Primer, probe and kit for detecting EB (Epstein-Barr) virus

Abstract

The invention provides EB (Epstein-Barr) virus nucleic acid detection primers, a probe and a kit, according to a target sequence of an EB virus gene, the sequences of the primers and the probe in an asymmetric primer ERA detection system are designed and screened, and the ratio of upstream and downstream primers and an amplification reaction system are optimized, so that the EB virus nucleic acid sequence can be specifically identified, and the EB virus nucleic acid detection kit has the advantages of high specificity and high sensitivity. Non-specific binding with other irrelevant nucleic acids is reduced, so that the detection specificity is improved; meanwhile, efficient amplification of EB virus nucleic acid is realized, and the EB virus nucleic acid can be accurately detected even under the condition that the content of the virus nucleic acid is extremely low, so that the detection sensitivity and the amplification efficiency are improved.

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to primers, probes and kits for EB virus detection. Background Technology

[0002] In my country, Epstein-Barr virus (EBV) is a herpesvirus that widely infects humans and is the main pathogen of infectious mononucleosis (IM). It is also strongly associated with various malignant tumors, such as nasopharyngeal carcinoma, Burkitt lymphoma, Hodgkin's lymphoma, and gastric cancer. Currently, the clinical diagnosis of EB in my country mainly relies on serological antibody testing. However, serological testing suffers from cross-reactivity and poor timeliness, while traditional EB antigen testing suffers from high equipment costs and low sensitivity. Therefore, there is an urgent need for accurate and effective etiological detection methods, especially nucleic acid detection technology, to improve the diagnostic accuracy of EB.

[0003] Currently, the main methods for detecting EBV DNA include real-time quantitative polymerase chain reaction (qPCR), loop-mediated isothermal amplification (LAMP), and ERA. Among these, qPCR has been widely used in clinical laboratories for the quantitative detection of nucleic acids of other viruses, and it also has some application in EBV nucleic acid detection. It features high sensitivity, specificity, and good reproducibility, but it also suffers from problems such as complex operation, high cost, and susceptibility to contamination. ERA utilizes a special primer design and enzyme system to achieve nucleic acid amplification under isothermal conditions. It offers advantages such as speed, sensitivity, and specificity, and is relatively simple to operate with lower requirements for equipment.

[0004] Existing studies have proposed asymmetric primer PCR technology, which utilizes a pair of primers of unequal concentrations to generate a large number of single-stranded products in the later stages of the PCR reaction, facilitating subsequent experiments that require single-stranded DNA as a template, such as sequencing and hybridization probe preparation. However, the large-scale clinical application of asymmetric primer PCR technology is limited by core drawbacks such as insufficient sensitivity, cumbersome operation, and lack of quantitative function. Furthermore, there is currently no method for detecting EBV using asymmetric primer ERA technology in rapid clinical diagnostic applications.

[0005] Therefore, there is an urgent need to explore and establish an asymmetric primer ERA detection system for EBV detection and diagnosis, so as to accurately distinguish EBV from other similar viruses or pathogens and provide new technical support for clinical diagnosis. Summary of the Invention

[0006] To address the problems of existing technologies, this invention provides specific primer pairs and probes for EB virus detection. Asymmetric specific primer pairs and corresponding probes are designed to target upstream and downstream regions of the EB virus gene as amplification segments, ensuring the conservation and specificity of the target sequence. Asymmetric primer ERA isothermal amplification technology can rapidly and specifically amplify the target nucleic acid sequence, contributing to early and accurate disease diagnosis.

[0007] To achieve the above objectives, the present invention employs the following technical solution: On one hand, the present invention provides an asymmetric primer set for detecting EB virus, comprising an upstream primer, a downstream primer and a probe, wherein the upstream primer has a nucleotide sequence as shown in SEQ ID NO.3; the downstream primer has a nucleotide sequence as shown in SEQ ID NO.4; and the probe has a nucleotide sequence as shown in SEQ ID NO.7.

[0008] EBV DNA load is an important biomarker for nasopharyngeal carcinoma screening, diagnosis, staging, efficacy evaluation, and recurrence monitoring. However, EBV nucleic acid detection faces a series of unique and severe technical challenges. First, as a double-stranded DNA virus, EBV initially exists at extremely low levels in patients, and traditional detection methods may not accurately detect low copy numbers of viral nucleic acid, leading to missed diagnoses. Second, as a herpesvirus, EBV has a genome length of 172 kb, a complex genome structure, and contains a large number of sequences highly homologous to other herpesviruses such as cytomegalovirus (CMV), herpes simplex virus type 1 (HSV-1), and herpes simplex virus type 2 (HSV-2), which can easily lead to non-specific cross-reactions during detection. Furthermore, EBV has two main subtypes (A and B) and multiple geographical strains, and the target gene sequence exhibits natural variations, increasing the difficulty of specific primer and probe design. Furthermore, the types of samples used in clinical EBV testing are diverse. The mucus components in nasopharyngeal swabs and saliva samples, as well as the abundant protein impurities in tissue samples, can inhibit amplification reactions. Moreover, after infection, EBV can remain latent in B lymphocytes, resulting in viral loads in blood and tissue samples often as low as 1-10 copies / μl, placing stringent demands on detection sensitivity. These characteristics create significant technical bottlenecks in EBV detection.

[0009] To address the aforementioned challenges, this invention first screens and obtains highly specific primers (SEQ ID NO. 3 and SEQ ID NO. 4) and probes (SEQ ID NO. 7), which target highly conserved and unique regions of the EBV genome, ensuring differentiation from other homologous viruses and the human genome. Building upon this, this invention innovatively combines an asymmetric primer strategy with ERA isothermal amplification technology. By generating a large amount of single-stranded DNA product and achieving direct and efficient hybridization of the probe, it significantly improves the detection rate and amplification speed of low-copy targets. Furthermore, targeting the characteristics of different sample types, hyaluronidase and Triton X-100 (suitable for nasopharyngeal swabs / saliva samples) or proteinase K and BSA (suitable for tissue samples) are selectively added to the reaction system. This significantly improves the release efficiency of nucleic acids and the stability of enzymatic reactions in complex samples. Combined with an optimal primer concentration ratio of 1:30 and a highly efficient amplification reagent combination consisting of phage UvsX / UvsY protein, large fragments of Klenow polymerase, and creatine phosphokinase / creatine kinase, highly sensitive and specific detection of low-load EB virus nucleic acid is finally achieved, comprehensively overcoming the technical difficulties of EB virus detection.

