An Angelica dahurica AdSVP gene and its application

By cloning and overexpressing the Angelica dahurica AdSVP gene, the problem of yield reduction caused by early flowering of Angelica dahurica was solved, and the pods became longer and the plants taller, thus increasing the yield of Angelica dahurica medicinal materials.

CN122303307APending Publication Date: 2026-06-30SICHUAN ACAD OF CHINESE MEDICINE SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SICHUAN ACAD OF CHINESE MEDICINE SCI
Filing Date
2026-05-18
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Angelica dahurica exhibits premature flowering during cultivation, leading to reduced yield of medicinal materials. Current technologies have failed to effectively regulate its molecular mechanism.

Method used

The Angelica dahurica AdSVP gene was cloned and overexpressed. An overexpression vector was constructed and transformed into recombinant bacteria by overexpressing the AdSVP gene in Arabidopsis thaliana. The vector was then applied to Angelica dahurica to inhibit early flowering and promote pod elongation and plant height.

Benefits of technology

It significantly inhibits premature flowering of Angelica dahurica plants, increases the number of rosette leaves, extends the length of fruit pods, increases plant height, and improves the yield of Angelica dahurica medicinal materials.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303307A_ABST
    Figure CN122303307A_ABST
Patent Text Reader

Abstract

This invention provides Angelica dahurica AdSVP This invention relates to genes and their applications, belonging to the field of plant molecular biology technology. The Angelica dahurica provided by this invention... AdSVP The CDS sequence of the gene is shown in SEQ ID NO.16, and the amino acid sequence is shown in SEQ ID NO.17. The gene was obtained by overexpression in Arabidopsis thaliana. AdSVP Gene, results showed overexpression AdSVP Arabidopsis plants not only showed significantly greater rates of bolting and rosette leaf number compared to wild-type plants, but also exhibited significantly greater pod length and plant height. AdSVP Gene overexpression not only significantly inhibits flowering in plants and increases the number of rosette leaves in transgenic plants, but also... AdSVP It can also cause transgenic plants to have longer pods and taller plants.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant molecular biology, and more particularly to a kind of Angelica dahurica. AdSVP Genes and their applications. Background Technology

[0002] Angelica dahurica, a traditional Chinese medicine, has the effects of relieving exterior syndromes and dispelling cold, dispelling wind and relieving pain, clearing nasal passages, drying dampness and stopping leukorrhea, and reducing swelling and draining pus. It is often used for major symptoms such as colds, headaches, nasal congestion, and runny nose. At the same time, Angelica dahurica is also a commonly used bulk medicinal and edible herb, widely used in the fields of medicine, food, spices, and cosmetics.

[0003] All Angelica dahurica used in modern times is cultivated. In cultivation, Angelica dahurica is sown in autumn around the time of the White Dew solar term. The underground roots are harvested in July of the following year when the plants wither and are dried for medicinal use. This stage is the vegetative growth period. Plants kept for cultivation continue to grow until the third year, entering the reproductive growth period, when they bolt and flower. Mature seeds are harvested in mid-July. However, in actual production, some Angelica dahurica plants bolt and flower prematurely in the second year (i.e., early bolting), entering reproductive growth. The growth of the above-ground parts consumes a large amount of nutrients, and the medicinal roots become loose, light, and lignified, unable to complete normal secondary metabolic growth, and therefore unsuitable for medicinal use. Field investigations have found that the early bolting rate is high in the main producing areas of Angelica dahurica, reaching over 50% in severe cases, causing a significant reduction in the yield of Angelica dahurica medicinal materials. Early bolting has become one of the key problems seriously restricting the high-quality production of Angelica dahurica medicinal materials.

[0004] Bolting and flowering are determined by the plant's own genetic mechanisms, but the molecular mechanisms regulating angelica dahurica are still unclear. To better guide production, research into genes regulating early bolting and flowering in angelica dahurica is urgently needed.

