Ppmed25 gene for regulating peach fruit epicuticular wax synthesis and application thereof

CN122146779BActive Publication Date: 2026-08-11NINGBO UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610630118.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-05-09
Publication Date
2026-08-11
Estimated Expiration
2046-05-09

AI Technical Summary

Technical Problem

然而,迄今尚未有任何研究报道桃MED25 (PpMED25) 基因在果实表皮蜡质合成中的具体功能与调控机制

Benefits of technology

1、首次克隆了桃果实中介体复合物亚基基因PpMED25,并通过实验证实其在桃和番茄果实中过表达能正调控表皮蜡质(尤其是三萜和醇类)的合成。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146779B_ABST
    Figure CN122146779B_ABST
Patent Text Reader

Abstract

This invention discloses a PpMED25 gene that regulates the synthesis of wax in peach fruit epidermis and its application, characterized by: PpMED25 The nucleotide sequence of the gene is shown in SEQ ID NO.1. PpMED25 The amino acid sequence of the encoded protein is shown in SEQ ID No:2, and the above-mentioned... PpMED25 The application of genes in regulating the synthesis of waxy substances in peach fruit epidermis, through overexpression of genes in peach fruit epidermis. PpMED25 The gene causes it to synthesize an increased amount of wax on the peach fruit peel. PpMED25 Methods of gene expression include constructing the peach fruit PpMED25 The method of overexpressing the gene, transforming the overexpression vector into Agrobacterium, and then infecting peach peel also provides the application of the above gene in regulating the synthesis of wax in tomato fruit peel; the advantages are that it increases the content of triterpenoids and alcohols in the peel wax of the fruit, significantly delays fruit water loss, and reduces permeability.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of plant molecular biotechnology and genetic engineering, and specifically relates to a method for regulating the synthesis of waxy substances in peach fruit epidermis. PpMED25 Genes and their application in improving fruit storage performance. Background Technology

[0002] Peach( Prunus persica L. Batsch belongs to the genus Prunus of the family Rosaceae. Prunus L. Prunus subgenus ( Amygdalus L. The peach is a perennial deciduous fruit tree. As a typical climacteric fruit, peaches undergo rapid postharvest changes, making them highly susceptible to water loss, rotting, and mold growth after harvest. This leads to losses during storage and distribution, ultimately harming the economic interests of fruit growers. The cuticle, as the outermost protective layer of the peach fruit, plays a crucial role in resisting various biotic and abiotic stresses. The waxy layer, an external structure of the cuticle, enhances the fruit's storage capacity and preservation level by preventing water loss, reducing pathogen infection, and delaying fruit oxidation.

[0003] Studies have shown that wax synthesis is regulated by transcription factors, and Mediator 25 (MED25), a multifunctional subunit of the mediator complex, can directly interact with various transcription factors at the protein level, participating in a series of physiological activities in plants, including regulating multiple hormone signaling pathways, regulating plant development, and resisting biotic and abiotic stresses. However, to date, no research has reported the specific function and regulatory mechanism of the peach MED25 (PpMED25) gene in fruit epidermal wax synthesis. The application of the mediator complex subunit MED25 in postharvest preservation of climacteric fruits such as peaches remains unknown. Therefore, further research and verification are needed. PpMED25 The function of genes in regulating the synthesis of waxy substances in peach fruit epidermis is of great significance for developing new technologies to improve the storage performance of fruit. Summary of the Invention

[0004] The technical problem to be solved by this invention is to provide a method for regulating the synthesis of wax on the peach fruit peel that can significantly delay fruit water loss and reduce permeability. PpMED25 Genes and their applications can positively regulate the synthesis of waxy substances in the skins of peaches and tomatoes.

[0005] The technical solution adopted by this invention to solve the above-mentioned technical problems is: a method for regulating the synthesis of wax on the skin of peach fruits. PpMED25 Genes, as described PpMED25 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0006] Furthermore, the aforementioned PpMED25The amino acid sequence of the encoded protein is shown in SEQ ID NO.2.

