A genetically engineered CHO cell strain of trastuzumab and a preparation method and application thereof

Abstract

This invention belongs to the field of CHO cell technology, specifically relating to a genetically modified CHO cell line for trastuzumab, its preparation method, and its applications. The genetically modified CHO cell line for trastuzumab is obtained by deleting the Ddit4 gene from the original CHO cell line. At the same cell density, the genetically modified CHO cell line shows a 1.62-2.17-fold increase in trastuzumab expression compared to the original CHO cell line. This invention specifically enhances the protein synthesis capacity of CHO cell lines by knocking out the Ddit4 gene, providing a new and stable platform for the efficient production of trastuzumab.

Description

Technical Field

[0001] This invention belongs to the field of CHO cell technology, specifically relating to a genetically modified CHO cell line of trastuzumab, its preparation method, and its application. Background Technology

[0002] Trastuzumab is an important anti-Her2 monoclonal antibody drug widely used in the treatment of breast and gastric cancer. Its market demand is huge; therefore, improving production efficiency and reducing production costs are among the core goals of the biopharmaceutical industry.

[0003] Currently, Chinese hamster ovary cells are the preferred host cells for recombinant protein production, with approximately 70% of recombinant antibodies prepared from them. Chinese hamster ovary cells, abbreviated as CHO, refer to the original CHO cell line. Existing CHO cells producing trastuzumab have relatively low trastuzumab yields. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides a genetically modified CHO cell line for trastuzumab, its preparation method, and its application.

[0005] To facilitate understanding of this invention, the materials used in this invention and their abbreviations are listed below: Chinese hamster ovary cells, abbreviated as CHO. Benzyl sulfonyl fluoride, abbreviated as PMSF. RIPA lysis buffer, abbreviated as RIPA. Clustered regularly spaced short palindromic repeat-associated endonuclease 9, abbreviated as CRISPR / Cas9. Transcription activator-like effector nucleases, abbreviated as TALENs. Zinc finger nucleases, abbreviated as ZFN.

[0006] The first objective of this invention is to provide a genetically modified CHO cell line that produces trastuzumab, wherein the genetically modified CHO cell line is obtained by deleting the Ddit4 gene function from the original CHO cell line.

[0007] At the same cell density, the genetically modified CHO cell line showed 1.62 to 2.17 times higher trastuzumab expression levels than the original CHO cell line.

[0008] Preferably, the loss of function of the Ddit4 gene is achieved through gene knockout, gene silencing, or mutation.

[0009] Preferably, the gene knockout is achieved through a CRISPR / Cas9 system, TALENs, or ZFN.

[0010] Preferably, when using the CRISPR / Cas9 system to knock out the Ddit4 gene, the nucleotide sequence of the gRNA targeting the Ddit4 gene is as shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6.

[0011] The nucleotide sequence of SEQ ID NO.3 is 5′-CACCGaacagtggcttcggaccgg-3′.

[0012] The nucleotide sequence of SEQ ID NO.4 is 5′-AAACccggtccgaagccactgttC-3′.

[0013] The nucleotide sequence of SEQ ID NO.5 is 5′-AAACcgcgcgcctgctaatgccaC-3′.

[0014] The nucleotide sequence of SEQ ID NO.6 is 5′-CACCGtggcattagcaggcgcgcg-3′.

[0015] Preferably, the method includes the following steps: introducing a gene editing tool targeting the Ddit4 gene into CHO host cells expressing trastuzumab to induce a loss-of-function mutation in the gene; and screening and identifying cell clones that have lost the function of the Ddit4 gene.

[0016] Preferably, the gene editing tool is a CRISPR / Cas9 system, comprising a vector expressing the Cas9 protein and a gRNA targeting the Ddit4 gene. The target sequence of the gRNA is located in the first and second exons of the Ddit4 gene.

[0017] The second objective of this invention is to provide a method for preparing a genetically modified CHO cell line that produces trastuzumab, wherein the screening and identification include: screening a successfully transfected cell pool using puromycin, obtaining a monoclonal cell line by limiting dilution, and screening homozygous knockout clones with frameshift mutations or large fragment deletions at the target site by PCR amplification and sequencing analysis.