[0010] Compared to traditional detection techniques such as PCR, ERA detection methods offer advantages such as speed, sensitivity, and specificity. However, traditional ERA methods typically require heating to denature and open the double-stranded DNA product after the amplification reaction before fluorescent probe hybridization, increasing the number of steps and time involved, and potentially reducing hybridization efficiency. Therefore, they may still suffer from insufficient sensitivity and specificity. Based on the principle of asymmetric primer PCR technology, this invention innovatively introduces an asymmetric primer ERA detection system. By designing specific primers and optimizing reaction conditions, it can achieve highly efficient amplification of EB virus nucleic acid, accurately detecting it even when the viral nucleic acid content is extremely low, thereby improving detection sensitivity.

[0011] Compared with conventional ERA detection techniques, the asymmetric primer ERA detection technology provided by this invention has significant advantages. Firstly, it can directly generate a large amount of single-stranded DNA, eliminating the need for complex methods to convert double-stranded DNA into single strands. Direct and efficient hybridization of single-stranded products offers higher detection sensitivity than hybridization after denaturation of double-stranded products. Therefore, for certain specific detection targets, asymmetric primer ERA amplification helps improve detection sensitivity and specificity. For example, in detecting single nucleotide polymorphisms (SNPs), by designing appropriate asymmetric primers, amplification can be made more biased towards specific alleles, thereby more accurately detecting SNP sites. Secondly, it eliminates the need for circular opening and other operational steps, simplifying the process and making it faster and more convenient. In pathogen detection, tumor gene detection, and other fields, the asymmetric primer ERA isothermal amplification technology provided by this invention can rapidly and specifically amplify target nucleic acid sequences, contributing to early and accurate disease diagnosis.

[0012] However, in practical applications, asymmetric primer ERA detection technology has significant advantages over conventional ERA technology and asymmetric primer PCR technology, but it also faces unique technical challenges. First, the primer design in asymmetric primer ERA detection systems has strict requirements on primer length; ERA primers typically need to be 28-32 nt (longer than conventional PCR primers), as shorter primers will significantly reduce amplification speed and sensitivity. Simultaneously, fluorescent or strip-type ERA requires specifically designed probes (such as those modified with THF sites). Second, in terms of primer ratio optimization, the proportion of primers in asymmetric ERA is usually higher than that in traditional asymmetric PCR, and it is necessary to avoid primer dimers interfering with the formation of recombinant complexes. Furthermore, ERA detection systems rely on multi-enzyme systems (recombinases, polymerases, etc.), and unequal primer amounts may disrupt enzyme synergy, leading to a decrease in single-strand yield. Therefore, in the construction of asymmetric primer ERA detection systems, primers, probes, recombinases, and other amplification reagents all need to be carefully designed, screened, and optimized to improve the sensitivity and specificity of the detection results. In some embodiments of the present invention, experimental results demonstrate that the sensitivity and specificity of the asymmetric primer ERA detection system provided by the present invention are significantly improved, the amplification speed is extremely fast, and compared with asymmetric primer PCR detection, no thermal cycler is required, which greatly simplifies the equipment requirements.

[0013] On the other hand, the present invention provides a nucleic acid detection system for EB virus, including the asymmetric primer set and nucleic acid isothermal amplification reaction reagent as described above.

[0014] The technical principle of the asymmetric primer ERA detection system is similar to that of conventional ERA technology. First, a recombinase binds to the primers, searches for complementary sequences on the template DNA, and opens the double strand. Then, a new DNA strand is synthesized under the action of DNA polymerase. The difference lies in the unequal concentrations of the upstream and downstream primers. In the early stages of amplification, since both primers are present, double-stranded DNA synthesis proceeds normally, and the product increases exponentially. As the reaction progresses, the low-concentration primers are gradually depleted, while the high-concentration primers continue to guide the synthesis of single-stranded DNA, ultimately producing mainly single-stranded DNA synthesized under the guidance of the high-concentration primers. Then, an ERA fluorescent probe is introduced into the amplification product. After the specific probe binds to the single-stranded target sequence, a specific local double strand is formed. Specific exonucleases in the reaction system recognize the specific DNA double strand bound to the probe and cleave the probe at specific sites. The fluorescent and quenching groups on the probe are separated, generating a fluorescence signal proportional to the amount of target DNA amplified. The fluorescence intensity increases with amplification.

[0015] In some embodiments, the present invention designs and screens the sequences of asymmetric primers and probes. The present invention uses the upstream and downstream regions of the EB virus gene as target amplification segments, designs three upstream and downstream primers and three probes, and provides primers formed by combining a specifically modified upstream primer and a specifically modified downstream primer. The specifically modified upstream and downstream primers are tailed primers, each consisting of a template hybridization region and a template extension region. Both the template hybridization region and the template extension region are template complementary sequences. The template hybridization region is the base sequence used for amplification, and the template extension region is a base sequence extending along the 3' axis. An Abasic-type base site is spaced between the template hybridization region and the template extension region. This special modification design improves the sensitivity and specificity of ERA primer amplification. Experimental results of the present invention show that, after combining the nine primer pairs with probes, only the asymmetric primer ERA detection system constructed using the upstream primer shown in SEQ ID NO.3, the upstream primer shown in SEQ ID NO.4, and the probe shown in SEQ ID NO.7 can significantly improve the sensitivity, specificity, and detection efficiency of EB virus detection.

[0016] In asymmetric ERA detection systems, the ratio of upstream to downstream primers significantly affects the specificity and sensitivity of the detection results. Therefore, in some embodiments, this invention also verified the necessity of selecting a 1:30 ratio of upstream to downstream primer concentrations. Results showed that when the ratio of upstream to downstream primer concentrations is higher than 1:30, the proportion of restriction primers in the detection system is too high, prematurely consuming the template and generating a large amount of double-stranded DNA, leading to insufficient amplification of the target single-stranded DNA and reducing the single-stranded yield. When the ratio of upstream to downstream primer concentrations is lower than 1:30, the proportion of restriction primers is too low, primers are exhausted prematurely, leaving a large amount of unused template and non-restriction primers. The single-stranded amplification stage is slowed down due to insufficient template, resulting in a decrease in overall amplification efficiency. Therefore, only by selecting a 1:30 ratio of upstream to downstream primer concentrations can the detection efficiency, sensitivity, and specificity of the asymmetric primer ERA detection system be improved.