[0007] Furthermore, the aforementioned PpMED25 The nucleotide sequence of the upstream amplification primer is shown in SEQ ID NO.3: tactattctagtcgagaattcATGGCGGAGAAGCAGCTGA. PpMED25 The nucleotide sequence of the downstream amplification primer is shown in SEQ ID NO.4: caggtcgactctagaggatccTTAACCCATAAAGCCCCCTCC.

[0008] Another aspect of the present invention also provides the above-mentioned PpMED25 The application of genes in regulating the synthesis of waxy substances in peach fruit skin, as described above PpMED25 The nucleotide sequence of the gene is shown in SEQ ID NO.1. This gene was expressed by overexpression in peach fruit. PpMED25 The gene causes it to synthesize an increased amount of wax on the surface of peach fruit.

[0009] Furthermore, the aforementioned expression was overexpressed in the peach fruit peel. PpMED25 Genetic methods, including constructing the peach fruit PpMED25 The steps include: overexpressing the gene using a vector, transforming the overexpression vector into Agrobacterium, and then infecting the peach peel.

[0010] Another aspect of the present invention also provides the above-mentioned PpMED25 The application of genes in regulating the synthesis of waxy substances in tomato skin, as described above PpMED25 The nucleotide sequence of the gene is shown in SEQ ID NO.1. This gene was obtained by overexpressing the gene in tomato fruit. PpMED25 The gene causes it to synthesize an increased amount of wax on the surface of the tomato fruit.

[0011] Furthermore, the aforementioned PpMED25 The sequence of the upstream primer for gene quantification is shown in SEQ ID NO.5: TGCTGTGATCCAATTGCCCT; PpMED25 The sequence of the downstream primer for gene quantification is shown in SEQ ID NO.6: ACACAACCATATCCCCAGGA.

[0012] Furthermore, the application of PpMED25 overexpression in tomato fruit in reducing the water permeability of the fruit epidermal cuticle.

[0013] Another aspect of the present invention also provides the above-mentioned PpMED25 The application of genes in improving the storage performance of fruits, including peaches and tomatoes.

[0014] Compared with the prior art, the advantages of the present invention are as follows: 1. The subunit gene PpMED25 of the peach fruit intermediate complex was cloned for the first time, and experiments confirmed that its overexpression in peach and tomato fruits can positively regulate the synthesis of epidermal waxes (especially triterpenes and alcohols).

[0015] 2. Overexpression of PpMED25 can promote wax deposition, improve the microstructure of wax crystals, thereby significantly reducing the water permeability of the fruit peel, delaying postharvest water loss, and improving storage performance.

[0016] 3. The function of this gene has been verified in both peach (Rosaceae) and tomato (Solanaceae), suggesting that it is functionally conserved in different plant species, providing new gene resources and improvement strategies for postharvest preservation of various horticultural crops. Attached Figure Description

[0017] Figure 1 peach fruit PpMED25 Gene cloning and pBG-Plant-expression PpMED25 Electrophoretic gel images of the recombinant vector construction, where A is... PpMED25 Gene amplification, 1 and 2 are PpMED25 Amplified fragments of the gene; B is the linearized electrophoresis image of the pBG-Plant-express vector, 1 is the linearized plasmid, 2 is the circular plasmid; C is the PCR identification results of Escherichia coli colonies, 1-3 are positive E. coli single colonies, -- is the negative control (no template added); D is the PCR identification results of Agrobacterium colonies, 1-4 are positive Agrobacterium single colonies, -- is the negative control (no template added), + is the positive control (with pBG-Plant-express-PpMED25 plasmid as template). Figure 2 To investigate the effect of PpMED25 on the composition and content of wax in peach fruit epidermis, the expression was performed as follows: A represents alkanes; B represents triterpenoids; C represents fatty acids; D represents alcohols; E represents total wax; and CK represents the control group. PpMED25- OE is the experimental group; Figure 3 For overexpression PpMED25 Effects on the microstructure of waxy crystals on peach fruit skin; Figure 4 For semi-quantitative PCR identification PpMED25 Expression levels in genetically modified tomatoes; Figure 5 For overexpression PpMED25 The effect on the water permeability of tomato fruit skin; Figure 6 For overexpression PpMED25 The effect on water loss in tomato fruits; Figure 7 For overexpression PpMED25 Effects on the microstructure of waxy crystals in tomato peel; In the above figure, ** indicates P < 0.005, *** indicates P < 0.001, ns indicates no significant difference, and OE-L1 indicates... PpMED25 -OE-L1, OE-L2 means PpMED25 -OE-L2, OE-L3 means PpMED25 -OE-L3. Detailed Implementation

[0018] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments.

