Blastocladia tenuis and uses thereof

Abstract

This invention discloses *Aphelenchus brittleus* and its applications, relating to the field of microbial technology. The strain is taxonomically named *Aphelenchus brittleus* (…). Acaulospora delicata The specimen, with accession number CGMCC NO.42100, is a *C. cristatum* NM26B that can improve the yield and quality of chives, enhance mineral nutrient absorption, and increase the expression of genes synthesizing chive-specific aroma compounds. This lays the foundation for future research and development of suitable microbial agents for the development of the chive industry.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and more specifically to a strain of *Aphelenchus brittleens* (…). Acaulospora delicata NM26B and its application in promoting leek growth, improving mineral nutrient absorption, and enhancing quality. Background Technology

[0002] Chinese chives( Allium tuberosum Rottler ex Spreng, a perennial vegetable crop belonging to the genus Allium in the family Liliaceae, originated in my country. It boasts a unique flavor and a long history of cultivation, spanning over 3,000 years, and is now grown nationwide. In 2018, the national planting area for leeks reached 400,000 hectares, ranking fourth among specialty vegetables, second only to chili peppers. Capsicum annuum L.), garlic ( Allium sativum L.) and scallions ( Allium fistulosum By 2020, the planting area of ​​chives had expanded to 435,000 hectares, with a total output of 22.8 million tons. Hebei, Henan, and Shandong provinces are the main producing areas, each with a planting area of ​​approximately 40,000 hectares and an average annual output of 2 million tons. Because chives are a perennial crop, continuous cropping obstacles and soil degradation are serious problems, posing potential risks to chive yield and product quality and safety.

[0003] Microbial fertilizers offer significant advantages in crop production, leading to their widespread application. In practical use, microbial fertilizer formulations containing different probiotics can effectively improve crop quality, enhance soil quality, and promote sustainable agricultural development. They offer advantages such as high yield and low input, and also inhibit or mitigate heavy metal hazards, significantly reducing the heavy metal content in vegetables. In my country's agricultural production sector, this aligns with the pursuit of green products and the national development direction for bio-fertilizers.

[0004] Arbuscular mycorrhizal fungi (AMF), belonging to the phylum Globosae, are a special type of soil microorganism that can form symbiotic relationships with approximately 80% of terrestrial plants. After infecting the host root system, AMF infects the root system and alters root morphology by promoting nutrient absorption, thereby increasing host biomass and nutrient uptake. In addition, AMF also promotes mineral nutrient absorption and improves crop quality.

[0005] The unique aroma of chives originates from the large number of volatile flavor compounds contained in its tissues. Among them, S-alkylcysteine ​​sulfoxides (CSOs) serve as core precursors, which degrade under specific enzymatic reactions to generate volatile organosulfur compounds. The quality of chives largely depends on the accumulation of its flavor compounds.

[0006] Therefore, how to provide a microbial strain that can efficiently promote the growth and nutrient absorption of chives and improve their quality is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0007] In view of this, the present invention provides a strain of *Aphelenchus brittleens* (… Acaulospora delicata NM26B and its applications.

[0008] To achieve the above objectives, the present invention adopts the following technical solution: A strain of *Aphelenchus fragilis* NM26B, taxonomically named *Aphelenchus fragilis* (… Acaulospora delicata (This is a fragment of a collection of microorganisms, deposited at the China General Microbiological Culture Collection Center, with accession number CGMCCNO.42100, deposit date September 11, 2025, deposit address No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.)

[0009] Application of *Amycosis cristatum* NM26B in chive cultivation.

[0010] Furthermore, it promotes the growth of chives and the absorption of mineral nutrients.

[0011] Furthermore, the *Streptococcus brittle* NM26B improves the absorption of nitrogen, phosphorus, and potassium by chives.

[0012] Furthermore, this includes promoting the growth of leek roots and changes in root morphology.

[0013] Furthermore, this includes increasing the yield and quality of chives.

