The application discloses a SNP molecular marker related to a total litter size character of pigs, a detection primer pair, a kit and application of the SNP molecular marker in a method for breeding large white pigs with high litter size.

Abstract

The application relates to the fields of molecular biological technology and livestock breeding technology, in particular to a SNP molecular marker related to a total number of piglets character, a detection primer pair, a kit and application of the SNP molecular marker in a method for breeding large white pigs with high number of piglets, the SNP molecular marker is located on a pig 9th chromosome, a physical position is located at chr9:65633096 of a genome version Ensembl Sscrofa11.1, a polymorphism site is C or A, and the C allele is positively correlated with the high number of piglets character; through genotype discrimination, selection breeding can be carried out: an individual with a genotype of C / C is preferentially selected or reserved as a breeding pig, because the total number of piglets has the highest potential, so that the genetic improvement speed of a population breeding performance is accelerated.

Description

Technical Field

[0001] This invention relates to the fields of molecular biotechnology and livestock breeding technology, specifically to an SNP molecular marker, detection primer pair, reagent kit related to the total number of piglets produced, and its application in the method of breeding high-producing Large White pigs. Background Technology

[0002] Total litter size is a key reproductive trait affecting the economic benefits of pig farming, but it is a typical low-heritability trait regulated by multiple genes, and improvement through traditional breeding methods is limited and slow. Molecular marker-assisted selection (MAS) provides an effective way to accelerate the genetic progress of low-heritability traits by using DNA markers closely associated with the target trait for early selection.

[0003] Total litter size in pigs is a core low-heritability trait affecting the economic benefits of the pig farming industry. Although some molecular markers related to pig reproductive traits have been reported (for example, Chinese patent CN117965742B discloses an SNP marker located at locus 117307797 on chromosome 7 of pigs, with the dominant genotype being AG), high-efficiency and high-stability molecular marker resources for the total litter size trait in Large White pigs remain very limited, restricting the precision and efficiency of molecular breeding. More importantly, different markers may reveal completely different genetic mechanisms and dominant genotype patterns. Therefore, continuously discovering new, significant, and specific molecular markers, especially those providing entirely new genotype-phenotype correspondences different from known patterns, is of great value for enriching the pig breeding toolbox, achieving multi-gene aggregation selection, and improving breeding efficiency. However, accurately locating a new locus with a clear phenotypic effect but an unknown effect pattern from the vast genome cannot be directly predicted from existing knowledge. Summary of the Invention

[0004] The purpose of this invention is to address the above-mentioned shortcomings by providing an SNP molecular marker, detection primer pair, kit related to the total litter size trait in pigs, and its application in the method of breeding high-producing Large White pigs. By identifying the genotype, selective breeding can be carried out: individuals with the C / C genotype are preferentially selected or retained as breeding pigs because they have the highest potential for total litter size, thereby accelerating the genetic improvement of the reproductive performance of the herd.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A SNP molecular marker associated with the total litter size trait in pigs, wherein the SNP molecular marker is located on pig chromosome 9, at chr9:65633096 in genomic version Ensembl Sscrofa11.1, and its polymorphic site is C or A, and the C allele is positively correlated with the high litter size trait.

[0007] Preferably, the nucleotide sequence containing the SNP molecular marker is shown in SEQ ID NO. 1; the SNP molecular marker is located at position 401 of the nucleotide sequence shown in SEQ ID NO. 1; wherein, the nucleotide sequence shown in SEQ ID NO. 1 is as follows:

[0008] CAGCGGGCTTCCTGGAACAGACCCCTTGGGCCGGGTTACAGATACAATCCCTCATTGAACACTCGGCCTCCCACTCCCACTGCTCTGCCAGCAGAGTCACACGCGCTCCCACCCTCTGTACCCCGAGGAGAACAGTGTGACCTTTGGAAAAAGCAAAGGGTCACCCCATCCACCAGAGTGATGTTTGCCAAAAAAGTGAGT CTGCTGGCCGCCCGCCTCTGTCTCCCTGTCCCCCATCAAGGAGCTCGGCATTTTTCTCCTGGGAACCCACAGAGGAGGGCAGTGGTGTAGGAGGGACATTTCCTCCTCACTGTCATCCCAATAGTGCTGCGGGATGGCCTCACACACACGTGCATGCACACATGCACGCACACACACACACACTCCAAGGGATGGGTAR(C / A)CAGGGGTGGTCGATATCCGAGCCAGGGAAAGAAAAGAGGTTCATGAATAAAGAAATCTTGTAGGAGTTCCCTGGTGGCCTAGTGATTAAGGATTCAGCGTTGTCACTTCTATGGCTGGAGTTCAGTCCCTGGCCTGGGAATTTCCACATGCTGTGGGCATGGCCAAAAAGAAAAAAACCTCGCAGACTGGACAGGCATC TGCCTCACCCCCTGCAGAGCCCATTGGAAGACTTTCCCTTCCCCTTGGAAGCCAAGAGAGCAAATTCATTTTCCACTCGACATTGTCATCCAGCGAGTTCCATAGAAGGAGAGAACGGCAGGTGGTGTGACATAGGGGACGAGGGCGTTCACAGGACTAGCTGGGTTGCCCTTGTCCCTAGGCAGTCTGTCTCCTCTGTCT.

