A type of N for inhibiting GCRV infection 6 N 6 -Dimethyladenosine and its applications
By using the metabolite N6,N6-Dimethyladenosine to prepare drugs and feed additives, the problem of unclear metabolites of Shigella-like bacteria in the prior art has been solved, achieving effective prevention and control of grass carp hemorrhagic disease, with significant inhibitory effect on viral infection and safety.
Patent Information
- Application Number
- CN202610312590.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-16
- Publication Date
- 2026-06-05
Smart Images

Figure CN122140744A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and more specifically to a metabolite (N) that can significantly inhibit the infection efficiency of reovirus (GCRV) in host cells. 6 N 6 -Dimethyladenosine, m2 6 A), and its application in the prevention or treatment of grass carp hemorrhagic disease. Background Technology
[0002] my country is a major aquaculture country in the world, with grass carp ( Ctenopharyngodon idella As one of my country's major freshwater aquaculture species, grass carp is prized for its rapid growth, wide availability of feed, and high economic value. According to the 2025 China Fisheries Statistical Yearbook, my country's annual grass carp production has exceeded 6 million tons, consistently ranking first in freshwater aquaculture. However, with the promotion of high-density intensive aquaculture, environmental pressures in aquaculture areas are increasing, leading to frequent disease outbreaks. Among these, grass carp hemorrhagic disease caused by Grass Carp Reovirus (GCRV) is the most serious and economically damaging viral infectious disease.
[0003] Grass carp reovirus (GCRV) is the first fish virus independently isolated and identified in my country. This virus particle exhibits icosahedral symmetry, lacks an envelope, and its genome consists of 11 double-stranded RNA (dsRNA) segments, demonstrating extremely high infectivity and pathogenicity. Grass carp hemorrhagic disease caused by GCRV infection has a rapid onset and spreads quickly, with mortality rates often reaching 60%–90% in fry and fingerling stages. Moreover, resistant fish often become latent carriers, continuously shedding the virus into the environment. Notably, the occurrence and spread of this disease show a significant temperature dependence. As poikilothermic animals, grass carp's physiological functions are strictly regulated by environmental temperature. Epidemiological surveys have confirmed that water temperatures of 25℃–30℃ are the peak period for GCRV outbreaks, while when water temperatures are below 20℃, the disease often remains in the incubation period or the onset of symptoms slows down. This unique temperature dependence suggests that differences in the host's physiological metabolic state under different temperature environments are likely a key factor determining the strength of its antiviral ability.
[0004] Previous studies have found that ambient temperature is a key factor affecting the structure of the host's gut microbiota and its antiviral capabilities. Microbiome analysis showed that under high temperature (28℃) and acute heat stress conditions, *Shigella*-like bacteria (*O. shigella*) in the host gut... Plesiomonas shigelloidesThe abundance of this microbiota was significantly upregulated, suggesting that it may be a potential protective component for the host in response to heat stress and intestinal homeostasis. However, the abundance of this microbiota was significantly downregulated after GCRV infection, showing a dynamic change closely related to the host's disease resistance status. Further in vivo and in vitro experiments confirmed that artificial supplementation with *Shigella* significantly inhibited GCRV infection and replication.
[0005] Based on the above findings, the inventors previously confirmed that *Shigella spp.* possesses significant anti-GCRV activity, but the specific material basis and molecular mechanism of its antiviral effect remain unclear. The scientific community has not yet determined which key metabolite in this strain inhibits GCRV replication. Furthermore, considering the biosafety risks and poor heat resistance inherent in live bacterial preparations in practical applications, there is an urgent need to identify structurally defined, safe, and stable core effector molecules from this functional strain. Finding and identifying this endogenous active metabolite that can replace live bacteria in exerting antiviral effects is of significant scientific and practical value for overcoming the limitations of live bacterial preparations and developing novel anti-grass carp hemorrhagic disease drugs with clearly defined mechanisms. Summary of the Invention The purpose of this invention
[0006] An endogenous metabolite capable of significantly inhibiting GCRV replication is provided, as well as a pharmaceutical composition, feed additive, or functional feed containing the metabolite, and its use in the preparation of drugs for the prevention or treatment of grass carp hemorrhagic disease.