[0018] A third objective of this invention is to provide an application of a trastuzumab-producing CHO cell line in the production of trastuzumab, wherein the method of application includes the following steps: culturing the trastuzumab-producing CHO cell line in a serum-free suspension medium. After culturing, collecting the culture supernatant by centrifugation, purifying it, and obtaining trastuzumab.

[0019] Preferably, the centrifugation conditions are 4°C and 13000 rpm for 5 to 10 minutes.

[0020] Preferably, the culture is a suspension culture, with culture conditions of 36℃~38℃, CO2 concentration of 4%~6%, rotation speed of 100rpm~140rpm, and culture time of 6d~8d.

[0021] Preferably, the culture medium for suspension culture is ExCellOptiVitro®CHO serum-free basal medium CE01.

[0022] Compared with the prior art, the present invention has the following beneficial effects: 1. The present invention relates to a genetically modified CHO cell line producing trastuzumab, wherein the genetically modified CHO cell line is obtained by deleting the Ddit4 gene from the original CHO cell line. At the same cell density, the genetically modified CHO cell line shows a 1.62-2.17-fold increase in trastuzumab expression compared to the original CHO cell line. This invention is the first to discover a functional correlation between the Ddit4 gene and trastuzumab expression in CHO cell lines, with a significant increase in trastuzumab expression in CHO cell lines lacking the Ddit4 gene.

[0023] This invention utilizes CRISPR / Cas9 technology to knock out the Ddit4 gene in CHO cell lines. In suspension culture, CHO cell lines with Ddit4 gene knockout showed significantly increased trastuzumab expression, with yields reaching 1.62 to 2.17 times that of parental cells. Notably, this yield increase was achieved without increasing cell density, indicating that Ddit4 knockout specifically enhances the cell's protein synthesis capacity, achieving unexpected technical results and providing a new and stable platform for the efficient production of trastuzumab. Attached Figure Description

[0024] Figure 1 This is an agarose gel electrophoresis image of the backbone vector PX459 in Example 1 of the present invention and PX459 linearized after being digested with BbsI.

[0025] Figure 2 This image shows the construction and validation of the Ddit4 gene knockout vector in Example 1 of this invention. A shows the sequencing validation and alignment of the gRNA designed in exon E1 of the Ddit4 gene. B shows the sequencing validation and alignment of the gRNA designed in exon E2 of the Ddit4 gene. C is an agarose gel electrophoresis image of the Ddit4 gene knockout vector.

[0026] Figure 3The images show agarose gel electrophoresis diagrams of the PCR amplification results of monoclonal cells K13D-1 to K13D-36 in Example 2 of this invention. In the diagram, A shows the agarose gel electrophoresis diagrams of the PCR amplification results of B-7-13 and monoclonal cell lines K13D-1 to K13D-12. B shows the agarose gel electrophoresis diagram of the PCR amplification results of monoclonal cell lines K13D-13 to K13D-36.

[0027] Figure 4 The above diagram shows the sequencing results of K13D-27, K13D-28, and K13D-29 in Example 2 of this invention. In the diagram, A represents the sequencing results of the monoclonal cell line K13D-27, B represents the sequencing results of the monoclonal cell line K13D-28, and C represents the sequencing results of the monoclonal cell line K13D-29.

[0028] Figure 5 The image shows the qPCR results of K13D-27, K13D-28, and K13D-29 in Example 2 of this invention.

[0029] Figure 6 This is a graph showing the protein expression levels of K13D-27, K13D-28, and K13D-29 in Example 2 of the present invention. In the graph, A represents the results of Western blot analysis, and B represents the quantitative results of the Western blot analysis.

[0030] Figure 7 This is a graph showing the cell viability and cell density of K13D-27, K13D-28, and K13D-29 in Example 3 of the present invention. In the graph, A represents cell viability, and B represents cell density.

[0031] Figure 8 This image shows the expression results of trastuzumab K13D-27, K13D-28, and K13D-29 in Example 3 of the present invention. In the image, A represents the trastuzumab expression results, and B represents the quantitative results of the Western blot. Detailed Implementation

[0032] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the following detailed description, in conjunction with preferred embodiments and accompanying drawings, provides a clear and complete account of the technical solutions of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0033] It should be noted that all technical terms used in this invention are for the purpose of describing specific embodiments only and are not intended to limit the scope of protection of this invention. Unless otherwise specified, all raw materials, reagents, instruments and equipment used in the following embodiments of this invention can be purchased from the market or prepared by existing methods.

