Application of combined ac4C modification of NAT10 and PCSK9 mRNA in the diagnosis and treatment of DAVD
By combining detection and targeting of ac4C modification of NAT10 and PCSK9 mRNA, the diagnosis and treatment challenges of degenerative aortic valve disease have been addressed, providing new diagnostic biomarkers and drug interventions, and reducing disease severity and medical risks.
Patent Information
- Application Number
- CN202610368613.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-25
- Publication Date
- 2026-06-05
AI Technical Summary
Current technologies lack precise drug treatments for degenerative aortic valve disease, and valve replacements have significant limitations, posing medical risks and economic burdens to patients. The regulatory mechanism of ac4C modification of NAT10 and PCSK9 mRNA in DAVD remains unclear.
We will jointly detect the ac4C modification levels of NAT10 and PCSK9 mRNA, prepare ac4C modification agents targeting NAT10 and PCSK9 mRNA, use them for the diagnosis of degenerative aortic valve disease, and develop targeted drugs to inhibit their activity and intervene in the pathological process of DAVD.
It improves the accuracy of early diagnosis of degenerative aortic valve disease and provides new treatment ideas. By inhibiting the ac4C modification of NAT10 and PCSK9 mRNA, it can delay or inhibit valve calcification, reduce disease severity, and reduce reliance on surgery.
Smart Images

Figure CN122146877A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of combined ac4C modification of NAT10 and PCSK9 mRNA in the diagnosis and treatment of degenerative aortic valve disease. Background Technology
[0002] Degenerative aortic valve disease (DAVD) is a serious cardiovascular disease that severely threatens the health of the elderly. Its main pathological feature is progressive fibrosis and calcification of the aortic valve leaflets, leading to valve thickening, stiffening, and functional abnormalities. This results in aortic stenosis or regurgitation, and is a significant contributing factor to heart failure, arrhythmias, and sudden death in the elderly. DAVD is not simply an age-related degenerative change, but an active pathological process driven by valvular endothelial damage, inflammatory cell infiltration, extracellular matrix remodeling, and abnormal osteogenic differentiation of valvular interstitial cells (VICs). Currently, the pathogenesis of DAVD is not fully understood, and there is a lack of targeted drug treatments in clinical practice. Treatment primarily relies on surgical or interventional aortic valve replacement. However, existing valve replacements have significant limitations, imposing heavy medical risks and economic burdens on patients. Therefore, in-depth analysis of the pathogenesis of DAVD and the development of new targets and strategies for precise intervention are of great clinical value and social significance for delaying or reversing the process of valve calcification and improving the prognosis of elderly patients.
[0003] N4-acetylcytidine (ac4C) is one of the ways RNA is modified and plays an important role in post-transcriptional gene regulation, enhancing mRNA stability, translation efficiency, and precision. N-acetyltransferase 10 (NAT10) is currently the only known mammalian "writing enzyme" that catalyzes ac4C and plays a crucial role in the development and progression of heart diseases such as cardiomyocyte apoptosis, vascular remodeling, and cardiac remodeling. Recent studies have shown that NAT10 can promote osteogenic differentiation of mesenchymal stem cells. However, the potential role and regulatory mechanism of NAT10 in osteogenic differentiation of human aortic valve interstitial cells (hVICs) during DAVD remain not fully elucidated.
[0004] Proprotein convertase subtilisin / kexin type 9 (PCSK9) is a well-established regulator of lipid metabolism. Beyond its classic function of regulating lipid homeostasis, increasing evidence suggests that PCSK9 also promotes calcification in dendritic vascular disease (DAVD). Although PCSK9 plays a crucial role in the pathogenesis of DAVD, whether its expression is regulated by post-transcriptional modifications and the specific mechanisms underlying this regulation remain unclear. Summary of the Invention
[0005] To address the problems mentioned above, this invention studies the changes in ac4C modification levels of NAT10 and PCSK9 mRNA in degenerative aortic valve disease and their impact on osteogenic differentiation of human aortic valve interstitial cells. It proposes that combined detection of ac4C modification levels of NAT10 and PCSK9 mRNA can diagnose degenerative aortic valve disease, and that targeting ac4C modification of NAT10 and PCSK9 mRNA can be used to prepare or screen drugs for treating degenerative aortic valve disease, thus providing a new approach to the diagnosis and treatment of degenerative aortic valve disease.
