Use of sesquiterpenes in the preparation of drugs for regulating synoviocytes

By using the sesquiterpene compound Chlojaponilactone B (CJB) to prepare a drug, combined with existing antirheumatic drugs, multi-target regulation of rheumatoid arthritis was achieved, solving the problems of single efficacy and large side effects of existing drugs, significantly improving treatment efficacy and reducing costs.

CN122163598APending Publication Date: 2026-06-09SUN YAT SEN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610640228.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-11
Publication Date
2026-06-09

Smart Images

  • Figure CN122163598A_ABST
    Figure CN122163598A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of medicine, and discloses application of a sesquiterpenoid compound in preparation of a drug for regulating synovial cells. The application first discloses a triple regulation mechanism of CJB on fibroblast-like synovial cells, i.e. inhibiting cell proliferation, reducing inflammatory reaction, and regulating ferroptosis pathway. Compared with a single-target drug, the multi-target effect mode can more comprehensively control the pathological process of RA, not only inhibits abnormal proliferation of FLS and secretion of inflammatory factors, but also removes pathological synovial cells by regulating ferroptosis and apoptosis, significantly improves the treatment effect, and reduces disease recurrence. Moreover, CJB has low toxicity, raw materials are easy to obtain, and can be used in combination with existing anti-rheumatic drugs, thereby reducing drug side effects and treatment costs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical technology, specifically relating to the application of a sesquiterpene compound in the preparation of a drug that inhibits the proliferation and migration of fibroblast-like synovial cells and promotes apoptosis. Background Technology

[0002] Rheumatoid arthritis (RA) is a chronic, systemic autoimmune disease characterized by symmetrical polyarthritis, abnormal synovial proliferation, and cartilage and bone destruction. It is characterized by insidious onset, progressive disability, systemic complications, and early death. The global prevalence of rheumatoid arthritis is 0.5%-1.0%, increasing with age. Without timely treatment, approximately 20%-30% of patients will develop severe joint deformities and functional loss within 10 years of diagnosis, significantly impacting their quality of life. Against the backdrop of an aging population, the socioeconomic burden of this disease is increasingly heavy.

[0003] Traditionally, rheumatoid arthritis (RA) was considered to be primarily caused by an autoimmune response mediated by immune cells such as T cells, B cells, and macrophages. However, recent studies have shown that stromal cells in the synovial tissue, especially fibroblast-like synoviocytes (FLS), play an indispensable core role in the pathogenesis of RA. RA-FLS exhibits a unique, tumor-like invasive phenotype, including abnormal proliferation, resistance to apoptosis, resistance to ferroptosis, metabolic reprogramming, and excessive secretion of pro-inflammatory factors and matrix metalloproteinases (MMPs). This phenotype can persist for months after the inflammatory environment is removed, and these characteristics collectively promote synovial hyperplasia and joint destruction. Therefore, targeting FLS has become an emerging strategy for the treatment of RA.

[0004] Currently, the main medications for treating rheumatoid arthritis include disease-modifying anti-rheumatic drugs (DMARDs), nonsteroidal anti-inflammatory drugs (NSAIDs), and glucocorticoids. Although these drugs have shown some effectiveness in the clinical treatment of rheumatoid arthritis, they still have limitations.

[0005] DMARDs only treat symptoms and relieve symptoms, but cannot improve disease progression; glucocorticoids have dose- and time-dependent adverse reactions; traditional synthetic DMARDs such as methotrexate (MTX), as first-line drugs for rheumatoid arthritis, have adverse reactions such as gastrointestinal, elevated liver enzymes, and bone marrow suppression, and studies have found that RA-FLS can develop adaptive resistance to MTX through protective autophagy, leading to weakened efficacy; biological DMARDs (such as TNF-α inhibitors) and targeted synthetic DMARDs (such as JAK inhibitors) can regulate inflammatory signal transduction, but have no direct inhibitory effect on the abnormal proliferative phenotype of RA-FLS.

[0006] Chlojaponilactone B (CJB), a sesquiterpene compound, has the following structural formula: Molecular weight 286.322, molecular formula C 17 H 18 O4 has been shown in many studies to have good anti-inflammatory and antioxidant effects, but current research results have not found that CJB has the effect of inhibiting the proliferation of fibroblast-like synovial cells and ferroptosis, or promoting apoptosis. Summary of the Invention

[0007] The purpose of this invention is to overcome at least one deficiency of the prior art and to provide the application of sesquiterpenoid compounds in the preparation of drugs that inhibit the proliferation and migration of fibroblast-like synovial cells and promote apoptosis, so as to solve the technical problems of existing RA treatment drugs having single efficacy, large side effects, and inability to effectively regulate the pathological state of FLS.

