SNP sites related to oil content in Hainan Camellia oleifera kernels and their applications

Abstract

This invention relates to the field of plant breeding technology, and particularly to SNP loci related to the oil content of Camellia oleifera seed kernels in Hainan and their applications. The SNP loci include one or more of Chr27_83344296, Chr43_56056639, or Chr15_65268299; Chr27_83344296 is located at position 83344296 on chromosome 27, with a polymorphism of G / T; Chr43_56056639 is located at position 56056639 on chromosome 43, with a polymorphism of C / T; and Chr15_65268299 is located at position 65268299 on chromosome 15, with a polymorphism of G / A. By detecting the polymorphism of these SNP loci, the oil content of Camellia oleifera seed kernels in Hainan can be detected at the seedling stage, significantly reducing production costs and improving selection efficiency, thus possessing significant application value.

Description

Technical Field

[0001] This invention relates to the field of plant breeding technology, and in particular to SNP sites related to the oil content of Camellia oleifera kernels in Hainan and their applications. Background Technology

[0002] Hainan camellia oil ( Camellia hainanica ), Theaceae family, Camellia genus ( Camellia Camellia oleifera (L.), also known as mountain tea tree, is a perennial woody oilseed tree species found in tropical regions. Compared to common camellia, Hainan camellia has larger fruits, a more intense aroma in its oil, and higher edible and medicinal value. Furthermore, Hainan camellia is a cross-pollinated plant, resulting in extremely rich and unique variations in its resources due to both environmental and genetic control. Seed kernel oil content is a crucial indicator for evaluating camellia seed quality. In the breeding of superior Hainan camellia varieties, extensive analysis of the oil content of camellia seed samples is frequently required. In recent years, significant progress has been made in camellia genetic breeding, with multiple genome sequencing and mapping projects completed, and substantial advancements achieved in the analysis of seed oil synthesis and accumulation mechanisms. Based on this, identifying and screening molecular markers for early selection of high-oil-content germplasm, and constructing corresponding detection systems, are effective ways to accelerate the breeding process of high-oil-content camellia varieties.

[0003] Compared to traditional breeding techniques, marker-assisted selection can significantly shorten the breeding cycle, with particularly pronounced advantages for economic forest breeding where fruit production is the primary objective. Effective and precise molecular markers are the foundation and key to marker-assisted breeding. Therefore, developing molecular markers related to the oil content of Hainan Camellia oleifera kernels is of great significance for marker-assisted breeding and genetic improvement of oil yield in Hainan Camellia oleifera. Summary of the Invention

[0004] To address the technical problems existing in the prior art, this invention provides SNP sites related to the oil content of Hainan Camellia oleifera kernels and their applications.

[0005] Camellia oleifera var. hainanensis is a typical outcrossing species, and linkage disequilibrium (LD) typically decreases rapidly over a small area. This invention performs LD mapping for important traits. Using a natural population of Camellia oleifera var. hainanensis ...

[0006] In a first aspect, the present invention provides SNP sites, including one or more of Chr27_83344296, Chr43_56056639, or Chr15_65268299; Based on the genome version Changlin 40 V1.0, Chr27_83344296 is located at position 83344296 on chromosome 27, and the polymorphism is G / T; Chr43_56056639 is located at position 56056639 on chromosome 43, and its polymorphism is C / T; Chr15_65268299 is located at position 65268299 on chromosome 15, and its polymorphism is G / A.

[0007] This invention developed three SNP loci highly associated with the oil content of Camellia oleifera kernels, which can explain 3.54%, 3.28%, and 3.12% of the phenotypic variance of oil content, respectively. These three markers were used for auxiliary selection of sexually occurring Camellia oleifera populations. The results showed that in individuals with the high oil content genotype (Chr27_83344296), 62.31% of the individuals had an oil content in their kernels higher than the population average (47.23%); in individuals with the low oil content genotype (Chr43_56056639) (CT), only 24.14% of the individuals had an oil content in their kernels higher than the population average (47.23%), while all individuals with the low oil content genotype (TT) had an oil content lower than the population average; the Chr15_652... Among the individual plants with the high oil content genotype at locus 68299, 57.6% of the individuals had kernel oil content higher than the population average (47.23%). Among the 71 individuals with high or candidate high oil content genotypes at all three loci (Chr27_83344296, Chr43_56056639, and Chr15_65268299), 71.83% of these individuals had an oil content higher than the population average. All individuals with low oil content genotypes at all three loci had kernel oil content lower than the population average (47.23%). This indicates that this marker has high accuracy in assisted selection.