[0006] To achieve the above-mentioned technical objectives, the present invention adopts the following technical solution: One objective of this invention is to provide an ac4C-modified formulation that targets both NAT10 and PCSK9 mRNA for use in the preparation of products for the diagnosis and treatment of degenerative aortic valve disease.
[0007] Furthermore, the formulation is a combined detection formulation of NAT10 and PCSK9 mRNA modified with ac4C, and the product is a product for diagnosing degenerative aortic valve disease or for assessing the severity of degenerative aortic valve disease.
[0008] Furthermore, the product includes reagents or kits.
[0009] Furthermore, the reagents or kits are used to detect the expression level of NAT10 and / or the ac4C modification level of PCSK9 mRNA in the sample.
[0010] Furthermore, the expression level of NAT10 is either the NAT10 mRNA level or the NAT10 protein level.
[0011] Furthermore, the sample includes aortic valve tissue.
[0012] Furthermore, the formulation is a combined inhibitor of ac4C modification of NAT10 and PCSK9 mRNA, and the product is a drug or pharmaceutical composition for treating degenerative aortic valve disease.
[0013] A second objective of this invention is to provide a drug or pharmaceutical composition for treating degenerative aortic valve disease, wherein the drug or pharmaceutical composition comprises a pharmaceutically acceptable carrier and an effective amount of an active ingredient, wherein the active ingredient comprises an inhibitor of the NAT10 gene or protein and an inhibitor of ac4C modification of PCSK9 mRNA.
[0014] Furthermore, the inhibitor of the NAT10 gene or protein is a small molecule compound, a nucleic acid inhibitor, or an antibody.
[0015] Furthermore, the ac4C modification inhibitor of PCSK9 mRNA works by inhibiting ac4C “writing” enzyme activity, enhancing ac4C “erasing” enzyme activity, and / or directly blocking the ac4C modification process.
[0016] Compared with the prior art, the present invention has the following beneficial effects: (1) This invention is the first to combine two biologically closely related molecular events, NAT10 and PCSK9 mRNA ac4C modification, into diagnostic biomarkers. By detecting the expression levels of NAT10 and the ac4C modification levels of PCSK9 mRNA in human aortic valve tissue, it was demonstrated that both are specifically and significantly elevated in DAVD tissue and are closely related to the severity of the disease. This suggests that the combined detection of NAT10 and PCSK9 mRNA ac4C modification levels can be used for the diagnosis of degenerative aortic valve disease. In addition, the combined detection of the two indicators can form a complementary relationship, which is expected to significantly improve the accuracy of early diagnosis and risk stratification compared to single indicators. Furthermore, this biomarker combination may exist in peripheral blood, laying the foundation for the development of non-invasive, portable early screening reagents or kits.
[0017] (2) This invention, by studying the effects of ac4C modification of NAT10 and PCSK9 mRNA on osteogenic differentiation of human aortic valve interstitial cells, demonstrates that NAT10 can promote osteogenic differentiation of human aortic valve interstitial cells by increasing the ac4C modification level of PCSK9 mRNA, clarifying the complete pathogenic axis of DAVD and providing two interventional targets for drug development. Furthermore, inhibiting NAT10 can reduce the ac4C modification level of PCSK9 mRNA, thereby inhibiting osteogenic differentiation of human aortic valve interstitial cells, thus delaying or inhibiting valve calcification. This suggests that combined targeting of NAT10 and PCSK9 mRNA ac4C modification can be used to prepare or screen drugs for the treatment of degenerative aortic valve disease, and simultaneous intervention of both may produce a synergistic therapeutic effect, providing a new approach for targeted drug therapy of degenerative aortic valve disease. Attached Figure Description
[0018] Figure 1 This study presents a differential analysis of NAT10 expression levels and ac4C modification levels in clinical samples from Example 2 of the present invention. Specifically, A shows that, compared to non-calcified aortic valve tissue, the NAT10 mRNA level was significantly increased in calcified aortic valve tissue using quantitative real-time polymerase chain reaction (qPCR); B shows that, compared to non-calcified aortic valve tissue, the NAT10 protein level was significantly increased in calcified aortic valve tissue using Western blot (WBC); and C shows that, compared to non-calcified aortic valve tissue, the ac4C modification level was significantly increased in calcified aortic valve tissue using Western blot (WBC).
