Quantitative PCR primers, probes, kits and applications for simian and cytomegalovirus
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SUZHOU XISHAN BIOLOGICAL TECH
- Filing Date
- 2026-05-11
- Publication Date
- 2026-06-23
Smart Images

Figure CN122256574A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of pathogen detection technology, specifically to quantitative PCR primers, probes, kits, and applications for monkey parvovirus and cytomegalovirus. Background Technology
[0002] Simian parvovirus (SPV) and simian cytomegalovirus (SCMV) are two important pathogens threatening the health of monkeys. They can infect various monkey species, including laboratory monkeys and wild monkeys. In recent years, these two viruses have often been found to cause mixed infections in laboratory monkey populations. This can lead to immune dysfunction, abnormal growth and development, and even death in young and immunodeficient monkeys. Furthermore, it can seriously interfere with the accuracy and reproducibility of research data.
[0003] Currently, existing SPV and SCMV detection technologies have several core shortcomings. First, single-virus detection technologies are inefficient and costly; if two viruses need to be screened simultaneously, two independent experiments are required. Second, virus isolation and identification technologies are time-consuming and have low sensitivity, making rapid batch screening impossible. Third, ordinary PCR technology lacks sensitivity, cannot quantify, and requires open-top electrophoresis, which can easily cause aerosol contamination. Fourth, while existing quantitative real-time PCR technologies can quantify, they are mostly single-virus detection and cannot detect two viruses simultaneously. Some laboratory-developed multiplex PCR methods suffer from poor specificity, interference between primers and probes, and cross-reaction with homologous viruses (such as SPV and PPV, CPV) or other simian viruses (such as SCMV and other herpesviruses), resulting in high false-positive rates. Fifth, there is a lack of standardized commercial dual detection kits with complete components and precise ratios, leading to poor stability and repeatability of test results, which cannot meet the needs of large-scale production and market promotion. Summary of the Invention
[0004] The purpose of this invention is to overcome the shortcomings of existing technologies by providing quantitative PCR primers, probes, kits, and applications for simian parvovirus and cytomegalovirus. It enables the screening of specific target regions unique to the two viruses and exhibiting low homology with other viruses through in-depth comparative analysis of the whole genomes of SPV and SCMV, resulting in the design of two sets of highly specific primer-probe combinations without mutual interference. Based on these two sets of primers and probes, a standardized kit with complete components and precise proportions is constructed, including core components such as dual fluorescent quantitative PCR premix and dual positive and negative controls. Simultaneously, an optimized dual rapid quantitative detection method is established. Through standardized sample pretreatment, precise reaction system, optimized amplification procedure, and clear interpretation criteria, it achieves simultaneous detection of two viruses in a single experiment, with a total detection time of ≤2 hours, a detection limit as low as 5 copies / μL for both viruses, and 100% specificity.
[0005] To solve the above-mentioned technical problems, the present invention provides the following technical solution: Firstly, primers for dual-fluorescent quantitative PCR of monkey parvovirus and monkey cytomegalovirus: including a first primer pair for detecting monkey parvovirus and a second primer pair for detecting monkey cytomegalovirus, with the specific sequences as follows: First upstream primer SPV191F: sequence as shown in SEQ ID NO:1; The first downstream primer SPV191R has the sequence shown in SEQ ID NO:2; The second upstream primer SCMV169F has the sequence shown in SEQ ID NO:4; The second downstream primer SCMV169R has the sequence shown in SEQ ID NO:5.
[0006] Secondly, the probe for dual real-time PCR of monkey parvovirus and monkey cytomegalovirus is characterized in that the probe combination includes a first probe for detecting monkey parvovirus and a second probe for detecting monkey cytomegalovirus, wherein the nucleotide sequence of the first probe SPV191P is SEQ ID NO:3 and the nucleotide sequence of the second probe SCMV169P is SEQ ID NO:6.