[0008] Furthermore, the present invention provides a combination of SNP sites that simultaneously include two of Chr27_83344296, Chr43_56056639, or Chr15_65268299.

[0009] Furthermore, the present invention provides a combination of SNP sites that simultaneously include the three SNP sites Chr27_83344296, Chr43_56056639 and Chr15_6526829.

[0010] Simultaneously using three SNP loci to identify the oil content phenotype of Camellia oleifera kernels in Hainan has a higher accuracy rate.

[0011] In a second aspect, the present invention provides molecular markers, including one or more of the following: Chr27_83344296 marker, Chr43_56056639 marker, or Chr15_65268299 marker; The Chr27_83344296 marker includes the nucleotide sequence shown in SEQ ID NO.1, with a polymorphism at position 156, which is G / T. The Chr43_56056639 marker includes the nucleotide sequence shown in SEQ ID NO.2, with a polymorphism at position 139, which is C / T. The Chr15_65268299 marker includes a nucleotide sequence as shown in SEQ ID NO.3, with a polymorphism at position 179, which is G / A.

[0012] The nucleotide sequence shown in SEQ ID NO.1: AAAATCTAATTTGCACATGGTGATACAAAAAAGTGTAACTTTCCATTATTTTTTTCTCCGTTTCCTACAGGTGATGGGAGTCTATGAATGGGCCAGATGCAACCCACTGCCCCCAGAATTCTGGCTTTTCCCTTCATTTTCACCTTGTCA CCCAGGCGAAATTTATTTCCTATATTTTATCATTTTGTATTTGTTGTTTTCAACAAAAGTTATAGGAGTATCCTTTACCTGAAGAAAATATGTAAAACATTCTACATTCTTATACTTGAAACTCTCAATTTAATGACCTATTAAAAGGAT.

[0013] The nucleotide sequence shown in SEQ ID NO.2: GACTGACCTCCTTTCGCACTAGGATTTCTAACTTCACTGGACCCACTTCAATAACCACCAAAGTCAGAATTCAATCACCACTTCCATCAGTGCAGAATCTGGCTCATTAGAAGTGAGCTCTGGTGCTTGTTGCCTCATCAACTCTCTAGT GTAGCCACTGCAAAAGTCCCAATTAATCTGAAAGTCACCTCATCCCACAAGTGTTGAGGCAAGCATATCAAATAGATCCACACCTCTTGTGCATCATCCTTTGTCCTGTAACACTTACTTGTCAAAGCCCATCAGTAGAATTGTTTCATG.

[0014] The nucleotide sequence shown in SEQ ID NO.3: ATGACTATGAGAATGAGCATGAATTAATTGAAGCTTGGAATTCTTTGATGGATAAATACAACTTGCAATAGAATGAGTGGATGAAAAGAACTTGGAGAAAAAGAGAGCACTGGGCACACATGTATGTGAAGTGGGTATTTACTGCAGGAA TACAAAGCATATAACTTAGTGTAAGTCTGAATGGAACATTAAGGGGATATTTGAAAGGTGATCATAACATTGTTCAATTCTTTACTCACTTCAATCGAATTATTGTAGATAAGTGGTATGAGGAAGTTTAAGTGCAATATATGATTCTAG.

[0015] Furthermore, the present invention provides a combination of molecular markers that simultaneously include two of the following markers: Chr27_83344296, Chr43_56056639, or Chr15_65268299.

[0016] Furthermore, the present invention provides a combination of molecular markers that simultaneously include the Chr27_83344296 marker, the Chr43_56056639 marker, and the Chr15_65268299 marker.

[0017] Thirdly, the present invention provides primer pairs for amplifying the aforementioned SNP sites or the aforementioned molecular markers.

[0018] The primer pair design method described in this invention can be a conventional method of this invention. Technicians can design primer pairs (including primer pairs or KASP primer combinations) of different lengths based on existing primer design rules and primer design software (such as Primer) to amplify the aforementioned molecular markers.

[0019] Furthermore, the primer pair includes one or more of the following: (1) The primers shown in SEQ ID NO.4 and SEQ ID NO.5; (2) The primers shown in SEQ ID NO.6 and SEQ ID NO.7; (3) Primers shown in SEQ ID NO.8 and SEQ ID NO.9.

[0020] The nucleotide sequence shown in SEQ ID NO.4: ATCTAATTTGCACATGGTGATAC.

