Application of citrus psylla saliva gene DcPS2 in prevention and treatment of citrus psylla and huanglongbing

By silencing the salivary gland gene DcPS2 of the citrus psyllid, and utilizing RNA interference technology and biological insecticides, the problem of target gene deficiency was solved, achieving efficient control of the citrus psyllid and Huanglongbing (HLB), providing an environmentally friendly solution.

CN122128315APending Publication Date: 2026-06-02GANNAN NORMAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
GANNAN NORMAL UNIV
Filing Date
2026-03-19
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

The lack of effective target genes in current technologies limits the application of RNA biopesticides in the control of citrus psyllids and Huanglongbing (HLB), while traditional chemical pesticide control has problems such as environmental pollution and pest resistance.

Method used

RNA interference technology was used to silence the salivary gland gene DcPS2 of the citrus psyllid, causing the citrus psyllid to die through gene silencing. The dsDcPS2 biological insecticide was then prepared and micro-injected into the citrus psyllid to cultivate citrus varieties resistant to citrus psyllid and resistant to Huanglongbing (HLB).

Benefits of technology

It significantly increased the mortality rate of citrus psyllids, reduced the number of pests, effectively prevented the spread of Huanglongbing (HLB), and provided a green control method.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122128315A_ABST
    Figure CN122128315A_ABST
Patent Text Reader

Abstract

This invention provides the application of the citrus psyllid salivary gland gene DcPS2 in the control of citrus psyllids and Huanglongbing (HLB). The nucleotide sequence of the citrus psyllid salivary gland gene DcPS2 is shown in SEQ ID NO. 1. This invention introduces dsDcPS2 into psyllids and measures the effect of DcPS2 gene silencing on psyllid survival. Experimental results show that after DcPS2 gene silencing, the mortality rate of citrus psyllids significantly increased compared to the control dsGFP, which has significant value for the control of citrus psyllids and the cultivation of psyllid-resistant plants.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of the citrus psyllid salivary gland gene DcPS2 in the control of citrus psyllids and Huanglongbing (HLB). Background Technology

[0002] Huanglongbing (HLB) is the most devastating disease affecting citrus production globally, often referred to as the "cancer" of citrus. In my country, HLB annually affects over 2 million mu (approximately 133,333 hectares). Taking Ganzhou, Jiangxi Province as an example, since 2013, an outbreak of HLB has resulted in the felling of over 50 million diseased trees, causing nearly 10 billion yuan in economic losses. Citrus psyllids release salivary effectors to promote phloem feeding, thereby increasing the likelihood of HLB transmission. Controlling their population is crucial to preventing the spread of HLB into a major disaster.

[0003] Currently, the control of citrus psyllids mainly relies on pesticides. Traditional chemical pesticide control strategies not only cause environmental pollution but also easily lead to pesticide resistance in pests. Therefore, developing green and pollution-free control methods is particularly important. As a new generation of insect-resistant technology and an important future pest control solution, RNA biopesticides have shown promising application prospects in the molecular control of citrus psyllids. However, the lack of highly efficient target genes, especially those related to citrus psyllid feeding, limits the further application of this technology. Summary of the Invention

[0004] In view of this, the present invention provides an application of the citrus psyllid salivary gland gene DcPS2 in the control of citrus psyllids and Huanglongbing (HLB). After the DcPS2 gene is silenced, the mortality rate of citrus psyllids increases significantly, which is of great value for the control of citrus psyllids and the cultivation of psyllid-resistant plants.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides an application of the citrus psyllid salivary gland gene DcPS2 in the control of citrus psyllids, the nucleotide sequence of which is shown in SEQ ID NO. 1.

[0006] Secondly, the present invention provides an application of the citrus psyllid salivary gland gene DcPS2 in the prevention and control of Huanglongbing (HLB), wherein the nucleotide sequence of the citrus psyllid salivary gland gene DcPS2 is shown in SEQ ID NO. 1.

