A method and application for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material.

By optimizing the umbilical cord mesenchymal stem cell culture system and enzymatic purification technology, a highly efficient humanized collagen was prepared, solving the preparation problems in the existing technology and realizing the production of efficient, safe and low-cost humanized collagen.

CN122080176APending Publication Date: 2026-05-26BASHANHONG (BEIJING) PHARMACEUTICAL TECHNOLOGY CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
BASHANHONG (BEIJING) PHARMACEUTICAL TECHNOLOGY CO LTD
Filing Date
2026-01-29
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

Existing technologies for preparing humanized collagen suffer from problems such as raw material scarcity, ethical controversies, pathogen infection risks, high production costs, low expression efficiency, and insufficient product activity, resulting in significant limitations in biocompatibility and functional activity.

Method used

Using umbilical cord mesenchymal stem cells, by optimizing the cell culture system and induction conditions, collagen synthesis-related genes are activated. Combined with serum-free culture medium and three-dimensional culture technology, extracellular matrix components are used to assist collagen in forming a natural triple helix structure. Using induction culture medium with specific additives such as TGF-β1, β-FGF, EGF, ascorbic acid and dexamethasone, combined with pepsin enzymatic hydrolysis and purification steps, highly efficient humanized collagen is prepared.

Benefits of technology

It achieves efficient secretion and self-assembly of collagen, retains the natural triple helix structure of the product, has better biocompatibility than gene recombination products, reduces the risk of pathogen transmission, is suitable for large-scale production, and reduces costs by 45% compared to gene recombination technology.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122080176A_ABST
    Figure CN122080176A_ABST
Patent Text Reader

Abstract

This invention discloses a method and application for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material, belonging to the field of biomaterial preparation technology. The key technical points of the method are as follows: S1, processing and passage-expanding umbilical cord tissue; S2, seeding the expanded umbilical cord mesenchymal stem cell suspension into a culture dish, then adding DMEM / F12 medium containing platelet lysis buffer for culture, followed by induction medium to obtain extracellular matrix; S3, enzymatically hydrolyzing the extracellular matrix, centrifuging the hydrolysate to obtain the supernatant, adjusting the pH, allowing it to stand, centrifuging again to obtain the precipitate, reconstituteing the precipitate, purifying it, centrifuging again, and then lyophilizing it; S4, forming the formulation to achieve efficient secretion and self-assembly of collagen, while utilizing extracellular matrix components (such as fibronectin and laminin) secreted by umbilical cord mesenchymal stem cells to assist collagen in forming an active product with a natural triple helix structure.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomaterial preparation technology, and in particular to a method and application for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material. Background Technology

[0002] Humanized collagen is a type of collagen synthesized through biotechnology. Its amino acid sequence is completely identical to that of natural human collagen, thus possessing the same biological functions and triple helix structure. This technology avoids the immunogenicity risks associated with traditional animal-derived collagen, providing a safer and purer ingredient.

[0003] Traditional methods for preparing humanized collagen mainly rely on human tissue extraction or gene recombination technology. Among these, human tissue extraction methods face challenges such as limited raw material sources, ethical controversies, and potential risks of pathogen infection. Direct human tissue extraction methods often rely on surgical waste (such as placenta and dermis), which are subject to raw material scarcity (<1kg tissue / ton of collagen), ethical compliance reviews (especially involving fetal tissue), and high costs for pathogen screening (false negative rate of latent viruses such as HIV / HBV >0.1%). Although gene recombination technology can achieve planned production, it suffers from problems such as low expression efficiency, insufficient product activity, and high production costs. While gene recombination expression methods have achieved theoretical large-scale production (e.g., CHO cells, E. coli systems), they suffer from an "activity-yield" paradox, specifically: 1. Although the eukaryotic system (CHO / HEK293) can fold into a triple helix structure, the production cycle is long (>14 days), the yield is low (<500 mg / L), and purification losses can reach up to 40%; 2. Although the prokaryotic system (E. coli) increases yield (>2 g / L), it lacks post-translational modifications (such as hydroxyprolylation), resulting in poor collagen thermal stability (denaturation temperature <30℃) and weak enzymatic tolerance, leading to loss of biological activity. Therefore, collagen prepared using existing technologies still has significant limitations in terms of biocompatibility, functional activity, and preparation efficiency. Summary of the Invention

[0004] To address the problems in the prior art, this invention provides a method and application for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cells (UC-MSCs). Due to their unique biological characteristics, UC-MSCs have become a key carrier for collagen production. Based on the multi-lineage differentiation potential and paracrine function of UC-MSCs, this application optimizes the cell culture system and induction conditions to activate the expression of collagen synthesis-related genes (such as COL1A1 and COL3A1) in UC-MSCs. Combined with serum-free culture medium and three-dimensional culture technology, efficient secretion and self-assembly of collagen are achieved. At the same time, the extracellular matrix components (such as fibronectin and laminin) secreted by UC-MSCs are used to assist collagen in forming an active product with a natural triple helix structure.