[0005] Based on this, the present invention is proposed. Summary of the Invention

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides an application of the Angelica dahurica AdSVP gene or an overexpression vector containing the Angelica dahurica AdSVP gene or a recombinant bacterium containing the Angelica dahurica AdSVP gene or the overexpression vector in promoting the elongation of Angelica dahurica pods and / or the increase in plant height.

[0007] Preferably, the CDS sequence of the Angelica dahurica AdSVP gene is shown in SEQ ID NO.16, and the amino acid sequence is shown in SEQ ID NO.17.

[0008] Preferably, the overexpression vector containing the Angelica dahurica AdSVP gene is obtained by ligating the Angelica dahurica AdSVP gene into the vector plasmid pCambia2301-JC, resulting in the overexpression vector pCambia2301-JC-AdSVP.

[0009] Preferably, the transformant bacteria containing the Angelica dahurica AdSVP gene or the overexpression vector is Agrobacterium GV3101.

[0010] Preferably, the plant is Arabidopsis thaliana or Angelica dahurica.

[0011] This invention uses Angelica dahurica as material and obtains it through RACE technology. AdSVP The gene, with a full-length CDS sequence of 726 bp, encodes 241 amino acids. It was obtained by overexpression in Arabidopsis thaliana. AdSVP Gene, results showed overexpression AdSVP Arabidopsis plants not only showed significantly greater rates of bolting and rosette leaf number compared to wild-type plants, but also exhibited significantly greater pod length and plant height. AdSVP Gene overexpression not only significantly inhibits flowering in plants and increases the number of rosette leaves in transgenic plants, but also... AdSVP It can also cause transgenic plants to have longer pods and greater plant height. Current research on... SVP Genetic studies have shown that overexpression SVP The altered vegetative growth status resulting from gene suppression of flowering in plants is limited to an increase in the number of rosette leaves, and no studies have shown that gene expression... SVP Genes can cause pods to become longer and / or plants to become taller. Attached Figure Description

[0012] Figure 1 for AdSVP Gene PCR amplification products: BY2: AdSVP intermediate fragment, BR2: AdSVP 5' RACE fragment, BF3: AdSVP 3' RACE fragment, M: 3000 bp Marker; Figure 2 for AdSVP Genetically modified Agrobacterium PCR detection, M: 2000 bp Marker, 1-3 are replicates; Figure 3 for AdSVP Sequencing results of Agrobacterium PCR products; Figure 4 for AdSVP PCR detection of gene-producing plants: "-" represents pure water blank control, "WT" represents wild-type plant control, "+" represents plasmid control, "M" represents DL2000 Marker, and 1-12 represent resistant plants. Figure 5 To overexpress the growth of the plant and wild-type plants on day 38. Detailed Implementation

[0013] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0014] Example 1

[0015] 1. Materials and Methods

[0016] 1.1 Materials

[0017] Using Hangzhou Angelica as the experimental material, it was planted at the planting base of Sichuan Quantaitang Angelica Industry Company. In May 2023, leaves of early flowering Angelica plants were taken, flash-frozen with liquid nitrogen, and stored in a -80℃ freezer for later use.

[0018] Trizol extraction kit (B511321), 5'-RACE kit (B605102), 3'-RACE kit (B605101), and SanPrep column DNA gel extraction kit (518131) are all from Shanghai Sangon Biotech Co., Ltd.

[0019] 1.2 Test Methods

[0020] 1.2.1 Total RNA extraction and cDNA reverse transcription

[0021] RNA was extracted using the Trizol extraction kit.

[0022] Add 1 μg of extracted RNA, 1 μl of 5'RACE primers (RC1094-B-RT1: 5'-GCAATACCACTTCTCAGCCAAC-3' (SEQ ID NO.1), RC1094-B-RT2: 5'-AAAAACATGATTGATTTGCACATTC-3' (SEQ ID NO.2), and 1 μl of 3' adapter primer (5'-GCTGTCAACGATACGCTACGTAACGGCATGACAGTGTTTTTTTTTTTTTTTTTT-3' (SEQ ID NO.3) (10 μM) according to the reverse transcription kit instructions. Add RNase-free water to a final volume of 10 μl, mix well, centrifuge briefly, incubate at 65°C for 5 minutes, and then on ice for 2 minutes. Add 10 μl of Reverse Transcriptase Mix (RNase H-), mix well, and centrifuge briefly. Incubate at 50°C for 30 minutes, and then heat at 85°C for 1 minute. Store at -20°C for later use.