[0007] Thirdly, the present invention provides a method for the application described above, which reduces the spread of citrus Huanglongbing by silencing the DcPS2 gene to kill citrus psyllids.

[0008] Preferably, the gene silencing is performed using RNA interference technology.

[0009] Preferably, the RNA interference technology includes the following steps: using citrus psyllid cDNA as a template, obtaining a partial fragment of the gene DcPS2 using PCR technology and amplification primers, ligating the amplification product into a plasmid, using the plasmid as a template, amplifying with primers containing a promoter, recovering the amplification product from the gel, and synthesizing dsDcPS2; diluting the synthesized dsDcPS2 and microinjecting it into citrus psyllids.

[0010] Preferably, the amplification primers are as follows: DcPS2 F1: ATGTACGGAAAAGTCATCGCTT; DcPS2 R1: TTATATGTAAGGGTAGACGACGG.

[0011] Preferably, the promoter-containing primer is as follows: DcPS2-T7 F:ggatcctaatacgactcactataggggGCTCCTCAACCAGAGCCA DcPS2-T7 R:ggatcctaatacgactcactataggggTTATATGTAAGGGTAGACGA.

[0012] Fourthly, the present invention provides a biological insecticide containing dsDcPS2 of the citrus psyllid salivary gland gene DcPS2.

[0013] Preferably, the dsDcPS2 nucleotide sequence is synthesized as shown in SEQ ID NO. 2.

[0014] SEQ ID NO. 2: GCTCCTCAACCAGAGCCAGGCTATGTCAGCAAATTTGGCAACTACGTTCCAACCGTGGAAGACTACGCCTACCCCAGAGGTTATCCTACAACCCAGCCTACTACCCATACAGCCCTTATGTCGACTATCCCAACCAACCTTATGTGTACGCAAGATCCTCCGTCGTCTACCCTTACATATAA.

[0015] Fifthly, this invention provides an application of the citrus psyllid salivary gland gene DcPS2 in the breeding of citrus varieties resistant to citrus psyllids and resistant to Huanglongbing (HLB).

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: Screening suitable target genes is a prerequisite for RNAi insect resistance. In this invention, dsDcPS2 was introduced into the psyllid and the effect of DcPS2 gene silencing on the survival of the psyllid was measured. The experimental results showed that after DcPS2 gene silencing, the mortality rate of citrus psyllids increased significantly compared with the control dsGFP, which is of great value for the control of citrus psyllids and the cultivation of psyllid-resistant plants. Attached Figure Description

[0017] Figure 1 The present invention provided in Embodiment 1 DcPS2 Gel electrophoresis image of the ORF amplification products of the gene; Figure 2 The present invention provided in Embodiment 2 DcPS2 A graph showing gene expression analysis at different developmental stages; Figure 3 The present invention provided in Embodiment 2 DcPS2 base Analysis diagram of expression in different tissue regions; Figure 4 This is an electrophoresis diagram of dsDcPS2 and dsGFP provided in Example 3 of the present invention. Detailed Implementation

[0018] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can more clearly understand the present invention.

[0019] Key experimental material sources and physicochemical parameters: The experimental material was the citrus psyllid, which was provided by the insect rearing room of the National Navel Orange Engineering Technology Research Center of Gannan Normal University. The rearing host was Murraya paniculata. The environmental conditions were a temperature of (28±2)℃, a humidity of 60-80%, and a photoperiod of L∶D=14∶10.

[0020] Instruments: GeneAmp PCR System 9700, LC96 real-time PCR instrument, high-speed centrifuge, ultra-low temperature freezer, NanoDrop OneC micro-volume nucleic acid analyzer, clean bench, microscope, tweezers, pipettes, etc.