[0034] The main materials used in this invention are PX459 backbone carrier, Lipofectamine™ 2000 transfection reagent, PMSF, and RIPA lysis buffer.

[0035] The PX459 backbone vector was purchased from Addgene, catalog number 62988, product name pSpCas9(BB)-2A-Puro (PX459) V2.0. Lipofectamine™ 2000 transfection reagent was purchased from Hefei Baisha Biotechnology Co., Ltd., catalog number BL623B. PMSF was purchased from Beyotime Biotechnology Co., Ltd., product code ST507-10ml. RIPA lysis buffer was purchased from Beyotime Biotechnology Co., Ltd. (Shanghai, China), product code P0013B, formulation: 50mM, pH 7.4 Tris-HCl, 150mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS.

[0036] The protein lysis buffer used in this invention consists of PMSF and RIPA lysis buffer.

[0037] The parental cells used in this invention are a CHO-S-derived cell line that was previously constructed in the laboratory and can stably express trastuzumab, named B-7-13.

[0038] Construction method of B-7-13: An expression vector containing the heavy and light chain genes of trastuzumab and the blast fungicide resistance gene for selection was transformed into CHO-S host cells. After introduction via liposome transfection, the cells were subjected to pressure selection in DMEM / F12 complete medium with a concentration of 15 μg / mL blast fungicide to obtain a cell pool with a stable integrated expression cassette. Subsequently, the cell pool was subjected to monoclonal selection using a limiting dilution method to obtain B-7-13. B-7-13 can stably express trastuzumab in chemically defined suspension medium under normal CHO cell culture conditions. The chemically defined medium refers to a medium in which the chemical structure and concentration of all components are known, and which does not contain animal-derived components or plant hydrolysates. B-7-13 will be used as the host cell or parental cell for subsequent editing of the Ddit4 gene.

[0039] Example 1 A method for constructing a Ddit4 gene knockout vector includes the following steps: The gene editing vector constructed in this embodiment is based on CRISPR / Cas9 technology to construct a recombinant plasmid with dual gRNA knockout target. The specific operation steps are as follows.

[0040] 1. Target primer design Using the genome sequence of the Chinese hamster as the target, the Ddit4 genome sequence was searched at http: / / www.ncbi.nlm.nih.gov. For the Ddit4 gene, a pair of sgRNAs was designed from the first and second exons of the CDS region based on the common exon sequences of the transcript, namely Ddit4-E1-gRNA-F, Ddit4-E1-gRNA-R and Ddit4-E2-gRNA-F, Ddit4-E2-gRNA-R. The sequence of the first exon (Exon 1) is SEQ ID NO.1. The sequence of the second exon (Exon 2) is SEQ ID NO.2. The sequence of Ddit4-E1-gRNA-F is SEQ ID NO.3. The sequence of Ddit4-E1-gRNA-R is SEQ ID NO.4. The sequence of Ddit4-E2-gRNA-F is SEQ ID NO.5. The sequence of Ddit4-E2-gRNA-R is SEQ ID NO.6.

[0041] SEQ ID NO. 1: ATGCCTAGCCTTTGGGATCGTTTCTCGTCCTCCTCCCTCCTCCTCTTCGTCCTCGTCCGGAACTCCAGCCACTGATCGGCCGCCGCGCTCCGCCTGGGGGTCTGCGGCCCGAGAAGAGGGCCTTGACCGCTGCGCGAGCCTGGAGAGCTCGGACTGTGAGTCCTTGGACAGCAGCAACAGTGGCTTCGGACCGGAGGAAG.