[0014] The effects of *Aphelenchus brittle-stalked* NM26B on the aromatic compounds in chives are as follows: 1) Upregulation of a single key gene involved in sulfur transport and CSO biosynthesis, encoding a sulfate transport protein. AtuSULTR ( DN25185_c0_g1 The expression of γ-glutamyltransferase; AtuGGT ( DN4209_c0_g1 ) and encoding flavin-containing monooxygenase AtuFMO ( DN10312_c0_g1 Genes have a positive impact.

[0015] 2) It increased the pyruvic acid content and decreased the nitrate content in chives.

[0016] A microbial agent comprising the *Streptococcus brittle* NM26B as described in claim 1.

[0017] As can be seen from the above technical solution, compared with the prior art, the beneficial effects of the present invention are as follows: This invention has screened a highly efficient strain of *Trichoderma brittleense* that promotes mineral nutrient absorption, growth, and quality improvement in chives. Acaulospora delicata ), strain number NM26B.

[0018] Inoculation of chives with the *Amyces brittlemi* NM26B of this invention produced a highly efficient effect in promoting nutrient absorption and increasing yield, with a yield increase of 30.5%. The absorption of nitrogen, phosphorus, and potassium in chive leaves increased by 34.1%, 50.0%, and 39.7%, respectively. This demonstrates that inoculation with *Amyces brittlemi* NM26B significantly promoted the absorption of nitrogen, phosphorus, and potassium in chive plants, providing more nutrients for plant growth, thereby promoting growth and achieving a significant yield increase.

[0019] Meanwhile, *Aphelenchoides brittle* NM26B significantly promoted root growth and nutrient absorption in chives, increasing root biomass by 60.3%, from 4.31g to 6.91g. Total root length, total root surface area, average diameter, and total root volume increased significantly by 59.2%, 47.2%, 5.4%, and 36.9%, respectively.

[0020] Meanwhile, after inoculation with the *Streptomyces brittleness* NM26B of this invention, the pyruvate content in leek leaves increased significantly by 32.0%, vitamin C content increased by 16.7%, soluble sugar increased by 4.4%, soluble protein content increased by 15.3%, while nitrate content, an important safety quality factor, decreased by 26.5%.

[0021] The unique aroma of chives is mainly attributed to a series of organosulfur compounds, primarily S-hydroxycysteine ​​sulfoxides (CSOs). Experimental results showed that inoculation with the strain NM26B of this invention significantly upregulated the expression of a single key gene involved in sulfur transport and CSO biosynthesis, including the gene encoding a sulfate transporter protein. AtuSULTR ( DN25185_c0_g1 Significantly upregulated; gene encoding γ-glutamyl transpeptidase AtuGGT ( DN4209_c0_g1 ) and genes containing flavin monooxygenase AtuFMO ( DN10312_c0_g1 The expression levels of these two genes are also positively affected.

[0022] Allicin is an important substance that contributes to the flavor of chives and also has significant pharmaceutical value, encoding γ-glutamyltransferase. AtuGGT ( DN4209_c0_g1 ) and the gene encoding flavin monooxygenase AtuFMO ( DN10312_c0_g1 These two genes are important for regulating the biosynthesis pathway of CSO, a precursor of leek flavor. Positive effects on the expression of these two genes are beneficial to the accumulation of leek flavor substances.

[0023] In conclusion, *Aphelenchus brittleides* NM26B can improve the yield and quality of chives, enhance mineral nutrient absorption, and increase the expression of genes synthesizing chive-specific aroma compounds. This lays the foundation for the subsequent development of microbial agents suitable for the development of the chive industry. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0025] Figure 1 Spore morphological characteristics of the strain of this invention; Figure 1 A: Magnified 10 times in PLVG solution; Figure 1 B: Magnified 50 times in PLVG solution; Figure 1 C: Melzer reagent magnified 50 times; Figure 1 D: Melzer reagent magnified 40 times; Figure 1 A scale bar is 50 μm; Figure 1 B scale is 10 μm; Figure 1 The scale bars for C and D are 20 μm; Figure 2 Phylogenetic tree construction of the SSU-ITS-LSU sequence of the strain of this invention; Figure 3 The effects of the strain of this invention on the root morphology of leek; Figure 3 A represents the total fresh weight of stems and leaves; Figure 3 B represents the total N absorption by stems and leaves; Figure 3 C represents the total P absorption by stems and leaves; Figure 3 D represents the total potassium absorption by stems and leaves; Figure 4 The effects of the strain of this invention on the yield and mineral nutrient absorption of leeks; CK is the uninoculated control, and NM26B is the strain treatment; in the same block, the letters a and b indicate significant differences at the 5% level (n=5), with an error of SE; Figure 5 The effect of the strain of this invention on the expression of sulfur transport genes in leek roots; Figure 5 A is DN25185_c0_g1 Relative expression level; Figure 5 B is DN10312_c0_g1 Relative expression level; Figure 5 C is DN4209_c0_g1 Relative expression levels; CK is the uninoculated control, and NM26B is the strain treatment; within the same block, the letters a and b indicate significant differences at the 5% level (n=5), with an error of SE. Detailed Implementation