[0017] Furthermore, asymmetric primer ERA detection systems rely on multi-enzyme systems (recombinases, polymerases, etc.). For example, recombinases bind to primers to form nucleoprotein filaments. This complex scans the double-stranded DNA template, searching for homologous sequences complementary to the primers. Once found, the recombinase catalyzes a strand exchange reaction, partially unwinding the template DNA double strand (forming a D-loop structure), exposing the single-stranded template region, creating conditions for primer annealing and extension. Meanwhile, DNA polymerases synthesize new DNA strands using deoxyribonucleotide triphosphates after primer-template binding. In addition, the recombinases in ERA detection systems consume a large amount of ATP to initiate the strand exchange reaction. To maintain the ATP concentration in the reaction system, an energy regeneration system, such as a creatine phosphate system or a pyruvate kinase system, is usually required. This energy regeneration system significantly affects ATP regeneration and the efficient operation of the recombinase. Therefore, the type of reagents, such as amplifying enzymes, in asymmetric primer ERA detection systems can significantly interfere with the synergistic effect between the primers and the recombinases, thus affecting the sensitivity, specificity, and detection efficiency.

[0018] Therefore, to ensure the specificity and sensitivity of the amplification products and improve amplification efficiency, the specific selection of recombinase, DNA polymerase, and energy regeneration system was compared and screened in some embodiments of the present invention. The results showed that the ERA detection system constructed using recombinases of phage UvsX and UvsY proteins, Klenow polymerase, and an energy regeneration system composed of phosphocreatine and creatine kinase exhibited good specificity and high sensitivity. This is because, compared to the commonly used RecA recombinase, UvsY in the UvsX / UvsY system acts as a loading factor, helping UvsX to rapidly bind with primers to form a complex, significantly reducing the amount of UvsX and ATP used, and the UvsX / UvsY system has a wider temperature adaptability. Klenow polymerase has high reliability, improving the specificity of the amplification products. Furthermore, the energy regeneration system using phosphocreatine + creatine kinase has higher stability and reaction efficiency than the phosphoenolpyruvate + pyruvate system, ensuring the continuous and efficient operation of the recombinase under isothermal conditions through continuous ATP regeneration, further improving the efficiency and specificity of the amplification reaction.

[0019] Furthermore, the nucleic acid isothermal amplification reaction reagent is an ERA reaction reagent, including bacteriophage uvsX protein and bacteriophage uvsY protein.

[0020] Furthermore, the nucleic acid isothermal amplification reaction reagent also includes phosphocreatine kinase, creatine kinase, and a large fragment of Klenow polymerase.

[0021] Furthermore, the nucleic acid isothermal amplification reaction reagent includes tris(hydroxymethyl)aminomethane-acetic acid buffer, potassium acetate, magnesium acetate, dithiothreitol, polyethylene glycol, ATP, phosphatase, creatine kinase, phage uvsX protein, phage uvsY protein, Klenow polymerase large fragment, exonuclease III, and dNTPs.

[0022] In some methods, the nucleic acid isothermal amplification reaction reagent includes tris(hydroxymethyl)aminomethane-acetic acid buffer, potassium acetate, magnesium acetate, dithiothreitol, polyethylene glycol, ATP, phosphatase, creatine kinase, phage uvsX protein, phage uvsY protein, Klenow polymerase large fragment, exonuclease III, dNTPs, hyaluronidase, and Triton X-100; the nucleic acid detection system is used for the detection of nasopharyngeal swab samples and saliva samples.

[0023] In some embodiments, the nucleic acid isothermal amplification reaction reagent includes tris(hydroxymethyl)aminomethane-acetic acid buffer, potassium acetate, magnesium acetate, dithiothreitol, polyethylene glycol, ATP, phosphatase, creatine kinase, bacteriophage uvsX protein, bacteriophage uvsY protein, Klenow polymerase large fragment, exonuclease III, dNTPs, proteinase K, and BSA; the nucleic acid detection system is used for the detection of nasopharyngeal tissue samples.

[0024] Furthermore, the present invention provides a method for detecting EB virus using the asymmetric primer set or the nucleic acid detection system described above, comprising the following steps: S1: Premixed reagent for constructing the template nucleic acid amplification reaction system; S2: Insert the premixed reagent tube into the fluorescence isothermal amplification instrument to carry out the amplification reaction.

[0025] Furthermore, the concentration ratio of the upstream primer to the downstream primer in the nucleic acid amplification reaction system described in step S1 is 1:(5-100).

[0026] Preferably, the concentration ratio of the upstream primer to the downstream primer in the nucleic acid amplification reaction system described in step S1 is 1:30.

[0027] Furthermore, the amplification reaction in step S2 is carried out at a temperature of 37~45℃ for 20~30 min.

[0028] In some implementations, the asymmetric ERA detection system is amplified and detected at the same temperature of 37-45°C. Amplification and detection are performed in the same reaction tube. The first step involves incubation in a metal bath or water bath at 37-45°C for 10-15 minutes. After removing the reaction tube and mixing it by inverting it 7-10 times, the reagent tube is inserted into a fluorescence isothermal amplification instrument at a preset temperature of 37-45°C for 5-10 minutes to collect fluorescence signals. The total reaction time is 20-25 minutes.

[0029] In another aspect, the present invention provides the use of an asymmetric primer set for preparing an ERA amplification detection reagent to improve the sensitivity of EB virus nucleic acid detection, characterized in that the asymmetric primer set includes an upstream primer, a downstream primer, and a probe, wherein the upstream primer has a nucleotide sequence as shown in SEQ ID NO.3; the downstream primer has a nucleotide sequence as shown in SEQ ID NO.4; and the probe has a nucleotide sequence as shown in SEQ ID NO.7.

[0030] The present invention has the following beneficial effects: 1. Primer and probe sequences were designed and screened to construct an asymmetric ERA detection system that can specifically identify the nucleic acid sequence of EB virus, reduce non-specific binding with other irrelevant nucleic acids, thereby improving the specificity of detection and ensuring the accuracy of detection results.

[0031] 2. The concentration ratio of upstream and downstream primers and nucleic acid amplification reaction reagents were optimized. A concentration ratio of 1:30 and nucleic acid amplification reagents containing recombinases of phage UvsX protein and phage UvsY protein, Klenow polymerase and creatine phosphokinase / creatine kinase system were used, which significantly improved the amplification efficiency of the detection system.