[0042] SEQ ID NO.2: ACTCCTCATACCTGGATGGGGTGTCCCTGCCCGACTTTGAGCTGCTCAGTGACCCGGAGGATGAGCATCTGTGTGCCAACCTGATGCAGCTGCTGCAGGAGAGCCTGTCCCAGGCGCGA TTGGGCTCGCGGCGCCCCGCGCGCCTGCTAATGCCAAGCCAGCTGGTGAGCCAGGTGGGCAAGGAACTCCTGCGCCTGGCTTACAGCGAGCCGTGCGGCCTGCGGGGGGCACTGCTGGACGTCTG TGTGGAGCAAGGCAAGAGCTGCCATAGCGTGGCTCAGCTGGCCCTCGACCCCAGCCTGGTGCCCACCTTTCAGCTGACCCTGGTGCTGCGCCTGGACTCTCGCCTCTGGCCCAAAATCCAGGGGC TGTTGAGTTCCGCTAACTCTTCCTTGGTCCCTGGCTACAGCCAGTCCCTGACGCTGAGCACCGGCTTCAGAGTCATCAAGAAGAAACTCTACAGCTCCGAACAGCTGCTCATTGAAGAGTGTTGA SEQ ID NO. 3: 5'-CACCGaacagtggcttcggaccgg-3'.

[0043] SEQ ID NO. 4: 5'-AAACccggtccgaagccactgttC-3'.

[0044] SEQ ID NO. 5: 5'-AAACcgcgcgcctgctaatgccaC-3'.

[0045] SEQ ID NO. 6: 5'-CACCGtggcattagcaggcgcgcg-3'.

[0046] 2. Construction of the Ddit4 gene knockout vector 2.1 Linearization Vector Construction: The backbone vector for expressing the Cas9 enzyme was PX459. PX459 contains two restriction endonuclease sites, BbsI. PX459 was linearized using BbsI. The linearization digestion system is shown in Table 1. The products were added to PCR tubes according to the following system, thoroughly mixed, and incubated at 37°C for at least 4 hours. The digestion products were then detected by agarose gel electrophoresis. The results are shown below. Figure 1As shown, the linearized vector was purified and recovered using a gel extraction kit for later use.

[0047] Table 1 Enzyme digestion system 2.2 Primer phosphorylation: The two pairs of synthesized gRNA primers were phosphorylated. The primer sequences are shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.4 and SEQ ID NO.5. The phosphorylation reaction system is shown in Table 2. The primers were added to the PCR tubes according to the following system, thoroughly mixed, and then transferred to a PCR instrument for reaction according to the procedure in Table 3.

[0048] Table 2 Primer phosphorylation system Table 3 Annealing Temperature System The final collected reaction solution is phosphorylated double-stranded gRNA, and the product can be stored at -20°C.

[0049] 2.3 Ligation of linearized vector: The two pairs of phosphorylated double-stranded gRNA fragments obtained in 2.2 and the linearized Cas9 expression vector obtained in 2.1 were ligated. The reaction system is shown in Table 4. The following systems were added to centrifuge tubes in sequence, and then thoroughly mixed. The mixture was transferred to a PCR instrument and incubated overnight at 16°C. The incubation product was transformed into Escherichia coli DH5α the next day. LB solid medium and liquid medium were prepared in advance, and ampicillin was added at a volume ratio of 1:1000. Escherichia coli DH5α cells were plated on LA solid culture plates and then placed in a 37°C incubator for 13 hours.

[0050] Table 4 Connection System After 14 hours, the culture was expanded. Using the autoclaved pipette tip, a single colony was carefully selected from the LA solid culture plate and then transferred to a 15 mL centrifuge tube containing 5 mL of LA liquid medium. The tubes were clearly labeled. The centrifuge tubes were placed in a shaker and incubated at 37°C and 220 rpm for 14 hours.

[0051] After 14 hours, the bacterial culture should be turbid. At this point, collect the bacterial culture and preserve the bacteria. The preservation steps are as follows: First, prepare 60% glycerol. Mix the collected bacterial culture with 60% glycerol in an equal proportion to form a glycerol bacterial culture. Take 1.8 mL of the glycerol bacterial culture and transfer it to a 2 mL autoclaved centrifuge tube. Send the glycerol bacteria to the company for sequencing. Transfer the remaining glycerol bacteria to other 2 mL autoclaved centrifuge tubes and store them at -20°C. After sequencing is complete, the correct plasmid is the expression vector containing sgRNA and Cas9. The glycerol bacteria corresponding to the correctly constructed vector, as determined by sequencing alignment, are removed from the -20°C freezer. 1 mL of the glycerol bacteria is transferred to a 15 mL centrifuge tube containing 5 mL of LA liquid medium. The tube is incubated at 37°C with shaking at 220 rpm for 14 hours. Once the bacterial culture becomes turbid, the plasmid is extracted according to the instructions of the Kangwei Century plasmid extraction kit. This yields two successfully constructed Ddit4 gene knockout vectors, named pX459-Ddit4-E1 and pX459-Ddit4-E2. Figure 2 As shown.