[0007] Furthermore, the first probe SPV191P has a first fluorescent reporter group labeled at its 5' end and a first fluorescent quencher group labeled at its 3' end; the second probe SCMV169P has a second fluorescent reporter group labeled at its 5' end, which is different from the first fluorescent reporter group, and a second fluorescent quencher group labeled at its 3' end.
[0008] Furthermore, the first fluorescent reporter group is selected from one of FAM, HEX, and VIC, and the first fluorescent quencher group is selected from one of BHQ1, BHQ2, and TAMRA; the second fluorescent reporter group is selected from one of VIC, HEX, and FAM with a different emission wavelength than the first fluorescent reporter group, and the second fluorescent quencher group is selected from one of BHQ1, BHQ2, and TAMRA with a different emission wavelength than the first fluorescent reporter group.
[0009] Thirdly, the kit for dual real-time PCR of monkey parvovirus and monkey cytomegalovirus includes primer combinations, probes, dual real-time PCR premix, nuclease-free ddH2O, double positive control, and negative control.
[0010] Furthermore, the concentrations of the first upstream primer SPV191F and the first downstream primer SPV191R were both 10 μM and mixed in equimolar amounts; the concentrations of the second upstream primer SCMV169F and the second downstream primer SCMV169R were both 10 μM and mixed in equimolar amounts.
[0011] Furthermore, the first probe SPV191P has a concentration of 10 μM, with FAM labeled at the 5' end and BHQ1 labeled at the 3' end; the second probe SCMV169P has a concentration of 20 μM, with VIC labeled at the 5' end and BHQ1 labeled at the 3' end.
[0012] Furthermore, the dual PCR premix is of the TaqMan type, containing hot-start Taq enzyme, dNTPs, PCR buffer, and Mg. 2+ .
[0013] Furthermore, the double positive control is a mixture containing both simian parvovirus positive nucleic acid and simian cytomegalovirus positive nucleic acid of known copy number; the negative control is a blank buffer without SPV and SCMV nucleic acid.
[0014] Fourthly, the application of quantitative PCR kits for monkey parvovirus and cytomegalovirus, the application steps of which are as follows: Sample pretreatment: Use the nucleic acid extraction reagent in the kit to extract total DNA from monkey tissue, blood, feces or secretions, adjust the nucleic acid concentration to 5-100 ng / μL, and store at -20℃ for later use; Dual reaction system preparation: A total reaction volume of 20 μL was used, consisting of 10 μL of dual real-time PCR premix, 0.6 μL of SCMV primer mixture, 0.4 μL of SCMV probe, 0.6 μL of SPV primer mixture, 0.4 μL of SPV probe, 3.0 μL of nuclease-free ddH2O, and 5 μL of DNA template; the double positive control and negative control were replaced with double positive control mixed nucleic acid and negative control buffer, respectively. Amplification program settings: 95℃ pre-denaturation for 30s, 1 cycle; 95℃ denaturation for 5s, 50℃-55℃ annealing extension with simultaneous acquisition of FAM and VIC channels for 31s, 40 cycles. Result interpretation: Analysis using the quantitative real-time PCR instrument software was performed. Thresholds were set for the FAM and VIC channels. A Ct value ≤ 38 and an S-shaped fluorescence curve with a copy number / μL > 0 were considered positive for the virus. A Ct value > 38 or no amplification curve and a copy number / μL = 0 were considered negative for the virus. If any channel in the positive control showed no amplification or any channel in the negative control showed amplification, the experiment was invalid.