[0026] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0027] Example 1 Isolation, screening and identification of strains 1. Isolation and screening of strains The strain of this invention was derived from the topsoil of the rhizosphere of *Setaria viridis* in the northwestern desert of Inner Mongolia, China (112°56′E, 40°90′N). The specific isolation method was as follows: Topsoil samples of 0-10 cm depth were collected using a 5 cm soil auger. After air-drying, 50 g of the air-dried soil sample was weighed and placed on the top of the analyzer's sieve (sieve apertures from top to bottom: 5 mm, 2 mm, 1 mm, 0.5 mm, 0.25 mm, 50 μm). Deionized water was slowly added along the barrel wall until the soil sample was submerged. The sample was soaked and moistened for 5 minutes, then vertically shaken for 5 minutes at 25-0 times / min with an amplitude of 3 cm. The material remaining on the 50 μm sieve was used to extract single spores under a microscope using tweezers. These spores were then cultured in sterile sand for 2 months for propagation and designated as NM26B.

[0028] 2. Identification of strains 1) Morphological identification Some spores of the propagated strain NM26B were pressed into slides to determine their morphological characteristics. Specifically, AMF spore slides and spore wall samples were prepared using polyvinyl alcohol-lactic acid glycerol mixture (PVLG) and Melzer's reagent, respectively. The microstructure of AMF spores was examined under an Olympus DP72 compound microscope to determine the morphological characteristics of the spores. The color of fresh specimens was examined under a 20-micron dissecting microscope.

[0029] Spore morphological characteristics (see) Figure 1 ): Spore color: Pale yellow to grayish yellow; Spore morphology: globose to nearly globose; diameter 36.23–(57.33)–86.47 μm; Spore wall and spore size: This fungus has four spore walls, namely SWL1, SWL2, SWL3, and SWL4.

[0030] SWL1, uniform (without visible sublayers), semi-permanent, flexible, smooth and transparent, with a thickness of 0.75-(2.46)-4.61 μm; SWL2 layer, uniform, permanent, semi-flexible, smooth, transparent, 0.95-(1.84)-3.19μm thick; SWL3 layers, uniform, permanent, semi-flexible, smooth, transparent, 0.81-(1.66)-3.85μm thick; SWL4 layers, layered, permanent, semi-flexible, 1.01-(2.41)-4.66 μm thick; Melzer staining: SWL1-3 are stained yellow-brown to dark brown in Melzer reagent, while SWL4 is left unstained.

[0031] Other characteristics: The appendage hyphae are pale yellow to grayish yellow, straight or downward curved, cylindrical, rarely slightly funnel-shaped or slightly constricted at the base of the spore, and do not break in the flattened spore. The hyphal wall consists of four continuous layers, 1-4 layers of which are continuous with the spore wall. The spore contains a transparent oily substance.

[0032] 2) Molecular biological identification DNA was extracted from the selected strains using a DNA extraction kit (CTAB Plant Genomic DNA Rapid Extraction Kit, Adley Company). The SSU-ITS-LSU sequence was then amplified to obtain the sequence shown in SEQ ID NO. 1. After BLAST alignment, the SSU-ITS-LSU sequence of the strains was shared with a globally accessible database. NCBI A phylogenetic tree was constructed using sequences of species with high homology to those from the National Center for Biotechnology Information (NCBI) (http: / / www.ncbi.nlm.nih.gov / ). On this phylogenetic tree, the strain of this invention is related to *Streptococcus brittle* (…). Acaulospora delicata They split into two branches, with the closest genetic distance, reaching over 99% (see...). Figure 2 ).

