteins; and the long non-coding control region (LCR) contains the origin of replication and transcriptional regulatory elements. Among these, the encoded E6 and E7 proteins play important roles in the pathogenesis of tumors.

[0003] Currently, clinical genotyping of human papillomavirus (HPV) mainly relies on cervical liquid-based cytology and molecular biology techniques. HPV E6 / E7 mRNA detection reagents have shown significant clinical value because they can directly reflect viral carcinogenic activity; however, this type of testing faces a severe challenge in China due to a lack of quality control products. The vast majority of HPV quality control products on the market are DNA-based, mostly in the form of plasmids, pseudoviruses, or integrated cell lines. RNA-based quality control products are limited to HPV16 and HPV18 pseudovirus forms of E6 / E7 mRNA. These control products are purified from prokaryotic E. coli, resulting in incomplete genotyping, a high risk of false negatives, and the potential presence of prokaryotic DNA, RNA, proteins, and cell wall fragments, leading to contamination or false positives. Summary of the Invention

[0004] To fill the market gap in existing HPV nucleic acid quality control products, this invention provides an HPV E6 / E7 mRNA quality control product. This quality control product is prepared using in vitro synthesis and in vitro transcription techniques, and is ultimately formulated into lyophilized pellets. It offers advantages such as high stability, accurate quantification, and ease of use.

[0005] To solve the above problems, the present invention adopts the following technical solution.

[0006] This invention provides a method for preparing a human papillomavirus mRNA quality control sample, comprising the following steps: S1. Obtain the CDS region sequences of HPV E6 and E7, and clone the sequences into a cloning vector by gene synthesis to obtain a synthetic plasmid; S2. After linearizing the synthetic plasmid, in vitro transcription was performed to obtain the in vitro transcribed HPV E6 / E7 mRNA fragment, which was then quantified in absolute terms. S3. Mix the human cervical cancer cell line RNA without HPV gene sequence with the HPV E6 / E7 mRNA fragment to prepare a mixed RNA solution; S4. Freeze-dry the mixed RNA solution to obtain human papillomavirus mRNA quality control material.

[0007] In step S1, the HPV includes any one or more high-risk HPV types selected from HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68.

[0008] In one implementation, a promoter is added to the 5' end of the CDS region sequence of HPV E6 and E7, and an enzyme restriction site is added to the 3' end; the linearization of the synthesized plasmid is performed by restriction enzyme digestion with the corresponding restriction enzyme. Furthermore, the promoter of the plasmid used in the cloning vector is different from the promoter added to the 5' end of the CDS region sequence of HPV E6 and E7.

[0009] Preferably, a T3 promoter is added to the 5' end of the CDS region sequence of HPV E6 and E7, and an EcoRⅤ restriction site is added to the 3' end; the linearization of the synthesized plasmid is performed by EcoRⅤ restriction enzyme digestion. The cloning vector of the present invention is any vector that does not contain a T3 promoter, such as the pUC57 plasmid.

[0010] Preferably, the absolute quantification described in step S2 is performed by detecting the copy number of HPV E6 / E7 mRNA using RT-ddPCR.

[0011] This invention also provides primer and probe sequences for detecting HPV E6 / E7 mRNA copy number. As one embodiment, the forward primer sequence for detecting the HPV16 E6 / E7 mRNA fragment copy number is gtcaaaagccactgtgtcctg, the reverse primer sequence is ccgaccccttatattatggaatctttg, and the probe sequence is FAM-caaagacatctggacaaaaagcaaag-BHQ1.

[0012] As one implementation method, the forward primer sequence for detecting the copy number of the HPV18 E6 / E7 mRNA fragment is cagcccgacgagccgaac, the reverse primer sequence is ctactagctcaattctggcttcacac, and the probe sequence is FAM-caacgtcacacaatgttgtg-BHQ1.

[0013] As one implementation method, the forward primer sequence for detecting the copy number of the HPV31 E6 / E7 mRNA fragment is caattacccgacagctcagatgag, the reverse primer sequence is gtaattggatgtgtccggttctg, and the probe sequence is FAM-atgtcatagacagtccagctgg-BHQ1.

[0014] As one implementation method, the forward primer sequence for detecting the copy number of the HPV33 E6 / E7 mRNA fragment is gcaattaagtgacagctcagatgag, the reverse primer sequence is ctgtggctggttgtgcttgt, and the probe sequence is FAM-cttggaccggccagatg-BHQ1.