[0023] 1.2.2 AdSVP Gene cloning

[0024] 1.2.2.1 AdSVP Amplification of intermediate gene segments

[0025] Forward primer RC1094-B-Y2F: 5'-CGAGTTGCTCCAAGAGAAAAGGT-3' (SEQ ID NO.4); Reverse primer RC1094-B-Y2R: 5'-CAGCTCAAGAGATGGTCGTTCC-3' (SEQ ID NO.5). PCR products were recovered.

[0026] 1.2.2.2 AdSVP Amplification of the 3' end fragment of the gene

[0027] Nested PCR reaction system was used. The first round forward primer was RC1094-B-F2: 5'-TGCAATGTAACCTTGTGCTCATAAC-3' (SEQ ID NO. 6); the reverse primer was 5.3'outer: 5'-GCTGTCAACGATACGCTACGTAAC-3' (SEQ ID NO. 7). The second round forward primer was RC1094-B-F3: 5'-ACTTGAAAGGCATAGTTTACACTCG-3' (SEQ ID NO. 8); the reverse primer was 5.3'inner: 5'-GCTACGTAACGGCATGACAGTG-3' (SEQ ID NO. 9). PCR products were recovered.

[0028] 1.2.2.3 AdSVP Amplification of the 5' end fragment of the gene

[0029] Nested PCR reaction system was used. The first round forward primer was RC1094-B-R1: 5'-GCCTGCGTTTGCTGGTAAGT-3' (SEQ ID NO.10); the reverse primer was 5'adaptor: 5'-GCTGTCAACGATACGCTACGTAACGGCATGACAGTGGGIIGGGIIGGGIIG-3' (SEQ ID NO.11, where II in the sequence represents inosine modification, which is not shown in the sequence listing). The second round forward primer was RC1094-B-R2: 5'-GACTGGGGATGGGTACCGTAT-3' (SEQ ID NO.12); the reverse primer was 5.3'outer: 5'-GCTGTCAACGATACGCTACGTAAC-3' (SEQ ID NO.13). PCR products were recovered.

[0030] The intermediate, 3', and 5' fragment sequences obtained from the amplification were spliced ​​together and ligated into the pMD-19 cloning vector, transformed, and positive colonies were selected and sequenced for verification.

[0031] 1.2.3 Bioinformatics Analysis

[0032] The sequencing results were verified using NCBI's alignment function. The open reading frames (ORFs) of the full-length cDNA were queried using the ORF-Finder website, and their encoded amino acid sequences were deduced.

[0033] 1.2.4 Construction of overexpression vector and functional verification of transgenic Arabidopsis thaliana

[0034] 1.2.4.1 Constructing the expression vector

[0035] The pCambia2301-JC plasmid was linearized by KpnI digestion (using the corresponding restriction endonuclease products from Thermo or Takara). The digestion reaction system is shown in Table 1 below: Table 1 Enzyme digestion reaction system

[0036] After purification by enzyme digestion, the product was combined with Angelica dahurica. SVP The full-length cDNA sequence of the gene was used for recombination (the recombination reaction kit was the Vazyme ClonExpress-II One Step Cloning Kit). The recombination ligation reaction system (total volume 10 μl) is shown in Table 2 below: Table 2 Recombinant Linkage Reaction System

[0037] The above reaction solution was gently mixed using a pipette, and the mixture was briefly centrifuged to collect the solution at the bottom of the tube. The mixture was then incubated at 37°C for 30 min, followed immediately by cooling on ice. After transformation, single clones of *E. coli* were picked from antibiotic plates for PCR testing.