[0033] Example 2 Effects of inoculation with *Streptomyces brittlemi* NM26B on leek yield and nitrogen, phosphorus, and potassium uptake Before sowing chives, soak the seeds in 30% hydrogen peroxide for 3 minutes, rinse 5 times with deionized water, soak in a 55℃ water bath for 15 minutes, and then place them in a petri dish for dark germination at 20℃. Germination will occur after 3 days. Sow 15 seeds per pot. When the seedlings reach about 10 cm in height, thin them out, leaving 10 uniformly growing chive seedlings per pot.

[0034] Two days after thinning, *Streptococcus brittleeri* NM26B was inoculated, with 200 spores per pot. Each treatment was replicated five times. Spore density was calculated using the sucrose wet sieving decanting method. Watering was done daily at a fixed weight, and nutrient solution was provided as needed. Four harvests were conducted during the growing season. Mineral nutrient absorption and yield data are the sum of all four harvests.

[0035] Methods for determining growth and mineral nutrient absorption indicators: Biomass was measured by dried weight; nitrogen was determined by the Kjeldahl method after digestion of plant samples; phosphorus was determined by the molybdenum-antimony colorimetric method; potassium and sodium content were determined by flame spectrophotometry.

[0036] From Table 1, Figure 3 It can be seen that the yield per leek plant increased from 114.4g to 149.3g, an increase of 30.5% (see...). Figure 3 A). The absorption of total nitrogen, phosphorus, and potassium by leek leaves increased by 34.1%, 50.0%, and 39.7%, respectively (see...). Figure 3 (BD). This demonstrates that inoculation with *Streptomyces brittlenis* NM26B significantly promoted the absorption of nitrogen, phosphorus, and potassium in leek plants, providing more nutrients for plant growth, thereby promoting growth and achieving a significant yield increase.

[0037] Table 1. Effects of the strain of this invention on leek yield and mineral nutrient absorption.

[0038] Note: Results in the table are expressed as mean ± standard error (mean ± SE). Different letters indicate significant differences at the p ≤ 0.05 (Duncan) level (n = 5).

[0039] Example 3 Effects of inoculation with *Streptomyces brittlemi* NM26 on root morphology of leek plants Similar to Example 2, before sowing chives, soak the seeds in 30% hydrogen peroxide for 3 minutes, rinse 5 times with deionized water, soak in a 55℃ water bath for 15 minutes, place them in petri dishes, and incubate in the dark at 20℃ to promote germination. Germination occurs after 3 days, and 15 seeds are sown per pot. When the seedlings reach about 10 cm in height, thin them out, leaving 10 chive seedlings of uniform growth per pot.

[0040] Two days after thinning, *Streptococcus brittleeri* NM26B was inoculated with 200 spores per pot, replicated 5 times. The density of the propagated inoculum was calculated using the sucrose wet sieving and decanting method. Watering was done daily at a fixed weight, and nutrient solution was provided as needed. A total of four harvests were conducted during the growing season. Mineral nutrient absorption and yield data are the sum of all four harvests.

[0041] Chives are perennial plants that can grow for a long time. After four harvests, root samples were taken, washed, and weighed (fresh weight), then dried to obtain dry weight (biomass). Root morphology was determined using a Perfection V800Photo scanner (Seiko Epson, Japan), and analyzed using the WinRHIZO 2007 system. All data were analyzed using ANOVA and SPSS variance analysis at a significance level of 5%.

[0042] According to the test results of this embodiment, as shown in Table 2 and Figure 4 As shown, inoculation with *Strombyx mori* NM26B also significantly promoted changes in the root morphology of chives. After inoculation with *Strombyx mori* NM26B, the total root length, total root surface area, average diameter, and total root volume increased significantly by 59.2%, 47.2%, 5.4% (non-significant difference), and 36.9%, respectively. Root biomass increased by 60.3%, from 4.31 g to 6.91 g.