[0015] As one implementation method, the forward primer sequence for detecting the copy number of the HPV35 E6 / E7 mRNA fragment is tgtgaggcgacactacgtct, the reverse primer sequence is atgctctctgtgaacagccg, and the probe sequence is FAM-cagagcacacacattgacatac-BHQ1.

[0016] As one implementation method, the forward primer sequence for detecting the copy number of the HPV39 E6 / E7 mRNA fragment is ctcacgggatactctgcgacaac, the reverse primer sequence is cacaccacggacacacaaatcc, and the probe sequence is FAM-cagcagctgtttatggactc-BHQ1.

[0017] As one implementation method, the forward primer sequence for detecting the copy number of the HPV45 E6 / E7 mRNA fragment is tcatgcacaactaccagccc, the reverse primer sequence is tctgccgagctctctactgt, and the probe sequence is FAM-cgagccgaaccacagcg-BHQ1.

[0018] As one implementation method, the forward primer sequence for detecting the copy number of the HPV51 E6 / E7 mRNA fragment is gttacagaattgaagctccgtgttg, the reverse primer sequence is gaagggtgtctccactgctttc, and the probe sequence is FAM-caagtgtagtacaactggcag-BHQ1.

[0019] As one implementation method, the forward primer sequence for detecting the copy number of the HPV52 E6 / E7 mRNA fragment is gagcaattaggtgacagctcagatg, the reverse primer sequence is cttgtggcttgttctgcttgtc, and the probe sequence is FAM-cagatggtgtggaccggc-BHQ1.

[0020] As one implementation method, the forward primer sequence for detecting the copy number of the HPV56 E6 / E7 mRNA fragment is atgaggatgaggatgaagtaga, the reverse primer sequence is ctgcaccacaaacttacactcac, and the probe sequence is FAM-ccatttgcaggagcggc-BHQ1.

[0021] As one implementation method, the forward primer sequence for detecting the copy number of the HPV58 E6 / E7 mRNA fragment is gcaattatgtgacagctcagacgag, the reverse primer sequence is tgtggccggttgtgcttgtc, and the probe sequence is FAM-tgaaataggcttggacgggc-BHQ1.

[0022] As one implementation method, the forward primer sequence for detecting the copy number of the HPV59 E6 / E7 mRNA fragment is ctacgagcaattacctgactccg, the reverse primer sequence is caatgttgtgacgctgtggttcag, and the probe sequence is FAM-ctccgagaatgaaaaagatgaac-MGB.

[0023] As one implementation method, the forward primer sequence for detecting the copy number of the HPV66 E6 / E7 mRNA fragment is tagaccatttgctggagcgg, the reverse primer sequence is tgcaccaccaactcacactt, and the probe sequence is FAM-cacagcaagctagacaagctg-BHQ1.

[0024] As one implementation method, the forward primer sequence for detecting the copy number of the HPV68 E6 / E7 mRNA fragment is cgaccatgcagttaatcaccacc, the reverse primer sequence is gtgagtccataaacagctgttgtag, and the probe sequence is FAM-ctagccagacgggacgaac-BHQ1.

[0025] In one embodiment, the final concentration of human cervical cancer cell line RNA in the reconstituted human papillomavirus mRNA quality control sample is 1-100 ng / μL, and the copy number of HPV E6 / E7 RNA in the reconstituted human papillomavirus mRNA quality control sample is ≥5.0E+03 copies.

[0026] The present invention also includes human papillomavirus mRNA quality control products prepared by the above method.

[0027] The present invention also includes the application of the above-mentioned human papillomavirus mRNA quality control material in HPV E6 / E7 mRNA nucleic acid detection reagents and / or kits.