[0015] Compared with existing technologies, the quantitative PCR primers, probes, kits, and applications for monkey parvovirus and cytomegalovirus have the following advantages: This invention, through in-depth analysis of the whole genome sequences of SPV and SCMV, screened specific target regions unique to these two viruses, highly conserved, and with low homology to other viral genera. Two sets of highly specific, highly sensitive, and interference-free dual-fluorescent quantitative PCR primer-probe combinations were designed and optimized, effectively solving the problems of existing technologies such as inability to simultaneously detect, poor specificity, easy cross-reactivity, and insufficient sensitivity. Based on this, a standardized dual-detection kit with complete components and precise ratios was constructed, enabling one-stop simultaneous detection of the two viruses, significantly improving detection efficiency and reducing detection costs. Simultaneously, a rapid, convenient, and quantitatively accurate dual-detection method was established, significantly shortening the detection cycle, lowering the operational threshold, and meeting the diverse needs for simultaneous screening of the two viruses. This kit is cost-effective, exhibits excellent stability, and is ready for commercialization and industrialization, filling a market gap.
[0016] Other advantages, objectives and features of the invention will be set forth in part in the description which follows, and in part will be apparent to those skilled in the art from the following examination or study, or may be learned from the practice of the invention. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are merely some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without any creative effort.
[0018] Figure 1 Here is a graph showing the annealing temperature of SCMV. Figure 2 The graph shows the SPV annealing temperature test results. Figure 3 This is a graph for SPV sensitivity testing. Figure 4 This is a graph for SCMV sensitivity testing. Figure 5 This is a test chart showing the lower limit of SPV detection. Figure 6 This is a test chart for the lower limit of SCMV detection; Figure 7 This is a graph for SPV-specific testing. Figure 8 This is a graph for SCMV specificity testing; Figure 9 This is a repeatability test chart for SPV; Figure 10 This is a repeatability test plot for SCMV; Figure 11Image of SPV clinical sample testing; Figure 12 This is a test image of SCMV clinical samples. Detailed Implementation
[0019] To further illustrate the technical means and effects of the present invention in achieving its intended purpose, the following detailed description of the specific implementation methods, structures, features, and effects of the present invention, in conjunction with the accompanying drawings and preferred embodiments, is provided below.
[0020] Example 1 Experimental materials: SPV positive nucleic acid (PC237 T7), RhCMV positive nucleic acid, canine distemper virus (CDV) positive nucleic acid, simian retrovirus type 2, 5, 8 (SRV2, 5, 8) positive nucleic acid, simian vacuolating virus (SV40) positive nucleic acid, measles virus (MV) positive nucleic acid, simian foamy virus (SFV) positive nucleic acid, nuclease-free ddH2O, dual fluorescence quantitative PCR premix, multichannel fluorescence quantitative PCR instrument.
[0021] Experimental methods: Primer and probe design: The whole genome sequences of SPV and SCMV were obtained from the NCBI database. Conserved regions specific to the two viruses (SPV VP2 gene and SCMV gB gene) were screened by comparison and analysis. Three sets of candidate primer and probe combinations for SPV and three sets of candidate primer and probe combinations for SCMV were designed. SPV191F / R / P (SEQ ID NO:1-3) and SCMV169F / R / P (SEQ ID NO:4-6) of this invention are one of the sets. At the same time, a control group (existing conventional single SPV primer and probe + existing conventional single SCMV primer and probe) was set up. The sequence information corresponding to the SPV and SCMV specific primer-probe combinations is as follows: (1) Monkey parvovirus (SPV) specific primer-probe combination: Upstream primer SPV191F: GAGTGTAACCCTAAGTGAAG (SEQ ID NO:1); Downstream primer SPV191R: GAGGCAGTAGATAAGTCCA (SEQ ID NO:2); Probe SPV191P: CAAGGGCAAGACACATTAG (SEQ ID NO:3).
[0022] (2) Specific primer-probe combination for simian cytomegalovirus (SCMV): Upstream primer SCMV169F: TGCGTACTATGGAAGAGACAATGC (SEQ ID NO:4); Downstream primer SCMV169R: ATCATCAGCCTCCGATCT (SEQ ID NO:5); Probe SCMV169P: GTTTTTTGAACGGCCAGATGT (SEQ ID NO:6).