[0021] Drugs and reagents: TaKaRa Trizol reagent, PrimeSTAR high-fidelity polymerase, TaKaRa gel extraction kit; T vector ligation kit, reverse transcription kit, and real-time fluorescence quantitative kit were all purchased from TransGen Biotech Ltd.; plasmid extraction kit was purchased from Beijing Tiangen Biotech Co., Ltd.; T7 RiboMAX™ Express RNAi System kit was purchased from Promega; other biochemical reagents were purchased from Shanghai Sangon Biotech Co., Ltd.

[0022] Example 1: ORF amplification of the salivary gland gene DcPS2 in citrus psyllids One hundred citrus psyllids were collected from rearing cages using a collector. The heads of the psyllids were dissected under a dissecting microscope using forceps. RNA was then extracted from the citrus psyllids using Trizol. (EasyScript) ® One-Step gDNA Removal and cDNA Synthesis SuperMix Reverse Transcription Kit synthesizes cDNA.

[0023] Based on the DcPS2 gene sequence obtained from the salivary protein transcriptome of the citrus psyllid, specific primers were designed using Premier Primer 5.0 software and named DcPS2-F1 and DcPS2-R1. Using cDNA as a template and DcPS2-F1 and DcPS2-R1 as primers, the ORF of the DcPS2 gene was amplified using the high-fidelity enzyme PrimeSTAR Max DNA Polymerase. (DcPS2 F1: ATGTACGGAAAAGTCATCGCTT; DcPS2 R1: TTATATGTAAGGGTAGACGACGG) Figure 1 As shown, specific primers were designed and synthesized based on RNA-seq data from the salivary glands of the citrus psyllid, and PCR amplification was performed. After gel extraction and recovery, the DNA was ligated, transformed, and sent to a sequencing company to obtain the nucleotide sequence of the gene. Sequencing results showed that the open reading frame length of the DcPS2 gene was 255 bp, predicting that it encodes 84 amino acids. The DL2000 DNA marker showed band sizes of 100, 250, 500, 750, 1000, and 2000 bp.

[0024] The PCR amplification products were recovered and purified using a Takara gel extraction kit, and then compared with pEASY. ® - The Blunt cloning vector was ligated, transformed into E. coli DH5α, and identified by sequencing. The DcPS2 gene sequence is shown below: SEQ ID NO. 1: ATGTACGGAAAAGTCATCGCTTTTGTTGTGATCTTGGCTGCTGTTGCCACAGCAGAACCAAACCCAGAACCAGCTCCTCAACCAGAGCCAGGCTATGTCAGCAAATTTGGCAACTACGTTCCAACCGT GGAAGACTACGCCTACCCCAGAGGTTATCTCTACAACCCAGCCTACTACCCATACAGCCCTTATGTCGACTATCCCAACCAACCTTATGTGTACGCAAGATCCTCCGTCGTCTACCCTTACATATAA.

[0025] Example 2: Expression analysis of the salivary gland gene DcPS2 in citrus psyllids To investigate the expression of the DcPS2 gene in different tissues and developmental stages of the citrus psyllid, samples were collected under a dissecting microscope. Different tissues of the citrus psyllid, including the salivary glands, head, legs, wings, epidermis, and midgut, were dissected. To study the expression level of the DcPS2 gene in the salivary glands of the citrus psyllid at different developmental stages, samples from psyllids at different stages, including eggs, first instar nymphs, second instar nymphs, third instar nymphs, fourth instar nymphs, fifth instar nymphs, and adults, were collected under a dissecting microscope. RNA was extracted from different tissues and developmental stages of the citrus psyllid using the Trizol RNA extraction kit. cDNA was synthesized by reverse transcription according to the instructions of the reverse transcription kit. Finally, qRT-PCR was used to detect the expression level of the DcPS2 gene in the salivary glands of the citrus psyllid at different tissues and developmental stages. The primers used were DcPS2-F2 and DcPS2-R2. The Actin genes (DcActinF and DcActin R) and GAPDH genes (DcGAPDH F and DcGAPDH R) of the citrus psyllid were used as internal controls for qPCR. PerfectStart reagent was used for real-time quantitative PCR. ® Green qPCR SuperMix (full gold).

