A heat-resistant chaperone PGI and application thereof in improving thermal stability of enzymes
By covalently linking the target enzyme to PGI using the SpyTag/SpyCatcher system, the problems of difficult linker peptide design and lack of stable tags in traditional fusion protein strategies are solved, thereby achieving high thermal stability and improved catalytic activity of the enzyme and broadening its industrial applications.
Patent Information
- Application Number
- CN202610705402.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-21
- Publication Date
- 2026-06-26
AI Technical Summary
In existing technologies, traditional fusion protein strategies suffer from difficulties in designing linker peptides, leading to steric hindrance and enzyme folding errors. Furthermore, existing stabilization tags lack universality, making it difficult to continuously improve thermal stability in different enzyme systems.
The SpyTag/SpyCatcher system was used for in vitro covalent ligation to covalently link the target enzyme with the universal heat-resistant chaperone protein PGI, forming a highly thermally stable enzyme-chaperone complex.
It effectively improves the thermal stability and catalytic activity of enzymes, avoids steric hindrance and folding errors, and broadens the industrial application scenarios of enzymes, especially showing a better thermal stability improvement effect for polymeric enzymes.
Smart Images

Figure CN122277677A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of enzyme engineering technology, and in particular to a heat-resistant chaperone protein PGI and its application in improving enzyme thermostability. Background Technology
[0002] In fields such as industrial catalysis and biomedicine, the application of enzyme preparations is often limited by the physical characteristics of natural enzymes, which are prone to unfolding, denaturation, and inactivation at high temperatures. Improving the thermal stability of enzymes has always been a core challenge in the field of bioengineering. Because traditional protein engineering methods (such as directed evolution and rational design) are time-consuming, difficult, and prone to sacrificing the enzyme's room-temperature catalytic activity, current research indicates that fusing the target enzyme with a heat-resistant protein is an effective way to improve its thermal stability.
[0003] However, current strategies for fusing target enzymes with thermostable proteins still face certain technical limitations in practical applications. These limitations are mainly manifested in the following two aspects:
[0004] (1) Traditional fusion protein strategies are limited by linker design.
[0005] While the method of using thermostable fusion tags is simple to operate, the spatial structural coordination between the tag and the target enzyme is extremely difficult. If the linker peptide is poorly designed or direct fusion is used, steric hindrance can easily occur, leading to misfolding of the target protein, reduced expression efficiency, or even complete loss of catalytic activity.
[0006] (2) Existing stabilization labels lack universality
[0007] While existing research has found that hyperacidic tags and similar methods can improve enzyme thermostability to some extent, their effects are often limited to specific enzyme classes. Currently, there is a lack of a widely applicable stabilization tag, making it difficult to consistently achieve stable enhancements across different enzyme systems.
[0008] In summary, existing strategies for constructing highly thermostable fusion proteins are limited by the lack of universally stable tags and face the technical challenge of effectively coordinating the connection between the target protein and the tag. To avoid the structural conflicts and loss of activity caused by traditional fusion expression, exploring spatially flexible non-fusion covalent linkages and developing new, broad-spectrum, and efficient thermostable chaperone proteins have become urgent problems to be solved. Summary of the Invention
[0009] To avoid the protein folding errors that traditional linker peptides may cause and to overcome the lack of universality of existing fusion tags, this invention discovers and verifies for the first time a novel heat-resistant chaperone protein, PGI, with broad-spectrum protective effects. Based on this, this invention proposes an in vitro covalent linking strategy: using the SpyTag / SpyCatcher system to covalently link the target enzyme (TE) to this universal heat-resistant tag, PGI, thereby achieving a highly efficient improvement in enzyme thermostability.
[0010] The specific technical solution of this invention is as follows:
[0011] In a first aspect, the present invention provides a heat-resistant chaperone protein, PGI. The amino acid sequence of the heat-resistant chaperone protein PGI is shown in SEQ ID NO.1.
[0012] Based on the aforementioned heat-resistant chaperone protein PGI, this invention provides a gene encoding the aforementioned heat-resistant chaperone protein PGI.
[0013] Based on the aforementioned heat-resistant chaperone protein PGI, the present invention provides a recombinant vector containing the aforementioned encoding gene.