[0008] The technical solution adopted in this invention is: In a first aspect, the present invention provides the use of a sesquiterpene compound in the preparation of a drug that inhibits the proliferation and migration of fibroblast-like synovial cells and promotes apoptosis, wherein the sesquiterpene compound is selected from... Or its salt.

[0009] In some instances, the sesquiterpenoids also include Solvents or derivatives thereof.

[0010] In some instances, the therapeutically effective amount of the sesquiterpene compound in the drug is 25–50 mg / kg.

[0011] In some instances, the drug is used in the preparation of a medicament for treating rheumatoid arthritis.

[0012] In some instances, the drug is used in the preparation of remedies for psoriatic arthritis, synovial sarcoma, osteoarthritis, and gouty arthritis.

[0013] In some instances, the drug is used in combination with an antirheumatic drug to prepare a pharmaceutical composition for treating rheumatoid arthritis.

[0014] In some instances, the antirheumatic drug is selected from methotrexate, sulfasalazine, hydroxychloroquine, and adalimumab.

[0015] In some instances, the drug also includes pharmaceutically acceptable carriers, diluents, or excipients.

[0016] In some instances, the drug is a tablet, capsule, granule, powder, oral liquid, granule, pill, injection, powder for injection, aerosol, film, liniment, gel, cream, or lotion.

[0017] The beneficial effects of this invention are: (1) Synergistic effect of multiple targets, significantly improving the therapeutic effect: This invention reveals for the first time the triple regulatory mechanism of CJB on fibroblast-like synovial cells—inhibiting cell proliferation, reducing inflammatory response, and regulating ferroptosis pathway. Compared with single-target drugs, this multi-target mechanism can more comprehensively control the pathological process of RA, not only inhibiting the abnormal proliferation of FLS and the secretion of inflammatory factors, but also clearing pathological synovial cells by regulating ferroptosis and apoptosis, significantly improving the therapeutic effect and reducing disease recurrence.

[0018] (2) Significantly reduced toxic side effects: As a naturally derived sesquiterpene compound, CJB has a well-defined chemical structure and good biocompatibility. CJB exhibits relative selectivity for FLS in cytotoxicity within the effective concentration range (2.5-10 μM), which can significantly reduce health problems such as gastrointestinal discomfort, liver and kidney damage, and cardiovascular diseases caused by long-term drug use.

[0019] (3) Raw materials are readily available, costs are reduced, and it is easy to promote: CJB can be isolated from plants such as silver thread grass, the raw material sources are wide, and the preparation process is relatively mature. This makes the treatment method provided by this invention less expensive and easier to promote and apply in clinical practice, especially for RA patients who need long-term treatment, which has greater practical value and social significance.

[0020] (4) Potential for combination therapy: The CJB provided by this invention can be used in combination with existing antirheumatic drugs. Through the synergistic effect of different mechanisms of action, the therapeutic effect can be enhanced while the dosage of a single drug can be reduced, thereby reducing drug side effects and treatment costs. Attached Figure Description

[0021] Figure 1The effects of CJB on the viability of TNF-α-induced inflammatory human arthritis fibroblast-like synovial cells MH7A (determined by CCK8 assay), the effects of CJB on the viability of mouse embryonic osteoblast precursor cells MC3T3E1, and the effects of CJB on the viability of human monocyte THP1 cells (as described in the reference WEN Q, ZHAN B, JIN L, et al. Chlojaponilactone B Attenuates THP-1 Macrophage Pyroptosis by Inhibiting the TLR / MyD88 / NF-κB Pathway. Pharmaceuticals, 2024, 17(3): 402) were investigated.

[0022] Figure 2 To detect the inhibitory effect of CJB on MH7A proliferation using the ImageXpress Micro Confocal high-content imaging analysis system in EdU proliferation experiments.

[0023] Figure 3 This is a graph showing the proliferation rate of MH7A cells in the EdU proliferation experiment.

[0024] Figure 4 This is a diagram showing the effect of CJB on the migration of MH7A cells in a microscopic scratch assay.

[0025] Figure 5 The graph shows the results of the scratch healing rate in the scratch test.

[0026] Figure 6 This is a diagram showing the effect of CJB on the migration of MH7A cells in a Transwell assay under a microscope.

[0027] Figure 7 The graph shows the relative mobility results from the Transwell experiment.

[0028] Figure 8 The image shows the results of Annexin V-FITC / PI double staining in the CJB assay for MH7A cell apoptosis.

[0029] Figure 9 The graph shows the apoptosis rate results in the CJB validation of MH7A cell apoptosis.