[0032] 3. For samples containing mucus, mucolytic enzymes and surfactants are introduced, and for tissue samples, proteases and protective proteins are added, thereby effectively degrading interfering substances and stabilizing enzyme activity, ensuring the robustness and reliability of the test in a real clinical environment.

[0033] 4. The asymmetric ERA detection system can achieve efficient amplification of EB virus nucleic acid, and can accurately detect it even when the viral nucleic acid content is extremely low, thereby improving the sensitivity of detection.

[0034] 5. Asymmetric ERA detection technology is an isothermal amplification technique that can amplify nucleic acids at a constant temperature without the need for a cumbersome temperature cycling process, greatly shortening the detection time and enabling rapid detection of EB virus nucleic acid, thus providing support for timely diagnosis and treatment of patients.

[0035] 6. The reaction system of asymmetric ERA detection technology is relatively simple, requiring no special instruments or equipment, and can be carried out under ordinary laboratory conditions. At the same time, its operation procedure is also relatively simple, reducing the impact of human factors on the detection results and improving the stability and repeatability of the detection. Attached Figure Description

[0036] Figure 1 The primer screening results are for EB virus gene detection.

[0037] Figure 2 The results of probe screening for EB virus gene detection.

[0038] Figure 3 This is a result validating the sensitivity of EB virus gene detection.

[0039] Figure 4 This is a specificity verification result for EB virus gene detection. Detailed Implementation

[0040] To make the above-mentioned objectives, technical solutions and advantages of the present invention clearer, the present invention will be further described in detail below with reference to the embodiments and accompanying drawings. The illustrative embodiments and descriptions of the present invention are only used to explain the present invention and are not intended to limit the present invention.

[0041] Unless otherwise specified, all raw materials used in the examples are commercially available.

[0042] Example 1: Design and screening of asymmetric primer sets I. Primer Screening Based on NCBI data and the target location of the EB virus gene, a specific region was selected as the target sequence (as shown in SEQ ID NO. 10). According to the primer design principles of ERA technology, the primer length should be 28–35 bp, and the probe length should be 44–52 bp, with the 5' end of the THF site being at least 30 nt and the 3' end at least 15 nt. THF replaces a base located between the fluorophore and the quencher, and the interval between the dT-fluorophore or dT-quencher and the THF base is 0, 1, or 2. The amplified fragment should not exceed 500 bp, and the GC content should be 30%–60%. ERA primers and probes targeting the EB virus gene were designed using Primer Premier 5 and preliminarily validated. Three upstream and three downstream primers with the lowest probability of secondary structure, hairpin structure, and primer dimer formation were selected as candidate primers. The reporter probe was modified with the fluorophore FAM at the 5' end and the quencher BHQ1 at the 3' end. Relevant sequences are shown in Table 1.

[0043] Table 1. Design of asymmetric ERA primers and probe sequences for EB virus genes. The optimal primer pairs were screened and validated using an asymmetric ERA detection system. All primers and probes were synthesized by General Biotech (Anhui) Co., Ltd. The asymmetric ERA detection system consisted of a 50 μL amplification reaction system and a 5 μL detection system, as shown in Tables 2 and 3, respectively.

[0044] Table 2 Amplification reaction system Table 3 Detection System The nucleic acid templates in Table 2 above are positive plasmids for EB virus. Based on the EB virus gene target sequence, a characteristic region was selected as the target amplification segment (sequence shown in SEQ ID NO.10), which was then constructed into the vector pUC57 to prepare a positive plasmid for EB virus. The plasmid DNA was synthesized by Nanjing Qingke Biotechnology Co., Ltd.

[0045] SEQ ID NO.10: EB virus gene target sequence: TAGGAGCCAGGCACAGTAAACGGTGTGATATGCATCGTTGACACTCTTCAGGTAGCCAGCATCCAGTCCTGACTCATGTTTCCTCCCTCGCTTCTTCAGGCGGCGCATGTTCTCTCCACGTTTAACTTCATCCAGACTATGGTGTCCCCCGGGTCTGCGGTAAACGTGGCCAAAACTTGAATAAAGTCA CTATAGGAGAGAAGCTGGCTCCGGAGCAGCATTAGAGGGAAAACCACGGAGGCCGACAGCAAATGGCGATCATGCAAAATCCAACAATCCAGGGGCGCGACTGACCTGGCACCAGACTCGGTAACCAGCAAGCTCCGCTTCCTAGAGGCCAAGACTCTGAAAGGGGTGGTAAATTTCATCTGGCATGCTA Table 1 shows the following combinations of upstream and downstream primers: S1: F1R1; S2: F1R2; S3: F1R3; S4: F2R1; S5: F2R2; S6: F2R3; S7: F3R1; S8: F3R2; S9: F3R3.

[0046] The amplification and detection steps are as follows: (1) Prepare 50 uL of amplification reaction system and 5 uL of detection system according to the components and dosages shown in Table 2 and Table 3 respectively. After preparation, add the amplification reaction system and detection system to the reaction tube and mix well to obtain the premixed solution. (2) Incubate the premixed reaction tube in a metal bath or water bath at 37-45℃ for 10-15 min (preferably 42℃, 15 min in this embodiment). Remove the reaction tube, invert it 7-10 times to mix, and then insert it into a fluorescence isothermal amplification instrument (Syndagene, GS8) with a preset temperature of 37-45℃ for 5-10 min (preferably 5 min in this embodiment) to collect fluorescence signals. The detection efficiency verification results of the 9 primer combinations are as follows: Figure 1 As shown.

[0047] During fluorescence signal acquisition, the positive fluorescence signal increases linearly at a certain slope. As the reaction time continues to extend, the fluorescence detection signal eventually reaches a plateau. The higher the slope of the fluorescence signal increase, the higher the detection efficiency, meaning that the combination of crRNA and primer pair has higher detection efficiency. Under the same template concentration, primer pair combinations with a higher slope of fluorescence signal increase are preferred. Figure 1 As shown in the fluorescence curves, the fluorescence signal growth rate of primer combination S7 (F3R1) is higher than that of other primer combinations, and the slope of fluorescence growth is the highest. This indicates that when the designed F3R1 primer combination is used to detect EB virus genes, it amplifies the target product faster and in greater quantities, resulting in higher amplification efficiency, making it the preferred combination.

[0048] Meanwhile, the present invention also uses 10 4 copies / uL, 10 3 copies / uL, 10 2 Using EB virus plasmid DNA at 10 copies / uL and 10 copies / uL as templates, the detection sensitivity of the 9 primer combinations was further verified using the above amplification and detection methods. The detection results are shown in Table 4.