[0014] Based on the above-mentioned heat-resistant chaperone protein PGI, the present invention provides a genetically engineered bacterium containing the above-mentioned encoding gene or the above-mentioned recombinant vector.
[0015] Secondly, the present invention provides an application of the heat-resistant chaperone protein PGI in improving the thermostability of a target enzyme.
[0016] Thirdly, the present invention provides a method for improving the thermostability of a target enzyme, characterized by comprising the following steps:
[0017] Using an in vitro covalent coupling system, the target enzyme is covalently linked to the heat-stable chaperone protein PGI to form an enzyme-chaperone complex with high thermal stability.
[0018] As a preferred embodiment of the above method, the in vitro covalent coupling system is the SpyTag / SpyCatcher system.
[0019] As a preferred embodiment of the above method, the covalent connection method is as follows:
[0020] The SpyTag tag is fused to the end of the target enzyme, and the SpyCatcher tag is fused to the end of the heat-resistant chaperone protein PGI; or, the SpyCatcher tag is fused to the end of the target enzyme, and the SpyTag tag is fused to the end of the heat-resistant chaperone protein PGI.
[0021] The tagged target enzyme was then reacted in vitro with the heat-resistant chaperone protein PGI.
[0022] Fourthly, this invention provides an enzyme complex with high thermal stability, which is composed of a heat-resistant chaperone protein PGI and a target enzyme linked by a covalent isopeptide bond. The target enzyme is an enzyme for which thermal stability enhancement is required.
[0023] As a preferred embodiment of the above-mentioned enzyme complex, the covalent isopeptide bond is formed by the reaction of aspartic acid from SpyTag and lysine from SpyCatcher.
[0024] Compared with the prior art, the present invention has the following technical effects:
[0025] (1) This invention discovers a universal thermostable tag and for the first time applies PGI as a thermostable molecular chaperone to improve the thermostability of target enzymes. PGI can accept a variety of target enzymes with different structures, so that different target enzymes exhibit different degrees of thermostability improvement, showing excellent universality and overcoming the shortcomings of existing stabilization tags that are limited to a single enzyme class.
[0026] (2) The method for improving the thermostability of target enzymes based on PGI provided by this invention can avoid steric hindrance and folding errors. This invention uses in vitro covalent linkage instead of traditional linear gene fusion expression, which effectively avoids folding errors caused by improper linker design and preserves the enzyme's background catalytic performance to the maximum extent.
[0027] (3) The method for improving the thermal stability of the target enzyme based on PGI provided by this invention effectively improves thermal stability while maintaining the original catalytic activity. Compared with wild-type free enzymes, the "target enzyme-Spy-PGI" complex obtained by covalent linkage using the method of this invention exhibits higher residual activity and lower enzyme half-inactivation temperature (T0) under high-temperature conditions. 50 Both were higher than those of natural free enzymes. (T) 50 Enzyme kinetic parameters and data demonstrate that the introduction of PGI not only effectively transfers high heat resistance to the target enzyme, but also does not change the catalytic efficiency of the target enzyme itself, greatly expanding the industrial application scenarios of the target enzyme.
[0028] (4) This invention reveals for the first time the size effect mechanism of PGI, demonstrating that PGI has higher applicability to multimeric enzymes. This invention also discovers for the first time that multimeric target enzymes and the heat-resistant chaperone protein PGI form protein complexes of different sizes when covalently linked. Test results confirm that the thermal stability (T...) of the complex... m and T 50The stability of PGI molecules is clearly positively correlated with their molecular size. This invention reveals for the first time that the core of this strategy for improving stability lies in the "complex size effect." For multimeric enzymes, due to their multiple subunits, they can covalently bind a greater number of PGI molecules, thereby forming a larger and more structurally stable complex, thus exhibiting a superior effect on improving thermal stability compared to monomeric enzymes.
[0029] (5) The PGI provided by this invention significantly improves the thermal stability and catalytic yield of the industrial enzyme nitrile hydratase. This invention applies a PGI-based thermal stability strategy to nitrile hydratase (NHase), a key enzyme in acrylamide biosynthesis. Compared to the wild-type enzyme NHase-wt, the thermal stability of NHase-PGI is significantly improved (ΔT). 50 (6.8 °C). In an industrial catalytic scale-up reaction at 42 °C, NHase-wt was deactivated within 20 minutes with a yield of only 50%, while the NHase-PGI complex could continue to catalyze efficiently for 40 minutes, with a final yield as high as 99%. Attached Figure Description
[0030] Figure 1 The image shows the SDS-PAGE electrophoresis results of the purified target enzyme (AC), the thermostable chaperone PGI-SpyCatcher (D), and its in vitro covalently coupled product (E).