[0021] The nucleotide sequence shown in SEQ ID NO.5: TATTTTCTTCAGGTAAAGGATA.

[0022] The nucleotide sequence shown in SEQ ID NO.6: GACTGACCTCCTTTCGCACTAG.

[0023] The nucleotide sequence shown in SEQ ID NO.7: CAATTCTACTGATGGGCTTTGAC.

[0024] The nucleotide sequence shown in SEQ ID NO.8: ATGACTATGAGAATGAGCATGA.

[0025] The nucleotide sequence shown in SEQ ID NO.9: AGTGAGTAAAGAATTGAACAAT.

[0026] Furthermore, the primer pair described in this invention carries a fluorescent tag, which may be one or more of the following: FAM, TET, HEX, ROX, Cy3, Cy5, Alexa Fluor, SYBR Green, DAPI, FITC, or Texas Red.

[0027] For example, GAAGGTGACCAAGTTCATGCT (FAM fluorescent tag sequence), GAAGGTCGGAGTCAACGGATT (HEX fluorescent tag sequence).

[0028] Fourthly, the present invention provides a kit comprising the aforementioned molecular markers or the aforementioned primer pairs.

[0029] Fifthly, the present invention provides the application of the aforementioned SNP sites as targets in any of the following: (1) Predict or detect the oil content of the kernels of Camellia oleifera in Hainan; (2) Identify or cultivate Hainan camellia varieties with high kernel oil content; (3) Molecular marker-assisted breeding of Camellia oleifera in Hainan; (4) Improvement of Hainan Camellia oleifera varieties related to kernel oil content; (5) Germplasm resource improvement of Hainan Camellia oleifera.

[0030] In a sixth aspect, the present invention provides the use of the aforementioned molecular markers, or the aforementioned primer pairs, or the aforementioned kits in any of the following: (1) Predict or detect the oil content of the kernels of Camellia oleifera in Hainan, or prepare reagents for predicting or detecting the oil content of the kernels of Camellia oleifera in Hainan; (2) To identify or cultivate Hainan Camellia oleifera varieties with high kernel oil content, or to prepare reagents for identifying or cultivating Hainan Camellia oleifera varieties with high kernel oil content; (3) Molecular marker-assisted breeding of Camellia oleifera in Hainan; (4) Improvement of Hainan Camellia oleifera varieties related to kernel oil content; (5) Germplasm resource improvement of Hainan Camellia oleifera.

[0031] Seventhly, the present invention provides a method for detecting the oil content of the kernels of Camellia oleifera var. hainanensis, comprising: The Hainan Camellia oleifera samples to be tested were examined for SNP sites or molecular marker polymorphisms as described above; the oil content of the kernels of the Hainan Camellia oleifera samples to be tested was determined based on the genotype test results.

[0032] Furthermore, the detection method includes one or more of the following: PCR amplification, probe hybridization, gene chip, gene sequencing, or mass spectrometry.

[0033] Further, the PCR amplification includes: (1) Extract genomic DNA from the Hainan camellia oil sample to be tested; (2) Using genomic DNA as a template, perform PCR amplification using the primer pairs described above; (3) Analyze the genotypes of the SNP sites in the PCR amplification products as described above, and determine the oil content of the kernels of the Hainan camellia oil sample to be tested based on the genotype detection results.

[0034] Furthermore, the PCR amplification reaction procedure includes: 94~95℃, 3~5min; 94~95℃, 15~30s, 65~69℃, 40~60s, 38~45 cycles; 67~70℃, 3~6min.

[0035] Preferred methods include: 95°C, 3 min, 1 cycle for pre-denaturation; 95°C, 15 s for denaturation, 68°C, 45 s for extension, 40 cycles; 68°C, 5 min, 1 cycle for complete extension.

[0036] Furthermore, the determination of the kernel oil content of the Hainan camellia oleifera sample based on the genotype detection results includes: If the genotype test result of Chr27_83344296 is G / G, then the Hainan Camellia oleifera to be identified has a high kernel oil content; if the test result is G / T or T / T, then the Hainan Camellia oleifera to be identified has a low kernel oil content. If the genotype test result of Chr43_56056639 is C / C, then the Hainan Camellia oleifera to be identified has a high kernel oil content; if the test result is C / T or T / T, then the Hainan Camellia oleifera to be identified has a low kernel oil content. If the genotype test result of Chr15_65268299 is G / G, then the Hainan Camellia oleifera to be identified is a high kernel oil content variety; if the test result is A / A, then the Hainan Camellia oleifera to be identified is a candidate for high kernel oil content variety; if the test result is G / A, then the Hainan Camellia oleifera to be identified is a low kernel oil content variety.