[0049] Table 4. Sensitivity verification results of the 9 primer combinations Note: "+" indicates detected; "-" indicates not detected. As shown in Table 4, the asymmetric ERA detection system constructed using the F3R1 primer pair achieved a detection sensitivity of 10 copies / μL, while the detection sensitivity of other primer combinations could only reach a maximum of 10. 2 The results showed that the primer pair F3R1, with a ratio of copies / μL, indicates that the asymmetric ERA detection system constructed using this primer pair is highly sensitive and is therefore the preferred combination.

[0050] In addition, the present invention also uses 2.5 × 10 2 Using plasmid DNA copies / uL, 75 ng / uL human genomic nucleic acid, 100 ng / uL cytomegalovirus (CMV) nucleic acid, 50 ng / uL herpes simplex virus type 1 (HSV-1) nucleic acid, and 75 ng / uL herpes simplex virus type 2 (HSV-2) nucleic acid as templates, and 2.5 × 10⁻⁶ μg / μL of plasmid DNA, 75 ng / uL human genomic nucleic acid, 100 ng / uL cytomegalovirus (CMV) nucleic acid, 50 ng / uL herpes simplex virus type 1 (HSV-1) nucleic acid, and 75 ng / uL herpes simplex virus type 2 (HSV-2) nucleic acid as templates, a 2.5 × 10⁻⁶ μg / μL plasmid DNA, 75 ng / uL 2 The plasmid DNA of copies / uL was used as a positive control template. The specificity of the nine primer combinations was further verified using the above amplification and detection methods. The detection results are shown in Table 5.

[0051] Table 5. Specificity verification results of the 9 primer combinations Note: "+" indicates detected; "-" indicates not detected. The results in Table 5 show that only the asymmetric primer ERA detection system constructed with primer pairs F1R1, F3R1, and F3R2 can specifically detect EB virus genes, without cross-reactivity with human genomic nucleic acids, CMV, HSV-1, and HSV-2 nucleic acids. Among them, the asymmetric primer ERA detection system with primer pair F3R1 has the best detection sensitivity and amplification efficiency. Therefore, primer pair F3R1 is the preferred choice.

[0052] II. Probe Screening Based on the primer pair (F3R1) obtained through the above screening, this embodiment further verified the specificity, sensitivity, and detection efficiency of probe BP1. Three probes for ERA-specific amplification of specific regions were designed as shown in Table 6. These probes were combined with primer pair F3R1, and 50 μL amplification reaction systems and 5 μL detection systems were constructed according to the components and amounts shown in Tables 2 and 3, respectively. Detection was performed according to the amplification and detection steps, and the comparison results of detection efficiency are as follows: Figure 2 As shown, the templates used for sensitivity and specificity verification are the same as those used for primer sensitivity and specificity verification. The comparison results are shown in Tables 7 and 8.

[0053] Table 6 Probe screening for EB virus genes Table 7. Sensitivity verification results of the three probes. Note: "+" indicates detected; "-" indicates not detected. Table 8. Specificity verification results of the three probes Note: "+" indicates detected; "-" indicates not detected. As shown in the fluorescence curves, the fluorescence signal growth rate of probe BP1 is higher than that of other probes, and the slope of fluorescence growth is the highest, indicating that probe BP1 has the best detection efficiency when used to detect EB virus genes. The results in Tables 7 and 8 show that only the asymmetric ERA detection system based on probe BP1 achieves a detection sensitivity of 10 copies / μl, and can specifically detect EB virus genes, without cross-reactivity with human genomic nucleic acids, CMV, HSV-1, and HSV-2 nucleic acids, indicating that this detection system has the best sensitivity and specificity. Therefore, probe BP1 is the preferred choice.

[0054] Example 2: Sensitivity and specificity verification of the asymmetric ERA detection system provided by the present invention Based on the primer pair F3R1 and probe BP1 screened in Example 1, the optimal asymmetric ERA detection system provided by this invention was constructed. This example further examines the sensitivity and specificity of this asymmetric ERA detection system for EB virus gene detection.

[0055] I. Sensitivity Verification The sensitivity validation of the asymmetric ERA detection system was performed according to the amplification reaction system shown in Table 2 and the detection system shown in Table 3 of Example 1. The template in the amplification reaction system was EB virus plasmid DNA diluted to different concentrations, with EB virus plasmid concentrations of 10-1... 3 copies / uL, 500 copies / uL, 10 2 Plasmids at concentrations of 50 copies / uL, 10 copies / uL, and 5 copies / uL were used as positive templates, with water as the negative template. The loading volume for each template was 2 uL. The amplification and detection steps were the same as in Example 1, and the detection results were as follows: Figure 3 As shown.

[0056] pass Figure 3 The results show that when the asymmetric primer ERA detection system based on primer pair F3R1 and probe BP1 is used to detect EB virus genes, 5 copies / uL of plasmid template can be detected in the reaction, indicating that the detection system and method have high sensitivity when used for EB virus detection.

[0057] II. Specificity Validation The specificity verification of the asymmetric ERA detection system was performed according to the amplification reaction system shown in Table 2 and the detection system shown in Table 3 of Example 1. The template in the amplification reaction system was 2.5 × 10⁻⁶. 2 Using plasmid DNA copies / uL, human genomic nucleic acid 75 ng / uL, and CMV nucleic acid as templates, at a concentration of 2.5 × 10⁻⁶, the sample was processed. 2 Plasmid DNA copies / µL served as a positive control template, with each template loaded at a volume of 2 µL. The amplification and detection procedures were the same as in Example 1. The detection results are as follows: Figure 4 As shown.

[0058] It can be seen that only the plasmid DNA showed a linear increase in fluorescence value, while the templates of human genomic nucleic acid and CMV nucleic acid did not show fluorescence growth. This indicates that the asymmetric primer ERA detection system and method constructed based on primer pair F3R1 and probe BP1 can only specifically detect EB virus genes, and has no cross-reaction with human genomic nucleic acid and CMV nucleic acid. This shows that the asymmetric primer ERA detection system and method provided by this invention has good specificity.