[0031] Figure 2 This is a comparison of the heat inactivation curves (T50) of the target enzyme after covalent ligation with PGI-SpyCatcher in vitro. In the figure, AC are the heat inactivation curves (T50) of PnUDH, PAP, CbFDH and their constructs, respectively.
[0032] Figure 3 The image shows the native-page diagrams of TE-PGI eluted by size exclusion chromatography. In the diagram, AC represent the native-page diagrams of PnUDH-PGI, PAP-PGI, and CbFDH-PGI eluted by size exclusion chromatography, respectively.
[0033] Figure 4 The figure shows a comparison of the thermal inactivation curves of eluted components F1-F4 separated by TE-PGI using self-filled size exclusion chromatography. In the figure, AC are the thermal inactivation curves (Tm) of PnUDH, PAP, CbFDH and their constructs, respectively, and DF are the thermal inactivation curves (T50) of PnUDH, PAP, CbFDH and their constructs, respectively.
[0034] Figure 5 This is a GPC outflow curve for CbFDH-PGI.
[0035] Figure 6 The figures show a comparison of the catalytic production curves of acrylamide by nitrile hydratase and covalently linked PGI. In the figures, A is the HPLC curve of acrylamide production catalyzed by nitrile hydratase and its construct, and B is the time-yield curve of acrylamide production catalyzed by nitrile hydratase and its construct. Detailed Implementation
[0036] The present invention will be further described below with reference to embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only some, not all, of the embodiments of the present invention. Therefore, all other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.
[0037] Example 1: Construction of recombinant expression vector and engineered strain
[0038] The coding gene sequences of the target enzymes were synthesized in their entirety by a professional biotechnology company. The target enzymes TE selected in this invention are prolyl iminopeptidase (PAP), uricase dehydrogenase (PnUDH), formate dehydrogenase (CbFDH), and nitrile hydratase (NHase). pET28a (+)-PAP-SpyTag and pET29b-PnUDH-SpyTag were synthesized by Jiutian Gene (Tianjin) Technology Co., Ltd., while pET28a (+)-CbFDH-SpyTag, the thermostable chaperone protein PGI tagged with SpyCatcher (PGI-SpyCatcher), and pET28a (+)-NHase-SpyTag were synthesized by Hangzhou Qingke Zixi Biotechnology Co., Ltd. The amino acid sequence of the thermostable chaperone protein PGI is shown in SEQ ID NO.1, and the amino acid sequence of PGI-SpyCatcher is shown in SEQ ID NO.2.
[0039] Based on the surface-exposed ends (N / C ends) determined by existing PDB models or AlphaFold3 modeling and structural analysis, SpyTag peptides were fused to the C-terminus or N-terminus of the target enzyme, with 6×His-tag added to both for purification. The synthesized target enzyme gene fragment was cloned into a gene expression vector to construct the recombinant plasmid TE-SpyTag, and a wild-type recombinant plasmid TE-wt without SpyTag was constructed as a control. Subsequently, the above recombinant vectors were transformed into Escherichia coli BL21 (DE3) to obtain the corresponding expression strains.
[0040] The amino acid sequences of TE-SpyTag in this experiment are shown in SEQ ID NO.3~SEQ ID NO.6, where the amino acid sequence of PnFDH-SpyTag is shown in SEQ ID NO.3, the amino acid sequence of PAP-SpyTag is shown in SEQ ID NO.4, the amino acid sequence of CbFDH-SpyTag is shown in SEQ ID NO.5, and the amino acid sequence of NHase-SpyTag is shown in SEQ ID NO.6.
[0041] The primers used in this experiment are listed in Table 1.