[0030] Figure 10 This study investigated the inhibitory effect of CJB on the secretion of inflammatory factors in TNF-α-induced inflammatory MH7A cells.

[0031] Figure 11This study presents experimental results on the effects of CJB on the expression of inflammation and ferroptosis-related genes in MH7A cells using quantitative real-time polymerase chain reaction (qRT-PCR).

[0032] Figure 12 This is a band analysis diagram from the Western blot experiment to detect the effect of CJB on the expression of Nrf2, HO-1, and GPX4 proteins in MH7A cells.

[0033] Figure 13 The figure shows the data results from the Western Blot experiment to detect the effects of CJB on the expression of Nrf2, HO-1, and GPX4 proteins in MH7A cells.

[0034] Figure 14 The results of an in vivo study on the therapeutic effect of CJB on collagen-induced rheumatoid arthritis in mice are shown in the following figures: (A, mouse body weight change curve; B, mouse arthritis score change curve; C, representative images of HE and SO-FG staining of mouse ankle joint sections; D, levels of inflammatory factors TNF-α, IL-6, and IL-17a in mouse serum). Detailed Implementation

[0035] The following disclosure provides many different implementations or examples for different ways of implementing the present invention. The sources of the experimental materials used in the specific implementations are as follows: MH7A human arthritis fibroblast-like synovial cells: purchased from Guangzhou Genio Biotechnology Co., Ltd.; Tumor necrosis factor α (TNF-α): purchased from PeproTech Biotechnology Co., Ltd. Methotrexate (MTX): Purchased from Shanghai Hongye Biotechnology Co., Ltd.; EdU Imaging Kits (Cy3): Purchased from APExBIO, USA; References for CJB preparation method: Zhao JJ, Guo YQ, Yang DP, et al. Chlojaponilactone B from Chloranthus japonicus: Suppression of inflammatory responses via inhibition of the NF-kappa B signaling pathway. J Nat Prod, 2016, 79(9):2257-2263; QuantiCyto® Human IL-6 ELISA kit: purchased from Shenzhen Xinbosheng Biotechnology Co., Ltd. Example 1: CCK assay for cell viability

[0036] (1) Experimental methods The effect of CJB on the viability of TNF-α-induced inflammatory human arthritis fibroblast-like synovial cells MH7A was determined using the CCK8 assay. The following groups were included: blank control group (cell-free, DMEM complete medium), negative control group (cells without drug treatment), model group, CJB-treated group, and MTX-positive control group. Cells from each group were distributed at 6 × 10⁶ cells / well. 3 Cells were seeded at a density of 100 μL in each well of a 96-well plate, and incubated at 37°C with 5% CO2. After 24 h, when the cells reached a suitable density, the old medium was removed from each well. The negative control group was treated with 100 μL of fresh medium, the model group with fresh medium containing 20 ng / mL TNF-α, the CJB-treated groups with fresh medium containing 20 ng / mL TNF-α and CJB (2.5, 5, 10, and 20 μM), and the MTX-positive control group with fresh medium containing 20 ng / mL TNF-α and 1 μM MTX. The cells were then cultured for another 24 h.

[0037] The experiment on the effect of CJB on the viability of mouse embryonic osteoblast precursor cells MC3T3E1 included a blank control group (cell-free, DMEM complete medium), a negative control group (cells without drug treatment), a CJB-treated group, and an MTX-positive control group. Cells were distributed at 6 × 10⁶ cells per well. 3 Cells were seeded at a density of 100 μL in each well of a 96-well plate, and incubated at 37°C with 5% CO2. After 24 h, once the cells reached a suitable density, the old culture medium in each well was removed. The negative control group was treated with 100 μL of fresh culture medium, the CJB-treated groups were treated with fresh culture medium containing CJB (2.5, 5, 10, and 20 μM), and the MTX-positive control group was treated with fresh culture medium containing 1 μM MTX. Incubation continued for another 24 h.

[0038] After cell drug treatment, remove the culture medium from each well and add 100 μL of fresh culture medium and 10 μL of CCK8 reagent. Avoid generating air bubbles during the process. Incubate the culture plate in the dark for 3.5 hours, then remove it and measure the absorbance at 450 nm using a microplate reader. Cell viability calculation: Cell viability (%) = [A(drug treatment) - A(blank)] ÷ [A(negative control) - A(blank)] × 100%.

[0039] (2) Experimental results The principle of the CCK8 method for cell proliferation / viability detection is that mitochondrial dehydrogenases in live cells reduce water-soluble WST-8 to an orange-yellow formazan product. When there is no significant change in the metabolic activity of cells, the amount of formazan product produced is directly proportional to the number of live cells. The absorbance value obtained at 450 nm can reflect the cell viability or proliferation status.