[0028] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) Precise quantification. The present invention prepares human papillomavirus mRNA quality control samples. From the design of the source E6 / E7 sequence to in vitro transcription and absolute quantification, it ensures that each quality control sample has a known and precise concentration, which can be used to draw a standard curve for quantitative detection; (2) High safety and non-infectiousness. The quality control product of this invention is only a specific E6 / E7 mRNA sequence of HPV virus, does not contain the complete viral genome, has no risk of infection, and has high biosafety; (3) High stability and easy transportation. The quality control product of the present invention is in lyophilized form, which allows the RNA in the quality control product to be stably stored for a long time at room temperature, and can be stably stored at 4°C or room temperature for at least 12 months, which greatly facilitates storage and transportation and reduces costs; (4) Wide variety and comprehensive coverage. The quality control products of the present invention provide quality control products that can cover all types, especially high-risk types of HPV E6 / E7 mRNA, solving the quality control problem in multi-target detection; the quality control products of the present invention can flexibly provide single type, multi-type mixed or different concentration quality control products according to user needs, and are suitable for most HPV mRNA detection platforms based on RT-PCR, isothermal amplification, NGS and other technologies.

[0029] The human papillomavirus (HPV) E6 / E7 mRNA quality control of this invention can mimic HPV E6 / E7 mRNA in clinical samples, covering a comprehensive range of types. It is suitable for accurately evaluating the analytical performance of HPV E6 / E7 mRNA detection kits, including sensitivity, specificity, and precision. This provides a crucial quality control tool for precise risk stratification of cervical cancer and is applicable to various testing platforms. Verification has shown that the quality control of this invention exhibits good specificity and repeatability, and can be used to continuously monitor the analytical performance of HPV E6 / E7 mRNA nucleic acid detection kits, thereby significantly reducing the risk of false negatives due to reagent fluctuations or operational errors. Attached Figure Description

[0030] Figure 1 This is a 1D scatter plot of the digital PCR detection of HPV16 E6 / E7 mRNA in this invention; Detailed Implementation This invention provides a method for preparing a human papillomavirus mRNA quality control sample, comprising the following steps: S1. Obtain the CDS region sequences of HPV E6 and E7, and clone the sequences into a cloning vector by gene synthesis to obtain a synthetic plasmid; S2. After linearizing the synthetic plasmid, in vitro transcription was performed to obtain the in vitro transcribed HPV E6 / E7 mRNA fragment, which was then quantified in absolute terms. S3. Mix the human cervical cancer cell line RNA without HPV gene sequence with the HPV E6 / E7 mRNA fragment to prepare a mixed RNA solution; S4. Freeze-dry the mixed RNA solution to obtain human papillomavirus mRNA quality control material.

[0031] This invention does not specifically limit the HPV types mentioned; any known HPV types can be used in the preparation of HPV mRNA quality control samples in this application, including high-risk HPV and / or low-risk HPV. This invention also does not specifically limit the number of HPV types mentioned; any one or more HPV types can be selected. As an example, this invention prepares quality control samples using 14 high-risk HPV E6 / E7 mRNA types, specifically HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68, covering all high-risk HPV types with carcinogenic risk, thus solving the quality control problem in multi-target detection. However, this is not a limitation of the invention; those skilled in the art can select the HPV types and number according to the actual detection target.

[0032] In one embodiment, the present invention first obtains the CDS region sequences of HPV E6 and E7, and clones these sequences into a cloning vector via gene synthesis to prepare a synthetic plasmid. The HPV E6 and E7 CDS region sequences of the present invention can be downloaded from NCBI and contain the genomic sequence from the E6 start codon ATG to the E7 stop codon TAA (TAG or TGA). In another embodiment, the present invention adds a promoter to the 5' end and an enzyme restriction site to the 3' end of the HPV E6 and E7 CDS region sequences, and synthesizes the nucleotide sequence of the above-mentioned HPV gene fragment via chemical synthesis. Optionally, the promoter is a T3 promoter, and its nucleotide sequence is AATTAACCCTCACTAAAGGGAGA., The restriction enzyme site is the EcoRⅤ restriction site, and its nucleotide sequence is GATATC. The synthesized HPV gene fragments are then ligated into cloning vectors. The promoter of the plasmid used in the cloning vector differs from the promoter added to the 5' end of the CDS region sequences of HPV E6 and E7. For example, if the pUC57 plasmid is used as the cloning vector, a synthetic plasmid containing the CDS region sequences of HPV E6 and E7 is obtained.