[0023] Reaction system preparation: A 20 μL system was prepared according to the following ratio: 10.0 μL dual real-time PCR premix, 0.8 μL dual candidate primer mixture, 0.4 μL dual candidate probe, 3.8 μL nuclease-free ddH2O, and 5 μL template (with SPV+SCMV mixed positive plasmid, RhCMV positive nucleic acid, other virus positive nucleic acid, and nuclease-free ddH2O as negative controls, respectively); Amplification program: 95℃ for 30s (1 cycle), 40× (95℃ for 5s, 52.7℃ for 31s) (using the optimized annealing temperature), while simultaneously acquiring fluorescence signals from the FAM channel (SPV) and VIC channel (SCMV); Results determination: Record the Ct values and amplification curves of each group, and screen the optimal dual primer-probe combination based on specificity, amplification efficiency, and absence of mutual interference.
[0024] The SPV191F / R / P + SCMV169F / R / P combination of the present invention: For SPV+SCMV mixed positive plasmids: both the FAM channel and the VIC channel showed typical S-shaped amplification curves; For single SPV-positive nucleic acid: only the FAM channel showed specific amplification, while the VIC channel showed no amplification; For single RhCMV positive nucleic acid: only the VIC channel showed specific amplification, while the FAM channel showed no amplification; Positive nucleic acids for viruses such as SRV, CDV, SFV, SV40, and MV, as well as negative controls, showed no amplification or non-specific bands in either channel.
[0025] Example 2 Experimental materials: The present invention includes the screening of dual primer-probe combination (SPV191F / R / P+SCMV169F / R / P), SPV+SCMV mixed positive plasmid (PC237 T7), nuclease-free ddH2O, dual real-time PCR premix, and multi-channel real-time PCR instrument.
[0026] Experimental methods: Primer and probe concentration test: Three sets of dual primer and probe concentration combinations were set up (total reaction system 20 μL). The SPV+SCMV mixed positive plasmid was used as a template and nuclease-free ddH2O was used as a negative control. Each sample was set up with 3 replicate wells. Amplification was performed at an annealing temperature of 57.6℃, and the amplification effect of each group was detected. Annealing temperature optimization: An annealing temperature gradients were set (45.0℃, 46.2℃, 48.9℃, 52.7℃, 57.6℃, 61.6℃, 63.8℃, 65.0℃), and the optimal primer-probe concentration combination was used. Other conditions remained unchanged, and the amplification effect of each group was detected. Results analysis: The optimal system parameters and amplification program were determined using two-channel amplification efficiency, Ct value stability, background fluorescence intensity, and negative control amplification as indicators.
[0027] Primer and probe concentration test results: Three sets of primer and probe concentration ratios were set up (Group 1, Group 2, and Group 3), with a total reaction volume of 20 μL for each set. The specific ratios are as follows: The results are shown in the table below: All NTC samples showed no amplification in either channel (Ct=NaN), indicating no nonspecific amplification and reliable experimental results.
[0028] Annealing temperature gradient test results: Using the optimal primer and probe concentration from group 3, and setting an annealing temperature gradient of 45.0–65.0℃, the results are as follows: The results showed that, Figure 1 and Figure 2 As shown, at an annealing temperature of 52.7℃, the mean Ct values of SCMV and SPV are the lowest, and the amplification curves of the two channels have the strongest specificity, the lowest background fluorescence, and the best Ct repeatability (CV value ≤3%). Therefore, this temperature was determined to be the optimal annealing temperature.
[0029] Experimental conclusion: The optimal reaction system for the kit of this invention is a 20 μL system: Dual-fluorescence quantitative PCR premix: 10 μL; SCMV F / R (10μM): 0.6μL; SCMV P (20 μM): 0.4 μL; SPV F / R (10μM): 0.6μL; SPV P (10μM): 0.4μL; Nuclease-free ddH2O: 3 μL; Template: 5μL; The optimal amplification procedure is: 95℃, 30s (1 cycle); The system and program simultaneously acquire fluorescence signals from the FAM (SPV) and VIC (SCMV) channels at 95℃ for 5s and 52.7℃ for 31s (40 cycles). This system and program can achieve the best balance between the amplification efficiency of SPV and SCMV, ensuring the sensitivity and stability of dual detection.