[0040] like Figure 1 As shown, after TNF-α stimulation, the viability of MH7A cells decreased compared to the solvent control group. Low-dose (2.5 μM) CJB could reverse the decrease in cell viability caused by TNF-α stimulation. Combined with the experimental results of subsequent Examples 2, 5, and 6, the increased absorbance value in the low-dose group was not because low-dose (2.5 μM) CJB promoted the proliferation of inflamed MH7A cells, but because CJB could activate the Nrf2 pathway, leading to upregulation of downstream antioxidant enzymes and an increase in overall cellular metabolism, manifested as an increase in the production of formazan products.

[0041] Higher concentrations of CJB (5, 10, and 20 μM) showed a concentration-dependent decrease in cell viability. At high doses (10 and 20 μM), the cell inhibition effect of the CJB-treated groups was comparable to that of the MTX-positive control group, reflecting the inhibitory effect of CJB on the proliferation of MH7A cells. Meanwhile, at the same dosage, CJB did not reduce the cell viability of mouse embryonic osteoblast precursor cells (MC3T3E1 cells), indicating that the inhibitory effect of CJB on cell proliferation is relatively selective. Example 2: EdU proliferation assay to detect the inhibitory effect of CJB on MH7A proliferation.

[0042] (1) Experimental methods The thymidine nucleoside analog EdU (5-ethynyl-2'-deoxyuridine) can be incorporated into the DNA strand during DNA synthesis. The acetylation group of EdU is a bioinert group and reacts highly selectively with the azide group of Cy3 dye via the CuAAC reaction to generate a 1,2,3-triazole product, thereby fluorescently labeling the DNA of proliferating cells. Hoechst 33342 is a blue fluorescent dye that can penetrate cell membranes; it emits strong blue fluorescence after intercalation into double-stranded DNA and was used in this experiment to label the DNA of all cells.

[0043] MH7A cells were spaced at 6 × 10⁶ cells per well. 3Cells were seeded at a density of [number] cells per well in 96-well plates, and the modeling and drug treatment methods were the same as in Example 1. After drug treatment, EdU incubation, cell fixation, and fluorescence staining were performed according to the EdU kit instructions. The proliferation of cells in each group was detected and analyzed using the ImageXpress Micro Confocal high-content imaging analysis system. The proliferation rate (%) was calculated as the ratio of the number of EdU-positive cells to the number of Hoechst 33342-positive cells in each group.

[0044] (2) Experimental results Experimental results and Figure 2 , Figure 3 The results showed that, compared with the model group, the CJB-treated group reduced the proliferation rate of MH7A cells in a concentration-dependent manner, indicating that CJB has a significant inhibitory effect on the proliferation of fibroblast-like synovial cells in the concentration range of 2.5-10 μM. Example 3: Scratch assay and Transwell cell migration assay to determine the inhibitory effect of CJB on MH7A migration

[0045] (1) Experimental methods Scratch assay: MH7A cells were spaced at 3.5 × 10⁶ cells per well. 5 Cells were seeded at a density of 100 μL in 12-well plates and incubated at 37°C with 5% CO2. After 24 h, when the cells reached a suitable density, uniform scratches of consistent width were made at the same location in each well using the tip of a 200 μL pipette. The initial scratches were photographed under an inverted microscope to record their appearance. The old culture medium was removed from each well. 1 mL of fresh culture medium was added to the negative control group, fresh culture medium containing 20 ng / mL TNF-α was added to the model group, fresh culture medium containing 20 ng / mL TNF-α and CJB (2.5, 5, and 10 μM) was added to the CJB treatment group, and fresh culture medium containing 20 ng / mL TNF-α and 1 μM MTX was added to the MTX positive control group. Incubation continued for another 24 h. After drug treatment, the scratches were photographed at the same location under an inverted microscope to record their appearance. ImageJ software was used to analyze the scratch area before and after drug treatment and calculate the healing rate. Healing rate calculation: Healing rate (%) = (1 - scratch area after drug treatment / initial scratch area) × 100%.

[0046] Transwell cell migration assay: MH7A cells were spaced at 3.5 × 10⁶ cells per well. 5 Cells were seeded at a density of 100 cells / well in 12-well plates and incubated at 37°C with 5% CO2. After 24 h, the old culture medium was discarded, and the modeling and drug treatment methods were the same as for the scratch assay. After 24 h of drug treatment, cells were digested with trypsin, and each group of cells was divided into two groups at a density of 2 × 10⁶ cells / well. 4Cells were seeded at a density of [number] cells per Transwell chamber (PET membrane, 8 μm pore size). The upper chamber contained 200 μL of serum-free culture medium, and the lower chamber contained 800 μL of complete culture medium. After culturing for 24 h, cells were fixed with 4% paraformaldehyde, stained with crystal violet, and the cells in the upper chamber were scraped off with a cotton swab. Cell migration results were recorded by photographing under an inverted microscope. ImageJ software was used to count the cells on the lower chamber membrane of each group, and the relative migration rate of each group was calculated. Relative migration rate calculation: Relative migration rate (%) = Number of cells on the lower chamber membrane of the drug-treated group / Number of cells on the lower chamber membrane of the negative control group × 100%.