[0005] The first aspect of this invention is to provide a method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material, employing the following technical solution: A method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material includes the following steps: S1. Process and passage umbilical cord tissue for amplification; S2. The expanded umbilical cord mesenchymal stem cell suspension was seeded into an ultra-low adsorption culture dish, and then cultured in DMEM / F12 medium containing 10% platelet lysis buffer. After that, the culture was changed to induction medium to obtain extracellular matrix. The induction medium included DMEM / F12 basal medium containing 1-5% platelet lysis buffer, 10-50 ng / mL TGF-β1, 10-50 ng / mL β-FGF, 50-250 ng / mL EGF, 50-250 μg / mL ascorbic acid, and 1-5 × 10-8 M dexamethasone. S3. Extraction and purification of collagen: Pepsin solution is added to the extracellular matrix for enzymatic hydrolysis. After centrifugation of the hydrolysate, the supernatant is collected, the pH is adjusted to 7-8, and the mixture is allowed to stand. After centrifugation, the precipitate is collected, reconstituted, purified, centrifuged, and then freeze-dried. S4, Formulation.

[0006] In a preferred embodiment, the induction culture medium comprises DMEM / F12 basal medium containing 1-5% platelet lysis buffer, 10-20 ng / mL TGF-β1, 10-20 ng / mL β-FGF, 50-100 ng / mL EGF, 50-100 μg / mL ascorbic acid, and 1-2 × 10⁻⁸ M dexamethasone.

[0007] In a preferred embodiment, the induction medium further includes 0.5-2 μmol / mL sodium selenite.

[0008] By employing the above-mentioned technical solutions, the conditions of the humanized induction culture medium have a significant impact on collagen synthesis. Different additives and concentrations may lead to insufficient or difficult collagen synthesis. In this application, when umbilical cord mesenchymal stem cells are selected as the material for collagen synthesis, the matrix metalloproteinase inhibitor (TIMP-1) secreted by them can prevent collagen degradation. At the same time, this application uses platelet lysis buffer instead of fetal bovine serum in the induction culture medium to effectively eliminate heterologous protein contamination. The addition of TGF-β1 can activate the Smad signaling pathway, ascorbic acid promotes proline hydroxylation, sodium selenite scavenge free radicals and reduce oxidative stress damage to collagen synthesis-related enzymes (such as proline hydroxylase), β-FGF and EGF support tissue construction by promoting cell proliferation, differentiation and extracellular matrix synthesis, and dexamethasone regulates cellular metabolic homeostasis. Therefore, the rational optimization of the addition of TGF-β1, β-FGF, EGF, ascorbic acid, dexamethasone, sodium selenite, and the amount of each substance effectively increases collagen secretion, while the culture cycle is also relatively shortened, which facilitates process development and meets production needs.

[0009] In a preferred embodiment, the concentration of the pepsin solution is 1-2 mg / mL and the enzymatic hydrolysis conditions are 24 h at room temperature, or the concentration of the pepsin solution is 4 mg / mL and the enzymatic hydrolysis conditions are 12 h at room temperature.

[0010] In a preferred embodiment, the pepsin solution contains 0.03M hydrochloric acid solution.

[0011] In a preferred embodiment, the enzymatic hydrolysis conditions are as follows: the concentration of the pepsin solution is 1-2 mg / mL, and the enzymatic hydrolysis is carried out at 37°C for 6-12 hours.

[0012] By adopting the above technical solution, the concentration of pepsin solution and the enzymatic hydrolysis conditions have a significant impact on the yield of collagen. This application effectively improves the yield of collagen by optimizing the concentration of pepsin solution and the enzymatic hydrolysis conditions.

[0013] In a preferred embodiment, in step S3, the volume ratio of extracellular matrix to pepsin solution is 500:1.

[0014] By adopting the above technical solution, when the volume ratio of extracellular matrix to pepsin solution is 500:1, the extraction yield of collagen can be effectively increased, ensuring complete collagen extraction. If the ratio of extracellular matrix to pepsin is too low, pepsin residue will occur. When enzyme residue occurs, it will digest other non-target proteins in the extracellular matrix, increasing the difficulty and burden of the subsequent purification process, ultimately leading to a decrease in the purity of collagen. If the ratio is too high, incomplete collagen extraction will occur, reducing the extraction yield.

[0015] In a preferred embodiment, the umbilical cord tissue in step S1 is expanded to the third generation for future use.

[0016] The second aspect of the present invention is to provide an application of humanized collagen obtained by the method described above for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material in the preparation of medical and cosmetic products, wound repair materials, bone tissue healing materials, biocomposite materials, cosmetics or skin care products.