[0038] 1.2.4.2 Functional Verification of Transgenic Arabidopsis

[0039] The overexpression vector pCambia2301-JC-AdSVP was transformed into Agrobacterium strain GV3101 using the liquid nitrogen freeze-thaw method, and the Agrobacterium inflorescence infection method was used to transform the strain. AdSVP Genes were transferred into wild-type Arabidopsis thaliana to obtain T0 generation seeds.

[0040] Harvested Arabidopsis thaliana T0 generation seeds were sterilized with 75% ethanol and then germinated on 1 / 2 MS plates containing kanamycin (40 mg / L) for resistance selection. Positive transgenic Arabidopsis seedlings were simultaneously detected using specific primers for the pCambia2301-JC plasmid (F: CGTCTTCAAAGCAAGTGGAT (SEQ ID NO.14); R: GAGCGGATAACAATTTCACAC (SEQ ID NO.15)). T3 generation transgenic plants and wild-type plants were cultured in the same environment, and their flowering phenotypes were observed and compared.

[0041] 1.2.5 Data Statistics and Analysis

[0042] Data analysis and graphing were performed using WPS Office software, while multiple comparisons were analyzed using DPS 14.0 software.

[0043] 2 Results and Analysis

[0044] 2.1 Angelica dahurica AdSVP Cloning of genes

[0045] According to other plants SVP Degenerate primers were designed based on conserved homologous sequences of the gene. Total RNA was extracted from Angelica dahurica leaves, and cDNA was obtained by PCR reverse transcription. The intermediate fragment was obtained through primers for the conserved region, and sequencing revealed that the intermediate fragment was 580 bp in length. SVP Primers for 3' RACE and 5' RACE were designed for the conserved region fragment, yielding a 115 bp 3' RACE amplification product and a 194 bp 5' RACE amplification product. Figure 1 The PCR product was recovered, ligated into the pMD-19 cloning vector, transformed, and positive colonies were selected and sequenced for verification. The resulting product was then assembled using DNAMAN software to obtain *Angelica dahurica*. SVP The full-length cDNA sequence of the gene was analyzed using ORF-Finder. SVP The gene is 736 bp in length, containing a 726 bp ORF region (as shown in SEQ ID NO.16), encoding 241 amino acids (as shown in SEQ ID NO.17), and is named... AdSVP .

[0046] AdSVP CDS sequence of the gene (SEQ ID NO.16): ATGGCGAGAGAGAAGATTCAGATCAGGAAGATCGACAACGCGACGGCGAGGCAAGTAACGTTTTCAAAACGAAGAAGAGGTCTTTTCAAGAAAGCTGAAGAGCTCTCCGTTCTCTGCGACGCTGATGTTGCTCTTATTATCTTTTCTTCTATAGGAAAACTCTTTGAGTTTTGTAGCTCCAGCATGAAGGAAGTACTAGTGAGGCATAATTTGCAGTCGAAGAATTTTGAGAAGCTTGATCAGCCATCTCTTGAGTTGCAGCTAGTTGAGAACAGCGACCACGCCCTGTTGAGTAAAGAGATTGCGGAAAAAAGCCATCGATTAAGGCAAATGAGAGGAGAGGATCTTCAAGGCATTAACATAGAAGAATTGCAACAGCTGGAGAAGTCCCTTGAATCTGGTTTGACTCGTGTGATTGAAACAAGAAGTGAAAAGATTATGAATGAGATTAACGAACTTCAAAGAAAGGGAATGCAATTGATGGATGAGAACGAGCGACTGAAGCAGCAAGGAACACAGCTAATGGAAGAGAACGAGCGACTTGGCAAGCAGATATATAATAGCGTGCATGAAAGATATATTAGTGTTGATTCTGAGAACATTGTAGTTTTCGAGGAAGGACAATCCTCGGAGTCCATTACTAACGCTGGAAATTCCACCGGCGCTCCTGTTGACTCCGAGAGCTCCGATATCTCCCTTGAGCTCGGCTTACCGTATGGTGGTTAA。