[0019] Figure 2 To analyze the correlation between the biomarker combination and disease severity in Example 3 of this invention, the NAT10 expression level, overall ac4C modification level, and clinical echocardiography of DAVD patients were analyzed. Specifically, the NAT10 expression level was negatively correlated with aortic valve orifice area (Figure A) and positively correlated with mean transvalvular pressure gradient (Figure B) and peak transvalvular pressure gradient (Figure C). The ac4C modification level of PCSK9 mRNA was negatively correlated with aortic valve orifice area (Figure D) and positively correlated with mean transvalvular pressure gradient (Figure E) and peak transvalvular pressure gradient (Figure F).
[0020] Figure 3To analyze the diagnostic efficacy of the biomarker combination in Example 4 of this invention, receiver operating characteristic (ROC) curve analysis was performed on data from 100 cases each of calcified aortic valve tissue (hCAVs) and non-calcified aortic valve tissue. The ROC curve area under the curve (AUC) was calculated using NAT10 expression level, PCSK9 mRNA ac4C modification level, and the combined area under the curve of both. The AUC for detecting NAT10 expression level was 0.846, the AUC for detecting PCSK9 mRNA ac4C modification level was 0.906, and the AUC for the combined detection of both was 0.946.
[0021] Figure 4 To clinically validate the diagnostic efficacy of the biomarker combination in Example 5 of this invention, data from 100 cases each of calcified aortic valve tissue (hCAVs) and non-calcified aortic valve tissue were analyzed. The diagnostic thresholds for NAT10 expression level (Figure A) and PCSK9 mRNA ac4C modification (Figure B) were determined using a control group mean of 1 and a threshold of control group mean + 2 standard deviations. The diagnostic sensitivity and specificity of single and combined biomarkers were calculated (Figure C). Furthermore, 25 cases each of hCAVs and non-calcified aortic valve tissue were used for independent validation sets (Figure D). ROC curve analysis was performed (Figure E), and a double-positive interpretation rule was applied for diagnosis. The results indicate that the biomarker combination has stable diagnostic efficacy (Figure F).
[0022] Figure 5 This invention, Example 6, describes the effect of ac4C modification of NAT10 and PCSK9 mRNA on osteogenic differentiation of human aortic valve interstitial cells in an in vitro experiment. A shows acRIP-qPCR results indicating that knockdown of NAT10 significantly reduced the ac4C modification level of PCSK9 mRNA; B shows Western blot results indicating a significant decrease in osteogenic differentiation markers in the NAT10 knockdown group; and C shows Alizarin Red staining and calcium content quantification results indicating a significant reduction in calcium nodules and calcium deposition in the NAT10 knockdown group.
[0023] Figure 6 This invention illustrates the effect of ac4C modification of NAT10 and PCSK9 mRNA on aortic valve calcification in animal experiments, as described in Example 7 of this invention. Specifically, A shows acRIP-qPCR results indicating a significant decrease in PCSK9 mRNA ac4C modification levels compared to the control group in the NAT10 knockdown group; B shows HE staining results indicating a significant reduction in aortic valve leaflet thickness compared to the control group in the NAT10 knockdown group; and C shows Alizarin Red staining results indicating a significant reduction in aortic valve leaflet calcium deposition compared to the control group in the NAT10 knockdown group. Detailed Implementation
[0024] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention. The reagents, products, and instruments used in the following examples are all commercially available, and the methods used in the examples, unless otherwise specified, are consistent with conventionally used methods.