[0042] Table 1 Primers used in this experiment
[0043] Primer Name Sequence (5’ to 3’) PnUDH-SpyTag-F TAAGAAGGAGATATACATATGACCATCAAGGTGCATGAT PnUDH-SpyTag-R1 CATGACGATATGCGGAACACCACGAGAGCCGCCAGAACCACCCTCGAGGTCACCAAACGGAC PnUDH-SpyTag-R2 CATGACGATATGCGGAACACCACGAGAGCCGCCAGAACCACCCTCGAGGTCACCAAACGGAC PnUDH-V-F ACCTCGAGCACCACCACCA PnUDH-V-R GATATGCGGAACACCACGTATATCTCCTTCTTAAAGTTAAAC PAP-SpyTag-F1 TGCCTACAAGCGCTACAAAGGTGGTTCTGGCGGCTCTATGCGTACCCTGTATCCGGAAA PAP-SpyTag-F2 TATACCATGCGTGGTGTTCCGCATATCGTCATGGTCGATGCCTACAAGCGCTACAAAG PAP-SpyTag-R AAGCTTAGCAAAACCATCGGTG PAP-V-F CACCGATGGTTTTGCTAAGCTT PAP-V-R GGAACACCACGCATGGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAGG CbFDH-WT-F GTTTAACTTTAAGAAGGAGATATACCATGGGCATGAAGATCGTACTGG CbFDH-WT-R TGGTGGTGGTGCTCGAGTTTCTTGTCGTGTTTACCGTACGCC NHase-β-C-SpyTag-F1 GATGCCTACAAGCGCTACAAATAAAAGGAGATATAGATATGTCTGAACACGTG NHase-β-C-SpyTag-F2 TGTTCCGCATATCGTCATGGTCGATGCCTACAAGCGCTACAAA NHase-β-C-SpyTag-R1 ACCACGAGAGCCGCCAGAACCACCAGCAGAGATCAGGTACGGTTC NHase-β-C-SpyTag-R2 ACCATGACGATATGCGGAACACCACGAGAGCCGCCAGA
[0044] In this experiment, 2×Phanta Flash Master Mix was used to amplify the DNA fragments for recombination, and 2×T5 Super PCR Mix was used to amplify and verify the DNA sequence. The PCR reaction system is shown in Table 2, and the PCR amplification reaction program can be found in the instruction manuals of the commercial enzymes Phanta Flash Master Mix and T5 Super PCR Mix.
[0045] Table 2 PCR amplification reaction system
[0046] Sample Dosage (unit: µL) 2×Phanta Flash Master Mix or 2×T5 Super PCR Mix 12.5 DNA template 0.5 upstream primer 1.0 Downstream primer 1.0 <![CDATA[ddH2O]]> up to 25.0
[0047] Example 2: Induction and purification of recombinant protein
[0048] Single colonies obtained in Example 1 were picked and inoculated into LB medium containing 50 μg / mL kanamycin and cultured at 37 °C until OD500. 600 When the concentration reached 0.6–0.8, IPTG was added to a final concentration of 0.5 mM, and expression was induced at 18 °C for 16 h. Cells were collected by centrifugation, and the supernatant was collected after cell disruption using an ultrasonic disruptor. TE-wt and TE-SpyTag were purified using a Ni-IDA affinity chromatography column, and the resulting high-purity protein enzyme solution was obtained after desalting and concentration. PGI-SpyCatcher purification involved boiling in a water bath at 100 °C for 10 min, followed by centrifugation at 12000 xg for 10 min, and the supernatant was collected to obtain the pure enzyme solution.
[0049] Example 3: In vitro covalent linkage reaction of SpyTag / SpyCatcher
[0050] The purified TE-SpyTag and PGI-SpyCatcher purified protein (an excess of PGI-SpyCatcher was added to accelerate the experimental process) were mixed in reaction buffer (50 mM PBS, pH 7.4) and incubated at room temperature for 0.5 h. The product was then detected by SDS-PAGE gel electrophoresis (e.g., ...). Figure 1 As shown in the figure, the results showed a clear “TE-PGI” covalent complex band in the corresponding high molecular weight region, proving that the in vitro covalent connection was completed.