[0009] Primer pairs for detecting a SNP molecular marker site associated with the total litter size trait in pigs as described above, wherein the nucleotide sequences of the primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.3, and the nucleotide sequences of the primer pairs for detecting the SNP molecular markers are as follows:

[0010] Forward primer SEQ ID NO.2: 5'-CCATCAAGGAGCTCGGCATT-3';

[0011] Reverse primer SEQ ID NO.3:5'-CTCGGATATCGACCACCCCT-3'.

[0012] A kit comprising the primer pairs described above, the kit comprising primer pairs SEQ ID NO.2 and SEQ ID NO.3, as well as dNTPs, DNA polymerase, buffer, and positive control sample necessary for the PCR reaction system.

[0013] A method for breeding high-yielding Large White pigs using any of the above-described SNP molecular markers, primer pairs for detecting the SNP molecular markers, and detection kits, specifically a method for identifying or screening high-yielding Large White pigs and a method for improving high-yielding Large White pigs.

[0014] A preferred method for identifying pig breeds with high total litter size includes the following steps:

[0015] a1, to detect the genotype of the SNP molecular markers on chromosome 9 of the pig individual to be tested;

[0016] a2. Based on the SNP locus chr9:65633096 genotype, the total number of piglets born was determined. Pigs with the CC genotype at the SNP locus had the highest total number of piglets born, pigs with the CA genotype had the middle total number of piglets born, and pigs with the AA genotype had the lowest total number of piglets born.

[0017] A preferred method for selecting pig breeds with high total litter size includes the following steps:

[0018] b1, to detect the genotype of the SNP molecular markers on chromosome 9 of the pig individual to be tested;

[0019] b2, Individuals with a single nucleotide at the SNP site being A are eliminated, and individuals with a single nucleotide at the SNP site being C are retained as breeding pigs; the pig breed is Large White.

[0020] A preferred method for improving pig breeds with high total litter size includes the following steps:

[0021] c1, to detect the genotype of the SNP molecular markers on chromosome 9 of the pig individual to be tested;

[0022] c2 involves selecting and breeding strains with the CC genotype to increase the total number of piglets born and improve the reproductive performance of sows.

[0023] The beneficial effects of this invention are:

[0024] The SNP molecular marker (rs711372444) disclosed in this invention is located on chromosome 9.

[0025] Association analysis of this invention showed a highly significant association between the genotype of this SNP locus and the total litter size. The total litter size of individuals with the C / C genotype (13.84 ± 0.089 litters) was significantly higher than that of individuals with the C / A genotype (12.91 ± 0.2376 litters) and the A / A genotype (10.2 ± 1.4514 litters), with the C / C genotype producing approximately 3.64 more litters than the A / A genotype. This effect size, along with the fact that the C / C genotype is the dominant genotype, underscores its importance.

[0026] The technology of this invention has high practical value in breeding. Due to the significant marker effect, it has high discrimination in breeding selection, good operability, repeatability, and predictive accuracy. Incorporating this marker into the breeding selection index can efficiently and early screen breeding pigs with high litter size potential, thereby effectively improving the overall reproductive efficiency and annual productivity (PSY) of the herd without increasing the number of sows.

[0027] This invention provides another independent and powerful new tool for molecular marker-assisted breeding. It can be used in conjunction with existing markers to perform multi-gene aggregation selection, which helps to address the genetic background of different pig populations and improve breeding results and genetic stability of breeding pigs. Attached Figure Description

[0028] Figure 1 This is a distribution density map of all SNPs identified in Example 1 of the present invention on pig autosomes;

[0029] Figure 2 This is a histogram of the frequency distribution of the total number of piglets born (TNB) trait in Large White pigs according to Example 1 of the present invention;

[0030] Figure 3 This is a Manhattan plot showing the genome-wide association analysis results of the total number of piglets born (TNB) trait in Large White pigs according to this invention. In this invention, SNPs with smaller P-values ​​on the threshold line located at chr9:65633096 are selected for further analysis. Different colored bars represent different chromosomes in pigs, dashed lines represent potential significance thresholds, and solid lines represent genome-wide significance thresholds.