[0025] The technical solution of the present invention will be further described in detail below with reference to the embodiments.
[0026] Example 1: Method for joint detection of ac4C modification of NAT10 and PCSK9 mRNA 1. Methods for detecting NAT10 expression levels (1) Detection of NAT10 mRNA levels by quantitative real-time polymerase chain reaction (qPCR) The qPCR primer sequences for NAT10 are shown in SEQ ID NO.1 (ATAGCAGCCACAAACATTCGC) and SEQ ID NO.2 (ACACACATGCCGAAGGTATTG). Total RNA was extracted from aortic valve tissue or cultured human valvular interstitial cells (hVICs) using TRIzol reagent according to the kit instructions. Complementary DNA (cDNA) was synthesized using the PrimeScript RT reverse transcription kit. qPCR amplification was performed in 96-well optical reaction plates using the SYBR Green dye method on a StepOne real-time quantitative PCR instrument. The relative expression level of the target gene was calculated using ΔΔCt, and β-actin was used as an internal reference gene for correction. Experimental results are expressed as fold changes relative to the control group.
[0027] (2) Western blot detection of NAT10 protein levels The primary antibodies used included anti-NAT10 (13365-1-AP) and anti-β-actin (66009-1-Ig). Total protein was extracted from frozen aortic valves using RIPA lysis buffer with a mixture of protease inhibitors, strictly following the kit instructions. Protein concentration was determined using a BCA protein quantification kit. 20 μg of total protein was separated by 10% SDS-PAGE and then electroblotted onto a PVDF membrane. The membrane was blocked with TBST containing 5% skim milk powder and 0.05% Tween 20, incubated overnight at 4°C with the primary antibody, washed, and incubated with HRP-labeled secondary antibody. Finally, the images were developed using an ECL Western blot assay kit. Band intensity was quantitatively analyzed using ImageJ software.
[0028] 2. Detection method for ac4C modification level of PCSK9 mRNA The ac4C modification level of PCSK9 mRNA was detected using acetylated RNA immunoprecipitation-quantitative PCR (acRIP-qPCR). RNA was randomly fragmented to approximately 200 nt in length using RNA fragmentation reagents. Protein A / G magnetic beads were incubated with anti-ac4C antibody at room temperature for 1 hour to conjugate the antibody to the beads. The RNA fragments were then mixed with the antibody-conjugated magnetic beads and incubated at 4°C for 4 hours. The RNA-antibody complex was subsequently digested with proteinase K, and the eluted RNA was purified by phenol / chloroform extraction. Finally, the enrichment level of PCSK9 mRNA was analyzed using qPCR.
[0029] Example 2: Elevated NAT10 expression and ac4C modification levels in DAVD patients. Fifty calcified aortic valve tissues (hCAVs) and 50 non-calcified aortic valve tissues were collected from patients with clinical DAVD. The mRNA and protein expression levels of NAT10 in aortic valve tissues were detected by qPCR and Western blot, respectively; the acRIP-qPCR was used to detect the ac4C modification level of PCSK9 mRNA. Results showed that the mRNA expression level of NAT10 in the hCAVs group (… Figure 1 A) and protein ( Figure 1 B) levels were significantly increased compared to the control group, and the ac4C modification level of PCSK9 mRNA was also significantly increased compared to the control group. Figure 1 C). This suggests that DAVD patients exhibit a dual molecular signature of high NAT10 expression and elevated PCSK9 mRNA ac4C modification levels, and the combination of these two characteristics could serve as a candidate diagnostic biomarker for DAVD.