[0051] Example 4: Half-deactivation temperature (T) 50 Determination of )
[0052] Equimolar amounts of the target enzyme (control group) and the "TE-PGI" covalent complex (experimental group) were placed in PCR incubators at a series of temperature gradients and heat-treated for a fixed time (30 min). After heat treatment, the incubators were quickly removed, and the residual catalytic activity of each group was measured. Using the initial enzyme activity before heat treatment as 100%, a curve of residual activity versus treatment temperature was plotted. The specific implementation method for enzyme activity measurement is as follows:
[0053] (1) PnUDH
[0054] Enzyme activity was determined by measuring the amount of NADH produced. NADH exhibits characteristic absorption at 340 nm, and enzyme activity was calculated based on its extinction coefficient. The reaction system consisted of 50 mmol·L⁻¹ enzymes. -1 Tris-HCl buffer (pH 8.0), containing 5 mmol·L⁻¹ -1 Glucuronic acid and 2 mmol·L -1 NAD + The enzyme amount was 0.05 μmol·L⁻¹. -1 One unit of enzyme activity (U) is defined as the amount of enzyme required to produce 1 μmol NADH per minute under the conditions described above.
[0055] (2) PAP
[0056] Prolyl peptidase (PAP) activity was detected by ultraviolet spectrophotometry: 0.32 μmol·L⁻¹ pure enzyme solution was mixed with 50 mmol·L⁻¹... -1 Mix with Tris-HCl (pH 8.0) buffer, add L-proline-p-nitroaniline (L-Pro-pNA) dissolved in the same buffer, react for 5 min, then terminate the reaction with an equal volume of 50% (v / v) sodium acetate (pH=4.8). Measure the absorbance of p-nitroaniline (pNA) at 405 nm. Enzyme activity units (U) are defined as the amount of enzyme required to produce 1 μmol of p-nitroaniline per minute.
[0057] (3) CbFDH
[0058] CbFDH activity was detected by ultraviolet spectrophotometry: 0.2 μmol·L⁻¹ -1 Pure enzyme solution and 50 mmol·L -1 Mix with PBS (pH 7.5) buffer, then add sodium formate and NAD dissolved in the same buffer. + NADH generation was monitored online at 340 nm, and enzyme activity was calculated based on the extinction coefficient of NADH. Enzyme activity unit (U) is defined as the amount of enzyme required to generate 1 μmol of NADH per minute.
[0059] The results are shown as follows Figure 2 .
[0060] The test results show that the temperature at which the residual enzyme activity decreases to 50% of the initial activity is T. 50 The measurement results confirmed that the T of the "TE-PGI" complex 50 The temperature was increased by up to 7.72 °C compared to the control group (Table 3), indicating that the introduction of PGI significantly enhanced the thermostability of the target enzyme.
[0061] Table 3 Summary of Half-Inactivation Temperatures
[0062]
[0063] Example 5: Determination of enzyme kinetic parameters
[0064] Enzyme kinetic parameters were determined as follows (enzyme activity was measured according to the method in Example 4, and all experiments were repeated three times):
[0065] (1) PnUDH
[0066] Glucuronic acid was used as the substrate, with a concentration range of 0-10 mmol·L⁻¹. -1 The reaction system contains 2 mmol·L⁻¹ -1 NAD + 50 mmol·L -1 Tris-HCl buffer (pH 8.0). Initial reaction rates were determined at various substrate concentrations under fixed enzyme concentrations. All data were analyzed using Origin software, and K was calculated by nonlinear curve fitting based on the Michaelis–Menten equation. m V max Isokinetic parameters.
[0067] (2) PAP
[0068] L-prolyl-p-nitroaniline (L-Pro-pNA) was used as the substrate, with a concentration range of 0-20 mmol·L⁻¹. -1 At 35°C, 50 mmol·L -1 The kinetic parameters of the enzyme were determined in Tris-HCl (pH 8.0). To ensure accuracy, only a very small amount of purified enzyme was used in the reaction system. The absorbance was monitored continuously at 405 nm for 3 min. The initial rate data were nonlinearly fitted using the Michaelis-Menten equation with Origin software to obtain K. m V max value.
[0069] (3) CbFDH
[0070] Ammonium formate was used as the substrate, with a concentration range of 0-300 mmol·L⁻¹. -1 50 mmol·L -1 The kinetic parameters of the enzyme were determined in PBS. To ensure accuracy, only a very small amount of purified enzyme was used in the reaction system. Absorbance changes were monitored continuously at 340 nm for 3 min, and the initial rate data were nonlinearly fitted using the Michaelis-Menten equation with Origin software to obtain K0. m V max value.