[0019] Specific Implementation Example 1: In peach fruit PpMED25 Gene cloning and sequence analysis.

[0020] Step 1: Extract RNA from peach peel Total RNA was extracted from peaches using the Eastep Super Total RNA Extraction Kit (LS1040, Promega). The procedure was followed according to the kit's instructions, and the RNA concentration and purity were determined using a micro spectrophotometer.

[0021] Step 2: RNA is reverse transcribed into cDNA The samples were reverse transcribed using the HiScript II Q RT SuperMix for qPCR (+gDNA wiper) kit (R223-01, Vazyme), and the products can be stored at -20°C.

[0022] Step 3 PpMED25 Cloning of the full gene Using the cDNA from step 2, "RNA reverse transcription to cDNA," as a template, and EcoRI and BamHCl as restriction enzyme sites, a design was developed. PpMED25 Upstream and downstream primers for gene amplification, PpMED25 Upstream amplification primers for the gene (pBG-Plant-express-) PpMED25 The sequence of -F) is shown in SEQ ID NO.3: tactattctagtcgagaattcATGGCGGAGAAGCAGCTGA; PpMED25 Downstream amplification primers for the gene (pBG-Plant-express-) PpMED25The sequence of -R) is shown in SEQ ID NO.4: caggtcgactctagaggatccTTAACCCATAAAGCCCCCTCC. Amplification was performed using PhantaMax Super-Fidelity DNA Polymerase (P505, Vazyme) high-fidelity enzyme. Analysis of the amplification product by agarose gel electrophoresis yielded a band approximately 2733 bp in size, as shown below. Figure 1 As shown in Figure A, the target band and brightness meet the requirements.

[0023] PpMED25

[0024] The amino acid sequence of the encoded protein is shown in SEQ ID NO.2: MAEKQLIVAVEGTAAMGPYWSTIISDYLDKIIRCFCGNELSGQKPSTSTVELSLVTFYTHGSYCGCLVQRSGWTRDLDLFLQWLSAIPFSGGGFSDAAIAEGLSEALMMFPTVQNGNQNQQNVDCQKHCILLAASNPHPLPTPVYRPQMQNLEQNEIIDSQTENRLYDAEAVAKSFPQCSVSMSVICPKQLPKLRAIYNAGKRNPRAADPPIDNAKNPQFLVLISENFLEARATLSRPGSTNLPSNQSPVKMDIAPVASVTGPPPTSVPSVNGSVMNRQPVAVGNVPPATVKVEPSTVSSMVAGPAFPHIPSVRPPSQGVPSLQTSSPSSASQEMTTNNENVPDLKPVVSGVTHPSRPVGSILNNISQARVMNSAALTGGTSIGLQTMGQNPMAMHVSNMISSGMASSVGAAQNVFSSSGSGTLTQVAQNSGLSSFTSANSNVSGNNNLGISQPMSNLQGGVSMGQSVPGMSQGNLSGPQMVQSAIGMNPNMMSALGSSGSSSGTGTMIPTPGMPQQVQAGIQSLGANNSSAPNVPLSQQTSSALQSAQSKYVKVWEGNLSGQRQGQPVFITRLEGYRSASASETLAANWPPTMQIVRLISQDHMNNKQYVGRADFLVFRAMNQHGFLGQLQEKKLCAVIQLPSQTLLLSVSDKACRLIGMLFPGDMVVFKPQVGGQQQQQQQMQQQQPQQHPQLQQQQQQHPQLQQQQHPQLQQQQQQQQLQQQQQHPQMQQQQQQQQHPQMQPQQQQHPQMQPQQQQHPQMQQQPQQHPQLQQQQQQHPQLQQQQQQHPQLQQQQQIPQLQQQQQQQQLPQLQQQQQLPQLQQQQLPQLQQQQLSQLQSQQQLPQLQQLQQQHQQQQLVGTGMGQAYVQGRSQLVSQGQVPSQGSNMPGGGFMG。

[0025] Specific Implementation Example 2: pBG-Plant-express- in peach fruit PpMED25 Construction of recombinant vectors.