[0017] In summary, the present invention has the following beneficial effects: This application utilizes human umbilical cord mesenchymal stem cells (umbilical cord mesenchymal stem cells) to secrete humanized umbilical cord mesenchymal stem cell collagen. Compared to recombinant collagen, it is closer to the natural human microenvironment, is synthesized autonomously by cells, retains complete biological activity signaling pathways, and the triple helix structure of the obtained humanized collagen is consistent with the human body's own collagen, thereby avoiding rejection of foreign proteins. Furthermore, the humanized umbilical cord mesenchymal stem cell collagen obtained in this application has multi-dimensional activity, such as the synergistic promotion of cell regeneration by collagen secreted by umbilical cord mesenchymal stem cells and growth factor TGF-β1, thereby accelerating tissue repair and significantly improving repair efficiency compared to recombinant collagen.

[0018] Furthermore, the extraction of human cells differs from that of tissues. Cells are denser and more viscous, making the extraction process more complex or specialized, and thus unsuitable for direct tissue replacement. This application optimizes the three-dimensional cell culture system and induction conditions, increasing collagen secretion efficiency by more than three times, shortening the preparation cycle, and ensuring the product retains its natural triple helix structure and cell binding sites, exhibiting significantly better biocompatibility than recombinant gene products. In addition, the humanized umbilical cord mesenchymal stem cell collagen obtained in this application contains no animal-derived components, reducing the risk of pathogen transmission, meeting medical device GMP standards, and reducing unit production costs by 45% compared to recombinant gene technology, making it suitable for large-scale production. Attached Figure Description

[0019] Figure 1 This is a comparison diagram of the expression levels of COL1A1 and COL1A3 in collagen obtained from step S2 in Example 2 of this application.

[0020] Figure 2 This is a phenotypic diagram of mice 9 days after injury in an in vitro animal experiment. Detailed Implementation

[0021] The present invention will be further described in detail below with reference to the accompanying drawings. All reagents, unless otherwise specified, are commercially available conventional reagent products. Example 1

[0022] A method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material includes the following steps: S1. Isolation and expansion of umbilical cord mesenchymal stem cells Umbilical cord tissue from healthy newborns was collected and stored at 4°C. It was then washed for 10-15 minutes in a solution containing 0.05-0.1% benzalkonium bromide to thoroughly remove residual blood. The tissue was rinsed and disinfected until colorless. The umbilical cord tissue was then removed in a laminar flow hood, the amnion and arteries / venous vessels were removed, and residual benzalkonium bromide was repeatedly rinsed with sterile saline. Finally, the umbilical cord tissue was cut into 1mm pieces. 2 Digest with 0.1% collagenase type II at 37°C for 2 hours, then seed at a density of 5 × 10⁶ cells / year. 4 The cells / cm² were passaged at a ratio of 1:3 to expand to the 3rd generation for later use; S2, Three-dimensional induction culture Umbilical cord mesenchymal stem cells expanded to the third generation were prepared into a suspension and seeded into ultra-low adsorption culture dishes for suspension culture at a seeding density of 4 × 10⁶ cells / day. 5 Then, add DMEM / F12 medium containing 10% platelet lysis buffer (Pall, 15950-017) and culture continuously for 3 days. After that, change to induction medium and culture in an incubator at 37℃ and 5% CO2. Change the medium every two days and culture continuously for 15-20 days to obtain cell tissue spheres. The induction culture medium included DMEM / F12 basal medium containing 1% platelet lysis buffer, 10 ng / mL TGF-β1, 10 ng / mL β-FGF, 50 ng / mL EGF, 50 μg / mL ascorbic acid, and 10 -8 M's dexamethasone; S3. Collagen Extraction and Purification S3.1 Add pepsin solution (1 mg / mL pepsin concentration, solution system containing 0.03 M hydrochloric acid) at a volume ratio of 500:1 (wet weight of decellularized matrix to enzyme). After enzymatic hydrolysis at room temperature for 24 h, centrifuge the hydrolysate at 5000 rpm for 15 min and collect the supernatant (the precipitate can be further hydrolyzed with hydrochloric acid and pepsin). Adjust the pH of the supernatant to 7.0-8.0 with 1 M NaOH, stir for 5-10 min, let stand for 30 min, and then centrifuge at 5000 rpm for 15 min and collect the precipitate. S3.2. Redissolve the precipitate with 0.03M hydrochloric acid and stir for 5-10 minutes. Purify the redissolved liquid by ultrafiltration using an ultrafiltration tube. After purification and filtration, let it stand overnight at 4℃. Neutralize the pH to 7.0-8.0 with 1M NaOH, let it stand for 30 minutes, and centrifuge to collect the precipitate. S3.3, The precipitate obtained in step S3.2 is directly freeze-dried; S4, Formulation Pour the reconstituted collagen solution into freeze-drying trays or vials, controlling the solution thickness to 5-15mm (too thick a solution will prolong sublimation time and may result in an incomplete "sandwich" of the product; too thin a solution will make the product prone to breakage). After dispensing, quickly transfer the solution to the pre-cooling zone to prevent microbial growth caused by room temperature exposure. Finally, place the solution into a freeze dryer for freeze-drying under the following conditions: stage Temperature range vacuum degree Processing time Core Objectives Preprocessing 20-25℃ / 1-2h The liquid is refined and evenly packaged. freeze ﹣40~﹣50℃ / 2-4h It forms tiny ice crystals and solidifies completely. First sublimation drying ﹣40~﹣10℃ 10-30Pa 12-24h Remove 80-90% of free water Secondary analysis and drying 30-45℃ 10-20Pa 4-8h Remove bound water; moisture content ≤3%. Post-processing 20-25℃ Nitrogen purging / vacuum 0.5-1h Sealed packaging to prevent moisture absorption. The lyophilized purified product is mixed with sodium hyaluronate at a mass ratio of (1-10):1 to prepare a gel or microsphere formulation. Example 2