[0071] The enzyme kinetic parameters are shown in Table 4.
[0072] Table 4 Summary of enzyme kinetic parameters
[0073] Enzyme Vmax(μM / min) Km (mM) <![CDATA[k cat (min -1 )]]> <![CDATA[k cat / K m (minor) -1* mm -1 )]]> PnUDH-wt 238.04 ± 10.65 2.29 ± 0.32 4760.92 ± 213.08 2076.88 ± 200.74 PnUDH-spytag 205.25 ± 15.07 1.11 ± 0.18 4104.70 ± 301.42 3699.73 ± 336.30 PnUDH-PGI 216.11 ± 7.41 0.78 ± 0.12 4322.24 ± 148.26 5536.86 ± 696.56 PAP-wt 101.33 ± 3.11 4.10 ± 0.54 326.2 ± 13.51 79.52 ± 8.43 PAP-spytag 167.29 ± 11.66 5.60 ± 0.98 514.74 ± 35.87 91.99 ± 10.03 PAP-PGI 143.20 ± 8.91 5.24 ± 0.85 440.02 ± 25.22 83.91 ± 9.48 CbFDH-wt 11.15 ± 0.21 11.23 ± 0.89 50.34 ± 1.46 4.48 ± 0.28 CbFDH-spytag 10.10 ± 0.20 10.47 ± 1.23 55.72 ± 1.06 5.32 ± 0.54 CbFDH-PGI 12.14 ± 0.09 12.00 ± 0.72 60.72 ± 0.43 5.06 ± 0.28
[0074] Example 6: Elucidation of the Size Effect Mechanism
[0075] TE-SpyTag, purified by Ni-NTA affinity chromatography, and TST-SpyCatcher, preliminarily purified by boiling water bath, were incubated at room temperature to form a TE-PGI enzyme covalent complex. The TE-TST enzyme covalent complex was then purified using self-filled propylene dextran gel molecular sieve chromatography (Sephacryl S-200 HR as packing material). Specific conditions were: PBS buffer (pH 7.4, containing 200 mmol / L) -1 NaCl was used as the eluent, and the flow rate was set to 0.5 mL / min. -1The detection wavelength was 280 nm. Proteins were collected according to the elution order, and after SDS-PAGE verification that the purity was greater than 95%, aggregates were observed using Native-PAGE. Aggregate fractions with the same number of bands on the Native-PAGE were collected sequentially (named F1, F2, F3, and F4, corresponding to different proportions of high molecular weight higher-order aggregates). After concentration, they were directly used to determine the T of the corresponding eluted fractions. m and T 50 Compare the differences in thermal stability among F1, F2, F3, and F4. m The specific measurement method was as follows: the protein ellipticity was determined using a circular dichroism spectrometer (Chriscan), with a temperature range of 25–90 °C and a temperature change rate of 2 °C·min. -1 The TE-PGI enzyme complex was diluted to 0.1 mg / mL. -1 Potassium phosphate buffer (10 mM, pH 7.4) was used, with a detection wavelength range of 185-260 nm. Global 3 software was used to analyze the circular dichroism (CD) spectra of the protein acquired at different temperatures to determine the calculated Tt. m Value. T 50 For specific measurement methods, please refer to Example 4.
[0076] To further confirm that TE-PGI forms enzyme complexes of different sizes, Yingshanhong Wisdom (Beijing) Testing Technology Co., Ltd. was commissioned to analyze the CbFDH-PGI complex mixture using GPC technology, and the elution curves were obtained, as shown in the figure. Figure 5 As shown in the figure, the elution curve results indicate the presence of enzyme complexes of three main sizes.