[0030] Example 3: NAT10 expression levels and ac4C modification levels were positively correlated with the severity of DAVD. Fifty calcified aortic valve tissues (hCAVs) and 50 non-calcified aortic valve tissues were collected from patients with deep vein vasculitis (DAVD). The expression level of NAT10 in aortic valve tissues was detected by qPCR and Western blot; the ac4C modification level of PCSK9 mRNA was detected by acRIP-qPCR; and the correlation between the expression level of NAT10 and the ac4C modification level of PCSK9 mRNA in DAVD patients and clinical echocardiography was analyzed. The results showed that the expression level of NAT10 in the valves of DAVD patients was negatively correlated with the aortic valve orifice area. Figure 2 A), and the average transvalvular pressure gradient ( Figure 2 B) and peak transvalvular pressure difference ( Figure 2C) showed a positive correlation; the ac4C modification level of PCSK9 mRNA in the valves of DAVD patients was negatively correlated with the aortic valve orifice area. Figure 2 D), and the average transvalvular pressure gradient ( Figure 2 E) and peak transvalvular pressure difference ( Figure 2 F) showed a positive correlation. This suggests that both NAT10 expression levels and ac4C modification levels can reflect the severity of DAVD, and combined detection can provide more comprehensive disease assessment information.
[0031] Example 4: Combined detection of ac4C modification of NAT10 and PCSK9 mRNA is superior to single biomarker detection in the diagnosis of DAVD. This embodiment compares the diagnostic efficacy of single biomarkers and combined biomarker combinations for DAVD. Fifty cases each of calcified aortic valve tissue (hCAVs) and non-calcified aortic valve tissue from clinical DAVD patients in Example 2 were collected, along with another 50 cases each of hCAVs and non-calcified aortic valve tissue from clinical DAVD patients, totaling 100 cases each of hCAVs and non-calcified aortic valve tissue. Receiver operating characteristic (ROC) curve analysis was performed, calculating the area under the ROC curve (AUC) for NAT10 expression level, PCSK9 mRNA ac4C modification level, and the combined AUC. The results showed that the AUC for detecting NAT10 expression level was 0.846, the AUC for detecting PCSK9 mRNA ac4C modification level was 0.906, and the AUC for the combined detection of both was 0.946. This indicates that the AUC for the combined detection of NAT10 expression level and PCSK9 mRNA ac4C modification level was significantly higher than the AUC of any single biomarker. Figure 3 The results suggest that the combined detection of ac4C modification of NAT10 and PCSK9 mRNA has better diagnostic efficacy than single biomarker detection and can be used as an ideal combination of diagnostic biomarkers for DAVD.
[0032] Example 5 validates the diagnostic efficacy of combined detection of ac4C modification of NAT10 and PCSK9 mRNA in DAVD. This embodiment was used to verify that the combined biomarker combination has a higher diagnostic efficacy for DAVD than a single biomarker. Fifty calcified aortic valve tissues and 50 non-calcified aortic valve tissues from clinical DAVD patients were collected, and diagnostic thresholds for NAT10 expression level and PCSK9 mRNA ac4C modification level were determined. The threshold for NAT10 expression level was determined to be 1.7966 times (with the control group mean as 1, the threshold was calculated as the control group mean + 2 times the standard deviation). Figure 4 A), the threshold for ac4C modification level of PCSK9 mRNA was determined to be 1.7766-fold (same as above). Figure 4 B).
[0033] 1. Comparison of diagnostic efficacy between single biomarkers and combined biomarkers ( Figure 4 C) The diagnosis was based solely on NAT10 expression level: a NAT10 expression level ≥ 1.7766 times was considered positive, otherwise negative. In 100 samples, the sensitivity was 0.69, specificity was 0.81, and accuracy was 0.75.
[0034] The ac4C modification level of PCSK9 mRNA was used as a single indicator for diagnosis: a positive result was defined as a PCSK9 mRNA ac4C modification level ≥1.7966-fold, otherwise a negative result. In 100 samples, the sensitivity was 0.59, the specificity was 0.88, and the accuracy was 0.735.