[0059] Example 3: Screening of reagents for isothermal amplification of nucleic acid Compared to asymmetric primer PCR, asymmetric primer ERA detection technology faces complex challenges in primer and probe design. Furthermore, because the ERA detection system relies on a multi-enzyme system (recombinase, polymerase, etc.), unequal primer amounts can disrupt enzyme synergy, leading to decreased single-strand yield. Therefore, the selection of reaction reagents in the amplification system is crucial. This example further investigates the effects of recombinase, DNA polymerase, and the energy regeneration system for maintaining ATP concentration in the asymmetric ERA detection system on the asymmetric ERA detection system, validating the necessity of using the amplification reaction system shown in Table 2. The construction of the asymmetric ERA detection system is basically the same as Tables 2 and 3 of Example 1, except that the recombinase, DNA polymerase, and energy regeneration substances are the reagents shown in Table 9, and the amplification and detection steps are the same as in Example 1. The templates for sensitivity and specificity verification are the same as those used in the primer sensitivity and specificity verification of Example 1, and the detection results are shown in Tables 10 and 11.

[0060] Table 9 Test Combinations for Nucleic Acid Isothermal Amplification Reagents Table 10 Sensitivity verification results for the four test combinations Note: "+" indicates detected; "-" indicates not detected. Table 11 Specificity verification results of the four test combinations Note: "+" indicates detected; "-" indicates not detected. As shown in Tables 10 and 11, among the asymmetric primer ERA detection systems constructed based on the four amplification reagent combinations, only combinations 1 and 4 could specifically detect the EB virus gene, but not human genomic nucleic acid, CMV, HSV-1, and HSV-2 nucleic acid. Only combination 1 achieved a detection sensitivity of 10 copies / μL, while combination 4's detection sensitivity was only up to 10 copies / μL. 2 The results suggest that the ratio of copies / μL may be due to the fact that, compared to RecA recombinase, the phage UvsX protein, with the assistance of UvsY protein, forms a more stable recombinase-primer complex, significantly improving the efficiency of single-stranded DNA invading the double-stranded template. Simultaneously, the large fragment of Klenow polymerase provides high fidelity, enhancing amplification accuracy and avoiding non-specific amplification. Furthermore, the phosphocreatine / creatine kinase system provides a more sustained and gradual ATP regeneration capacity than the phosphoenolpyruvate / pyruvate kinase system, preventing energy depletion in the later stages of the reaction and further improving amplification efficiency and sensitivity.

[0061] In summary, when the asymmetric primer ERA detection system provided by this invention uses bacterial UvsX protein and bacteriophage UvsY protein, a large fragment of Klenow polymerase, and a phosphocreatine / creatine kinase system as amplification reagent, the system significantly improves the specificity, sensitivity, and amplification efficiency of asymmetric primer ERA detection through the synergistic effect of highly efficient recombinase combination, high-fidelity polymerase, and stable energy system.

[0062] Example 4: Optimization of Asymmetric Primer Concentration Ratio The detection principle of the asymmetric ERA detection system is similar to that of conventional ERA technology, the difference being the unequal concentrations of upstream and downstream primers. In the early stages of amplification, the presence of both primers allows for normal double-stranded DNA synthesis, resulting in exponential product growth. As the reaction progresses, the low-concentration primers are gradually depleted, while the high-concentration primers continue to guide single-stranded DNA synthesis, ultimately producing primarily single-stranded DNA synthesized under the guidance of the high-concentration primers. A fluorescent probe is then introduced into the amplification product. The specific probe binds to the single-stranded target sequence, forming a specific local double strand. Specific exonucleases in the reaction system recognize the specific DNA double strand bound to the probe and cleave the probe at specific sites. The fluorescent and quenching groups on the probe are separated, generating a fluorescence signal proportional to the amount of target DNA amplified; the fluorescence intensity increases with amplification. Therefore, the ratio of upstream to downstream primers significantly affects the sensitivity and specificity of the detection method. Therefore, this embodiment further investigated the effect of primer ratio in the amplification reaction system on the detection results. The amplification reaction system was constructed using the four upstream and downstream primer concentrations shown in Table 12. The other reagents and dosages were the same as those in Tables 2 and 3 of Example 1. The sensitivity and specificity of the detection system were verified using the same method as in Example 2. The detection results are shown in Tables 12 and 13.

[0063] Table 12 Sensitivity Validation Results of Asymmetric Primers Note: "+" indicates detected; "-" indicates not detected. Table 13 Specificity validation results of asymmetric primers Note: "+" indicates detected; "-" indicates not detected. As shown in Tables 12 and 13, among the four primer concentration ratio detection systems, test group 4 failed to detect the EB virus gene, while test groups 1-3 could only specifically detect the EB virus gene, without detecting human genomic nucleic acid or CMV nucleic acid. Only test group 2 (upstream primer 21 nM, downstream primer 630 nM, i.e., upstream / downstream primer concentration ratio of 1:30) achieved a detection sensitivity of 5 copies / µL, indicating that the detection system at this concentration ratio had the best amplification efficiency, high sensitivity, and good specificity. This is because when the restriction primer ratio is too high (test group 1), template resources are consumed prematurely, resulting in a large amount of double-stranded DNA and insufficient amplification of the target single-stranded DNA, reducing the single-stranded yield. Consequently, insufficient single-stranded DNA binds to the fluorescent probe, reducing amplification efficiency and sensitivity. Conversely, when the restriction primer ratio is too low (test groups 3 and 4), it is exhausted prematurely, leaving a large amount of unused template and non-restriction primers. Insufficient template during the single-stranded amplification stage affects the specificity and sensitivity of the amplification. In summary, the optimal concentration ratio of upstream and downstream primers in the asymmetric ERA detection system is 1:30.

[0064] Example 5: Optimization of reaction systems for different sample types Because Epstein-Barr virus (EBV), as a herpesvirus, has a genome length of 172kb and contains numerous homologous sequences with other herpesviruses such as CMV and HSV-1 / 2, its genome is complex and subject to strong homology interference. Furthermore, in clinical testing, a variety of samples are used for EBV detection, including blood, nasopharyngeal swabs, tissue, and saliva. Nasopharyngeal swabs contain mucus, and tissue samples contain protein impurities, both of which inhibit amplification reactions, making the detection process more complex than blood-only testing. Therefore, the detection system must possess excellent anti-interference capabilities. To effectively overcome mucus interference in nasopharyngeal swab / saliva samples and protein impurities in tissue samples, and to avoid cross-reactions, thereby improving the sensitivity and specificity of the asymmetric ERA method for EBV detection, this embodiment further optimizes the components of the reaction system for different sample types. The specific scheme is as follows: I. Reaction system for nasopharyngeal swabs / saliva samples containing mucus 1. Sample Collection: Twenty clinical nasopharyngeal swab samples were collected (10 positive and 10 negative for EBV DNA, verified by qPCR), 20 saliva samples were collected (10 positive and 10 negative, verified by qPCR), and positive plasmids for human cytomegalovirus (CMV) and herpes simplex virus type 1 / 2 (HSV-1 / 2) were collected at a concentration of 10. 3 Copies / μL, stored at -80°C. All samples were extracted using a nucleic acid extraction kit according to the instructions. The extracted nucleic acid template volume was 2 μL, which was used for the amplification reaction.