[0007] To achieve the above objectives, the present invention adopts the following technical solution:
[0008] In a first aspect, the present invention provides a metabolite N 6 N 6 The use of β-dimethyladenosine in the preparation of drugs, feed additives or functional feeds for the prevention or treatment of GCRV infection.
[0009] Secondly, the present invention provides a pharmaceutical composition for preventing and treating hemorrhagic disease in grass carp, the pharmaceutical composition comprising an effective amount of N. 6 N 6 -Dimethyladenosine and pharmaceutically acceptable carriers or excipients.
[0010] In some embodiments, the dosage form includes injection, oral liquid, soaking solution, powder, granules, microcapsules or tablets.
[0011] In some embodiments, the pharmaceutical composition is administered by injection, oral administration (mixing), or soaking.
[0012] Thirdly, the present invention provides an antiviral feed additive or compound feed, comprising N 6 N 6 -Dimethyladenosine is the active ingredient.
[0013] In some embodiments, the feed additive is in the form of a premix that can withstand high-temperature pelleting or extrusion processes.
[0014] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0015] 1. Significant effects: In vitro and in vivo experiments have confirmed that the metabolite N described in this invention has significant effects. 6 N 6 -Dimethyladenosine can significantly reduce the infection rate of GCRV in host cells, reduce viral load, and alleviate infection-related symptoms.
[0016] 2. Green and safe: It has natural biocompatibility, no toxic side effects, no withdrawal period restrictions, and meets the development needs of green and healthy aquaculture.
[0017] 3. Wide range of applications: It can be developed into various forms such as drugs, functional foods, health products, and feed additives for the prevention and treatment of hemorrhagic disease in grass carp. Attached Figure Description
[0018] Figure 1 To establish a temperature-dependent model for GCRV infection in the rare gudgeon and analyze viral tissue distribution; Figure 1 Figure A shows a schematic diagram of the experimental process for infecting rare gudgeon with GCRV at different temperatures (18℃, 28℃); Figure 1 The data in section B represents the qPCR analysis of viral replication levels in different tissues of rare gudgeon infected with GCRV at different time points under conditions of 18℃ and 28℃.
[0019] Figure 2 Based on Shigella-like enomonas ( Plesiomonas shigelloides Metabolomics analysis to screen key antiviral metabolites based on abundance differences.
[0020] Figure 3 m2 6 A inhibits CIK cells from infecting GCRV; Figure 3 In the middle, A is m2 6 A flowchart for inhibiting CIK cell infection with GCRV; Figure 3 B represents CIK cells plus m2 6 qPCR analysis of GCRV virus-related genes after A infection. Detailed Implementation
[0021] To make the technical problems, technical solutions and advantages of the present invention clearer, a detailed description will be given below in conjunction with the accompanying drawings and specific embodiments.
[0022] Experimental materials: 1. Cells, viral strains The grass carp kidney cell lines CIK and GCRV strains are preserved in our laboratory.
[0023] 2. Reagents and Kits M199, DMEM culture medium, and fetal bovine serum (Gibco) were purchased from Changsha Boyi Biotechnology Co., Ltd. 6 N 6 -Dimethyladenosine, purchased from Ombio Biotechnology (Shanghai) Co., Ltd.
[0024] 3. RNA extraction, reverse transcription, and quantitative fluorescence analysis RNA extraction kit was purchased from Ambion, reverse transcription kit from Thermo, and SYBR Green PCRMaster Mix from Vazyme.
[0025] Instrument consumables: Cell culture dishes, cell culture plates, and cell culture flasks were purchased from Corning.
[0026] Centrifuges and CO2 incubators were purchased from Thermo Fisher Scientific, as were cell manipulation tables. The pure water system was purchased from Millipore, and the quantitative PCR system was a Bio-Rad CFX96™ Real-Time System.
[0027] Example 1: Establishment of a rare gudgeon infection model of GCRV at different temperatures and the distribution pattern of the virus in tissue tissues.
[0028] Experimental methods: 1. Rare gudgeon infected with GCRV at different temperatures Ninety rare gudgeon were temporarily held for one week and then divided into two groups, acclimatizing to their respective temperatures of 18°C and 28°C for seven days. Diseased fish were homogenized to obtain grass carp reovirus (GCRV) stock solution, which was then diluted 10-fold. 20 μL of the diluted virus solution was injected intraperitoneally into each of the three groups of rare gudgeon. On days 1, 3, and 5 after injection, three rare gudgeon from each group were selected, and their tissues were collected.