[0026] Step 1: Linearization of pBG-Plant-express vector The empty vector pBG-Plant-express was digested with restriction endonucleases EcoRI and BamHI. The digestion system was as follows: EcoRI 1 μL, BamHI 1 μL, FD buffer 2 μL, pBG-Plant-express plasmid X μL (calculated based on 1 μg plasmid), and RNase-free ddH2O to a final volume of 20 μL. The digestion was performed at 37℃ for 20 min and then at 80℃ for 5 min. The PCR products were then subjected to agarose gel electrophoresis. The vector linearization results are shown below. Figure 1 As shown in B.

[0027] Step 2: Purification of cloning and enzyme digestion products The gel was recovered and purified using the EZNAGel Extraction Kit (D2500, Omega). The specific operating procedures were performed according to the instruction manual.

[0028] Step 3: Connect the target fragment to the linearized vector The pBG-Plant-express linearized vector and the target gene obtained in Example 1 were ligated using recombinase. PpMED25 The fragment was recombined and ligated according to the kit (C116, Vazyme) instructions, using the vector (0.03 pmol) and the insert fragment (0.06 pmol) to obtain the recombinant product.

[0029] Step 4: Transform the recombinant product into E. coli. 100 μL of competent E. coli cells were thawed on ice. The recombinant product obtained in step 3 was added to the competent E. coli cells. After centrifugation, ice bath, and heat shock, the recombinant product was transferred into E. coli DH5α competent cells. Subsequently, the bacterial culture was plated onto LB agar medium supplemented with 100 mg / L spectinomycin and incubated upside down at 37°C for 14-16 h. Single colonies of E. coli with round shape and bright white color were selected for colony PCR identification. The results are as follows: Figure 1 As shown in Figure C, the band position is correct. After selecting positive clones and verifying their accuracy through sequencing, the correct recombinant plasmid pBG-Plant-express- was obtained. PpMED25 .

[0030] Step 5: Transformation of Agrobacterium and colony PCR identification The extracted recombinant plasmid pBG-Plant-express- PpMED25 The empty vector pBG-Plant-express was mixed with 50 μL of GV3101 (pSoup) Agrobacterium competent cells, and the mixture was gently stirred at the bottom of the tube. The mixture was then incubated sequentially on ice for 5 min, in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and finally cooled in ice for 5 min. Antibiotic-free LB broth was then added, and the cells were cultured in a shaker at 28°C for 2 h to activate them. 100 µL of the bacterial culture was spread onto LB solid medium (containing 100 mg / L spectinomycin, 20 mg / L rifampin, and 40 mg / L gentamicin), and incubated upside down at 28°C for 3 days. Positive colonies were picked for colony PCR identification. The results are as follows: Figure 1 As shown in Figure D, the band position is correct. Further culture in LB liquid medium (containing 100 mg / L spectinomycin, 20 mg / L rifampin, and 40 mg / L gentamicin) resulted in the acquisition of the band containing pBG-Plant-express-. PpMED25 Agrobacterium and pBG-Plant-express recombinant plasmid.

[0031] Specific Implementation Example 3: Peach Fruit PpMED25 Genes are instantaneously transformed into peach fruits.

[0032] Will include pBG-Plant-express and pBG-Plant-express- PpMED25 Agrobacterium bifidum culture containing recombinant plasmids was streaked onto LB solid medium (containing 100 mg / L spectinomycin, 20 mg / L rifampin, and 40 mg / L gentamicin) and incubated at 28°C for 3 days for the first activation. The bacteria were then scraped onto LB liquid medium (containing the corresponding antibiotics) and cultured overnight with shaking for the second activation. An appropriate amount of fresh bacterial culture was added to fresh LB liquid medium (containing 100 mg / L spectinomycin, 20 mg / L rifampin, and 40 mg / L gentamicin) and cultured at 28°C with shaking at 220 rpm until OD (dose elapsed). 600 Value = 0.8-1.0. Centrifuge the bacterial suspension at 5000×g for 10 min, discard the supernatant, resuspend Agrobacterium in freshly prepared infection buffer (containing 10 mM MES, 10 mM MgCl2, and 200 μMAS), and adjust the OD value. 600 =3.0, and used after standing at room temperature in the dark for 1 h. Agrobacterium with the empty vector plasmid pBG-Plant-express was used as the control group. The recombinant plasmid pBG-Plant-express carrying the target gene was used instead. PpMED25 Agrobacterium was used as the experimental group.