[0065] 2. Preparation of the reaction system: Based on the primers, probes (primer pair F3R1 and probe BP1) and asymmetric ERA reaction systems screened in Example 1 (Tables 2 and 3), the reaction systems were further optimized, and the following 6 comparison groups were established: Group A (Standard System): The same primers (F3R1), probes (BP1), reaction system, and detection system as in Example 1 were used; Group B (Optimized System): Hyaluronidase (final concentration 50 U / mL) and Triton X-100 (final concentration 0.05% v / v) were added to the standard reaction system premix solution of Example 1 (Table 2). Group C: Hyaluronidase (final concentration 50 U / mL) was added to the standard reaction system premix solution of Example 1 (Table 2). Group D: Triton X-100 (final concentration 0.05% v / v) was added to the standard reaction system premix solution of Example 1 (Table 2). Group E: In the standard reaction system premix of Example 1 (Table 2), additional streptase E (final concentration 30 U / mL) and Triton X-100 (final concentration 0.05% v / v) were added. Group F: Hyaluronidase (final concentration 50 U / mL) and Tween-20 (final concentration 0.05% v / v) were added to the standard reaction system premix solution of Example 1 (Table 2).

[0066] The information for the core reagents mentioned above is as follows: Hyaluronidase was purchased from Sigma-Aldrich, catalog number H3506; Triton X-100 was purchased from Amresco, catalog number 0694; Tween-20 was purchased from Sigma-Aldrich, catalog number P1379; Streptomycin E was purchased from Roche, catalog number 11047835001.

[0067] The premixed reaction tubes with added template were incubated in a 42℃ metal bath for 15 min. After inverting and mixing the tubes 7-10 times, they were then inserted into a fluorescence isothermal amplification instrument (Syndagene, GS8) with a preset temperature of 42℃ for 5 min of fluorescence signal acquisition. The sample detection rate and minimum detection concentration were compared among the groups to assess the sensitivity of the method. The specificity of the method was assessed by the cross-reactivity rate, calculated as: cross-reactivity rate = (number of false positive samples / total number of interfering samples tested) × 100%. The detection results are shown in Table 14.

[0068] Table 14 Comparison of test results from different groups of nasopharyngeal swab / saliva samples The results in Table 14 show that the standard system (Group A) has significant limitations in both types of samples. The positive detection rate for nasopharyngeal swabs is only 70%, while for saliva samples it is 80%, with minimum detection concentrations of 50 copies / uL and 20 copies / uL, respectively. A 10% cross-reactivity rate is also observed, indicating that the mucus component in the samples significantly inhibits nucleic acid release and enzymatic reactions. The optimization effect of the single-reagent addition groups (Groups C and D) is limited, only increasing the positive detection rate of nasopharyngeal swabs to 70%-90%, while the minimum detection concentration remains at 20-35 copies / uL. The cross-reactivity rate is not effectively improved, confirming that a single reagent cannot simultaneously address multiple issues such as mucus degradation, nucleic acid stability, and anti-interference.

[0069] Compared to the standard system (Group A), the optimized system (Group B) improved the detection rate of nasopharyngeal swab positive samples from 70% to 100%, and reduced the minimum detection concentration from 50 copies / uL to 5 copies / uL; for saliva positive samples, the detection rate improved from 80% to 100%, and the minimum detection concentration decreased from 20 copies / uL to 5 copies / uL. Furthermore, no cross-reactivity was observed with human cytomegalovirus nucleic acid and herpes simplex virus type 1 / 2 nucleic acid. While the other two dual-reagent combinations (Group E and Group F) showed some improvement over the single-reagent groups, they still had limitations. For example, the minimum detection concentration of Group E was 10 copies / uL, and the positive detection rate of nasopharyngeal swabs in Group F was only 80%, with a cross-reactivity rate still reaching 6.7%. This result fully demonstrates that introducing specific auxiliary components hyaluronidase and Triton X-100 into the asymmetric ERA reaction system not only ensures the full release of nucleic acids but also avoids interference with enzyme activity in the ERA system. This effectively breaks through the detection bottleneck of mucus-containing samples, significantly improves the detection rate of EBV DNA in real clinical samples, and enhances the anti-interference ability of the detection system.

[0070] II. Reaction system for tissue samples containing protein impurities 1. Sample Collection: Nasopharyngeal tissue samples were collected from surgically removed 15 patients with nasopharyngeal carcinoma. Pathological examination confirmed that the tissues were EBV-related. Five non-tumor nasopharyngeal tissue samples were also collected as negative controls. Positive plasmids for human cytomegalovirus (CMV) and herpes simplex virus type 1 / 2 (HSV-1 / 2) were also collected at a concentration of 10-1. 3 Copies / μL, stored at -80°C. All samples were extracted using a nucleic acid extraction kit according to the instructions. The extracted nucleic acid template volume was 2 μL, which was used for the amplification reaction.

[0071] 2. Preparation of the reaction system: Based on the primers, probes (primer pair F3R1 and probe BP1) and asymmetric ERA reaction systems screened in Example 1 (Tables 2 and 3), the reaction systems were further optimized, and the following 6 comparison groups were established: Group G (Standard System): The same (F3R1), probe (BP1), reaction system, and detection system as in Example 1 are used; Group H (Optimized System): Proteinase K (final concentration 100 ng / uL) and BSA (final concentration 2 mg / ml) were added to the standard reaction system premix solution of Example 1 (Table 2).

[0072] Group I: Proteinase K (final concentration 100 ng / uL) was added to the standard reaction system premix solution of Example 1 (Table 2). Group J: BSA (final concentration 2 mg / ml) was added to the standard reaction system premix solution (Table 2) of Example 1. Group K: In the standard reaction system premix of Example 1 (Table 2), trypsin (final concentration 80 ng / uL) and BSA (final concentration 2 mg / ml) were added. Group L: Proteinase K (final concentration 100 ng / uL) and glycerol (final concentration 5% v / v) were added to the standard reaction system premix of Example 1 (Table 2).