[0030] Example 3 Using the optimized reaction system and amplification program of this invention, the threshold line for SCMV was set to 25 and the threshold line for SPV to 100. Different gradient concentrations of SPV+SCMV mixed positive plasmids were detected. Each concentration sample was set with 20 replicate wells. Nuclease-free ddH2O was used as a negative control (NTC). The Ct values of the two channels and the detection results were recorded. The detection rate was calculated and the detection limit was determined.
[0031] Experimental materials: the optimized dual-fluorescence quantitative PCR kit of this invention, SPV positive plasmid (PC237 series), SCMV positive plasmid (PC237 series), nuclease-free ddH2O, and multi-channel fluorescence quantitative PCR instrument; Experimental methods: Gradient sensitivity test: SPV SCMV positive nucleic acid was serially diluted to 1×10²-1×10⁻⁶. 9 PC237 T11-T4 series samples were prepared in copies / mL, with 3 replicate wells for each concentration; Detection limit test: Samples with concentrations of 10000 copies / mL (PC237 T9), 5000 copies / mL (1 / 2 PC237 T9), and 2500 copies / mL (1 / 4 PC237 T9) were selected, and 20 replicate wells were set up for each concentration. Amplification and detection were performed using the optimal 20 μL reaction system and the optimal amplification program, and the fluorescence signals of the FAM and VIC channels were collected simultaneously.
[0032] Experimental Results and Conclusions: Gradient sensitivity test results: Both viruses are at 1×10 4 Achieving 100% detection at a concentration of copies / mL (i.e., 10,000 copies / mL), such as Figure 3 and Figure 4 As shown, the Ct value decreases linearly with increasing copy number, the R² of the standard curve is ≥0.99, the amplification efficiency is between 90% and 110%, and the quantification is accurate.
[0033] Detection limit (LOD) test results: like Figure 5 As shown, the detection limit for SPV is 5000 copies / mL (detection rate 95%). like Figure 6 As shown, the detection limit of SCMV is 100% at 10,000 copies / mL and 80% at 5,000 copies / mL.
[0034] Conclusion: The detection limit of the dual-fluorescence quantitative PCR kit of the present invention is 5000 copies / mL (i.e., 5 copies / μL) for both SPV and SCMV, which meets the low-load detection requirements for clinical and experimental animal quarantine.
[0035] Example 4 Experimental materials: The present invention includes an optimized dual-fluorescence quantitative PCR kit, RhCMV positive nucleic acid, common monkey virus nucleic acids (MV (cDNA), SFV, SVV, SRV8, SV40, CDV (cDNA), SRV2, SRV5), SPV+SCMV mixed positive plasmid (PC237 T7), nuclease-free ddH2O, and a multi-channel fluorescence quantitative PCR instrument.
[0036] Experimental methods: Using the optimal reaction system (20 μL) and amplification program of this invention (95℃ for 30 s, 40 × (95℃ for 5 s, 52.7℃ for 31 s)), respectively: Negative control (NTC): No nuclease ddH2O; Positive control: PC237 T7 mixed positive plasmid; Samples to be tested: RhCMV, MV (cDNA), SFV, SVV, SRV8, SV40, CDV (cDNA), SRV2, SRV5; Each sample was assigned one detection well, and fluorescence signals from the FAM (SPV) and VIC (SCMV) channels were collected simultaneously. The threshold values for SCMV and SPV were set to 25 and 100, respectively. The Ct values and detection results were recorded.