[0052] Example 2 A method for establishing a stable CHO cell line with the Ddit4 gene knocked out includes the following steps: 1. Construction of Ddit4 gene knockout monoclonal cell line 1.1 Selection of puromycin concentration: pX459-Ddit4-E1 and pX459-Ddit4-E2 vectors have puromycin resistance and can be used for screening positive clone cell lines in the later stage.

[0053] It is necessary to determine the minimum lethal dose of puromycin for normal cells. Different mammalian cells have different sensitivities and tolerance levels to puromycin. B-7-13 cells stably expressing trastuzumab were then administered at a concentration of 2 × 10⁻⁶. 5 Cells were seeded at a density of 10 cells / mL into 24-well plates. After 24 hours, when the cell confluence reached 80%, puromycin was added at concentrations of 0 μg / mL, 6 μg / mL, 8 μg / mL, 10 μg / mL, 12 μg / mL, 14 μg / mL, and 16 μg / mL, respectively. The cells were cultured for 7 days, and the optimal concentration that could induce normal cell death was observed. The optimal concentration was 10 μg / mL.

[0054] After confirming the puromycin concentration to be 10 µg / mL, B-7-13 cells were again incubated at 6 × 10⁻⁶ cells / mL. 5Cells were seeded at a density of 10 cells / mL into 6-well plates. After 24 hours, when cell confluence reached 80%, pX459-Ddit4-E1 and pX459-Ddit4-E2 cells were co-transfected at a 1:1 ratio, following the instructions for the Lipofectamine™ 2000 transfection reagent from Biosharp. After 48 hours, the medium was replaced with DMEM / F12 complete medium at a puromycin concentration of 10 μg / mL, with the medium changed every 1 day. After 5 days, the untransfected normal cells died, and the medium was replaced with DMEM / F12 complete medium at a puromycin concentration of 5 μg / mL, with the medium changed every 1 day. After 14 days of selection, the cell pool was obtained, expanded in 6-well plates, cryopreserved, and used for subsequent experiments.

[0055] 1.2 Screening and Establishment of Monoclonal Cell Lines To obtain gene knockout cell lines with uniform genetic background, the cell pool initially screened with puromycin was subjected to monoclonal screening. The specific steps are as follows: (1) Cell preparation: The cell pool was digested with trypsin and resuspended in complete culture medium for cell counting.

[0056] (2) Limiting dilution: The cell suspension is serially diluted to a theoretical concentration of 0.5 to 1 cell per 100 μL of culture medium.

[0057] (3) Seeding and culture: The diluted cell suspension was seeded into a 96-well cell culture plate, with 100 μL added to each well. In this way, each well contains less than one cell on average, to ensure that the vast majority of positive wells are derived from the proliferation of a single cell.

[0058] (4) Single-cell identification and labeling: 96-well cell culture plates were incubated in an incubator at 37°C and 5% CO2. After 6 days, wells formed by the division of single cells with colonies containing only one independent cell were observed and labeled under a microscope.

[0059] (5) Single-clone expansion culture: When the cell colonies in the labeled wells grow to cover 30% to 50% of the bottom area of ​​the well, they are digested with trypsin and transferred sequentially to 24-well, 12-well and 6-well plates for gradual expansion culture.

[0060] (6) Cell Preservation and Nomenclature: The expanded monoclonal cell lines were promptly cryopreserved. Several monoclonal cell lines with potential Ddit4 gene knockout were screened from the CCP and numbered as follows: K13D-1, K13D-2, K13D-3, K13D-4, K13D-5, K13D-6, K13D-7, K13D-8, K13D-9, K13D-10, K13D-11, K13D-12, K13D-13, K13D-14, K13D-15, K13D-16, K13D-17, K13D-18, K13D-19, K13D-10, K13D-11, K13D-12, K13D-13, K13D-14, K13D-15, K13D-16 ... 13D-17, K13D-18, K13D-19, K13D-20, K13D-21, K13D-22, K13D-23, K13D-24, K13D-25, K13D-26, K13D-27, K13D-28, K13D-29, K13D-30, K13D-31, K13D-32, K13D-33, K13D-34, K13D-35, K13D-36. These monoclonal strains will be used for subsequent genotyping.