[0029] 2. RNA extraction Follow the instructions in the TRIzol™ Reagent (Ambion) reagent manual for total RNA extraction: 1) Aspirate the culture medium from the well plate; 2) Rinse 1-2 times with sterile PBS; 3) Add 1 ml of Trizol lysis buffer to each well (6-well plate), let stand for 5 min, then repeatedly pipette until the cells are completely lysed, and transfer to a 1.5 ml enzyme-free centrifuge tube; 4) Transfer the liquid to a 1.5 mL enzyme-free centrifuge tube, add 200 µL of chloroform, shake well, and let stand for 15 min. 5) Centrifuge at 4℃, 12000g for 15min, and transfer the upper aqueous phase (measured) to a new enzyme-free centrifuge tube; 6) Add an equal volume of isopropanol (pre-cooled with ice), mix gently, and let stand at room temperature for 15 minutes; 7) Centrifuge at 4℃, 12000g for 10 minutes, discard the supernatant, and let the RNA settle at the bottom of the tube; 8) Add 1 mL of pre-cooled 75% ethanol (prepared with DEPC water), gently shake the centrifuge tube to suspend the precipitate (invert and mix for 10 seconds, then wash). 9) Centrifuge at 4℃, 8000g for 5 minutes, and discard as much of the supernatant as possible (pour carefully to ensure that the RNA is not discarded); 10) Air dry at room temperature for 5-10 minutes (the RNA should not be too dry, otherwise it will be difficult to dissolve); 11) Dissolve RNA samples in DEPC water; 12) Measure the concentration with a spectrophotometer, record the data, and store at -80℃.
[0030] 3. cDNA first-strand synthesis Refer to RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Cat#:K1622) The kit instructions are as follows: Premixed I is shown in Table 1: Table 1 Premixed Reaction System Reagent Volume <![CDATA[oligdT 18 ]]> 0.5 μL / sample Random Primer 0.5 μL / sample Sample 2000 / RNA concentration DEPC water 11 μL - sample 12μL system: 65℃ for 5min Premixed II is shown in Table 2: Table 2 Premixed Reaction System Reagent Volume Reaction Buffer 4 μL / sample dNTP 2 μL / sample RT 1 μL / sample RI 1 μL / sample 20 μL system: 25℃ 5 min → 42℃ 70 min → 70℃ 5 min → 4℃ +∞ 4. Quantitative Real-Time PCR 1) Primer design: a. Primer length is 20 or 21 bp; b. Primers cannot contain 5 consecutive identical bases; c. The bases at both ends of each primer should preferably be G or C; d. GC content is 45%~55%; e. The size of the PCR product is 85~300 bp.
[0031] All primers used in this invention were designed using Prime5, and are listed in Table 3. Table 3 Primer sequences q-PCR primer Sequence β-actin-qF SEQ ID No.1: CTATGTTGGTGACGAGGCTCA β-actin-qR SEQ ID No.2: CCCAGTTGGTGACAATACCG GCRV-Ⅱ-qF SEQ ID No.3: GTACAGCATTTGGCACGTCT GCRV-Ⅱ-qR SEQ ID No.4: TCCGCTGAATCGACATACCAC 2) Quantitative PCR system in 10 μL (Vazyme, Cat#: Q711-02), see Table 4; Table 4 Reaction System Reagent Volume 2 × ChamQ Universal SYBR qPCR Master Mix 5.0 μL Primer1 (10 μM) 0.4 µL Primer2 (10 μM) 0.4 µL Template DNA / cDNA x μL <![CDATA[ddH2O]]> To 10.0 μL 3) qPCR procedure, see Table 5: Table 5 Reaction System 1 95.0℃ for 0:30 2 95.0℃ for 0:05 3 60.0℃ for 0:40 + Plate Read 4 GO TO 2, 45 more times 5 Melt Curve 65.0℃ to 95.0℃, increment 0.5 ℃, for 0:05 +Plate Read END Experimental Results and Discussion: like Figure 1 As shown, the viral replication levels in the brain, gills, liver, intestines, and skin of the 28℃ group were significantly higher than those of the 18℃ group. In particular, at 28℃, the virus rapidly multiplied in all tissues over time, while the viral load in the 18℃ group remained at extremely low levels. This indicates that GCRV infection is strongly temperature-dependent, and 28℃ is the critical susceptible temperature for viral outbreak and replication.