[0033] This invention linearizes the aforementioned synthetic plasmid. As one embodiment, using the synthetic plasmid as a template, the plasmid is linearized with an endonuclease corresponding to the described restriction site, such as EcoRⅤ, and purified to obtain a linearized plasmid. This invention uses the linearized plasmid as a template for in vitro transcription, and the HPV E6 / E7 mRNA fragment obtained from in vitro transcription is absolutely quantified to obtain HPV E6 / E7 mRNA fragments with a fixed copy number. This invention does not particularly limit the plasmid linearization system and in vitro transcription system; any existing known systems and methods can be used. As one embodiment, this invention uses RT-ddPCR to detect the copy number of HPV E6 / E7 mRNA. The primer and probe sequences for detecting the HPV E6 / E7 RNA copy number are as follows: As one implementation method, the forward primer sequence for detecting the copy number of the HPV16 E6 / E7 mRNA fragment is gtcaaaagccactgtgtcctg, the reverse primer sequence is ccgaccccttatattatggaatctttg, and the probe sequence is FAM-caaagacatctggacaaaaagcaaag-BHQ1.

[0034] As one implementation method, the forward primer sequence for detecting the copy number of the HPV18 E6 / E7 mRNA fragment is cagcccgacgagccgaac, the reverse primer sequence is ctactagctcaattctggcttcacac, and the probe sequence is FAM-caacgtcacacaatgttgtg-BHQ1.

[0035] As one implementation method, the forward primer sequence for detecting the copy number of the HPV31 E6 / E7 mRNA fragment is caattacccgacagctcagatgag, the reverse primer sequence is gtaattggatgtgtccggttctg, and the probe sequence is FAM-atgtcatagacagtccagctgg-BHQ1.

[0036] As one implementation method, the forward primer sequence for detecting the copy number of the HPV33 E6 / E7 mRNA fragment is gcaattaagtgacagctcagatgag, the reverse primer sequence is ctgtggctggttgtgcttgt, and the probe sequence is FAM-cttggaccggccagatg-BHQ1.

[0037] As one implementation method, the forward primer sequence for detecting the copy number of the HPV35 E6 / E7 mRNA fragment is tgtgaggcgacactacgtct, the reverse primer sequence is atgctctctgtgaacagccg, and the probe sequence is FAM-cagagcacacacattgacatac-BHQ1.

[0038] As one implementation method, the forward primer sequence for detecting the copy number of the HPV39 E6 / E7 mRNA fragment is ctcacgggatactctgcgacaac, the reverse primer sequence is cacaccacggacacacaaatcc, and the probe sequence is FAM-cagcagctgtttatggactc-BHQ1.

[0039] As one implementation method, the forward primer sequence for detecting the copy number of the HPV45 E6 / E7 mRNA fragment is tcatgcacaactaccagccc, the reverse primer sequence is tctgccgagctctctactgt, and the probe sequence is FAM-cgagccgaaccacagcg-BHQ1.

[0040] As one implementation method, the forward primer sequence for detecting the copy number of the HPV51 E6 / E7 mRNA fragment is gttacagaattgaagctccgtgttg, the reverse primer sequence is gaagggtgtctccactgctttc, and the probe sequence is FAM-caagtgtagtacaactggcag-BHQ1.

[0041] As one implementation method, the forward primer sequence for detecting the copy number of the HPV52 E6 / E7 mRNA fragment is gagcaattaggtgacagctcagatg, the reverse primer sequence is cttgtggcttgttctgcttgtc, and the probe sequence is FAM-cagatggtgtggaccggc-BHQ1.

[0042] As one implementation method, the forward primer sequence for detecting the copy number of the HPV56 E6 / E7 mRNA fragment is atgaggatgaggatgaagtaga, the reverse primer sequence is ctgcaccacaaacttacactcac, and the probe sequence is FAM-ccatttgcaggagcggc-BHQ1.

[0043] As one implementation method, the forward primer sequence for detecting the copy number of the HPV58 E6 / E7 mRNA fragment is gcaattatgtgacagctcagacgag, the reverse primer sequence is tgtggccggttgtgcttgtc, and the probe sequence is FAM-tgaaataggcttggacgggc-BHQ1.

[0044] As one implementation method, the forward primer sequence for detecting the copy number of the HPV59 E6 / E7 mRNA fragment is ctacgagcaattacctgactccg, the reverse primer sequence is caatgttgtgacgctgtggttcag, and the probe sequence is FAM-ctccgagaatgaaaaagatgaac-MGB.