[0061] 2. Validation of Ddit4 gene knockout monoclonal cell lines 2.1 Genome-level sequencing validation: Expanded monoclonal cells K13D-1, K13D-2, K13D-3, K13D-4, K13D-5, K13D-6, K13D-7, K13D-8, K13D-9, K13D-10, K13D-11, K13D-12, K13D-13, K13D-14, K13D-15, K13D-16, K13D-17, K13D-18, K13D-19, K13D-20, K13D-21, K13D-22, K13D-23, K13D- 24. K13D-25, K13D-26, K13D-27, K13D-28, K13D-29, K13D-30, K13D-31, K13D-32, K13D-33, K13D-34, K13D-35, and K13D-36 were collected separately, and genomic DNA was extracted using a genomic DNA extraction kit. PCR primers were designed at the knockout site, 300 bp upstream of the first exon and downstream of the second exon of the Ddit4 genome. The Ddit4-EF and Ddit4-ER sequences are shown in SEQ ID NO.7 and SEQ ID NO.8, respectively. PCR amplification was performed, and the reaction system is shown in Table 5.

[0062] Forward primer of SEQ ID NO.7: ACGGGATCCTTGTCCCTCTT.

[0063] SEQ ID NO.8 Reverse primer: GCAGGCATCAGTCCTTCAGT.

[0064] Table 5 Amplification System 10 µL of the amplified product was analyzed by agarose gel electrophoresis, and the results are as follows: Figure 3 As shown in the figure. Based on the agarose gel electrophoresis results, cell lines that may have been knocked out were selected and subjected to PCR again. 2 µL of the amplification product was taken for agarose gel electrophoresis, and the remaining 18 µL of product was sequenced. The sequencing results are shown in the figure. Figure 4 As shown in the figure. The results showed that K13D-27, K13D-28, and K13D-29 caused large-fragment knockouts. Three successful knockout cell lines were obtained, namely K13D-27, K13D-28, and K13D-29, and subsequent experiments were conducted on these three knockout cell lines.

[0065] 2.2 mRNA and protein level validation: 2.2.1 qPCR verification of mRNA levels in knockout cell lines RNA was extracted from B-7-13 and knockout cell lines, and reverse transcription was performed to obtain cDNA. The specific reaction was carried out in two steps. The reaction system for the first step is shown in Table 6, and the reaction system for the second step is shown in Table 7.

[0066] Table 6. First-step reaction system Table 7 Second Step Reaction System qPCR primers for the Ddit4 gene were designed. The nucleotide sequences of Ddit4-F and Ddit4-R are shown in SEQ ID NO. 9 and SEQ ID NO. 10, respectively. qPCR detection was performed on B-7-13 and K13D-27, K13D-28, and K13D-29 cell lines. The primers were diluted 10-fold and the cDNA was diluted 2-fold. The reaction system is shown in Table 8. The expression levels of the Ddit4 gene in K13D-27, K13D-28, and K13D-29 cell lines are shown in Table 8. Figure 5 As shown in the figure. The results showed that the mRNA expression level of the Ddit4 gene in the knockout cell line was significantly lower than that in B-7-13.

[0067] Forward primer of SEQ ID NO.9: CAGCAGTGAGAGGGTCTCC.

[0068] SEQ ID NO.10 Reverse primer: CTCGAACGTGTAGGCCATGA.