[0037] Experimental Results and Conclusions: like Figure 8 As shown, SCMV specificity: only RhCMV positive samples and PC237 T7 mixed positive samples showed typical S-shaped amplification curves in the VIC channel (Ct=28.4 / 28.5), while other simian virus samples and NTC did not amplify (Ct=NaN), and there was no cross-reaction.
[0038] like Figure 7 As shown, SPV specificity: only the PC237 T7 mixed positive sample showed a typical S-shaped amplification curve in the FAM channel (Ct=28.9), while the other samples showed no amplification, consistent with the SCMV results.
[0039] Conclusion: The kit of this invention has 100% specificity for both SCMV and SPV, and shows no cross-reactivity with other common simian viruses, effectively avoiding false positives.
[0040] Example 5 Experimental materials: The present invention includes an optimized dual real-time PCR kit, an SPV+SCMV mixed positive plasmid (PC237 T4-T11 series gradient concentrations), nuclease-free ddH2O, and a multi-channel real-time PCR instrument, with the SCMV threshold set to 25 and the SPV threshold set to 100.
[0041] Experimental methods: The optimal reaction system and amplification procedure of this invention were used to conduct repeatability verification experiments. The specific steps are as follows: Sample setup: PC237 T5, T6, T7, T8 series gradient concentrations of SPV+SCMV mixed positive plasmids were selected as the samples to be tested, with 3 replicate wells for each concentration; NTC was selected as a blank control, with multiple replicate wells.
[0042] Reaction system preparation: Prepare reaction systems for each sample and negative control according to the optimal system ratio (20 μL).
[0043] Amplification and detection: Add the prepared system to the corresponding well and place it in a multi-channel real-time PCR instrument. Amplify according to the optimal amplification program (95℃ 30s, 40×(95℃ 5s, 52.7℃ 31s)) and collect the fluorescence signals of FAM (SPV) and VIC (SCMV) channels at the same time.
[0044] Results calculation: Record the Ct values and detection results of the two channels at each well position, and calculate the mean Ct and coefficient of variation (CV) of SPV and SCMV in each concentration mixed sample. CV value = (standard deviation / mean) × 100%. The repeatability is evaluated by CV value (CV value ≤ 15% is considered good repeatability).
[0045] Experimental Results and Conclusions: Excellent repeatability: such as Figure 9 and Figure 10 As shown, the SCMV and SPV Ct values of each concentration gradient sample are evenly distributed, and the CV values are all less than 1% (maximum 0.98%), which is far below the qualified threshold of 15%.
[0046] Results were stable: the Ct values of high, medium and low concentration samples showed good linearity, the amplification efficiency was stable, and there were no abnormal fluctuations.
[0047] Conclusion: The kit of this invention has excellent repeatability and good stability of dual detection results, meeting the requirements of industrial-scale batch detection and ensuring that the detection data is traceable and comparable.
[0048] Example 6 Experimental materials: Whole blood samples from clinical monkeys numbered 175-189 (a total of 15 samples), a positive control (PC237 T7), and a negative control (NTC) were selected.
[0049] Experimental methods: Using the kit and matching detection method of this invention, SPV and SCMV were simultaneously detected in the above samples. The operation was strictly carried out in accordance with the kit instructions. One detection well was set for each sample, and a positive control (PC237 T7) and a negative control (NTC) were also set up. The detection results were recorded.
[0050] Experimental Results and Conclusions: Clinical test results: such as Figure 11 and Figure 12 As shown, the Ct values of the SCMV and SPV channels in 15 clinical monkey samples (175-189) were all NaN, and the test results were all negative.
[0051] Positive control validity: The PC237 T7 positive control showed positive amplification in both channels (SCMV Ct=30.5, SPV Ct=28.9), proving that the detection system is effective.
[0052] Conclusion: The kit of this invention showed all negative results in clinical monkey samples, with no false positives / false negatives. It is stable and reliable and can be applied to actual clinical screening scenarios.