[0045] As one implementation method, the forward primer sequence for detecting the copy number of the HPV66 E6 / E7 mRNA fragment is tagaccatttgctggagcgg, the reverse primer sequence is tgcaccaccaactcacactt, and the probe sequence is FAM-cacagcaagctagacaagctg-BHQ1.

[0046] As one implementation method, the forward primer sequence for detecting the copy number of the HPV68 E6 / E7 mRNA fragment is cgaccatgcagttaatcaccacc, the reverse primer sequence is gtgagtccataaacagctgttgtag, and the probe sequence is FAM-ctagccagacgggacgaac-BHQ1.

[0047] The 1D scatter plot of digital PCR detection of E6 / E7 RNA fragments transcribed in vitro for various HPV types shows that the signal differentiation between positive and negative droplets is good, and the accuracy and reliability of the experimental results are strong. The primers and probes designed for each fragment can achieve efficient and specific detection of their copy number.

[0048] As one implementation method, the final copy number of HPV E6 / E7 RNA in the human papillomavirus mRNA quality control product of the present invention is preferably ≥5.0E+03 copies. Based on the detection limit of the HPV E6 / E7 RNA detection kit, the final copy number of HPV E6 / E7 RNA in the human papillomavirus mRNA quality control product is reasonably set. Theoretically, the concentration of HPV E6 / E7 RNA after dilution of the quality control product is greater than the detection limit of the kit.

[0049] The human papillomavirus (HPV) E6 / E7 mRNA quality control of this invention contains, in addition to precisely quantified HPV E6 / E7 mRNA, a certain amount of HPV-free human cervical cancer cell line RNA, such as cervical cancer cell lines C-33A or HT-3, accurately simulating clinical samples. As one embodiment, the final concentration of HPV-free human cervical cancer cell line RNA in the HPV mRNA quality control of this invention is 1-100 ng / μL, more preferably 20-80 ng / μL, and even more preferably 30-60 ng / μL. This concentration conforms to the RNA concentration range extracted from real cell lines. This invention does not particularly limit the extraction method of human cervical cancer cell line RNA; conventional RNA extraction methods in the art can be used.

[0050] This invention involves mixing the aforementioned HPV gene sequence-free human cervical cancer cell line RNA with the HPV E6 / E7 mRNA fragment and then lyophilizing the mixture to obtain lyophilized microspheres of human papillomavirus mRNA quality control. As one embodiment, a lyophilization preservative is added during lyophilization to protect the structural integrity and biological activity of the mRNA, ensuring that the lyophilized microspheres maintain the stability and accuracy of the quality control after reconstitution. As one embodiment, the lyophilization preservative is selected from a 40 mM Tris (pH 7.4) solution containing 25% sucrose, 6% mannitol, and 0.2 mM EDTA. This invention does not particularly limit the lyophilization process; conventional vacuum freeze-drying processes in the art are acceptable.

[0051] The human papillomavirus mRNA quality control product prepared by the above method of the present invention has the advantages of high stability, accurate quantification, and high safety. It has good specificity and repeatability and can be used to continuously monitor the analytical performance of HPV E6 / E7 mRNA nucleic acid detection reagents, thereby significantly reducing the risk of false negatives caused by reagent fluctuations or operational errors.

[0052] The present invention will be further described below with reference to specific embodiments. The following embodiments are intended to illustrate the implementation methods and technical effects of the present invention in more detail, but should not be construed as limiting the scope of protection of the present invention. Unless otherwise expressly stated, the experimental methods used in the following embodiments all follow conventional operating standards in the art or the requirements of instrument manuals; the raw materials, reagents, or equipment involved, unless otherwise specified, can be purchased commercially.

[0053] Example 1: Preparation of 14 high-risk HPVE6 / E7 RNA fragments 1. Chemical synthesis of the E6 / E7 genome sequences of 14 high-risk HPV types Based on NCBI sequences: HPV16 (K02718.1), HPV18 (X05015.1), HPV31 (J04353.1), HPV33 (M12732.1), HPV35 (X74477.1), HPV39 (M62849.1), HPV45 (X74479.1), HPV51 (M62877.1), HPV52 (X74481.1), HPV56 (X74483.1), HPV58 (D90400.1), HPV59 (X77858.1), HPV66 (U31794), HPV68 (DQ080079.1) The genomic sequences from the E6 start codon to the E7 stop codon were downloaded, and a T3 promoter sequence was added to the 5' end of the sequence, and an EcoRI site (EcoRⅤ) was added to the 3' end, resulting in nucleotide sequences of 14 DNA fragments. The above nucleotide sequences were chemically synthesized by a synthetic company, and the synthesized sequences were ligated into the pUC57 vector to obtain synthetic plasmids.