[0047] (2) Experimental results Experimental results and Figure 4 , 5 Figures 6 and 7 show that, compared with the negative control group, the scratch healing rate and relative migration rate of cells in the model group were significantly increased; compared with the model group, the CJB-treated group showed a concentration-dependent decrease in the scratch healing rate and relative migration rate of MH7A cells, indicating that CJB has a significant inhibitory effect on the migration of fibroblast-like synovial cells in the concentration range of 2.5-10 μM. Example 4: Experiment on the effect of CJB on apoptosis of MH7A cells using Annexin V-FITC / PI double staining method

[0048] (1) Experimental methods MH7A cells were spaced at 8 × 10⁸ cells per well. 5 Cells were seeded at a density of 1000 cells / well in 6-well plates, with 2 mL of DMEM medium added to each well. The plates were then incubated at 37°C with 5% CO2. After 24 h, once the cells reached a suitable density, the old medium was removed from each well. The negative control group received 2 mL of fresh medium, the model group received fresh medium containing 20 ng / mL TNF-α, the CJB-treated groups received fresh medium containing 20 ng / mL TNF-α and CJB (2.5, 5, and 10 μM), and the MTX-positive control group received fresh medium containing 20 ng / mL TNF-α and 1 μM MTX. The plates were then cultured for another 24 h. After drug treatment, 0.5 mL of EDTA-free trypsin was added to each well for 1 minute to digest the cells. 0.5 mL of complete culture was added to stop the digestion. The cells were gently blown off the cells, centrifuged (4℃, 1800 rpm) for 5 minutes, the supernatant was discarded, and the cells were washed with pre-cooled PBS. The cells were then stained according to the instructions of the Annexin V-FITC / PI apoptosis detection kit and detected by flow cytometry.

[0049] (2) Experimental results Experimental results and Figure 8 , 9The results showed that, after 24 h of drug treatment, compared with the model group, the CJB-treated group promoted the total apoptosis rate of MH7A cells in a concentration-dependent manner. At concentrations of 2.5 and 5 μM, it significantly increased the early apoptosis rate of cells, and at a concentration of 10 μM, it further promoted the cells to enter late apoptosis. This indicates that CJB can significantly promote apoptosis of fibroblast-like synovial cells in the concentration range of 2.5-10 μM. Example 5: Detection of IL-6 release from MH7A cells using enzyme-linked immunosorbent assay (ELISA).

[0050] (1) Experimental methods Cell culture, plating, modeling, and drug treatment were performed using the same methods as in Example 4. After drug treatment, the supernatant culture medium from each well was collected. A standard curve was established according to the instructions of the QuantiCyto® Human IL-6 ELISA kit. The cell supernatant was diluted at a certain ratio and then incubated sequentially with the sample, biotinylated detection antibody, enzyme conjugate, and chromogenic substrate. The absorbance of each well at 450 nm was measured using an ELISA reader, and the release of the inflammatory factor IL-6 in each sample group was calculated.

[0051] (2) Experimental results Experimental results and Figure 10 The results showed that after TNF-α stimulation, the concentration of IL-6 in the cell supernatant of the model group was significantly increased compared with the negative control group. Compared with the model group, the concentration-dependent decrease of IL-6 in the supernatant of MH7A cells by CJB administration group, while the concentration of IL-6 in the cell supernatant of MTX group was significantly increased. This indicates that CJB has a significant inhibitory effect on the release of IL-6, an inflammatory factor in fibroblast-like synovial cells, in the concentration range of 2.5-10 μM, while MTX, although it can inhibit cell proliferation and promote apoptosis at a concentration of 1 μM, exacerbates the release of IL-6. Example 6: Detection of the effect of CJB on the expression of inflammation and ferroptosis-related genes in MH7A cells using quantitative real-time polymerase chain reaction (qRT-PCR).