[0033] Using green-ripe peaches as experimental material, 1 mL of prepared Agrobacterium permeation solution was drawn into the fruit using a sterile syringe. With the needle tip angled inwards towards the inside of the peel, the fruit was pierced at approximately a 20° angle and slowly injected until water droplets appeared on the surface. After drying, the fruit was incubated in the dark at 25°C and 85±5% humidity. After 24 h, the fruit was placed under light to promote transformation, resulting in transient overexpression. PpMED25 Experimental group (pBG-Plant-express- PpMED25 Peach fruits from the control group (pBG-Plant-express) and the control group (pBG-Plant-express).

[0034] Specific Example 4: Determination of wax components and content in instantaneously transformed peach fruit.

[0035] Step 1: Extraction and determination of fruit wax Four biological replicates were set up, and each was drilled using a 2cm diameter circular punch to enlarge the transient overexpression isolate prepared in Specific Example 3. PpMED25 The surface of the peaches in both the control and control groups was perforated, with four round perforations constituting a replicate. The surface area was calculated using the formula: S = πr². 2 The wafer discs were immersed in chloroform for 1 min to extract the cuticle wax. 10 µL of n-tetracosane (1 mg / mL) was added as an internal standard. The mixture was concentrated to 1 mL under nitrogen, filtered through a 0.45 µm nylon filter, and dried under nitrogen. 100 µL of pyridine and 100 µL of N,O-bis(trimethylsilyl)trifluoroacetamide (containing 1 wt% trimethylchlorosilane) were added to the sample, and the mixture was derivatized in an 80℃ drying oven for 1 h. The residual derivatizing reagents were dried under nitrogen at room temperature. 1 mL of chloroform was added to dissolve the sample. The wax composition and content of peach peel were determined using GC-MS. The column model was HP-5MS, with dimensions of 30 m × 0.25 mm × 0.25 μm. An autosampler was used with an injection volume of 4 µL, an injection port temperature of 280℃, a detector temperature of 300℃, and a transfer line temperature of 320℃. Temperature program: Initial temperature 50℃, hold for 2 min, increase to 200℃ at a rate of 20℃ / min and hold for 2 min; then increase to 320℃ at a rate of 3℃ / min and hold for 15 min. Wax components were identified using the NIST 17 database, and wax content was quantified using peak area. Wax content was calculated using the following formula: Wax content (μg / cm) 2 = (Area of ​​analyte peak / Area of ​​internal standard peak) × Amount of internal standard added; Step 2: Analyze the wax components and content by GC-MS. The results are as follows Figure 2 As shown in the middle AE, overexpression was found. PpMED25It promoted the accumulation of waxy substances in the stratum corneum of the epidermis, with a significant increase in the content of triterpenes and alcohols. This result indicates... PpMED25 It activated the biosynthesis of waxy substances in the peach fruit peel.

[0036] Specific Implementation Example 5: Overexpression PpMED25 Effects on the microstructure of waxy crystals on peach fruit skin The transient overexpression prepared in Specific Example 3 PpMED25 The peels of peaches from both the control and control groups were perforated using a sampler and then soaked in 3% (v / v) glutaraldehyde for storage. The treated samples were then frozen at -80°C for at least 1 hour, followed by freeze-drying in a freeze dryer for 48 hours to completely remove moisture from the peels. The samples were then fixed in an ion sputtering apparatus for gold sputtering and finally observed using a scanning electron microscope (SEM).

[0037] The results are as follows Figure 3 As shown in the SEM image, overexpression can be observed. PpMED25 The partial filling of the stratum corneum depressions resulted in a denser distribution of crystals, exhibiting a smoother and fuller appearance, indicating that wax deposition on the peach fruit epidermis was promoted. In contrast, the control group showed significant epidermal wax layer depressions, larger pores, and sparser wax crystals. This result confirms... PMED25 It strengthens the physical barrier function of the cuticle layer of peach fruit epidermis.