[0023] A method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material differs from Example 1 in that the amount of each substance added to the induction culture medium in step S2 is different. Specifically, the medium contains DMEM / F12 with 2% platelet lysis buffer, 20 ng / mL TGF-β1, 20 ng / mL β-FGF, 100 ng / mL EGF, 100 μg / mL ascorbic acid, and 2 × 10⁻⁶ mol / mL β-FGF. -8 M contains dexamethasone, and everything else is the same as in Example 1. Example 3

[0024] A method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material differs from Example 1 in that the amount of each substance added to the induction culture medium in step S2 is different. Specifically, the medium contains DMEM / F12 with 3% platelet lysis buffer, 50 ng / mL TGF-β1, 50 ng / mL β-FGF, 250 ng / mL EGF, 250 μg / mL ascorbic acid, and 5 × 10⁻⁶ mol / mL β-FGF. -8 M contains dexamethasone, and everything else is the same as in Example 1. Example 4

[0025] A method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material is disclosed. The difference between this method and Example 2 is that 0.5 μmol / mL sodium selenite is added to the induction culture medium in step S2. All other steps are the same as in Example 2. Example 5

[0026] A method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material is disclosed. The difference between this method and Example 2 is that 1 μmol / mL sodium selenite is added to the induction culture medium in step S2. All other steps are the same as in Example 2. Example 6

[0027] A method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material is disclosed. The difference between this method and Example 2 is that 2 μmol / mL sodium selenite is added to the induction culture medium in step S2. All other steps are the same as in Example 2. Example 7

[0028] A method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material differs from Example 5 in that the concentration of pepsin solution in step S3 is different. Specifically, the concentration of pepsin solution is 2 mg / mL, and enzymatic hydrolysis is carried out at room temperature for 24 hours. All other steps are the same as in Example 5. Example 8

[0029] A method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material differs from Example 5 in that the concentration of pepsin solution in step S3 is different. Specifically, the concentration of pepsin solution is 4 mg / mL, and enzymatic hydrolysis is carried out at room temperature for 12 hours. All other steps are the same as in Example 5. Example 9

[0030] A method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material differs from Example 5 in that the enzymatic hydrolysis regulation in step S3 is different. Specifically, the concentration of pepsin solution is 1 mg / mL, and the enzymatic hydrolysis is carried out at 37°C for 12 h. All other steps are the same as in Example 5. Example 10

[0031] A method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material differs from Example 5 in that the concentration of pepsin solution and the enzymatic hydrolysis conditions in step S3 are different. Specifically, the concentration of pepsin solution is 2 mg / mL, and the enzymatic hydrolysis is carried out at 37°C for 6 hours. All other conditions are the same as in Example 5. Comparative Example 1

[0032] A method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material differs from Example 2 in that the amount of each substance added to the induction culture medium in step S2 is different, specifically 100 ng / mL TGF-β1, 500 μg / mL ascorbic acid, and 10 × 10⁻⁶ ppm. -8 M contains dexamethasone, and everything else is the same as in Example 2. Comparative Example 2

[0033] A method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material is disclosed. The difference between this method and Example 2 is that 5 μmol / mL sodium selenite is added to the induction culture medium in step S2. All other steps are the same as in Example 2. Comparative Example 3

[0034] A method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material differs from Example 2 in that, in step S3, the ECM (extracellular matrix) obtained in step S2 is first soaked in 0.03M hydrochloric acid at a concentration of 10 mg / mL, shaken evenly, and then left to stand overnight at 4°C. Then, pepsin solution is added. All other steps are the same as in Example 2. Comparative Example 4

[0035] A method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material differs from Example 7 in that the enzymatic hydrolysis time in step S3 is different. Specifically, the concentration of pepsin solution is 2 mg / mL, and the enzymatic hydrolysis is carried out at room temperature for 12 hours. All other steps are the same as in Example 7. Comparative Example 5

[0036] A method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material differs from Example 7 in that the concentration of pepsin solution in step S3 is different. Specifically, the concentration of pepsin solution is 4 mg / mL, and enzymatic hydrolysis is carried out at room temperature for 24 hours. All other steps are the same as in Example 7. Comparative Example 6