[0043] Inoculation with *Strombyx mori* NM26B forms a mycelial network at the plant roots to absorb water and nutrients, increasing the surface area for mineral absorption by the plant roots. *Strombyx mori* NM26B expands the plant's absorption range by improving nutrient levels and altering root morphology (Table 2). Figure 4 Plant root morphology determines the contact area with soil and its absorption capacity; a good root morphology is beneficial for plants to acquire water and nutrients from the soil. *Aphelenchoides brittleii* NM26B not only altered the root morphology of chives but also significantly increased the average root biomass.

[0044] Table 2. Effects of the strains of this invention on root morphology and biomass of leek.

[0045] Note: Results in the table are expressed as mean ± standard error (mean ± SE). Different letters indicate significant differences at the p ≤ 0.05 (Duncan) level (n = 5).

[0046] Example 4 Effects of inoculation with *Streptomyces brittlemi* NM26B on the quality and key gene expression of chives Similar to Example 2, before sowing, the chive seeds were soaked in 30% hydrogen peroxide for 3 minutes, then rinsed 5 times with deionized water, soaked in a 55℃ water bath for 15 minutes, and placed in petri dishes for dark germination at 20℃. Germination occurred after 3 days, and 15 seeds were sown per pot. When the seedlings reached about 10 cm in height, the seedlings were thinned, leaving 10 chive seedlings of uniform growth per pot.

[0047] Two days after thinning, *Streptococcus brittleeri* NM26B was inoculated, with 200 spores per pot. Each treatment was replicated five times. The density of the propagated inoculum was calculated using the sucrose wet sieving decanting method. Watering was done daily at a fixed weight, and nutrient solution was provided as needed. Four harvests were conducted during the growing season. The quality of the chives was determined. After harvesting, the chives were refrigerated at 4℃. Quality determination included soluble sugar, soluble protein, vitamin C content, nitrate, and pyruvic acid content.

[0048] Flavor compound content was expressed as pyruvate content, which was determined using the enzymatic pyruvate content method after CSO hydrolysis. For each treatment, 5-8 uniformly growing chives were taken, the leaf tips and stems were removed, retaining only the middle part of the chives, and cut into 3-5 mm segments. Each treatment was divided into a background group and a reaction group. Approximately 0.200 g of chives was placed in an EP tube. 1.5 ml of 5% TCA phosphate buffer (pH=6.5) was added to the background group, and 1.5 mL of distilled water was added to the reaction group. The mixtures were homogenized and heated at 10000 r·min. -1 Centrifuge for 5 min. Dilute the reaction mixture 5 times, then add the supernatant of chives and 0.0125% 2,4-dinitrophenylhydrazine solution to the reaction mixture at a ratio of 3:1:5. After reacting for 5 min, add 0.6 mol·L⁻¹ -1 NaOH solution, and for the background group, the supernatant of chives, 0.0125% 2,4-dinitrophenylhydrazine solution, and 0.6 mol·L⁻¹ were added in the same ratio (3:1:5). - 1 NaOH solution was added simultaneously to terminate the reaction. The absorbance was measured at 520 nm using a BioTek microplate reader. The mixture was serially diluted with sodium pyruvate solution, and a standard curve was plotted to calculate the enzymatic pyruvate content in the leek leaves.

[0049] Vitamin C content was determined using the 2,6-dichlorophenolindophenol colorimetric method; soluble protein content was determined using the Coomassie brilliant blue colorimetric method; soluble sugar content was determined using the anthrone colorimetric method; and nitrate content was determined using the salicylic acid method.

[0050] Experimental data were processed using Microsoft Excel 2021 and analyzed using IBM SPSS Statistics 26, including ANOVA and multiple comparisons (Duncan and Tukey method, n=5, significance level set at p≤0.05).

[0051] Regarding quality, as shown in Table 3, pyruvate is an important flavor compound in chives. In the experiment, the pyruvate content in chive leaves inoculated with *Amygdaloides brittleii* (NM26B) increased significantly by 32.0%. Vitamin C content increased by 16.7%, soluble sugar by 4.4%, and soluble protein by 15.3%, while nitrate content, an important safety factor, decreased by 26.5%.