[0031] Figure 4 This is a genotypic effect diagram of the significant association locus chr9:65633096 SNP for the total number of piglets born (TNB) trait in Large White pigs according to the present invention; the vertical axis of the diagram represents the phenotypic value of total number of piglets born, and the horizontal axis represents the genotypes CC, CA and AA of the three groups. Detailed Implementation

[0032] Example 1

[0033] Discovery and Association Verification of SNP Molecular Markers

[0034] (1) Blood samples were collected from 679 Large White pigs, and DNA was extracted from the samples for low-depth (0.5×) whole-genome resequencing to obtain initial genotyping data. QUILT2 was used to fill the initial genotyping data with genotypes, and PLINK v1.9.0 software was used to perform quality control filtering on the filled data, retaining SNP loci with MAF > 0.05 and genotype detection rate greater than 0.9. After quality control screening, a total of 5,756,902 SNP loci were obtained for subsequent genome-wide association analysis. The SNPs obtained from the quality control screening were all distributed on the 18 autosomes of pigs, and their genome coverage and distribution density were as follows: Figure 1 As shown, the quality-controlled data covered the entire genome, and the marker density was evenly distributed across the 18 autosomes, confirming its applicability to genome-wide association analysis.

[0035] (2) Phenotypic data of total litter size (TNB) in Large White pigs were processed. The phenotypic values ​​of TNB from 679 Large White pigs were corrected using yc=EBV+e to obtain standardized phenotypic values ​​for subsequent GWAS studies. The histogram of the frequency distribution of TNB in ​​Large White pigs is shown below. Figure 2 As shown, the higher the TNB value, the lower its frequency, and the trait distribution is consistent with the actual production results of the pig farm.

[0036] (3) Based on the QUILT2-filled genotype data, GWAS analysis of the SNP loci and the total litter size trait in Large White pigs was performed using the MLM model in GCTA v1.94.1. The specific model is as follows:

[0037] yc = Xα + Zβ + Wμ + e,

[0038] Where y is the vector of phenotypic values ​​of total litter size in Large White pigs; Xα is the fixed effect; Zβ is the marking effect; Wμ is the random effect; and e is the vector of random residual effects.

[0039] (4) The significance threshold for genome-wide significance was set at 5 × 10⁻⁶ in this study. -8 The reference significance threshold is 5×10 -6 Using the R package CMPLOT, SNP density plots and Manhattan plots are generated. Figure 3 As shown in the figure, the X-axis represents the 18 chromosomes of pigs, and the Y-axis represents the statistical significance results, expressed in terms of -logi. 10 (p) indicates that three genome-wide significant SNPs were identified, located on chromosome 9. An additional 58 reference significant SNPs were identified, located on chromosomes 9 and 11.

[0040] (5) Among the association signals that reached a significant level across the entire genome, the SNP locus located on chromosome 9 at chr9:65633096 with accession number rs711372444 was identified and focused. The total number of offspring for individuals with different genotypes at this locus was statistically analyzed, and the results are shown in Table 1. The differences in population phenotypic values ​​among different genotypes at this locus and the distribution of the number of individuals with the corresponding phenotypic values ​​are shown in Table 1. Figure 4 As shown.

[0041] Table 1. Significant association loci (chr9:65633096) SNP genotype-phenotypic value association analysis for Total Liver Count (TNB) in Large White pigs.

[0042]

[0043] To confirm the statistical significance of the phenotypic differences, multiple comparison ANOVA was performed on the data in Table 1 (e.g., using Duncan's new multiple range method).

[0044] The analysis results show that:

[0045] The total number of litters of individuals with genotype C / C (13.84 ± 0.0890) was significantly higher (P < 0.01) than that of individuals with genotype C / A (12.91 ± 0.2376) and individuals with genotype A / A (10.2 ± 1.4514).

[0046] Individuals with genotype C / A had a significantly higher total number of offspring than individuals with genotype A / A (P < 0.05).

[0047] In conclusion, the statistical analysis above sufficiently demonstrates a highly significant association between the rs711372444 locus located at chr9:65633096 and the total litter size trait in Large White pigs. The C allele at this locus exhibits a significant additive genetic effect, with the C / C homozygous genotype being most favorable for increasing total litter size. Therefore, in breeding practice, individuals with the C / C genotype at this locus should be prioritized for breeding.