[0037] Furthermore, the Hainan Camellia oleifera samples identified by this invention can be any breeding material, including individuals from natural populations and individuals from sexually occurring populations.

[0038] The present invention has the following beneficial effects: In conventional selection and breeding of Camellia oleifera in Hainan, the identification of kernel oil content requires 5-6 years of seedling afforestation, which is time-consuming and labor-intensive. The SNP loci provided by this invention have clearly defined locations, a convenient and rapid detection method, are unaffected by environmental factors, are more targeted, require less work, are more efficient, and are less costly. Therefore, by detecting the SNP loci provided by this invention, identification and auxiliary screening can be carried out at the seedling stage, greatly saving production costs and improving selection efficiency. In Camellia oleifera breeding in Hainan, the molecular markers and detection methods of this invention can be selected to identify Camellia oleifera with high oil content for breeding, which can improve the selection efficiency of Camellia oleifera breeding in Hainan and accelerate the breeding process. Detailed Implementation

[0039] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0040] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.

[0041] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.

[0042] The 189 clones of natural population materials used in the following examples were all collected and evaluated by the Camellia oleifera team of the Coconut Research Institute of the Chinese Academy of Tropical Agricultural Sciences and are preserved in the Hainan Wenchang Germplasm Resource Nursery of the Coconut Research Institute.

[0043] Example 1: Construction and trait determination of an isolated population of oil content in the kernels of Camellia oleifera from Hainan. In this embodiment, 189 natural populations of camellia oleifera germplasm resources from a collection garden were used, with their origins covering the entire Hainan province. Seeds were collected from all 189 individuals after the fruits were fully mature (5% of the fruits had split open), and the oil content of the kernels was determined using Soxhlet extraction. The operational steps are as follows: (1) Prepare medium-speed filter paper packs and place them in an aluminum box. Dry them at 105°C until constant weight is achieved. Record the weight of the aluminum box and the filter paper packs. W 1).

[0044] (2) Remove the hard seed coat from an appropriate amount of Hainan camellia seeds, dry them at 105℃ to constant weight, crush them with a pulverizer, pack them into a filter paper bag and wrap them up, and record the total mass of the aluminum box, filter paper bag and sample. W 2).

[0045] (3) Using a Swiss Buchi Soxhlet extractor B-811LSV, the weighed sample filter paper package was placed in an extraction flask, and about 100 ml of petroleum ether was added. Extraction was carried out for 6 hours, and the petroleum ether was recovered. The filter paper package (containing residue) was placed in an aluminum box and dried at 105°C until constant weight was achieved. The weights of the aluminum box, filter paper package, and residue were recorded. W 3).

[0046] Kernel oil content = [( W 2- W 3) / ( W 2- W 1) × 100% The results of the oil content determination of Camellia oleifera seeds from Hainan showed that the oil content of the seeds in the natural population exhibited a normal distribution, indicating that this trait has quantitative characteristics.

[0047] Example 2: Simplified Genome Sequencing and Polymorphic Site Identification 1. Genomic DNA extraction from young leaves of 189 Hainan Camellia oleifera clones: Total genomic DNA was extracted from young leaves of each clone using the TaKaRa MiniBEST Plant Genomic DNA Extraction Kit (TaKaRa, Dalian, China).

[0048] 2. Simplified genome sequencing: Total DNA from each sample was tested for purity and concentration to ensure an OD260 / 280 ratio between 1.8 and 2.0, with no significant degradation. The DNA concentration was adjusted to 50-100 ng / μL. Genomic DNA was digested with restriction endonucleases PstI and MspI, and barcode sequences and sequencing primer adapters were ligated. The ligation products from each sample were mixed in equimolar ratios to form two pooled samples. After PCR amplification to enrich the target fragment, the PCR products were purified using magnetic beads to remove impurities such as primers, dNTPs, and polymerase. Target fragments of 250-550 bp were screened using agarose gel electrophoresis to construct a simplified genome sequencing library. The constructed library was then analyzed using Illumina HiSeq. TM 4000 platform sequencing.

[0049] 3. Polymorphic site identification: To ensure data quality, the clean reads obtained after initial filtering are further filtered more rigorously to obtain high-quality clean reads for subsequent information analysis. The filtering steps are as follows: (1) Remove reads containing connectors; (2) Remove reads that are all A bases; (3) Remove reads containing more than 10% N; (4) Remove low-quality reads (the number of bases with a quality value of Q≤20 accounts for more than 50% of the total reads).