[0054] 2. Linearization of E6 / E7 genomic templates of 14 high-risk HPV types Using the synthesized plasmid as a template, the plasmid was linearized and the template was purified using EcoRⅤ restriction enzymes. The enzyme digestion system was prepared according to Table 1 below: Table 1. Plasmid linearization system The linearized plasmid was digested at 37℃ for 1 hour, purified and recovered, and its concentration was determined using a DeNovix DS-11 spectrophotometer. The measurement was repeated 3 times and the average value was taken.

[0055] 3. Using the linearized plasmid from step 2 as a template, perform in vitro transcription as follows: (using MEGAscript™ T7 Transcription Kit, catalog number: AM1333 as an example) (1) Remove each reagent from the refrigerator, thaw, vortex mix, briefly centrifuge, and prepare the reaction system according to Table 2 below: Table 2 In vitro transcription system (2) After the reaction system was shaken and mixed, it was incubated at 37°C for 3 hours. Then, 1 µL of TURBODNase was added to the system, shaken and mixed, and incubated at 37°C for another 15 minutes to completely digest the DNA template; (3) Transfer the transcribed RNA sample to a 1.5 mL centrifuge tube, add 500 μL TE, and gently mix by pipetting. (4) Prepare the purification column and resuspend and equilibrate the Sephadex G-25 gel column with 2 column volumes of TE buffer, then rinse with 500 uL of TE buffer for later use. (5) Transfer the RNA solution from step (3) to a purification column, centrifuge at 12000g for 30s, and discard the liquid; (5) Add 500 µL Wash Solution to the purification column, centrifuge at 12,000 × g for 30 seconds, and then discard the effluent in the collection tube.

[0056] (6) Repeat step (5) once; (7) Centrifuge the purification column at 12000g for 30s to completely remove residual liquid; (8) Transfer the purification column to a new collection tube, add 50 μL of preheated (60℃) enzyme-free water, let stand for 1 minute, and then elute by centrifugation at 12,000 × g for 1 minute; (9) The concentration of transcribed RNA was determined using a DeNovix DS-11 spectrophotometer, and the size of single-stranded RNA was determined using formaldehyde denaturing agarose gel electrophoresis; (10) The obtained RNA in vitro transcription product was stored at -70℃ for later use.

[0057] Example 2: Preparation of HPV E6 / E7 mRNA nucleic acid quality control material 1. Preparation of RNA from human cervical cancer cell line C-33A Total RNA was extracted from C-33A cells using the TRIzol™ Plus RNA purification kit (Invitrogen, Cat. No. 12183555CN). The specific steps are as follows: (1) Cell lysis: After growing to an appropriate density of C-33A monolayer, gently wash once with PBS. Add 1 mL of TRIzol reagent directly to a 10 cm² culture area petri dish, gently pipette to mix, and incubate at room temperature for 5 minutes to achieve complete lysis; (2) Phase separation: Transfer the lysate to a sterile 1.5 mL enzyme-free centrifuge tube, add chloroform at a ratio of 0.2 mL chloroform per 1 mL TRIzol, and vortex vigorously for 15 seconds. Then centrifuge at 4°C and 12,000 × g for 15 minutes; (3) RNA recovery: After centrifugation, the sample separates into three phases. Carefully transfer about 500 μL of the upper colorless aqueous phase into a new 1.5 mL centrifuge tube using a pipette, strictly avoiding contact with the intermediate phase interface; (4) RNA purification: Add an equal volume of 70% ethanol to the aqueous phase and invert the centrifuge tube several times. Transfer the entire mixture to a purification column and perform the binding, washing, and elution steps according to the kit instructions to obtain high-purity total RNA. (5) Concentration determination: The concentration of the extracted RNA was measured using a DeNovix DS-11 spectrophotometer. The measurement was repeated 3 times, and the final concentration was taken as the average value for later use.