[0048] Example 2

[0049] SNP site detection method (1) For the sequence shown in SEQ ID NO.1, the following primers are designed:

[0050] Forward primer (SEQ ID NO.2): 5'-CCATCAAGGAGCTCGGCATT-3';

[0051] Reverse primer (SEQ ID NO.3): 5'-CTCGGATATCGACCACCCCT-3'.

[0052] (2) PCR amplification system

[0053] PCR reaction system: Add 5 μL TaqMix, 0.2 μL each of forward and reverse primers, 1 μL DNA template, and 3.6 μL ddH2O to a 10 μL reaction system. PCR reaction conditions: 94°C pre-denaturation for 3 min; 94°C denaturation for 30 s, 59°C annealing for 30 s, 72°C extension for 10 s, 35 cycles; final extension at 72°C for 5 min.

[0054] (3) Finally, the PCR amplified products are sequenced. The gene fragment sequencing requires bidirectional sequencing.

[0055] The sequencing results are shown in SEQ ID NO.4:

[0056] CCATCAAGGAGCTCGGCATTTTTCTCCTGGGAACCCACAGAGGAGGGCAGTGGTGTAGGAGGGACATTTCCTCCTCACTGTCATCCCAATAGTGCTGCGGGATGGCCTCACACACACGTGCATGCACACATGCACGCACACACACACACACTCCAAGGGATGGGTAR(C / A)CAGGGGTGGTCGATATCCGAG;

[0057] Note: The sequence at the beginning and end of this sequence is bolded to show the sequence corresponding to the primer.

[0058] The specific embodiments described herein are merely illustrative examples of the invention. Those skilled in the art to which this invention pertains may make various modifications or additions to the described specific embodiments or use similar methods to substitute them, without departing from the scope defined by this invention.

Claims

1. A SNP molecular marker associated with the trait of total litter size in pigs, characterized in that: The SNP molecular marker is located on pig chromosome 9, with its physical location at chr9:65633096 in the genome version Ensembl Sscrofa11.

1. Its polymorphic site is C or A, and the C allele is positively correlated with the high litter size trait.

2. The SNP molecular marker related to the total litter size trait in pigs according to claim 1, characterized in that, The nucleotide sequence containing the SNP molecular marker is shown in SEQ ID NO.1; the SNP molecular marker is located at position 401 of the nucleotide sequence shown in SEQ ID NO.

1.

3. A primer pair for detecting an SNP molecular marker site related to the total litter size trait in pigs as described in any one of claims 1-2, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.

3. The nucleotide sequences of the primer pairs used to detect the SNP molecular marker are as follows: Forward primer SEQ ID NO.2: 5'-CCATCAAGGAGCTCGGCATT-3'; Reverse primer SEQ ID NO.3:5'-CTCGGATATCGACCACCCCT-3'.

4. A kit comprising the primer pair of claim 3, characterized in that, The kit includes primer pairs SEQ ID NO.2 and SEQ ID NO.3, as well as dNTPs, DNA polymerase, buffer, and positive control sample necessary for the PCR reaction system.

5. A method for breeding high-producing Large White pigs using the SNP molecular markers, primer pairs for detecting the SNP molecular markers, and a test kit according to any one of claims 1-4, characterized in that, Methods for identifying or screening high-yielding Large White pigs and methods for improving high-yielding Large White pigs.

6. The method for breeding high-yielding Large White pigs according to claim 5, characterized in that, The method for identifying pig breeds with high total litter size includes the following steps: a1, to detect the genotype of the SNP molecular markers on chromosome 9 of the pig individual to be tested; a2. Based on the SNP locus chr9:65633096 genotype, the total number of piglets born was determined. Pigs with the CC genotype at the SNP locus had the highest total number of piglets born, pigs with the CA genotype had the middle total number of piglets born, and pigs with the AA genotype had the lowest total number of piglets born.

7. The method for breeding high-yielding Large White pigs according to claim 5, characterized in that, The method for selecting pig breeds with high total litter size includes the following steps: b1, to detect the genotype of the SNP molecular markers on chromosome 9 of the pig individual to be tested; b2, Individuals with a single nucleotide at the SNP site being A are eliminated, and individuals with a single nucleotide at the SNP site being C are retained as breeding pigs; the pig breed is Large White.

8. The method for breeding high-yielding Large White pigs according to claim 5, characterized in that, Methods for improving pig breeds with high total litter size include the following steps: c1, to detect the genotype of the SNP molecular markers on chromosome 9 of the pig individual to be tested; c2 involves selecting and breeding strains with the CC genotype to increase the total number of piglets born and improve the reproductive performance of sows.

Images