[0037] A method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material differs from Example 7 in that the concentration of pepsin solution in step S3 is different. Specifically, the concentration of pepsin solution is 10 mg / mL, and enzymatic hydrolysis is carried out at room temperature for 24 hours. All other steps are the same as in Example 7. Comparative Example 7

[0038] A method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material differs from Example 7 in that the concentration of pepsin solution in step S3 is different. Specifically, the concentration of pepsin solution is 10 mg / mL, and enzymatic hydrolysis is carried out at room temperature for 12 hours. All other steps are the same as in Example 7. Comparative Example 8

[0039] A method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material differs from Example 7 in that the concentration of pepsin solution in step S3 is different. Specifically, the concentration of pepsin solution is 10 mg / mL, and enzymatic hydrolysis is carried out at room temperature for 6 hours. All other steps are the same as in Example 7. Comparative Example 9

[0040] A method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material differs from Example 7 in that the concentration of pepsin solution in step S3 is different. Specifically, the concentration of pepsin solution is 4 mg / mL, and enzymatic hydrolysis is carried out at 37°C for 6 hours. All other steps are the same as in Example 7. Comparative Example 10

[0041] A method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material differs from Example 7 in that the concentration of pepsin solution in step S3 is different. Specifically, the concentration of pepsin solution is 10 mg / mL, and enzymatic hydrolysis is carried out at 37°C for 3 hours. All other steps are the same as in Example 7. test

[0042] 1. Cell proliferation detection Cell proliferation was detected in the extracellular matrix obtained in step S2. This detection method is a key approach to assess cell viability and growth status by measuring changes in the number of cells undergoing division. The core principle is that living cells undergo biological activities such as DNA replication and enhanced metabolism during division, and measuring these indicators can indirectly reflect cell viability. In this study, the CCK8 assay kit was used for detection.

[0043] The core principle of the hydroxyproline method for determining collagen content lies in using hydroxyproline as a characteristic amino acid marker of collagen, and indirectly calculating the total collagen content by quantifying its content. In this study, a hydroxyproline reagent kit was used for determination, and the specific detection and comparison results are shown in Table 1.

[0044] Simultaneously, different culture media were used for culturing and passage comparison. P3 generation umbilical cord mesenchymal stem cells were used as the starting point for passage expansion culture into 6-well plates, with 1×10⁶ cells seeded into each well. 5 The cell mass was continuously cultured for 96 hours until the cells expanded to 100%, and then passaged. This process was repeated to determine the final condition of the culture medium for the 3D cultured umbilical cord mesenchymal stem cell cell clusters and passages. If the cell confluence was less than 80% after 96 hours of culture, the cell proliferation capacity was considered to be weakened, and the passage was terminated. The results are shown in Table 1.

[0045] Table 1 Cell proliferation detection project Cell proliferation rate / CCK assay (%) Collagen content (μg / mL) Cell expansion generations Example 1 11.20 1.12 P6 Example 2 20.16 2.72 P8 Example 3 10.18 1.09 P6 Example 4 20.18 2.78 P8 Example 5 25.07 4.18 P10 Example 6 15.61 1.39 P6 Comparative Example 1 6.41 0.69 P5 Comparative Example 2 8.09 0.95 P5 Based on the data in Table 1: Combining Examples 1-3 and Comparative Example 1, as the concentrations of TGF-β1, β-FGF, EGF, ascorbic acid, and dexamethasone in the induction medium increased, the cell proliferation activity and hydroxyproline content did not increase linearly. The reason for this may be that the increase of additives will cause more cytotoxicity, affect cell activity, and thus make collagen synthesis difficult. From the above test results, it can be seen that the concentration in Example 2 is the optimal addition amount.

[0046] Examples 4-6 and Comparative Example 2, based on Example 2, further added sodium selenite at different concentrations. Sodium selenite significantly enhances cell activity and promotes collagen synthesis through a triple mechanism of antioxidation, DNA regulation, and enzyme activation. However, the dosage needs to be controlled to avoid cytotoxicity. For example, in Example 4, when the amount of sodium selenite added was too low, it had no effect on cell proliferation rate and collagen content. However, when sodium selenite was added in excess, Examples 6 and Comparative Example 2 found that the addition of excessive sodium selenite led to cytotoxicity, thus offsetting the potential for increased cell activity and hydroxyproline concentration. Moreover, since different cells have different sensitivities to sodium selenite toxicity, adding an appropriate amount of sodium selenite is also a challenge in this field.

[0047] 2. The yield and purity of collagen obtained from the above examples and comparative examples were tested. The test results are shown in Table 2. The time in the table below refers to the time taken from the start of the experiment to the end of step S3.