[0073] The information for the core reagents mentioned above is as follows: Proteinase K was purchased from Thermo Fisher Scientific, catalog number EO0491; trypsin was purchased from Sigma-Aldrich, catalog number T4799; BSA was purchased from Solarbio, catalog number A8010; and glycerol was purchased from Amresco, catalog number G8761.

[0074] The premixed reaction tubes with added template were incubated in a 42℃ metal bath for 15 min. After inverting and mixing the tubes 7-10 times, they were then inserted into a fluorescence isothermal amplification instrument (Syndagene, GS8) with a preset temperature of 42℃ for 5 min of fluorescence signal acquisition. The sample detection rate and minimum detection concentration were compared among the groups to assess the sensitivity of the method. The specificity of the method was assessed using the cross-reactivity rate, calculated as: cross-reactivity rate = (number of false positive samples / total number of interfering samples tested) × 100%. The detection results are shown in Table 15.

[0075] Table 15 Comparison of detection results of different groups of nasopharyngeal tissue samples The detection data from tissue samples showed that the positive detection rate of the standard system (Group G) was only 66.7%, with a minimum detection concentration as high as 100 copies / uL and a cross-reactivity rate of 15%, reflecting the strong inhibitory effect of abundant protein impurities in tissues on the amplification reaction. The improvement effects of single-reagent addition groups (Group I and Group J) were limited. Group I, which only added proteinase K, had a positive detection rate of 73.3% and a minimum detection concentration of 50 copies / uL. Group J, which only added BSA, still had a minimum detection concentration of 80 copies / uL, indicating that protein degradation or enzyme protection alone could not completely eliminate the detection interference from tissue samples. In the dual-reagent combination, Groups K and L also failed to achieve ideal results. Group K had a minimum detection concentration of 50 copies / uL due to the substrate specificity of trypsin. Although Group L reduced the minimum detection concentration to 30 copies / uL, the positive detection rate was only 86.7%, and the cross-reactivity rate was still 5%. The optimized system (Group H) of this invention exhibited the best performance, achieving 100% detection in 15 positive tissue samples, with the lowest detection concentration reduced to 10 copies / uL and a cross-reactivity rate of 0%. This indicates that the combined use of protein K, proteinase K, and BSA provides optimal protection for key enzyme components while efficiently degrading tissue protein impurities, thereby significantly overcoming amplification inhibition caused by tissue samples.

[0076] In summary, this invention introduces specific auxiliary reagents to address two common types of complex samples in EB virus clinical testing—mucus-containing samples and protein-rich samples. This fundamentally improves the sensitivity, specificity, and robustness of the asymmetric ERA detection system in detecting complex clinical samples, solves key technical obstacles in detecting EB virus in samples from different sources, and is applicable to diverse clinical scenarios.

[0077] Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.

Claims

1. An asymmetric primer set for detecting EB virus, characterized in that, It includes an upstream primer, a downstream primer, and a probe, wherein the upstream primer has the nucleotide sequence shown in SEQ ID NO.3; the downstream primer has the nucleotide sequence shown in SEQ ID NO.4; and the probe has the nucleotide sequence shown in SEQ ID NO.

7.

2. A nucleic acid detection system for Epstein-Barr virus (EBV), characterized in that, Includes the asymmetric primer set and nucleic acid isothermal amplification reaction reagent as described in claim 1.

3. The nucleic acid detection system as described in claim 2, characterized in that, The nucleic acid isothermal amplification reaction reagents are isothermal reaction reagents containing recombinases, such as RPA, ERA, and RAA.

4. The nucleic acid detection system as described in claim 3, characterized in that, The nucleic acid isothermal amplification reaction reagent also includes phosphocreatine kinase, creatine kinase, and a large fragment of Klenow polymerase.

5. The nucleic acid detection system as described in claim 4, characterized in that, The nucleic acid isothermal amplification reaction reagents include tris(hydroxymethyl)aminomethane-acetic acid buffer, potassium acetate, magnesium acetate, dithiothreitol, polyethylene glycol, ATP, phosphatidylinosylphosphatase, creatine kinase, phage uvsX protein, phage uvsY protein, Klenow polymerase large fragment, exonuclease III, and dNTPs.

6. The nucleic acid detection system as described in claim 4, characterized in that, The nucleic acid isothermal amplification reaction reagent includes tris(hydroxymethyl)aminomethane-acetic acid buffer, potassium acetate, magnesium acetate, dithiothreitol, polyethylene glycol, ATP, phosphatase, creatine kinase, phage uvsX protein, phage uvsY protein, Klenow polymerase large fragment, exonuclease III, dNTPs, hyaluronidase, and Triton X-100; the nucleic acid detection system is used for the detection of nasopharyngeal swab samples and saliva samples.

7. The nucleic acid detection system as described in claim 4, characterized in that, The nucleic acid isothermal amplification reaction reagent includes tris(hydroxymethyl)aminomethane-acetic acid buffer, potassium acetate, magnesium acetate, dithiothreitol, polyethylene glycol, ATP, phosphatase, creatine kinase, bacteriophage uvsX protein, bacteriophage uvsY protein, Klenow polymerase large fragment, exonuclease III, dNTPs, proteinase K, and BSA; the nucleic acid detection system is used for the detection of nasopharyngeal tissue samples.

8. A method for detecting EB virus using the asymmetric primer set of claim 1 or the nucleic acid detection system of any one of claims 2-7, characterized in that, Includes the following steps: S1: Premixed reagent for constructing the template nucleic acid amplification reaction system; S2: Insert the premixed reagent tube into the fluorescence isothermal amplification instrument to carry out the amplification reaction.

9. The detection method as described in claim 8, characterized in that, The concentration ratio of upstream primer to downstream primer in the nucleic acid amplification reaction system described in step S1 is 1:(5-100); the temperature of the amplification reaction described in step S2 is 37~45℃ and the time is 20~30min.

10. The use of an asymmetric primer set for preparing an ERA amplification detection reagent to improve the sensitivity of EB virus nucleic acid detection, characterized in that, The asymmetric primer set includes an upstream primer, a downstream primer, and a probe, wherein the upstream primer has the nucleotide sequence shown in SEQ ID NO.3; the downstream primer has the nucleotide sequence shown in SEQ ID NO.4; and the probe has the nucleotide sequence shown in SEQ ID NO.7.

Images