[0032] Example 2: Screening of key bioactive metabolites for N based on non-targeted metabolomics 6 N 6 -Dimethyladenosine
[0033] Experimental methods: 1. Non-targeted metabolomics Intestinal contents samples of rare gudgeon from the 28℃ and 18℃ groups in Example 1 were collected, and the non-targeted metabolomics detection was performed by Beijing Novogene Technology Co., Ltd.
[0034] Experimental Results and Discussion: like Figure 2 As shown, by comparing the intestinal metabolic profiles of the 28℃ group and the 28℃ group, we constructed a heatmap of differential metabolite clusters. According to the results, N6 and N6-Dimethyladenosine showed significant differences between the two groups.
[0035] Example 3, N 6 N 6 -Dimethyladenosine inhibits CIK cells infected with GCRV
[0036] Experimental methods: The experimental methods for RNA extraction, reverse transcription, and quantitative fluorescence are the same as in Example 1.
[0037] 1. Cell resuscitation and passage culture 1) Cell thawing: Remove the frozen cells and place them in a 37°C digital display water bath to thaw completely within 1-2 minutes. Carefully aspirate the cells in a sterile environment and add them to a 15mL centrifuge tube containing M199 or DMEM. Centrifuge at 800 r / min at room temperature for 5 minutes, carefully aspirate the supernatant, add 5mL of culture medium, gently pipette to resuspend the cell pellet, and transfer it to a T25 culture flask. Incubate at 28°C for 24 hours, change the medium, and observe the growth.
[0038] 2) Cell passage: Aspirate the culture medium and wash once with PBS. Add 1 mL of trypsin (0.25% Trypsin-EDTA) to the culture flask and place it in an incubator for 2 minutes to digest. Observe the cell digestion status in real time. When the cells become round, quickly return them to a sterile operating table, gently tap the culture flask, and add 5 mL of M199 or DMEM culture medium to stop digestion. Mix well with a pipette. The growth of adherent cells must be carefully monitored to ensure that the cells remain healthy. Depending on the cell type, many adherent cells need to be passaged when they reach 70-90% confluence.
[0039] 2. Cellular attack Replace the cultured cells with serum-free basal medium and add m2 6 Two hours after mixing with A / PBS, GCRV was added at a dose of approximately 10 MOI. Cells were collected after 12 hours to detect the efficiency of viral proliferation within the cells.
[0040] Experimental Results and Discussion: like Figure 3 As shown, m2 6 Cells were infected with GCRV after mixing with CIK for 12 hours, and RNA was extracted to detect viral load. Results showed m2 6 A can significantly inhibit CIK cells from infecting GCRV.
[0041] Based on the above three embodiments, we can conclude that m2 6 A can inhibit GCRV, providing a theoretical and factual basis for the development of drugs to combat grass carp hemorrhagic disease.
[0042] The above description represents the preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. N 6 N 6 -Dimethyladenosine (N 6 N 6 The use of β-Dimethyladenosine or a pharmaceutically acceptable salt thereof in the preparation of drugs, feeds or feed additives for the prevention or treatment of grass carp reovirus (GCRV) infection.
2. The application according to claim 1, characterized in that, The prevention or treatment of GCRV infection includes: inhibiting GCRV replication in host cells, reducing viral load in host tissues, or alleviating symptoms of grass carp hemorrhagic disease caused by GCRV infection.
3. The application according to claim 1, characterized in that, The dosage forms of the drug include injection, oral liquid, soaking agent, powder, granules, microcapsules or tablets; the dosage forms of the feed additive include premix or compound feed.
4. The application according to claim 1, characterized in that, The drug or feed additive also contains a pharmaceutically or feed-acceptable carrier.
5. The application according to claim 1, characterized in that, The methods of application include: spraying the drug into the water, injecting it into the fish via intraperitoneal injection, or mixing it into feed as a feed additive.