[0047] AdSVP Amino acid sequence of the gene (SEQ ID NO.17): MAREKIQIRKIDNATARQVTFSKRRRGLFKKAEELSVLCDADVALIIFSSIGKLFEFCSSSMKEVLVRHNLQSKNFEKLDQPSLELQLVENSDHALLSKEIAEKSHRLRQMRGEDLQGINIEELQQLEKSLESGLTRVIETRSEKIMNEINELQRKGMQLMDENERLKQQGTQLMEENERLGKQIYNSVHERYISVDSENIVVFEEGQSSESITNAGNSTGAPVDSESSDISLELGLPYGG。

[0048] AdSVP Full-length cDNA sequence of the gene (SEQ ID NO.18): .

[0049] 2.2 AdSVP Functional verification of genes

[0050] 2.2.1 Construction of overexpression vector

[0051] The recombinant plasmid was transformed into Agrobacterium GV3101, and after plating culture, single colonies were selected for PCR electrophoresis detection. The resulting bands corresponded to the size of the target gene. Figure 2 ), sequencing results and AdSVP Sequence consistency ( Figure 3 This indicates that the target gene has been successfully transferred into Agrobacterium.

[0052] 1.2.2 Identification of positive Arabidopsis seedlings

[0053] Twelve healthy Arabidopsis thaliana T3 seedlings were selected for positive identification. DNA was extracted from the leaves of each Arabidopsis thaliana seedling, and the target gene was amplified by PCR. The results are as follows: Figure 4 As shown, AdSVP The gene amplification bands were all the same size as the plasmid bands, while no bands were observed in wild-type Arabidopsis thaliana, indicating that... AdSVP The gene has been successfully transferred into Arabidopsis thaliana.

[0054] 2.2.3 Phenotypic Statistics of Transgenic Plants

[0055] Phenotypic data were collected after flowering and pod maturation in Arabidopsis thaliana, and the results showed overexpression AdSVP Arabidopsis plants showed significantly greater rates of bolting onset, rosette leaf number, pod length, and plant height compared to wild-type plants, indicating that overexpression of [specific expression] was [positive / negative]. AdSVP Compared to the wild type, the Arabidopsis thaliana plants all exhibited varying degrees of late-flowering phenotype. Figure 5 After 38 days of growth, the transgenic Arabidopsis plants were just beginning to bolt and flower, while the wild-type Arabidopsis had already bolted and flowered. Table 3 shows the traits recorded at different growth stages of Arabidopsis. As shown in Table 3, the wild-type plants began to bolt and flower around 23 days, while the transgenic lines bolted and flowered between 38 and 40 days, indicating that... AdSVP Gene overexpression significantly inhibits plant flowering; at the same time, overexpression AdSVP It can also cause an increase in the number of rosette leaves, longer pods, and greater plant height in transgenic plants.

[0056] Table 3 AdSVP Phenotypic statistics of transgenic Arabidopsis thaliana

[0057] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A white AdSVP gene or a recombinant bacteria containing the white AdSVP gene or a recombinant bacteria containing the overexpression vector of the white AdSVP gene or the overexpression vector in promoting plant pod lengthening and / or plant height increase.

2. The application as described in claim 1, characterized in that, The Angelica dahurica AdSVP The CDS sequence of the gene is shown in SEQ ID NO.16, and the amino acid sequence is shown in SEQ ID NO.

17.

3. The application as described in claim 1, characterized in that, Contains the Angelica dahurica AdSVP The gene overexpression vector is the angelica root described above. AdSVP The gene was ligated into the vector plasmid pCambia2301-JC to obtain the overexpression vector pCambia2301-JC-AdSVP.

4. The application as described in claim 1, characterized in that, Contains the Angelica dahurica AdSVP The transformant bacteria of the recombinant bacteria of the gene or the overexpression vector was Agrobacterium GV3101.

5. The application as described in claim 1, characterized in that, The plant in question is either Arabidopsis thaliana or Angelica dahurica.