[0035] The combined use of NAT10 expression level and PCSK9 mRNA ac4C modification level as indicators for diagnosis: a positive result was defined as a NAT10 expression level ≥1.7766-fold increase and a PCSK9 mRNA ac4C modification level ≥1.7966-fold increase; otherwise, a negative result was defined as negative. In 100 samples, the sensitivity was 0.53, the specificity was 0.99, and the accuracy was 0.76. The specificity and accuracy were significantly higher than any single biomarker, making it suitable for the diagnosis of DAVD.
[0036] 2. Independent validation set verification To further verify the diagnostic efficacy of the present invention, 25 cases each of hCAVs and non-calcified aortic valve tissues from clinical DAVD patients were collected. Figure 4 (D) The same detection method was used to determine the expression level of NAT10 and the ac4C modification level of PCSK9 mRNA. ROC curve analysis was performed, and the AUC was calculated for NAT10 expression level, PCSK9 mRNA ac4C modification level, and the combined AUC. The above-mentioned double-positive interpretation rule was used for diagnosis. The results showed that in the independent validation set: the AUC for detecting NAT10 expression level was 0.675, the AUC for detecting PCSK9 mRNA ac4C modification level was 0.862, and the AUC for the combined detection of the two was 0.878. That is, the AUC for the combined detection of NAT10 expression level and PCSK9 mRNA ac4C modification level was significantly higher than the AUC of any single marker. Figure 4 E). Additionally, in 25 DAVD patients, 14 were correctly interpreted as positive (sensitivity 0.56); in 25 controls, 24 were correctly interpreted as negative (specificity 0.96); the overall accuracy was 0.76 (E). Figure 4 F). This suggests that the combined diagnostic biomarker combination of the present invention has stable diagnostic efficacy and can be achieved through a simple threshold interpretation method, making it suitable for widespread use in the clinical diagnosis of DAVD.
[0037] Example 6: In vitro inhibition of ac4C modification of NAT10 and PCSK9 mRNA can suppress osteogenic differentiation of hVICs. In this embodiment, hVICs were isolated and cultured, and a NAT10 gene-specific short hairpin RNA (shNAT10) was constructed to knock down NAT10. After transfection into hVICs, an in vitro osteogenic differentiation model was constructed by inducing hVICs to undergo osteogenic differentiation. The osteogenic-induced hVICs were analyzed by acRIP-qPCR to detect the ac4C modification level of PCSK9 mRNA, and the degree of osteogenic differentiation of hVICs was assessed by Western blot, alizarin red staining, and calcium quantification.
[0038] The specific experimental plan is as follows: 1. Isolation and culture of primary hVICs and induction of osteogenic differentiation Primary hVICs were isolated from non-calcified aortic valves using type I collagenase digestion. The aortic valves were placed in 1 mg / mL type I collagenase and digested at 37°C for 30 minutes. After vortexing to remove endothelial cells, the valve leaflets were placed in freshly prepared 1.0 mg / mL collagenase culture medium and incubated at 37°C for 4–6 hours. After repeatedly pipetting to break up tissue clumps, the cell suspension was centrifuged at 1000 rpm for 10 minutes, and the cell pellet was collected. Finally, the isolated valvular interstitial cells were resuspended, seeded, and cultured in DMEM medium containing 100 mg / mL streptomycin, 10% fetal bovine serum, and 100 U / mL penicillin, and incubated at 37°C in a 5% CO2 incubator.
[0039] All experiments used passaged cells from the 3rd to 5th generation. When the cells reached 70%–90% confluence, osteogenic differentiation was induced using osteogenic induction medium (basal medium supplemented with 50 mg / mL ascorbic acid, 0.1% fetal bovine serum, 5 mmol / L sodium β-glycerophosphate, 50 ng / mL BMP-2, and 100 nmol / L dexamethasone).