[0026] The primers for qRT-PCR detection are as follows: DcPS2 F2: CAGAACCAAACCCAGAACCA DcPS2 R2:GTAGTAGGCTGGGTTGTAGAGA DcActin F:AGAAAGTACTCCGTGTGGATTG DcActin R: CGGACTCGTCGTATTCTTGTT DcGAPDH F:TGAGATCAAGGCCAAGGTAAAG DcGAPDH R: GTCAAAGATGGAGGAGTGAGTG.

[0027] To investigate the spatiotemporal expression of the DcPS2 gene, the expression level of the DcPS2 gene in different developmental stages and tissues of the citrus psyllid was analyzed using real-time quantitative PCR. -ΔΔCT The method processes the data. The results are as follows: Figure 2 and Figure 3 As shown, the DcPS2 gene is expressed at all developmental stages of the citrus psyllid, with relatively high expression levels in first and second instar nymphs. Tissue expression analysis revealed that the expression levels of the DcPS2 gene in the salivary glands and head of the citrus psyllid were 18,967 times and 93 times higher than those in the epidermal tissue, respectively, indicating that this gene may be specifically expressed in the salivary glands of the citrus psyllid.

[0028] Example 3 Synthesis of dsRNA from the salivary gland gene DcPS2 in citrus psyllids (1) Primer design and gene cloning Primers DcPS2 F3, DcPS2 R3, DcPS2-T7 F, DcPS2-T7R, GFP-F, GFP-R, GDP-T7F, and GFP-T7R were designed using Primer Primer 5.0 software and synthesized by Shanghai Sangon Biotech Co., Ltd.

[0029] The specific primers for DcPS2 dsRNA synthesis are as follows: DcPS2 F3: GCTCCTCAACCAGAGCCA DcPS2 R3: TTATATGTAAGGGTAGACGA DcPS2-T7 F: ggatcctaatacgactcactataggggGCTCCTCAACCAGAGCCA DcPS2-T7 R: ggatcctaatacgactcactataggggTTATATGTAAGGGTAGACGA The specific primers for GFP dsRNA synthesis are as follows: GFP F: ACAAGTTCAGCGTGTCCG GFP R: TCACCTTGATGCCGTTCT GFP-T7 F: ggatcctaatacgactcactataggggACAAGTTCAAGCGTGTCCG GFP-T7 R: ggatcctaatacgactcactatagggTCACCTTGATGCCGTTCT The lowercase letters in each primer sequence represent the T7 RNA polymerase promoter sequence.

[0030] The PCR reaction system consisted of: 25 μL of high-fidelity enzyme PrimeSTAR Max Premix (2X) and forward primer (10 μmol·L⁻¹). -1 2 μL of reverse primer (10 μmol·L⁻¹) -1 2 μL of plasmid, 2 μL of plasmid (diluted 50 times), and 19 μL of ddH2O.

[0031] The reaction program for PCR of the DcPS2 gene is as follows: 98℃ for 10s, 52℃ for 15s, 72℃ for 30s; 35 cycles, stored at 4℃.

[0032] The reaction program for GFP gene PCR was as follows: 98℃ for 10s, 56℃ for 15s, 72℃ for 30s; 35 cycles, stored at 4℃.

[0033] Using the DcPS2 ORF plasmid as a template, the DNA fragment of dsDcPS2 was amplified by primers DcPS2 F3 and DcPS2-T7 R, and DcPS2-T7 F and DcPS2 R3, respectively.

[0034] Using 16318hGFP plasmid as a template, GFP F and GFP-T7 R, and GFP-T7 F and GFP R were used as primers for amplification to obtain the DNA fragment for synthesizing dsGFP.

[0035] dsDcPS2 and dsGFP gel images are shown below Figure 4 As shown, the DL2000 DNA marker has band sizes of 100, 250, 500, 750, 1000, and 2000 bp.