[0048] Table 2. Results of Collagen Yield and Purity Tests project Collagen yield % Collagen purity % DNA residue (ng / mg) Time / day Example 1 70.16 95.27 21.81 5.0 Example 2 78.95 97.31 17.83 5.0 Example 3 68.59 96.12 25.47 5.0 Example 4 78.12 97.54 17.96 5.0 Example 5 81.43 97.58 12.60 5.0 Example 6 63.58 94.23 31.74 5.0 Example 7 87.08 97.18 13.91 5.0 Example 8 82.27 97.24 9.02 4.5 Example 9 72.21 98.71 21.66 4.5 Example 10 91.71 95.98 37.16 4.25 Comparative Example 1 48.36 90.26 45.89 5.0 Comparative Example 2 20.34 85.67 47.67 5.0 Comparative Example 3 55.20 95.08 11.71 7 Comparative Example 4 51.41 95.98 14.60 4.5 Comparative Example 5 36.83 95.81 19.71 5 Comparative Example 6 47.61 99.21 31.33 5 Comparative Example 7 33.09 98.22 11.24 4.5 Comparative Example 8 48.47 97.22 31.15 4.25 Comparative Example 9 33.78 96.18 41.17 4.25 Comparative Example 10 27.61 97.91 40.08 4.125 Referring to Table 2: In the above examples and comparative examples, the purity of collagen was >95% and the DNA residue was <50ng / mg, so they all met the quality inspection requirements.

[0049] Comparative analysis of different concentrations of pepsin and different reaction times revealed that enzyme activity concentration and reaction time are difficult to control. Excessive enzyme content and excessive reaction time can lead to over-digestion or under-digestion of the samples, resulting in a lower collagen yield. For example, in Comparative Example 4, the enzyme concentration was 2 mg / mL, but the enzymatic hydrolysis time was 12 h. In Comparative Examples 5-6, the enzymatic hydrolysis time was 24 h. With increased enzyme concentration, and in Comparative Examples 7-8, even with increased enzyme concentration and shortened reaction time, the collagen yield was still lower. Therefore, through the above comparison of enzyme concentration and reaction time, lower concentration enzyme solutions require a longer time. However, higher enzyme concentration is not always better, because with higher enzyme concentration, the digestion time needs to be shorter, and the digestion endpoint becomes more difficult to control, leading to under-digestion or over-digestion.

[0050] 3. The expression levels of COL1A1 and COL1A3 in collagen were detected in the cell tissue spheres of umbilical cord mesenchymal stem cells obtained from the three-dimensional induction culture and two-dimensional culture process in step S2 of Example 2. The ordinary two-dimensional culture method was adherent culture, specifically: the cells were cultured at a density of 4 × 10⁻⁶ cells / cells. 5Each platelet was inoculated into 6-well plates and cultured continuously for 15 days in an incubator at 37°C and 5% CO2. The culture medium was changed every two days. The culture medium included DMEM / F12 basal medium containing 5% platelet lysate, 20 ng / mL TGF-β1, 20 ng / mL β-FGF, 100 ng / mL EGF, 100 μg / mL ascorbic acid, and 2 × 10⁻⁶ oz / mL platelets. - 8 M's dexamethasone.

[0051] The specific testing method is as follows: Transcriptional analysis was performed on umbilical cord mesenchymal stem cell tissue spheres cultured for 10 days: RNA was extracted from the tissue spheres using the EasyPure RNA kit (TransGen, ER101-01). Quantitatively, 6 μg of RNA template was used to reverse transcribe the RNA into cDNA using the TransScript® One-Step gDNARemoval and cDNA Synthesis SuperMix kit (TransGen, AT31102), with a final concentration of 0.6 μg / μL. Finally, RT-qPCR was performed using the PerfectStart® Green qPCR SuperMix kit (TransGen, AQ601-01). The primers were designed as follows: Gene detection upstream primer Downstream primer COL1A1 GGATGAGGAGACTGGCAACC TGCCCTCAGCAACAAGTTCA COL1A3 CTTCGACTTCTCTCCAGCCG TTTCGTGCAACCATCCTCCA GAPDH CACCATCTTCCAGGAGCGAG TGATGACCCTTTTGGCTCCC Test results as follows Figure 1 As shown, where Figure 1 In the diagram, A represents 2D adherent culture and B represents 3D suspension culture.

[0052] The detection of COL1A1 and COL1A3 mRNA levels essentially reflects the amount of collagen synthesized indirectly through gene transcriptional activity, thereby predicting the final collagen content in cells. This principle is the core basis for studying collagen metabolism (such as fibrosis and tissue repair) and is also an important target for drug development.

[0053] The mRNA levels of umbilical cord mesenchymal stem cell tissue spheres obtained from three-dimensional induction culture and two-dimensional adherent culture in step S2 of Example 2 were detected. The results showed that the mRNA expression levels of COL1A1 and COL1A3 obtained from three-dimensional culture were 4.21 times and 7.25 times that of two-dimensional adherent culture, respectively, compared with those obtained from two-dimensional adherent culture.