[0069] Table 8 qPCR reaction system 2.2.2 Western blot validation of protein expression levels in knockout cell lines Total protein was extracted from B-7-13, K13D-27, K13D-28, and K13D-29 cell lines and analyzed by Western blotting. The specific steps are as follows: Cells were lysed using a protein lysis buffer containing PMSF and RIPA at a volume ratio of 1:100. After cell collection, the cells were centrifuged, and the supernatant was collected. Protein concentration was determined using the BCA method. 40 μg of protein sample was added to each well, and electrophoresis was initiated after loading. Electrophoresis was performed initially at 80 V for 30 min, followed by electrophoresis at 220 V. After sample dispersion, wet transfer was performed for 35 min. The membrane was blocked with rapid blocking buffer for 15 min, washed with TBST for 10 min, and incubated with primary antibody overnight at 4°C. After primary antibody recovery, the membrane was washed three times with TBST for 10 min each time, and incubated with secondary antibody at room temperature for 2 h. After secondary antibody recovery, the membrane was washed three times with TBST for 10 min each time. High-sensitivity ECL chromogenic solution was used for color development. The protein expression levels of Ddit4 in K13D-27, K13D-28, and K13D-29 cell lines were as follows: Figure 6 As shown, the results indicate that the protein expression level of Ddit4 in the three cell lines K13D-27, K13D-28, and K13D-29 was significantly lower than that in B-7-13 cells, indicating that the Ddit4 gene knockout was successful.

[0070] In this embodiment, the gene editing vector with dual gRNA knockout target provided by the present invention was used to co-transfect B-7-13 cells to achieve efficient knockout of the Ddit4 gene in CHO cells, thereby constructing an endogenous Ddit4 gene-deficient CHO cell line.

[0071] Example 3 The application of trastuzumab production in CHO cell lines with the Ddit4 gene knocked out includes the following steps: 1. Application of trastuzumab produced by CHO cell lines (1) Cell lines: Three monoclonal cell lines K13D-27, K13D-28 and K13D-29, which were confirmed as homozygous knockout of Ddit4 by genotype identification and verification of mRNA and protein levels in Example 2, were selected as the experimental group. Unedited parental cells B-7-13 were used as the control group.

[0072] (2) Culture and Inoculation: After thawing and adapting all cell lines from cryopreservation, suspension culture was performed using ExCellOptiVitro®CHO serum-free basal medium CE01 with chemically defined suspension medium. Cells in logarithmic growth phase and in good condition were centrifuged to remove the original medium, resuspended in fresh suspension medium, and their density adjusted. Each cell line was cultured at the same initial viable cell density of 0.5 × 10⁻⁶ cells / year. 6 Cells / mL were inoculated into multiple parallel shake flasks.

[0073] (3) Culture and monitoring: The shake flasks were placed in a constant temperature shaking incubator at 37°C, 5% CO2, and 120 rpm for 7 days. Samples were taken daily, and the viable cell density and cell viability of each group were measured using an automated cell counter, and growth curves were plotted. Viable cell density is abbreviated as VCD.

[0074] (4) Product yield detection: At the end of day 7 of culture, the culture supernatant of all shake flasks was collected and cell debris was removed by centrifugation. The yield of trastuzumab was detected by Western blotting for semi-quantitative analysis. The specific steps were as follows: equal volumes of supernatant samples were subjected to SDS-PAGE electrophoresis, and after membrane transfer, incubation and color development were performed using a specific primary antibody against human IgG Fc fragment and the corresponding secondary antibody. The signal was acquired by a chemiluminescence imaging system, and the gray values ​​of the bands in each experimental group and the control group were compared using image analysis software to calculate the relative expression level.

[0075] 2. Results of trastuzumab production by CHO cell lines Cell viability and cell density of cell lines K13D-27, K13D-28, and K13D-29 are as follows: Figure 7 As shown in the figure. The results showed that during the 7-day culture period, the cell viability of the three Ddit4 knockout cell lines K13D-27, K13D-28, and K13D-29 was not significantly different from that of the parental control group B-7-13, and all remained above 90%. However, the maximum viable cell density of the knockout cell lines was lower than that of the parental control group.

[0076] The expression levels of trastuzumab in cell lines K13D-27, K13D-28, and K13D-29 are as follows: Figure 8 As shown in the figure. The results showed that, through quantitative analysis of the gray values ​​of the Western Blot bands, it was found that, at the end of culture day 7, the signal intensity of trastuzumab in the culture supernatant of the three knockout cell lines was significantly stronger than that of the control group.

[0077] Based on the yield of parental cell line B-7-13, calculations showed that: cell line K13D-27's yield was 2.17 times that of the parental cell line; cell line K13D-28's yield was 1.62 times that of the parental cell line; and cell line K13D-29's yield was 1.74 times that of the parental cell line.