[0040] 2. Cell transfection Gene silencing was achieved using gene-specific lentiviral short hairpin RNAs (shRNAs), with a non-targeted negative control shRNA (shNC) used simultaneously. Both the NAT10-specific shRNAs and the negative control shNC were synthesized by Shanghai Gemma Biotechnology Co., Ltd. The shNAT10 sequence is SEQ ID NO.3: CGAGCTGGATTTGTTCCTGTT, and the shNC sequence is SEQ ID NO.4: CCGGCGCCTAATCGCCTATCTCTATCTCGAGATAGAGATAGGCGATTAGGCGTTTTTG.
[0041] The transfection steps are as follows: (1) Add hVICs at 1.0×10 5 Cells were seeded at a density of 10 cells / well in 6-well plates. Transfection was started after the cells reached 80% confluence. Lentiviral virus was added and the cells were incubated for 48 hours.
[0042] (2) Subsequently, puromycin (3 μg / mL; Thermo Fisher Scientific) was used to screen for 2 weeks to establish a stable pool of knockdown or overexpression cells and to verify whether gene regulation was successful.
[0043] 3. Alizarin Red staining Fixed hVICs were stained with 2% alizarin red solution for 10 minutes, washed with water, and photographed. The area of alizarin red positive reaction in each magnified field (displayed in arbitrary units) was calculated and quantified using ImageJ 1.55 software, and the results for each biological replicate were averaged. Images were acquired using an Olympus DP71 camera and CellSens software, and observed using an Olympus BX51 microscope; the contrast and brightness of the images were adjusted using Adobe Photoshop CC software.
[0044] 4. Quantitative analysis of calcium The lysates of cultured hVICs were dissolved in 0.1 mol / L hydrochloric acid, and the calcium ion content was determined using the o-cresolphthalein complex ketone colorimetric method. Calcium ion concentration was expressed as calcium per milligram of protein (μg / mg), and all results were corrected for total cellular protein content.
[0045] The results showed that, compared with the control group, knocking down NAT10 significantly reduced the ac4C modification level of PCSK9 mRNA ( Figure 5 A), thereby significantly inhibiting osteogenic differentiation markers of hVICs induced by osteogenic induction medium (A). Figure 5 B), calcium salt nodules and calcium salt deposits ( Figure 5 C) Increasing effect.
[0046] Example 7: In vivo inhibition of ac4C modification of NAT10 and PCSK9 mRNA can suppress aortic valve calcification in mice. The PCSK9 mRNA ac4C modification inhibitors described in this invention achieve their effect by inhibiting the activity of the ac4C "writing" enzyme, enhancing the activity of the ac4C "erasing" enzyme, or directly blocking the ac4C modification process. NAT10 is currently the only known mammalian "writing enzyme" that catalyzes ac4C; inhibiting NAT10 expression can thus inhibit PCSK9 mRNA ac4C modification. The NAT10 inhibitors described in this invention refer to various small molecule compounds, nucleic acid inhibitors, or antibodies that downregulate the expression level of NAT10 nucleic acid, inhibit its activity, or reduce or eliminate the activity of the NAT10 protein. In this embodiment, the small molecule compound Remodelin is used to inhibit NAT10, with the molecular formula C10. 15 H 14 N4S has a molecular weight of 282.36.
[0047] In this embodiment, ApoE is selected. - / - Genetically engineered mice were used to construct a DAVD animal model by inducing a high-cholesterol diet. The mice were then administered the NAT10 inhibitor Remodelin via gavage to inhibit NAT10 expression and ac4C modification of PCSK9 mRNA. An equal volume of DMSO was administered as a control. The administration was repeated for 2 weeks.
[0048] The specific experimental plan is as follows: 1. Animal model construction and grouping: Twelve 4-week-old male ApoE were selected. - / - Mice were randomly divided into two groups. Control group: HCD + DMSO (100 mg / kg / d), n=6; Treatment group: HCD + Remodelin (100 mg / kg / d), n=6. Dietary induction began at 8 weeks of age, and mice were sacrificed at 24 weeks to obtain aortic valve tissue.