[0038] Specific Implementation Example Six PpMED25 Obtaining homozygous tomato plants by overexpression.

[0039] Step 1 PpMED25 Obtaining overexpression tomato plants The successfully sequenced pBG-Plant-MED25 vector was sent to Chongqing Baoguang Biotechnology Co., Ltd. for Agrobacterium transformation. The positive rooted seedlings were sent to the Agricultural Product Processing and Storage Laboratory of Ningbo University. The first seedlings obtained were recorded as generation T0.

[0040] Step 2 PpMED25 Screening and identification of homozygous tomato plants overexpressing the gene The harvested T0 generation tomato seeds were planted in 1 / 2 MS solid medium (containing 50 mg / L kanamycin, pH=5.7-5.9) to screen for positive plants up to the T3 generation for subsequent experiments.

[0041] Semi-quantitative PCR detection was used. PpMED25 Expression in wild-type (WT) and transgenic tomatoes. Tomato peels were frozen and ground into powder under liquid nitrogen. Total RNA was extracted from the tomato peels and cDNA was synthesized following the method described in step 1 of Example 1. Using the tomato peel cDNA as a template, SlGAPDHAs a reference gene, the PCR products were electrophoresed on a 1% (w / v) agarose gel, and the band brightness was observed. PpMED25 Quantitative upstream primers for genes (q PpMED25 The sequence of -F) is shown in SEQ ID NO.5: TGCTGTGATCCAATTGCCCT; PpMED25 Quantitative downstream primers for genes (q PpMED25 The sequence of -R) is shown in SEQ ID NO.6: ACACAACCATATCCCCAGGA; SlGAPDH Quantitative upstream primers for genes (q SlGAPDH The sequence of -F) is shown in SEQ ID NO.7: CTGCTCACTTGAAGGGTGGT, SlGAPDH Quantitative downstream primers for genes (q SlGAPDH The sequence of -R) is shown in SEQ ID NO.8: GACAATGTCCAGCTCTGGCT. The agarose gel electrophoresis results are as follows: Figure 4 As shown, wild-type tomatoes and PpMED25 -OE-L1、 PpMED25 -OE-L2 and PpMED25 -OE-L3 internal reference gene SlGAPDH The electrophoretic bands have similar brightness. For PpMED25 Genes were almost undetectable in WT, while PpMED25 -OE-L1、 PpMED25 -OE-L2 and PpMED25 The three strains -OE-L3 showed distinct bands, indicating that... PpMED25 -OE-L1、 PpMED25 -OE-L2 and PpMED25 -OE-L3 material PpMED25 Successful expression.

[0042] Specific Implementation Example 7 PpMED25 Permeability test of overexpression in tomato fruit.

[0043] Wild type and overexpression PpMED25 Three biological replicates were set up for each tomato strain. Tomato fruits 5 days after color breakage were soaked in a 1% (w / v) toluidine blue (TB) solution, ensuring the fruit was completely submerged, for 20 hours. After soaking, the surface residual liquid was washed off with sterile water, and the water permeability of the fruit epidermis was observed and photographed.

[0044] Experimental results are as follows Figure 5 As shown, the wild-type tomato fruit had a larger area and more numerous blue spots soaked in TB, and significantly more than [the wild-type tomato fruit]. PpMED25 -OE-L1、 PpMED25 -OE-L2 and PpMED25-OE-L3 on the tomato fruit skin indicates PpMED25 Overexpression in tomatoes reduced the water permeability of the fruit's cuticle.

[0045] Specific Implementation Example 8 PpMED25 Dehydration test of overexpression in tomato fruit.

[0046] Take tomatoes 5 days after they have broken color and measure their weight at harvest, denoted as y1. Store them in an incubator at 25℃ and 80% relative humidity for 20 days, weighing them every 5 days and recording the weight as y. Calculate the water loss rate of the tomatoes during storage. The calculation formula is as follows: Tomato fruit water loss rate (%) = (y1 - y) / y1 × 100%, where y1: initial weight of the tomato fruit (g); y: weight of the tomato fruit during storage (g).