[0077] Example 7: Application of PGI-based thermostability strategy to the synthesis of acrylamide by nitrile hydratase
[0078] SpyTag and nitrile hydratase were constructed on the same vector, and plasmid PCR was performed using the primers in Table 1 to construct the corresponding NHase-SpyTag (amino acid sequence as shown in SEQ ID NO. 6). The 2×Phanta Flash Master Mix reaction system is shown in Table 2, followed by heterologous expression in E. coli. E. coli BL21(DE3) carrying the target plasmid were inoculated into LB medium and cultured at 37 °C until OD600. 600After adding 0.5 mg of the solution, IPTG and cobalt chloride were added to induce protein expression, and expression was induced at 18 °C for 24 h. Bacterial cells were collected, sonicated in 10 mM PBS buffer, and the supernatant was collected after centrifugation. NHase-SpyTag and PGI-SpyCatcher were rapidly linked via isopeptide bonds at room temperature. Protein expression and covalent linkage with PGI-SpyCatcher were observed by SDS-PAGE. NHase-PGI was then used to catalyze the synthesis of acrylamide (AM). 10 mg of wet bacterial cells were sonicated in 10 mM PBS buffer, and the supernatant was collected after centrifugation. The enzyme activities of NHase-wt, NHase-SpyTag, and NHase-PGI were measured in a 200 mL reaction system (containing 200 mM acrylonitrile, 10 mM PBS buffer, pH 7.4). The reaction solution was incubated at 42 °C. Samples were then taken at predetermined time points, and the reaction was quenched with methanol (1:10). The mixture was centrifuged at 12000 xg for 5 min, and the supernatant was filtered through a 0.22 μm filter. The product formation was then analyzed using reversed-phase high-performance liquid chromatography (HPLC). Three parallel experiments were conducted, and the reaction progress was monitored, recording the product changes over time. Figure 6 As shown. The specific HPLC analysis conditions were: AQ-C18 column, acetonitrile (33%) and water (67%) mobile phase, and detection wavelength of 210 nm.
[0079] The results showed that the nitrile hydratase-chaperone complex NHase-PGI, obtained by covalently linking PGI to nitrile hydratase NHase, exhibited significantly improved thermostability compared to the wild-type enzyme NHase-wt, with a ΔT... 50 The optimal temperature range is 6.8℃. In an industrial catalytic scale-up reaction at 42℃, NHase-wt is deactivated within 20 minutes with a yield of only 50%, while the NHase-PGI complex can continue to catalyze efficiently for 40 minutes, with a final yield as high as 99%.
[0080] Therefore, covalently linking PGI with nitrile hydratase (NHase) forms an enzyme-chaperone complex with high thermal stability; based on the linking of PGI, the thermal stability and catalytic yield of the industrial enzyme nitrile hydratase are significantly improved.
[0081] Unless otherwise specified, the raw materials and equipment used in this invention are all commonly used in the field; unless otherwise specified, the methods used in this invention are all conventional methods in the field.
[0082] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any simple modifications, alterations, and equivalent transformations made to the above embodiments based on the technical essence of the present invention shall still fall within the protection scope of the present invention.
Claims
1. A heat-resistant chaperone protein PGI, characterized in that: The amino acid sequence of the heat-resistant chaperone protein PGI is shown in SEQ ID NO.
1.
2. The gene encoding the heat-resistant chaperone protein PGI as described in claim 1.
3. A recombinant vector, characterized in that: It includes the coding gene as described in claim 2.
4. A genetically engineered bacterium, characterized in that: It contains the coding gene as described in claim 2 or the recombinant vector as described in claim 3.
5. The application of the heat-resistant chaperone protein PGI as described in claim 1 in improving the thermostability of the target enzyme.
6. A method for improving the thermostability of a target enzyme, characterized in that: Includes the following steps: Using an in vitro covalent coupling system, the target enzyme is covalently linked to the heat-stable chaperone protein PGI to form an enzyme-chaperone complex with high thermal stability.
7. The method as described in claim 6, characterized in that: The in vitro covalent coupling system is the SpyTag / SpyCatcher system.
8. The method as described in claim 6, characterized in that: The method of covalent connection is as follows: The SpyTag tag is fused to the end of the target enzyme, and the SpyCatcher tag is fused to the end of the heat-resistant chaperone protein PGI; or, the SpyCatcher tag is fused to the end of the target enzyme, and the SpyTag tag is fused to the end of the heat-resistant chaperone protein PGI. The tagged target enzyme was then reacted in vitro with the heat-resistant chaperone protein PGI.
9. An enzyme complex with high thermal stability, characterized in that: It is composed of the heat-resistant chaperone protein PGI and the target enzyme linked by a covalent isopeptide bond.
10. The enzyme complex according to claim 9, characterized in that: The covalent isopeptide bond is formed by the reaction of aspartic acid from SpyTag and lysine from SpyCatcher.