[0050] Tophat v2.1.1 software was used to align high-quality reads from each sample to the hexaploid reference genome sequence. Unaligned sequences were removed, and the remaining sequences were used to identify SNP sites using bcftools v1.9 software. The identified SNP sites underwent rigorous filtering to obtain high-quality SNP data. The filtering criteria are as follows: (1) There are only 2 alleles at the locus; (2) Genotype deletion rate ≤ 20%; (3) Minimum allele frequency (MAF) ≥ 5%; (4) SNP quality value ≥ 100; (5) The number of homozygous genotype samples is greater than 10; (6) The heterozygous genotype sample rate is ≤70%.

[0051] Example 3: Screening of SNP sites related to oil content in Hainan Camellia oleifera kernels 1. Group structure analysis: Principal component analysis (PCA) was performed on the natural population of Camellia oleifera in Hainan using GCTA v1.25.2 software. The first 10 principal components (PCs) were used as fixed effects for subsequent association analysis (Table 1).

[0052] Table 1. Top 10 PC values ​​of 189 individuals in the natural population

[0053] 2. Association Analysis: All SNP locus data, the top 10 PC values, phenotypic data (see Example 1), and Kinship matrix data were imported into IIIVmrMLM software. MLM analysis was used to analyze the linkage disequilibrium between SNPs and kernel oil content. Molecular markers significantly associated with kernel oil content were screened. After multiple validation corrections, three loci with extremely significant associations to kernel oil content were detected. P <10 -5 (Table 2) These three loci are located in the intronic or intergenic regions of chromosomes 27, 43 and 15, respectively, and their contribution rates to the difference in oil content are 3.54%, 3.28% and 3.12% (Table 2).

[0054] Table 2 SNP molecular marker information

[0055] Example 4: Application of the molecular markers of the present invention in high-oil-content breeding of Camellia oleifera in Hainan The present invention further applies the molecular markers obtained from the final screening in Example 3 to breeding, and the specific process is as follows: (1) Select a Hainan Camellia oleifera hybrid F1 generation family as material (maternal parent is 'Reyan 2', paternal parent is 'HN88'), collect young leaves to extract total DNA (see Example 2).

[0056] (2) Genomic DNA was amplified by PCR using the primer pairs shown in SEQ ID NO.4-5, SEQ ID NO.6-7, and SEQ ID NO.8-9, respectively. The reaction systems are shown in Table 3. Table 3 PCR reaction system

[0057] The PCR amplification procedure is as follows: Table 4 PCR Amplification Program

[0058] (3) PCR amplification products were subjected to gel detection, purification, recovery, sequencing, and genotyping. Gel detection and purification were performed according to the instructions of the AxyPrep DNA Gel Recovery Kit (AxyGEN, Code No. AP-GX-50). DNA was recovered from the gel, and the corresponding amplification primers were used as sequencing primers. The nucleotide sequence of the amplification products was determined by Sanger sequencing, and the genotype of each SNP site on the sequencing peak map was interpreted using Chromas software.

[0059] (4) Identify the genotypes of all individuals at three loci. Compare the relationship between the genotype of the locus and the oil content. If the genotype of Chr27_83344296 is G / G, then the Hainan Camellia oleifera individual has a high oil content; if the genotype of Chr43_56056639 is C / C, then the Camellia oleifera individual has a high oil content; if the genotype of Chr15_65268299 is G / G, then the Hainan Camellia oleifera individual has a high oil content.

[0060] (5) Collect fully mature seeds from all F1 generation individuals and determine the oil content of their kernels (see Example 1).

[0061] The results (Table 5) showed that among the individual plants with the high oil content genotype at Chr27_83344296, 62.31% of the individuals had a higher kernel oil content than the average kernel oil content of the population (47.23%).

[0062] Among individual plants with the low oil content genotype C / T at Chr43_56056639, only 24.14% of the individual kernels had an oil content higher than the population average (47.23%), while all individual plants with the low oil content genotype T / T had an oil content lower than the population average.

[0063] Among individual plants with the high oil content genotype at Chr15_65268299, 57.6% of the individual kernels had an oil content higher than the average oil content of the population kernels (47.23%).

[0064] There were 71 individuals with high oil content genotypes or candidate high oil content genotypes at the three loci Chr27_83344296, Chr43_56056639, and Chr15_65268299, and 71.83% of these individuals had an oil content higher than the population average. All individuals with low oil content genotypes at the three loci had an oil content in their kernels that was lower than the population average (47.23%).