[0052] (1) Experimental methods MH7A cells were prepared at a ratio of 1×10⁶ cells per dish. 6Cells were seeded at a density of 100 cells / well in 6 cm culture dishes, with 3 mL of DMEM medium added to each well. The dishes were then incubated at 37°C with 5% CO2. After 24 h, once the cells reached a suitable density, the old medium was removed from each well. The negative control group received 3 mL of fresh medium, the model group received fresh medium containing 20 ng / mL TNF-α, and the CJB-treated groups received fresh medium containing 20 ng / mL TNF-α and CJB (2.5, 5, and 10 μM), respectively. Incubation continued for another 24 h. After drug treatment, total RNA was extracted from the cells in each dish, and the RNA was reverse transcribed into cDNA template according to the instructions of the EZbioscience Color Reverse Transcription Kit (with gDNA Remover). Following the steps described in the EZbioscience 2× EZ Color SYBR Green qPCR Master Mix reagent instructions, primers for human NFE2L2, HMOX1, GPX4, SLC3A2, SLC7A11, FTH1, GCLM, PTGS2, IL1B, IL6, MMP13, and ACTB genes were added to perform real-time quantitative amplification of each cDNA template. The cycle number (Ct value) of the target gene was compared with that of the internal reference gene to calculate the relative expression level of each target gene. The calculation expression is 2. (-ΔΔCt) The primer sequences are shown in Table 1 below: Table 1 Forward Reverse NFE2L2 GCCAACTACTCCCAGGTTGC GTGACTGAAACGTAGCCGAAG HMOX1 ACGGCTTCAAGCTGGTGAT AAGACTGGGCTCTCCTTGTTG GPX4 GCATCCTGGGAAATGCCATC GCCACACACTTGTGGAGCTA SLC3A2 GAGTGACCAGCGGAGTAAGGAG CCAGTGGCGGATATAGGAGAAGAG SLC7A11 CGTCCTTTCAAGGTGCCACT GGCAGATTGCCAAGATCTCA FTH1 CCTACGTTTACCTGTCCATGTCTT AAGGAAGATTCGGCCACCTC GCLM GCACAGCGAGGAGCTTCAT CCCTGACCAAATCTGGGTTGA PTGS2 GCAAATTGCTGGCAGGGTTG GCTCTGGTCAATGGAAGCCT IL1B AGCCATGGCAGAAGTACCTG CCTGGAAGGAGCACTTCATCT IL6 TTCGGTCCAGTTGCCTTCTC TCTGAAGAGGTGAGTGGCTGTC MMP13 CGCCAGACAAATGTGACCCT CAGGCGCCAGAAGAATCTGT ACTB CCTCGCCTTTGCCGATCC GGATCTTCATGAGGTAGTCAGTC (2) Experimental results Experimental results and Figure 11The results showed that, compared with the negative control group, the relative expression levels of NFE2L2, GPX4, SLC3A2, FTH1, PTGS2, IL1B, IL6, and MMP13 genes were significantly increased in the model group after TNF-α stimulation, indicating that MH7A cells exhibited an invasive phenotype after TNF-α stimulation, manifested as increased ferroptosis resistance, inflammatory factors, and the relative expression levels of matrix metalloproteinase-related genes. Compared with the model group, CJB treatment significantly increased the expression levels of HMOX1, SLC3A2, SLC7A11, FTH1, and GCLM genes, while significantly decreasing the expression levels of GPX4, PTGS2, IL1B, IL6, and MMP13 genes. This indicates that CJB treatment can, in a concentration-dependent manner, reduce the expression of inflammation and matrix metalloproteinase-related genes in MH7A cells after TNF-α stimulation, and enhance the regulation of cysteine ​​ingestion, glutathione synthesis, and iron homeostasis. The increased GPX4 expression in the model group may be due to compensatory upregulation under high oxidative lipid stress, which decreased after CJB treatment. The above results indicate that CJB can inhibit ferroptosis in TNF-α-stimulated inflammatory MH7A cells in a concentration-dependent manner, reduce the inflammatory response, and alleviate articular cartilage damage by reducing the expression of matrix metalloproteinases. Example 7: Western Blot Detection of Ferroptosis-Related Protein Expression in MH7A Cells

[0053] (1) Experimental methods Cell Culture and Protein Sample Preparation Cell culture, plating, modeling, and drug treatment methods were the same as in Example 6. After drug treatment, total protein was extracted according to the following steps: Each culture dish was placed on ice, the culture medium was discarded, and the dishes were rinsed twice with pre-cooled PBS. 150 μL of RIPA lysis buffer containing protease inhibitors and phosphatase inhibitors was added to each dish. Cells were scraped off with a cell scraper and transferred to 1.5 mL centrifuge tubes. The tubes were placed on ice for lysis for 30 minutes, centrifuged at 4 ℃ and 12000 rpm for 10 minutes, and the precipitate was discarded to obtain the total protein solution from each dish. The protein concentration of each dish was determined using the BCA method according to the Beyotime BCA protein concentration assay kit (P0010) instructions. Each sample was prepared into a working solution containing 15 μg of protein per 10 μL using protein solution, ultrapure water, and 5×SDS-PAGE Loading Buffer. After mixing, the solution was heated in a metal bath at 100 ℃ for 5 minutes to denature the protein. After being placed at room temperature, the solution was stored at -80 ℃.