[0049] 2. Mouse heart specimen acquisition and testing indicators: Twelve mouse heart tissues were collected from the control and treatment groups. The procedure was as follows: Mice were fasted for one day; the following day, they were anesthetized with 10% chloral hydrate, and a clear surgical field was established under a microscope. The aorta was quickly severed approximately 5 mm from the root; the heart was obtained intact; the entire heart tissue was fixed with 4% paraformaldehyde. Serial sections were taken from the aortic root, and the sections were stained with hematoxylin and eosin red to assess the degree of calcification of the aortic valve tissue. Total RNA was extracted from each sample, and the ac4C modification level of PCSK9 mRNA was assessed using acRIP-qPCR.
[0050] The results showed that, compared with the control group, the PCSK9 mRNA ac4C modification level in the NAT10 inhibition group mice was significantly decreased. Figure 6A). HE staining results of the valves showed that, after induction with a high-fat, high-cholesterol diet, the thickness of the aortic valve leaflets in the NAT10 inhibition group was significantly reduced compared with the control group. Figure 6 B). Alizarin Red staining of the valves showed that, after induction with a high-fat, high-cholesterol diet, the NAT10 inhibition group showed a significant reduction in aortic valve leaflet calcium salt deposition compared to the control group. Figure 6 C). The above results confirm that inhibiting ac4C modification of NAT10 and PCSK9 mRNA can significantly inhibit aortic valve calcification in mice, suggesting that combined ac4C modification targeting NAT10 and PCSK9 mRNA can be used to prepare or screen drugs for the treatment of degenerative aortic valve disease.
[0051] In summary, this invention is the first to discover and verify that the combined detection of ac4C modification levels of NAT10 and PCSK9 mRNA can be applied to the diagnosis of degenerative aortic valve disease, and that the combined targeting of ac4C modification of NAT10 and PCSK9 mRNA can be used to prepare drugs for treating or screening degenerative aortic valve disease. This invention provides a new approach for the diagnosis and treatment of degenerative aortic valve disease.
[0052] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. The use of an ac4C-modified formulation targeting NAT10 and PCSK9 mRNA in the preparation of a product for the diagnosis and treatment of degenerative aortic valve disease.
2. The application according to claim 1, wherein the formulation is a combined detection formulation of NAT10 and PCSK9 mRNA modified with ac4C, and the product is a product for diagnosing degenerative aortic valve disease or for assessing the severity of degenerative aortic valve disease.
3. The application according to claim 2, characterized in that, The products include reagents or kits.
4. The application according to claim 3, characterized in that, The reagents or kits are used to detect the expression level of NAT10 and / or the ac4C modification level of PCSK9 mRNA in the sample.
5. The application according to claim 4, characterized in that, The expression level of NAT10 is either the NAT10 mRNA level or the NAT10 protein level.
6. The application according to claim 4, characterized in that, The sample included aortic valve tissue.
7. The application according to claim 1, characterized in that, The formulation is a combined inhibitor of ac4C modification of NAT10 and PCSK9 mRNA, and the product is a drug or pharmaceutical composition for the treatment of degenerative aortic valve disease.
8. A medicament or pharmaceutical composition for treating degenerative aortic valve disease, characterized in that, The drug or pharmaceutical composition comprises a pharmaceutically acceptable carrier and an effective amount of an active ingredient, said active ingredient including an inhibitor of the NAT10 gene or protein and an inhibitor of ac4C modification of PCSK9 mRNA.
9. The drug or drug composition according to claim 8, characterized in that, The inhibitor of the NAT10 gene or protein is a small molecule compound, a nucleic acid inhibitor, or an antibody.
10. The medicament or pharmaceutical composition according to claim 8, characterized in that, The ac4C modification inhibitor of PCSK9 mRNA works by inhibiting ac4C "writing" enzyme activity, enhancing ac4C "erasing" enzyme activity, and / or directly blocking the ac4C modification process.