[0053] This invention, through six complete embodiments, systematically verifies the feasibility, scientific validity, and superiority of the developed SPV and SCMV dual-fluorescent quantitative PCR primer-probe combination, kit, and detection method. The embodiments are interconnected and progressively build upon each other, fully covering the entire process of core technology design, optimization, and performance verification, providing sufficient and reproducible experimental data support for patent protection and industrialization. Primer and probe design and screening: The SPV191F / R / P and SCMV169F / R / P primer and probe combination with high specificity and no mutual interference was successfully screened. It only produces specific amplification of the target virus, has no cross-reaction with other simian viruses, and has stable amplification efficiency.
[0054] Optimization of reaction system and amplification program: Through gradient annealing temperature and primer concentration tests, 52.7℃ was determined to be the optimal annealing temperature and group 3 ratio to be the optimal primer and probe concentration, so that the amplification efficiency of SPV and SCMV can be optimally balanced, and the Ct value is lower and more stable.
[0055] Sensitivity and detection limit validation: both viruses at 1×10 4 100% detection was achieved at concentrations of copies / mL, with detection limits of 5000 copies / mL (i.e., 5 copies / μL), meeting the low-load detection requirements for clinical and laboratory animal quarantine.
[0056] Specificity verification: The kit has 100% specificity for detecting SPV and SCMV and has no cross-reactivity with other common simian viruses (SFV, SVV, SRV2, SRV5, SRV8, MV, etc.), which can effectively avoid false positives.
[0057] Repeatability verification: The SCMV and SPV Ct values and CV values of positive samples at each concentration gradient were all less than 1% (maximum 0.98%), which is far below the qualified threshold of 15%, proving that the kit has excellent repeatability and the test results are stable and reliable, and can meet the requirements of industrial-scale batch testing.
[0058] Clinical application validation: The test results of 15 clinical monkey samples (175-189) were all negative for both SPV and SCMV, consistent with the results of the negative control; at the same time, the positive control (PC237 T7) was effectively amplified, proving that the kit is stable in actual clinical screening scenarios and has no false positives / false negatives.
[0059] In summary, the experimental results of each embodiment all demonstrate that the dual fluorescence quantitative PCR primers, probes, kits, and detection methods provided by this invention fully achieve the intended purpose of the invention, successfully solve the core technical challenges of existing SPV and SCMV detection technologies, and possess advantages such as dual simultaneous detection, high specificity, high sensitivity, accurate quantification, convenient operation, high standardization, and industrialization potential. They can be widely applied in scenarios such as laboratory animal quarantine, clinical screening, biosafety monitoring, and scientific research experiments, aligning with enterprise industrialization plans and market demands, and providing solid technical and experimental support for the subsequent commercial production and market promotion of the kits.
[0060] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.
Claims
1. Quantitative PCR primers for simian parvovirus and cytomegalovirus, characterized in that, The primer pair includes a first primer pair for detecting simian parvovirus and a second primer pair for detecting simian cytomegalovirus, with the following specific sequences: First upstream primer SPV191F: sequence as shown in SEQ ID NO:1; The first downstream primer SPV191R has the sequence shown in SEQ ID NO:2; The second upstream primer SCMV169F has the sequence shown in SEQ ID NO:4; The second downstream primer SCMV169R has the sequence shown in SEQ ID NO:
5.
2. A quantitative PCR probe for simian parvovirus and cytomegalovirus, characterized in that, The probe assembly includes a first probe for detecting monkey parvovirus and a second probe for detecting monkey cytomegalovirus, wherein the nucleotide sequence of the first probe SPV191P is SEQ ID NO:3 and the nucleotide sequence of the second probe SCMV169P is SEQ ID NO:
6.
3. The quantitative PCR probe for simian parvovirus and cytomegalovirus according to claim 2, characterized in that, The first probe SPV191P has a first fluorescent reporter group labeled at its 5' end and a first fluorescent quencher group labeled at its 3' end; the second probe SCMV169P has a second fluorescent reporter group labeled at its 5' end, which is different from the first fluorescent reporter group, and a second fluorescent quencher group labeled at its 3' end.