[0052] The aroma components of Allium species are a series of volatile organic sulfur compounds, typically derived from the aroma precursor CSO. Since direct identification of CSO or volatile aroma compounds is difficult, measuring pyruvate produced by CSO hydrolases becomes a low-cost and rapid alternative method for testing aroma intensity. In this experiment, the total aroma intensity was determined by measuring pyruvate produced by CSO hydrolases. Inoculation with the strain of this invention not only increased the yield of chives but also significantly increased the pyruvate content (Table 3), demonstrating that *Allium brittleense* NM26B has a dual effect on improving both yield and quality in chives.

[0053] Table 3. Effects of the strains of this invention on the enzymatic pyruvate content of leeks.

[0054] Note: Results in the table are expressed as mean ± standard error (mean ± SE). Different letters indicate significant differences at the p ≤ 0.05 (Duncan) level (n = 5). This is the first batch of data.

[0055] Example 5 Effects of *Streptococcus brittlemi* NM26B on sulfur transporter gene expression in leek Given that the aroma of chives is mainly derived from sulfur metabolites, S-alkylcysteine ​​sulfoxide (CSO), real-time quantitative PCR was used to analyze the relative expression levels of sulfur-related genes at the transcriptional level. The experiment employed a kit for extracting RNA from plant roots (Tiangen Biotech (Beijing) Co., Ltd.) and a kit for reverse transcription to cDNA (Beijing Adley Biotechnology Co., Ltd.). The resulting products were used for real-time quantitative PCR analysis. The ubiquitin gene was used as an internal reference gene, and the relative expression level was calculated according to equation 2-ΔΔCt.

[0056] The primer sequences (5'-3') are as follows: DN25185_c0_g1F: GGAATGAAGTTGAGGCCAAA, as shown in SEQ ID No. 1; DN25185_c0_g1R: ACGAGGAGGGAATCCAACTT, as shown in SEQ ID No. 2; DN10312_c0_g1F: AAAAGCCCCATCGAGAAAAT, as shown in SEQ ID No. 3; DN10312_c0_g1R: GTACTCCGACCACGACCATT, as shown in SEQ ID No. 4; DN4209_c0_g1F: AATTTCCCATCGACAGTGGTC, as shown in SEQ ID No. 5; DN4209_c0_g1R: GGGGGAGGAGCATTTATTGT, as shown in SEQ ID No. 6.

[0057] The unique aroma of chives is mainly attributed to a series of organosulfur compounds, primarily S-hydroxycysteine ​​sulfoxides (CSOs). A single gene is involved in sulfur assimilation and CSO biosynthesis; CSO biosynthesis originates from sulfur assimilation and is thus incorporated into organic metabolites. Experimental results showed that inoculation with the present invention strain NM26B significantly upregulated the encoding of sulfate transport proteins. AtuSULTR ( DN25185_c0_g 1) Gene expression, such as Figure 5 As shown in Figure A. Figure 5 B and Figure 5 C shows the encoding γ-glutamyltransferase. AtuGGT ( DN4209_c0_g1 ) and encoding flavin-containing monooxygenase AtuFMO ( DN10312_c0_g1 Both genes have a positive effect.

[0058] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0059] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A strain of *Aphelenchus brittleens* NM26B, characterized in that, The strain was taxonomically named *Aphelenchostomum brittleense*. Acaulospora delicata (The accession number is CGMCC NO.42100).

2. The application of the *Amygdalina brittleis* NM26B as described in claim 1 in the cultivation of chives.

3. The application according to claim 2, characterized in that, This includes promoting the growth of chives and the absorption of mineral nutrients.

4. The application according to claim 2, characterized in that, This includes promoting the growth of leek roots and changes in root morphology.

5. The application according to claim 2, characterized in that, This includes increasing the yield and quality of chives.

6. A microbial inoculant, characterized in that, The claimed microbial agent includes the *Streptococcus brittle* NM26B as described in claim 1.

Images