[0054] Western Blot Experiment Gel preparation: Prepare 10% PAGE gel according to the steps described in the Omni-Easy™ One-Step PAGE Gel Rapid Preparation Kit instructions.

[0055] Electrophoresis: Fix the gel glass plate in place in the electrophoresis tank, add sufficient electrophoresis buffer (Seville rapid high-resolution electrophoresis buffer), remove the comb, add 10 μL of protein sample to each well, and add 5 μL of PageRuler pre-stained protein molecular weight standard (Thermo Fisher Scientific, catalog number 26616) to the outermost well. Electrophoresis conditions: 80 V for about 30 min, then adjust the voltage to 120 V and continue electrophoresis for about 60 min, stopping when bromophenol blue reaches the gel endpoint.

[0056] Transfer: Immerse a 0.22 μm PVDF membrane in methanol for 2 min to activate it. Open the transfer clamp, with the black plate as the base, and sequentially layer the transfer sponge, gel, PVDF membrane, and transfer sponge, clamping them securely. Ensure there are no air bubbles between each layer during the process. Place the transfer clamp in the electrophoresis tank, add the transfer buffer, and place the tank in an ice bath. Adjust the constant current to 220 mA and perform transfer in an ice bath for 100 min.

[0057] Blocking: After transfer, prepare a 5% skim milk blocking buffer using TBST buffer and skim milk powder. Immerse the PVDF membrane in the blocking buffer and gently shake on a horizontal shaker at room temperature for 2 hours. After blocking, discard the blocking buffer, add TBST buffer, and wash the membrane by rapid shaking for 5 minutes. Repeat three times.

[0058] Antibody incubation: Dilute the antibodies according to the dilution ratio specified in the instructions using Beyotime Western blotting primary antibody dilution buffer. Place the membrane bands containing the target protein into the corresponding primary antibody and incubate at 4 °C for 12 h. After primary antibody incubation, remove the membrane bands, add TBST buffer, and wash the membrane with rapid shaking for 10 min. Repeat three times. Dilute the secondary antibody 1:10000 using Beyotime Western blotting secondary antibody dilution buffer. Place the membrane bands into the corresponding secondary antibody and incubate at room temperature on a horizontal shaker with gentle shaking for 1 h. After incubation, remove the membrane bands, add TBST buffer, and wash the membrane with rapid shaking for 10 min. Repeat three times.

[0059] Development: The chemiluminescence solution was prepared according to the instructions of the NewCeMed High-Sensitivity ECL Chemiluminescence Kit. The chemiluminescence solution was uniformly added to the membrane surface, and the membrane was placed in a dark chamber. The focus, background exposure, and exposure time were adjusted. After exposure was complete and a clear image was obtained, the white light image and chemiluminescence image were acquired. Quantitative analysis of the Western blotting bands was performed using ImageJ software.

[0060] (2) Experimental results Experimental results and Figure 12 , 13The results showed that after TNF-α stimulation, the expression level of GPX4 protein in the model group cells was significantly increased compared with the negative control group; while compared with the model group, the CJB-treated group significantly increased the expression of Nrf2 protein, increased the expression of HO-1 protein in a concentration-dependent manner, and decreased the expression of GPX4 protein, indicating that CJB can regulate iron metabolism balance, reduce oxidative damage, and inhibit ferroptosis in MH7A cells by activating the Nrf2 / HO-1 axis. Example 8: Therapeutic effect of CJB on collagen-induced rheumatoid arthritis in mice