[0058] 2. Digital PCR to determine the copy number of in vitro transcribed RNA The in vitro transcription product obtained in Example 1 was appropriately diluted with TE buffer. The diluted RNA was then used to confirm copy number on a Pilot Drop Digital PCR System D3200, and RT-ddPCR was performed using its two-step reagent kit (Zhejiang Hangzhou Medical Device Registration No. 20190880). The primer and probe sequences used to detect HPV E6 / E7 RNA copy number are shown in Table 3 below: Table 3 Primer and probe sequences Digital PCR was used to detect the HPV 16 in vitro transcribed E6 / E7 mRNA fragment, and its 1D scatter plot is shown below. Figure 1 As shown in the figure, the detection results for the remaining mRNA fragment types all exhibited similar distribution patterns. This result indicates that the primers and probes designed for each fragment can achieve efficient and specific detection of their copy numbers.

[0059] 3. In vitro transcription of HPV E6 / E7 mRNA mixed with cervical cancer cell line RNA Based on the copy number concentration of each HPV E6 / E7 mRNA and the concentration of cervical cancer cell line RNA, the two were mixed in a certain proportion to ensure that the final concentration of each HPV type in the mixture was not less than 500 copies / µL, while the final concentration of cervical cancer cell line RNA was adjusted to 20 ng / µL.

[0060] Example 3: Preparation process of freeze-dried microspheres for HPV E6 / E7 mRNA nucleic acid quality control products (1) The quality control solution prepared in Example 2 was mixed with 10 µL of RNA lyophilization preservative at a ratio of 10 µL to 10 µL. The lyophilization preservative was a 40 mM Tris (pH 7.4) solution containing 25% sucrose, 6% mannitol, and 0.2 mM EDTA. Each time, 5 L of the prepared solution was used for drop bead granulation and vacuum freeze-drying to obtain porous, non-collapsed, uniformly sized, and stable lyophilized microspheres. The average diameter of the lyophilized microspheres was approximately 3.4 mm.

[0061] (2) Dispense each lyophilized microsphere into a 1.5mL enzyme-free tip-bottom centrifuge tube, tighten the cap, and store in an aluminum foil bag at 2-8℃.

[0062] Example 4: Determination of copy number of HPV E6 / E7 mRNA nucleic acid quality control sample (1) Take 3 lyophilized microspheres from Example 3 for each type, centrifuge briefly, add 50 µL of enzyme-free water, and reconstitute at room temperature for 10 min.

[0063] (2) The copy number of the HPV E6 / E7 mRNA nucleic acid control sample was detected using the 14 sets of primers and probes listed in Table 3. RT-ddPCR was performed using the Navigator Droplet Digital PCR System D3200 and the two-step reagent kit (Zhejiang Hangzhou Medical Device Registration No. 20190880) to accurately quantify the reconstituted RNA solution. In each RT-ddPCR reaction, 1 µL of the reconstituted RNA solution was used as a template, and each probe was used in 3 replicate wells. The final result was the average of three replicates. The copy number of the target sequence contained in each tube of lyophilized microspheres of the quality control sample was calculated based on the total volume of the RNA solution. Detailed detection results are listed in Table 4.

[0064] Table 4 Copy number concentration of each quality control sample Test results confirmed that the HPV E6 / E7 mRNA copy number in each sample was ≥5.00E+03 copies, and the performance indicators met expectations. This product is suitable for quality evaluation of HPV E6 / E7 mRNA detection reagents, helping to ensure detection accuracy and thus reducing the occurrence of false negative results.

[0065] Example 5: Stability testing of HPV E6 / E7 mRNA quality control samples After storage at 2-8℃ for 4 months, 8 months, and 12 months, one vial of the lyophilized microspheres prepared in Example 3 was taken each time. After brief centrifugation, 50 µL of enzyme-free water was added, and the microspheres were reconstituted at room temperature for 10 min. RT-ddPCR was performed using the Navigator Droplet Digital PCR System D3200 and its two-step reagent kit (Zhejiang Hangzhou Medical Device Registration No. 20190880) to test its stability. In each RT-ddPCR reaction, 1 µL of the reconstituted RNA solution was used as a template, and each probe was used in three replicate wells. The final result was the average of three replicates. The reconstituted RNA solution was precisely quantified to detect the HPV E6 / E7 mRNA copy number, as detailed in Table 5 below.