[0047] Experimental results are as follows Figure 6 As shown, PpMED25 -OE-L1、 PpMED25 -OE-L2 and PpMED25 The water loss rate of tomato fruits with -OE-L3 was significantly lower than that of wild-type tomato fruits, indicating that overexpression of -OE-L3... PpMED25 It slows down the loss of moisture from the tomato fruit.

[0048] Specific Implementation Example Nine: Overexpression PpMED25 The effect on the microstructure of waxy crystals in tomato peel.

[0049] The pericarps of tomato fruits 5 days after color breakage were immersed in FAA fixative (methanol, ethanol, and glacial acetic acid in a volume ratio of 1:8.5:0.5) for at least 2 hours. They were then rinsed three times with 0.1 mM PBS for 10-15 min each. Dehydration was then repeated twice with 30% ethanol, 50% ethanol, 70% ethanol, 80% ethanol, and 90% ethanol for 10-15 min each, followed by two more rounds of dehydration with anhydrous ethanol for 10-15 min each. The pericarps were then replaced with a 3:1 (v / v) replacement buffer of anhydrous ethanol and tert-butanol for 10-15 min each, a 1:1 (v / v) replacement buffer of anhydrous ethanol and tert-butanol for 10-15 min each, and a 1:3 (v / v) replacement buffer of anhydrous ethanol and tert-butanol for 10-15 min each. Replace with pure tert-butanol for 20 min. Freeze at -80℃ for at least 1 h, then freeze-dry. Sputter-coate the dried sample with gold using an ion sputtering coating machine and observe it under a scanning electron microscope at an accelerating voltage of 5.0 kV.

[0050] The results are as follows Figure 7 As shown in the SEM image, overexpression can be observed. PpMED25The tomato fruit contained more abundant wax crystals, indicating that wax deposition on the tomato skin was promoted. This result confirms... PMED25 It strengthens the physical barrier function of the waxy layer on the tomato peel.

[0051] The foregoing description is not intended to limit the invention, nor is the invention limited to the examples given. Any changes, modifications, additions, or substitutions made by those skilled in the art within the scope of the invention should also be considered within the protection scope of the invention.

Claims

1. A kind PpMED25 The application of genes in regulating the synthesis of waxy substances in peach fruit epidermis is characterized by: The aforementioned PpMED25 The nucleotide sequence of the gene is shown in SEQ ID NO.

1. This gene was expressed by overexpression in peach fruit. PpMED25 The gene causes it to synthesize an increased amount of wax on the surface of peach fruit.

2. The application according to claim 1, characterized in that: The aforementioned PpMED25 The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

3. The application according to claim 1, characterized in that: The aforementioned PpMED25 The nucleotide sequence of the upstream amplification primer is shown in SEQ ID NO.3: tactattctagtcgagaattcATGGCGGAGAAGCAGCTGA. PpMED25 The nucleotide sequence of the downstream amplification primer is shown in SEQ ID NO.4: caggtcgactctagaggatccTTAACCCATAAAGCCCCCTCC.

4. The application according to claim 1, characterized in that: Overexpression of the above in peach fruit epidermis PpMED25 Gene-based methods, including constructing the PpMED25 The steps include: overexpressing the gene using a vector, transforming the overexpression vector into Agrobacterium, and then infecting the peach peel.

5. A kind PpMED25 The application of genes in regulating the synthesis of waxy substances in tomato skin is characterized by: The aforementioned PpMED25 The nucleotide sequence of the gene is shown in SEQ ID NO.

1. This gene was obtained by overexpressing the gene in tomato fruit. PpMED25 The gene causes it to synthesize an increased amount of wax on the surface of the tomato fruit.

6. The application according to claim 5, characterized in that: The aforementioned PpMED25 The sequence of the upstream primer for gene quantification is shown in SEQ ID NO.5: TGCTGTGATCCAATTGCCCT; PpMED25 The sequence of the downstream primer for gene quantification is shown in SEQ ID NO.6: ACACAACCATATCCCCAGGA.

Citation Information

Patent Citations

  • Rice mediator subunit OsMED25 gene, its encoding protein and its application

    CN110305875A

  • Method for enhancing resistance of tomatoes to root-knot nematode

    CN116200400A