[0061] (1) Experimental methods DBA / 1 mice (7 weeks old, 20±2 g) were used to establish a collagen-induced rheumatoid arthritis mouse model. On day 0, 0.1 mL of emulsified type II collagen emulsion (chicken type II collagen: complete Freund's adjuvant = 1:1) was injected intradermally at the base of the tail. On day 14 after the initial immunization, 0.1 mL of emulsion (chicken type II collagen: incomplete Freund's adjuvant = 1:1) was injected again to boost the immunization. The control group was injected with the same amount of physiological saline at the same time point. On day 28 after the initial immunization, mice exhibiting joint swelling were selected from the model mice and randomly divided into four groups: Model group, Methotrexate positive control group (MTX group), low-dose CJB group (CJBL group), and high-dose CJB group (CJBH group), with six mice in each group. After grouping, mice in each group were administered the drugs intraperitoneally. The CJBL group received 25 mg / kg CJB, the CJBH group received 50 mg / kg CJB, the MTX group received 1 mg / kg MTX, and the negative control group (NC group) and Model group received a blank solution. Administered the drugs three times a week for two weeks. During the experiment, the mice's body weight was recorded and a weight change curve was plotted. Every other day after the start of drug administration, arthritis scores were assessed for each mouse's limbs. Each limb was scored individually, and the sum of the scores for all four limbs was the mouse's arthritis score. An arthritis score change curve was plotted, with the scoring rules as follows: 0 points, normal without swelling; 1 point, mild swelling; 2 points, significant swelling; 3 points, joint ankylosis. Mice were sacrificed 24 hours after the last administration. Joint tissues were fixed, sectioned, stained with hematoxylin and eosin (H&E) and Safanin O-Fast Green (SO-FG). Serum was collected from mice and the levels of inflammatory factors TNF-α, IL-6, and IL-17a in the serum were detected to study the therapeutic effect of CJB on mice with collagen-induced rheumatoid arthritis.

[0062] (2) Experimental results Experimental results and Figure 14Figures A and B show that, compared with the negative control group, the weight gain in each model group was slower and the arthritis score was significantly higher, indicating that the experimental model was successful. After administration of CJB and MTX, the arthritis score of mice was significantly lower than that of the model group, indicating that CJB treatment reduced joint swelling in mice with rheumatoid arthritis.

[0063] Experimental results and Figure 14 C10 staining showed that, compared with the model group, the CJB-treated group and the MTX-positive control group mice exhibited significantly reduced synovial tissue proliferation and inflammatory cell infiltration in the toe and ankle joints, indicating that CJB inhibited synovial tissue proliferation and reduced joint inflammation in mice with rheumatoid arthritis. SO-FG staining showed reduced SO staining in the joints of the model group compared to the negative control group, while SO staining in the joints of the CJB-treated group and the MTX-treated group was significantly increased compared to the model group. SO is a cationic dye that binds multiple anions, and it can visualize cartilage tissue based on the principle of binding cationic dyes to anionic groups (chondroitin sulfate or keratin sulfate) in proteoglycans. SO staining is approximately proportional to the concentration of anions, indirectly reflecting the content and distribution of proteoglycans in the matrix. Normal cartilage matrix is ​​uniformly distributed; when cartilage is damaged, the matrix composition changes, resulting in lighter or even absent SO staining. Therefore, the staining results indicate that the cartilage in the joints of the model group mice was significantly damaged, while CJB treatment can alleviate cartilage damage in the joints of mice with rheumatoid arthritis.

[0064] Experimental results and Figure 14 The results showed that, compared with the negative control group, the levels of inflammatory factors TNF-α, IL-6, and IL-17a in the serum of mice in the model group were significantly increased, while the levels of inflammatory factors in the serum of mice in the CJBL, CJBH, and MTX groups were significantly reduced, indicating that CJB treatment can alleviate the inflammatory response in mice with rheumatoid arthritis.

[0065] The above is a further detailed description of the present invention and should not be considered as a limitation on the specific implementation of the present invention. For those skilled in the art, simple deductions or substitutions without departing from the concept of the present invention are all within the protection scope of the present invention.

Claims

1. The use of a sesquiterpene compound in the preparation of a drug that inhibits the proliferation and migration of fibroblast-like synovial cells and promotes apoptosis, characterized in that, The sesquiterpenoids are selected from... Or its salt.

2. The application according to claim 1, characterized in that, Sesquiterpenoids also include Solvents or derivatives thereof.

3. The application according to claim 1, characterized in that, The therapeutically effective amount of the sesquiterpene compound in the drug is 25–50 mg / kg.

4. The application according to claim 1, characterized in that, The application of the drug in the preparation of a drug for treating rheumatoid arthritis.

5. The application according to claim 1, characterized in that, The drug is used in the preparation of drugs for treating psoriatic arthritis, synovial sarcoma, osteoarthritis, and gouty arthritis.

6. The application according to claim 1, characterized in that, The drug is used in combination with an antirheumatic drug to prepare a pharmaceutical composition for treating rheumatoid arthritis.

7. The application according to claim 1, characterized in that, The antirheumatic drugs are selected from methotrexate, sulfasalazine, hydroxychloroquine, and adalimumab.

8. The application according to claim 1, characterized in that, The drug may also contain pharmaceutically acceptable carriers, diluents, or excipients.

9. The application according to any one of claims 1-8, characterized in that, The drug is in the form of tablets, capsules, granules, powders, oral liquids, granules, pills, injections, powder injections, aerosols, films, liniments, gels, creams, or lotions.