[0036] (2) Preparation of dsRNA of salivary gland genes DcPS2 and GFP in citrus psyllid The two DNA products amplified by DcPS2-F3 and DcPS2-T7 R, and DcPS2-T7 F and DcPS2-R3 were purified according to the instructions of the TaKaRa DNA Product Purification Kit.

[0037] The two purified products obtained above were measured for concentration and used as templates for in vitro transcription of dsRNA. The following steps were performed according to the Promega T7 RiboMAX™ Express RNAi System kit instructions. The in vitro transcription system for dsRNA was as follows: RiboMAX™ Express T7 2X Buffer10.0μL 8 μL linear DNA template Enzyme Mix, T7 Express 2.0μL Total 20μL After incubating at 37 °C for two hours, the products from the two systems were mixed.

[0038] dsRNA annealing: 70℃ water bath for 10 min, then cool to room temperature.

[0039] dsRNA purification: Add 1 μL (1:200 enzyme-free water dilution) RNase and 1 μL RQ1, incubate at 30°C for 30 min; add 60 μL enzyme-free water, 10 μL sodium acetate, and 100 μL isopropanol, incubate on ice for 5 min, then at 12000 rpm for 10 min; wash the precipitate with 1 mL of 75% ethanol, at 7500 rpm for 5 min; incubate in a fume hood at room temperature for 20 min, then add 50 μL enzyme-free water to dissolve the dsRNA. Following this procedure, dsDcPS2 of the citrus psyllid was obtained, and dsGFP was obtained using the same procedure.

[0040] Take 1 μL of the above dsRNA, dilute it 10-fold, and store the remaining dsRNA at -20°C; take 2 μL of the diluted dsRNA and use Nano Drop One. C Concentration was determined using an ultra-micro nucleic acid analyzer.

[0041] Example 4: dsRNA microinjection and biodetection Citrus psyllid dsDcPS2 injection group: 10 citrus psyllids that had emerged 3 days prior were injected with 500 ng of dsDcPS2 each and then reared on Murraya paniculata plants.

[0042] Citrus psyllid dsGFP injection group: 10 citrus psyllids that had emerged 3 days prior were injected with 500 ng of dsGFP each and reared on Murraya paniculata plants.

[0043] Each group was set up with 10 replicates and placed in an artificial climate chamber (temperature (28±2)℃, humidity 60-80%, photoperiod L∶D=14∶10). The number of citrus psyllids surviving in each Murraya paniculata was counted daily. The results are shown in Table 1.

[0044] Table 1. Mortality rates (%) in the dsDcPS2 and dsGFP injection groups

[0045] Note: Compared with the control group ( dsGFP Compared to (Multiple t-test; n=10;) , p <0.05; , p <0.01).

[0046] As shown in Table 1, the mortality rate of dead citrus psyllids in the dsDcPS2 injection group was significantly increased compared with the control dsGFP, and the mortality rate showed an upward trend over time, reaching 58% on the tenth day.

[0047] Example 5: dsDcPS2 inhibits the expression of the salivary gland gene DcPS2 in citrus psyllids. Primers DcPS2-F2 and DcPS2-R2 for amplifying the DcPS2 gene, as well as internal reference genes Actin (DcActin F and DcActin R) and GAPDH (DcGAPDH F and DcGAPDH R), were designed using Primer Primer 5.0 software.

[0048] Following step 4, citrus psyllid samples were collected from each group after microinjection of dsRNA for 48 h and 96 h, with 5 groups each of dsDcPS2 and dsGFP, and 5 citrus psyllids in each group. RNA was extracted from citrus psyllids using the Takara Bio Trizol kit; it was reverse transcribed into cDNA using the Total Gold Reverse Transcription Kit; after a 20-fold dilution, it was used as a template for real-time quantitative PCR, with DcPS2-F2 and DcPS2-R2 as primers, and Actin genes (DcActin F and DcActin R) and GAPDH genes (DcGAPDH F and DcGAPDH R) as internal control genes.