[0066] Table 5 Stability test results As shown in Table 5, the HPV E6 / E7 mRNA copy number remained at the original level (≥5000) after 12 months of storage at 2-8℃, demonstrating excellent stability. This characteristic ensures usability during long-term storage and provides strong assurance for the reliability of quality control results.

[0067] Example 6: Suitability Testing of HPV E6 / E7 mRNA Quality Controls (1) High-risk human papillomavirus E6 / E7 region mRNA detection kit (PCR-fluorescent probe method) (Chaozhou Kaipu Biochemical Co., Ltd., hereinafter referred to as Chaozhou Kaipu) and human papillomavirus (HPV) E6 / E7 mRNA genotyping detection kit (fluorescent PCR-melting curve method) (Guangzhou Baochuang Biotechnology Co., Ltd., hereinafter referred to as Guangzhou Baochuang) were selected to test the quality control products.

[0068] (2) The lyophilized microspheres of HPV E6 / E7 mRNA quality control sample from Example 3 were reconstituted with 50 μL of enzyme-free water and allowed to stand for 10 minutes. Subsequently, the samples were detected on a SLAN-96 real-time PCR instrument according to the instructions of each kit.

[0069] The high-risk human papillomavirus E6 / E7 region mRNA detection kit (PCR-fluorescent probe method) (Chaozhou Kaipu) was used to detect the above-prepared quality control samples, and all of them were positive. The results are shown in Table 6. Table 6. Detection Results of Chaozhou Kaipu Reagent Kit The human papillomavirus (HPV) E6 / E7 mRNA genotyping kit (fluorescent PCR-melting curve method) (Guangzhou Baochuang) was used to detect the quality control samples of each type prepared above. The results are shown in Table 7. Table 7. Test Results of Guangzhou Baochuang Reagent Kit Test data show that the HPV E6 / E7 mRNA quality control product exhibits stable performance and reliable results under different systems, verifying its wide applicability.

[0070] The above description is intended to illustrate specific embodiments of the present invention in detail, but its content should not be construed as limiting the scope of protection of the present invention. For those skilled in the art, any simple modifications or substitutions made without departing from the core concept of the present invention should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A method for preparing a human papillomavirus mRNA quality control sample, characterized in that, Includes the following steps: S1. Obtain the CDS region sequences of HPV E6 and E7, and clone the sequences into a cloning vector by gene synthesis to obtain a synthetic plasmid; S2. After linearizing the synthetic plasmid, in vitro transcription was performed to obtain the in vitro transcribed HPV E6 / E7 mRNA fragment, which was then quantified in absolute terms. S3. Mix the human cervical cancer cell line RNA without HPV gene sequence with the HPV E6 / E7 mRNA fragment to prepare a mixed RNA solution; S4. Freeze-dry the mixed RNA solution to obtain human papillomavirus mRNA quality control material.

2. The preparation method according to claim 1, characterized in that, In step S1, the HPV includes any one or more high-risk HPV types selected from HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, HPV66, and HPV68.

3. The preparation method according to claim 1, characterized in that, A promoter was added to the 5' end of the CDS region sequence of HPV E6 and E7, and an enzyme restriction site was added to the 3' end; the linearization of the synthesized plasmid was performed by enzyme digestion with the corresponding restriction enzyme.

4. The preparation method according to claim 3, characterized in that, The promoter of the plasmid used in the cloning vector is different from the promoter added to the 5' end of the CDS region sequence of HPV E6 and E7.

5. The preparation method according to claim 1, characterized in that, The absolute quantification described in step S2 is performed by detecting the copy number of HPV E6 / E7 mRNA using RT-ddPCR.

6. The preparation method according to claim 5, characterized in that, The primer and probe sequences for detecting the copy number of the HPV E6 / E7 mRNA fragment are as follows: 。 7. The preparation method according to claim 1, characterized in that, The concentration of the human papillomavirus mRNA quality control sample containing the RNA of the human cervical cancer cell line after reconstitution is 1-100 ng / μL.

8. The preparation method according to claim 1, characterized in that, The reconstituted human papillomavirus mRNA quality control sample contains ≥5.0E+03 copies of the HPV E6 / E7 RNA.

9. Human papillomavirus mRNA quality control product prepared by the method described in claims 1-7.

10. The use of the human papillomavirus mRNA quality control material according to claim 9 in HPV E6 / E7 mRNA nucleic acid detection reagents and / or kits.