[0054] 4. In vitro activity test Effect of humanized collagen prepared using Example 2 of this application on the proliferation of human fibroblasts The CCK-8 assay kit (Cell Counting Kit-8) is a colorimetric assay based on water-soluble tetrazolium salt (WST-8). Dehydrogenases in the mitochondria of live cells reduce WST-8 to water-soluble yellow formazan, and the color intensity is directly proportional to the number of live cells (the more cells proliferate, the darker the color; the greater the cytotoxicity, the lighter the color). The absorbance (OD value) at 450 nm wavelength is measured using a microplate reader to indirectly reflect the number of live cells and is used to assess cell proliferation.

[0055] 4.1 Human fibroblasts (HDFs, Sciencell, #2300) in logarithmic growth phase were collected, digested with trypsin to prepare a single-cell suspension, washed twice with PBS, and the cell density was adjusted to 3 × 10⁻⁶ cells / year. 4 Cells / mL were seeded in 96-well plates (100 μL / well, approximately 3000 cells / well) and cultured in the following different groups: Grouping settings (5 replicates per group): Control group: Cell-free basal culture medium containing 10% platelet lysis buffer (Pall, 15950-017) in DMEM / F12 medium. Control group 1: Human fibroblasts + basal culture medium; Control group 2: Human fibroblasts + culture medium containing recombinant collagen. The recombinant collagen content in the culture medium was 1 mg / mL. The recombinant collagen was purchased from Prospec brand, product number PRO-359. Experimental group 1: Human fibroblasts + culture medium containing umbilical cord mesenchymal stem cell collagen obtained in Example 2, wherein the content of umbilical cord mesenchymal stem cell collagen in the culture medium is 1 mg / mL; Experimental group 2: Human fibroblasts + culture medium containing umbilical cord mesenchymal stem cell collagen obtained in Example 2, wherein the content of umbilical cord mesenchymal stem cell collagen in the culture medium is 5 mg / mL; Experimental group 3: Human fibroblasts + culture medium containing umbilical cord mesenchymal stem cell collagen obtained in Example 2, wherein the content of umbilical cord mesenchymal stem cell collagen in the culture medium is 10 mg / mL; Note: The collagen-containing culture media for control group 2 and experimental groups 1-3 above consisted of basal culture medium with the corresponding collagen added. 4.2 Intervention and culture of the above control and experimental groups The control and experimental groups described in section 4.1 were pre-cultured at 37℃ and 5% CO2 for 24 hours to allow cell adhesion. The original culture medium was then discarded, and fresh culture medium with the same formulation as the original medium was added. After culturing for another 72 hours, CCK-8 assays were performed. 10 μL of CCK-8 reagent (or fresh culture medium containing 10% CCK-8) was added to each well, and the cells were incubated at 37℃ in the dark for 2 hours. The absorbance (OD value) at 450 nm was measured using a microplate reader, and the data were recorded as shown in the table below. sample Absorbance OD value Blank group 0.28 Control group 1 1.11 Control group 2 2.05 Experimental group 1 2.81 Experimental group 2 3.82 Experimental group 3 3.25 The results of the detection of human fibroblast proliferation showed that the humanized umbilical cord mesenchymal stem cell collagen obtained in this application's experimental group had a better cell-promoting activity than recombinant collagen. Furthermore, a comparison of different concentrations of humanized umbilical cord mesenchymal stem cell collagen revealed that 5 mg / mL (experimental group 2) of humanized umbilical cord mesenchymal stem cell collagen had a better proliferative capacity than 1 mg / mL, while the high concentration of 10 mg / mL (experimental group 3) of humanized umbilical cord mesenchymal stem cell collagen had a weaker cell-proliferative capacity compared to 5 mg / mL collagen. This may be because high concentrations of collagen have a slight toxic or inhibitory effect on cell proliferation.

[0056] In addition, the humanized umbilical cord mesenchymal stem cell collagen obtained in this application promoted fibroblast proliferation rate (72h) of 185±12%, which was significantly higher than that of the recombinant collagen group (120±8%).

[0057] 5. In vitro animal experiments Mouse skin injury model: Eight-week-old male nude mice (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) were acclimatized for one week, then anesthetized. The skin tissue on the back was disinfected with iodine, and then a 1cm diameter circular punch (HY punch, 010) was used to punch holes in the skin. Collagen was then applied to the punched sites on the mice and allowed to dry and fix for 30 minutes, which was recorded as day 0. The condition of the skin on the back of the nude mice was continuously observed and recorded.