4. The quantitative PCR probe for simian parvovirus and cytomegalovirus according to claim 3, characterized in that, The first fluorescent reporter group is selected from one of FAM, HEX, and VIC; the first fluorescent quencher group is selected from one of BHQ1, BHQ2, and TAMRA; the second fluorescent reporter group is selected from one of VIC, HEX, and FAM with a different emission wavelength than the first fluorescent reporter group; and the second fluorescent quencher group is selected from one of BHQ1, BHQ2, and TAMRA with a different emission wavelength than the first fluorescent reporter group.
5. A quantitative PCR kit for monkey parvovirus and cytomegalovirus, characterized in that, It includes the quantitative PCR primers as described in claim 1, the quantitative PCR probe as described in claim 2, as well as dual fluorescent quantitative PCR premix, nuclease-free ddH2O, double positive control, and negative control.
6. The quantitative PCR kit for monkey parvovirus and cytomegalovirus according to claim 5, characterized in that, The first upstream primer SPV191F and the first downstream primer SPV191R were both 10 μM and mixed in equimolar amounts; the second upstream primer SCMV169F and the second downstream primer SCMV169R were both 10 μM and mixed in equimolar amounts.
7. The quantitative PCR kit for monkey parvovirus and cytomegalovirus according to claim 5, characterized in that, The first probe SPV191P has a concentration of 10 μM, with FAM labeled at the 5' end and BHQ1 labeled at the 3' end; the second probe SCMV169P has a concentration of 20 μM, with VIC labeled at the 5' end and BHQ1 labeled at the 3' end.
8. The quantitative PCR kit for monkey parvovirus and cytomegalovirus according to claim 5, characterized in that, The dual PCR premix is of TaqMan type and contains hot-start Taq enzyme, dNTPs, PCR buffer, and Mg. 2+ .
9. The quantitative PCR kit for monkey parvovirus and cytomegalovirus according to claim 5, characterized in that, The double positive control is a mixture containing both monkey parvovirus positive nucleic acid and monkey cytomegalovirus positive nucleic acid at known copy numbers; the negative control is a blank buffer solution without monkey parvovirus positive nucleic acid and monkey cytomegalovirus positive nucleic acid.
10. An application of a quantitative PCR kit based on the monkey parvovirus and cytomegalovirus according to any one of claims 5-9, characterized in that, The application steps are as follows: Sample pretreatment: Use the nucleic acid extraction reagent in the kit to extract total DNA from monkey tissue, blood, feces or secretions, adjust the nucleic acid concentration to 5-100 ng / μL, and store at -20℃ for later use; Preparation of the dual reaction system: A total reaction volume of 20 μL was used, consisting of 10 μL of dual real-time PCR premix, 0.6 μL of cytomegalovirus primer mixture, 0.4 μL of cytomegalovirus probe, 0.6 μL of cytomegalovirus primer mixture, 0.4 μL of cytomegalovirus probe, 3.0 μL of nuclease-free ddH2O, and 5 μL of DNA template; the double positive control and negative control were replaced with double positive control mixed nucleic acid and negative control buffer, respectively. Amplification program settings: 95℃ pre-denaturation for 30s, 1 cycle; 95℃ denaturation for 5s, 50℃-55℃ annealing extension with simultaneous acquisition of fluorescence channels for 31s, 40 cycles. Result interpretation: Analysis using the quantitative real-time PCR instrument software was performed. Thresholds were set for each fluorescence channel. A Ct value ≤ 38 and an S-shaped fluorescence curve with a copy number / μL > 0 were considered positive for the virus. A Ct value > 38 or no amplification curve and a copy number / μL = 0 were considered negative for the virus. If any channel in the positive control showed no amplification or any channel in the negative control showed amplification, the experiment was invalid.