[0078] As demonstrated in the above examples, knocking out the Ddit4 gene in CHO-S cells expressing trastuzumab can significantly increase the expression level of the target protein without affecting cell viability. Particularly noteworthy is that this yield increase was achieved without increasing or even slightly decreasing cell density, indicating that Ddit4 knockout may specifically enhance the protein production capacity per unit cell by affecting cellular metabolic efficiency or protein synthesis pathways, achieving unexpected technical effects. These results fully demonstrate that cell engineering targeting Ddit4 can effectively increase the expression yield of trastuzumab, and this modification strategy possesses significant innovation.

[0079] It should be noted that when numerical ranges are involved in this invention, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. Since the steps and methods used are the same as in the embodiments, preferred embodiments are described in this invention to avoid redundancy. Although preferred embodiments of this invention have been described, those skilled in the art, once they understand the inventive concept of this invention, can make other changes and modifications to these embodiments, and all such changes and modifications fall within the scope of this invention.

[0080] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. If such modifications and variations fall within the scope of equivalents of this invention, then this invention is also intended to include such modifications and variations.

Claims

1. A genetically modified CHO cell line containing trastuzumab, characterized in that, The genetically modified CHO cell line was obtained by deleting the function of the Ddit4 gene from the original CHO cell line. At the same cell density, the genetically modified CHO cell line showed 1.62 to 2.17 times higher trastuzumab expression levels than the original CHO cell line.

2. The genetically modified CHO cell line of trastuzumab according to claim 1, characterized in that, The loss of function of the Ddit4 gene is achieved through gene knockout, gene silencing, or mutation.

3. The genetically modified CHO cell line for trastuzumab according to claim 2, characterized in that, The gene knockout is achieved through a CRISPR / Cas9 system, TALENs, or ZFN.

4. The genetically modified CHO cell line of trastuzumab according to claim 3, characterized in that, When knocking out the Ddit4 gene using the CRISPR / Cas9 system, the nucleotide sequences of the gRNA targeting the Ddit4 gene are shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.

6. The nucleotide sequence of SEQ ID NO.3 is 5′-CACCGaacagtggcttcggaccgg-3′; The nucleotide sequence of SEQ ID NO.4 is 5′-AAACccggtccgaagccactgttC-3′; The nucleotide sequence of SEQ ID NO.5 is 5′-AAACcgcgcgcctgctaatgccaC-3′; The nucleotide sequence of SEQ ID NO.6 is 5′-CACCGtggcattagcaggcgcgcg-3′.

5. The method for preparing a genetically modified CHO cell line of trastuzumab according to claim 1, characterized in that, The procedure includes the following steps: introducing a gene-editing tool targeting the Ddit4 gene into CHO host cells expressing trastuzumab to induce a loss-of-function mutation in the gene; and screening and identifying cell clones that have lost the function of the Ddit4 gene.

6. The method for preparing a genetically modified CHO cell line of trastuzumab according to claim 5, characterized in that, The gene editing tool is a CRISPR / Cas9 system, which includes a vector expressing the Cas9 protein and a gRNA targeting the Ddit4 gene; the target sequence of the gRNA is located in the first and second exons of the Ddit4 gene.

7. The method for preparing a genetically modified CHO cell line of trastuzumab according to claim 6, characterized in that, The screening and identification process includes: screening successfully transfected cell pools using puromycin, obtaining monoclonal cell lines through limiting dilution, and screening homozygous knockout clones with frameshift mutations or large deletions at the target site through PCR amplification and sequencing analysis.

8. The application of the genetically modified CHO cell line for trastuzumab according to claim 1 in the production of trastuzumab, characterized in that, The method of application includes the following steps: culturing the CHO cell line producing trastuzumab in serum-free suspension medium; after culturing, collecting the culture supernatant by centrifugation, purifying it, and obtaining trastuzumab.

9. The application of the genetically modified CHO cell line for trastuzumab according to claim 8 in the production of trastuzumab, characterized in that, The culture was a suspension culture, with culture conditions of 36℃~38℃, CO2 concentration of 4%~6%, rotation speed of 100rpm~140rpm, and culture time of 6d~8d.

10. The application of the genetically modified CHO cell line for trastuzumab according to claim 9 in the production of trastuzumab, characterized in that, The culture medium for suspension culture is ExCellOptiVitro®CHO serum-free basal medium CE01.

Images