[0065] This indicates that the marker has high accuracy in assisting selection, and can be used for early identification or auxiliary identification, which can greatly save production costs, improve selection efficiency, and accelerate the breeding process of high-oil-content camellia.

[0066] Table 5. Oil content and genotype data of F1 individual plants in their kernels.

[0067] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. SNP site characterized in that, Comprising: one or more of Chr27_83344296, Chr43_56056639 or Chr15_65268299; Chr27_83344296 is located at chromosome 27 position 83344296, and the polymorphism is G / T, based on the genome version Changlin 40 V1.0; Chr43_56056639 is located at chromosome 43 position 56056639, and the polymorphism is C / T; Chr15_65268299 is located at chromosome 15 position 65268299, and the polymorphism is G / A.

2. Molecular marker characterized in that, Comprising: one or more of Chr27_83344296 marker, Chr43_56056639 marker or Chr15_65268299 marker; the Chr27_83344296 marker comprises the nucleotide sequence as shown in SEQ ID NO. 1, and there is a polymorphism at position 156, which is G / T; the Chr43_56056639 marker comprises the nucleotide sequence as shown in SEQ ID NO. 2, and there is a polymorphism at position 139, which is C / T; the Chr15_65268299 marker comprises the nucleotide sequence as shown in SEQ ID NO. 3, and there is a polymorphism at position 179, which is G / A.

3. A pair of primers characterized in that, The primer pair is used for amplifying the SNP site in claim 1, or the molecular marker in claim 2.

4. The primer pair according to claim 3, characterized in that, The primer pair comprises one or more of the following: (1) the primers as shown in SEQ ID NO. 4 and SEQ ID NO. 5; (2) the primers as shown in SEQ ID NO. 6 and SEQ ID NO. 7; (3) the primers as shown in SEQ ID NO. 8 and SEQ ID NO.

9.

5. A kit characterized in that, The molecular marker in claim 2, or the primer pair in claim 3 or 4.

6. The SNP site in claim 1 as a target in any one of the following: (1) predicting or detecting the kernel oil content of Camellia reticulata; (2) identifying or breeding Camellia reticulata varieties with high kernel oil content; (3) molecular marker assisted breeding of Camellia reticulata; (4) Camellia reticulata variety improvement related to kernel oil content; (5) Camellia reticulata germplasm improvement.

7. The molecular marker in claim 2, or the primer pair in claim 3 or 4, or the kit in claim 5, is used in any one of the following: (1) predicting or detecting the kernel oil content of Camellia reticulata, or preparing a reagent for predicting or detecting the kernel oil content of Camellia reticulata; (2) identifying or breeding Camellia reticulata varieties with high kernel oil content, or preparing a reagent for identifying or breeding Camellia reticulata varieties with high kernel oil content; (3) molecular marker assisted breeding of Camellia reticulata; (4) Camellia reticulata variety improvement related to kernel oil content; (5) Camellia reticulata germplasm improvement.

8. A method for detecting the oil content of the seed kernel of Camellia oleifera Abel, characterized in that, Comprising: detecting the polymorphism of the SNP site in claim 1 or the molecular marker in claim 2 in a Camellia reticulata sample to be tested; The oil content of the kernels of the Hainan camellia oleifera samples to be tested was determined based on the genotype test results.

9. The method of claim 8, wherein, The detection methods include one or more of the following: PCR amplification, probe hybridization, gene chip, gene sequencing, or mass spectrometry.

10. The method according to claim 8 or 9, characterized in that, The determination of the kernel oil content of the Hainan camellia oleifera sample based on the genotype detection results includes: If the genotype test result of Chr27_83344296 is G / G, then the Hainan Camellia oleifera to be identified has a high kernel oil content; if the test result is G / T or T / T, then the Hainan Camellia oleifera to be identified has a low kernel oil content. If the genotype test result of Chr43_56056639 is C / C, then the Hainan Camellia oleifera to be identified has a high kernel oil content; if the test result is C / T or T / T, then the Hainan Camellia oleifera to be identified has a low kernel oil content. If the genotype test result of Chr15_65268299 is G / G, then the Hainan Camellia oleifera to be identified is a high kernel oil content variety; if the test result is A / A, then the Hainan Camellia oleifera to be identified is a candidate for high kernel oil content variety; if the test result is G / A, then the Hainan Camellia oleifera to be identified is a low kernel oil content variety.

Images