[0049] The real-time quantitative PCR system is as follows: forward primer (10 μmol·L⁻¹) -1 0.4 μL of reverse primer (10 μmol·L⁻¹) -1 0.4 μL, 2×PerfectStart ® Green qPCR SuperMix 10μL, template cDNA 4μL, ddH2O 5.2μL.

[0050] The PCR cycling program was as follows: 95℃ for 10 min; 2-step method: 95℃ for 5 s, 60℃ for 30 s, 40 cycles; melting curve: 95℃ for 10 s, 65℃ for 1 min, 97℃ for 1 s. Each sample was replicated in triplicate.

[0051] The final result is calculated using 2 -△△Ct The calculation was performed using the method (Ct represents the cycle number), and the results are shown in Table 2.

[0052] Table 2. Relative expression levels of the salivary gland gene DcPS2 in different injection groups of citrus psyllids

[0053] Note: * indicates a significant difference in results between the experimental group and the control group (dsGFP) (t < 0.05). test; n = 3; P <0.05).

[0054] As shown in Table 2, the relative expression level of the salivary gland gene DcPS2 in the dsDcPS2 injection group was significantly reduced compared with the control dsGFP. dsDcSP2 can reduce the relative expression level of the salivary gland gene DcPS2 in the citrus psyllid, thereby increasing the mortality rate of the citrus psyllid and thus achieving the goal of controlling the population of citrus psyllids and preventing the spread of Huanglongbing (HLB).

[0055] Unless otherwise specified, all raw materials used in this invention are existing substances that can be purchased directly from the market.

[0056] The above are merely preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. The application of the citrus psyllid salivary gland gene DcPS2 in the control of citrus psyllids, characterized in that, The nucleotide sequence of the salivary gland gene DcPS2 of the citrus psyllid is shown in SEQ ID NO.

1.

2. The application of the citrus psyllid salivary gland gene DcPS2 in the control of Huanglongbing (HLB), characterized in that, The nucleotide sequence of the salivary gland gene DcPS2 of the citrus psyllid is shown in SEQ ID NO.

1.

3. The method of application according to claim 1 or 2, characterized in that, Citrus Huanglongbing (HLB) can be controlled by silencing the DcPS2 gene to kill citrus psyllids and reduce its spread.

4. The method of application according to claim 3, characterized in that, The gene silencing was performed using RNA interference technology.

5. The method of application according to claim 4, characterized in that, The RNA interference technology includes the following steps: using citrus psyllid cDNA as a template, a partial fragment of the gene DcPS2 is obtained by PCR technology using amplification primers, the amplification product is ligated into a plasmid, the plasmid is used as a template, and amplification is performed using primers containing a promoter. The amplification product is recovered by gel and dsDcPS2 is synthesized. The synthesized dsDcPS2 is diluted and microinjected into citrus psyllids.

6. The method of application according to claim 5, characterized in that, The amplification primers are as follows: DcPS2 F1: ATGTACGGAAAAGTCATCGCTT; DcPS2 R1: TTATATGTAAGGGTAGACGACGG.

7. The method of application according to claim 5, characterized in that, The promoter-containing primers are as follows: DcPS2-T7 F:ggatcctaatacgactcactataggggGCTCCTCAACCAGAGCCA DcPS2-T7 R:ggatcctaatacgactcactataggggTTATATGTAAGGGTAGACGA.

8. A biological insecticide, characterized in that, The biological insecticide contains the dsRNA of the citrus psyllid salivary gland gene DcPS2.

9. The biological insecticide according to claim 8, characterized in that, The nucleotide sequence of the synthesized dsRNA is shown in SEQ ID NO.

2.

10. Application of the salivary gland gene DcPS2 of the citrus psyllid in the breeding of citrus varieties resistant to citrus psyllids and resistant to Huanglongbing (HLB).