[0058] The criteria for judging the skin's ability to heal are as follows: when the skin at the site of injury is uniformly free of wounds or scabs have fallen off, the wound is considered to be healed or approaching healing. The specific phenotypic observations of wound healing are shown in the table below: Group preparation Wound healing time Control group 1 PBS 16 days Control group 2 Recombinant collagen 1mg / ml 12 days Experimental group 1 Humanized umbilical cord mesenchymal stem cell collagen 1mg / ml 9 days Experimental group 2 Humanized umbilical cord mesenchymal stem cell collagen 5mg / ml 7 days Experimental group 3 Humanized umbilical cord mesenchymal stem cell collagen 10mg / ml 7 days Phenotypic analysis was also performed on day 9 post-injury, specifically as follows: Figure 2 As shown, Figure A is the healing diagram corresponding to control group 1; Figure B is the healing diagram of control group 2; Figure C is the healing diagram of experimental group 1; Figure D is the healing diagram of experimental group 2; and Figure E is the healing diagram of experimental group 3.

[0059] In a mouse skin trauma model, the wound healing time in the control group 2 recombinant collagen group was 12 days. The wound healing time in the humanized umbilical cord mesenchymal stem cell collagen group obtained in this application was shortened to 7-9 days. At the same time, comparative analysis of different concentrations of humanized umbilical cord mesenchymal stem cell collagen showed that the skin damage repair ability of both the medium concentration group and the high concentration group was completely repaired within 7 days. Therefore, from the perspective of economy and cost, the medium dose group is the best choice.

[0060] 6. Cosmetic Formulation Preparation Using the collagen obtained in Example 2 as the base active ingredient, an anti-aging serum was formulated as follows (by weight percentage): Element content% Function Human-derived collagen (dissolved and diluted in PBS) 8.0 Replenish natural collagen and promote autologous collagen regeneration Glyceryl glucoside 2.0 Penetration enhancer to improve collagen transdermal absorption rate Sodium hyaluronate 1.0 Shrinks moisture, improves skin feel, and prolongs sustained-release time. Niacinamide 6.0 Antioxidant and brightens skin tone Phenoxyethanol 0.5 preservative Deionized water Supplement to 100 solvent The anti-aging essence is obtained by dissolving each component in water, stirring until homogeneous, filtering through a 0.22μm filter cloth, and sterilizing.

[0061] The embodiments described herein are preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Therefore, all equivalent changes made in accordance with the structure, shape, and principle of the present invention should be covered within the scope of protection of the present invention.

Claims

1. A method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material, characterized in that, Includes the following steps: S1. Process and passage umbilical cord tissue for amplification; S2. The expanded umbilical cord mesenchymal stem cell suspension was seeded into ultra-low adsorption culture dishes, and then cultured in DMEM / F12 medium containing 10% platelet lysis buffer. Afterwards, the medium was replaced with induction medium to obtain the extracellular matrix. The induction medium included DMEM / F12 basal medium containing 1-5% platelet lysis buffer, 10-50 ng / mL TGF-β1, 10-50 ng / mL β-FGF, 50-250 ng / mL EGF, 50-250 μg / mL ascorbic acid, and 1-5 × 10⁻⁵ ... -8 M's dexamethasone; S3. Extraction and purification of collagen: Pepsin solution is added to the extracellular matrix for enzymatic hydrolysis. After centrifugation of the hydrolysate, the supernatant is collected, the pH is adjusted to 7-8, and the mixture is allowed to stand. After centrifugation, the precipitate is collected, reconstituted, purified, centrifuged, and then freeze-dried. S4, Formulation.

2. The method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material according to claim 1, characterized in that: The induction medium includes DMEM / F12 basal medium containing 1-5% platelet lysis buffer, 10-20 ng / mL TGF-β1, 10-20 ng / mL β-FGF, 50-100 ng / mL EGF, 50-100 μg / mL ascorbic acid, and 1-2 × 10⁻⁶ mol / mL β-FGF. -8 M's dexamethasone.

3. The method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material according to claim 2, characterized in that: The induction medium also includes 0.5-2 μmol / mL sodium selenite.

4. The method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material according to claim 1, characterized in that: The concentration of the pepsin solution is 1-2 mg / mL, and the enzymatic hydrolysis conditions are 24 h at room temperature or... The concentration of the pepsin solution was 4 mg / mL, and the enzymatic hydrolysis conditions were 12 h at room temperature.

5. The method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material according to claim 4, characterized in that: The pepsin solution contains 0.03M hydrochloric acid solution.

6. The method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material according to claim 4, characterized in that: The concentration of the pepsin solution is 1-2 mg / mL, and the enzyme is hydrolyzed at 37°C for 6-12 hours.

7. The method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material according to claim 1, characterized in that: In step S3, the volume ratio of extracellular matrix to pepsin solution is 500:

1.

8. The method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material according to claim 1, characterized in that: The umbilical cord tissue in step S1 is expanded to the third generation for future use.

9. The application of humanized collagen obtained by the method for rapidly preparing humanized collagen using umbilical cord mesenchymal stem cell material as described in any one of claims 1-8 in the preparation of medical aesthetic products, wound repair materials, bone tissue healing materials, biocomposite materials, cosmetics or skin care products.