A method for constructing a microbial multi-target amplicon abundance standard substance and application thereof

Abstract

This invention discloses a method for constructing a multi-target amplicon abundance standard for microorganisms and its application, belonging to the fields of molecular biology detection and microbiome analysis. This standard material screens sequences of common human gut microbiota strains, designs and adds universal primers, and obtains 14 DNA fragments of different lengths through gene synthesis, cloning, and purification, which are then mixed according to a preset abundance. It retains natural characteristics such as primer binding sites and GC content, and can systematically correct technical deviations in amplicon sequencing, solving the problem of species abundance distortion. This standard material functions as both a non-homologous internal reference and a homologous external reference, and can be used for laboratory proficiency testing, reagent kit performance evaluation, and cross-platform data calibration, promoting the leap from relative qualitative to absolute quantitative research in microbiome studies and providing metrological support for the standardization and precision of detection results.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology detection and microbiome analysis technology, specifically relating to a method for constructing a microbial multitarget amplicon abundance standard and its application. Background Technology

[0002] Amplicon sequencing, as an important branch of targeted sequencing, has been widely applied in various fields such as medicine, animal husbandry, agriculture, environment, and bioenergy due to its advantages such as high throughput, low cost, short cycle, small amount of starting DNA required, and simple bioinformatics analysis. This technology uses specific primers to amplify hypervariable regions or specific functional genes such as 16S rDNA / 18S rDNA / ITS of microorganisms by PCR. Combined with high-throughput sequencing analysis of the sequence variation and abundance of the amplified products, it can then be used to analyze the diversity, composition, and distribution patterns of microbial communities (Schloss PD, Westcott SL, Ryabin T, et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities [J]. Appl EnvironMicrobiol. 2009,75(23):7537-7541.). Among them, 16S rRNA gene sequencing is the mainstream method for bacterial community analysis, while 18S rRNA gene and ITS region sequencing are suitable for the identification of eukaryotic microorganisms and fungi, respectively, providing effective means for microbial species identification and relative abundance assessment (Caporaso JG, Kuczynski J, Stombaugh J, et al. QIIME allows analysis of high-throughput community sequencing data [J].Nat Methods. 2010,7(5):335-336.).

[0003] However, current amplicon sequencing technology has significant limitations: First, sequencing results are affected by technical biases such as GC bias and primer bias, which can easily lead to distortion of species abundance and the problem of "inaccuracy"; Second, this technology can only provide relative abundance information of community members. Affected by the "zero-sum game" effect, it is difficult to distinguish between the real change in the absolute number of microorganisms and the structural shift in the relative proportion, which hinders the comparability of data across samples, time and platforms, and also restricts the absolute quantification ability of key microbial groups. This is especially critical in scenarios such as probiotic intervention effect evaluation and disease biomarker screening (Sanschagrin S, Yergeau E. Next-generation sequencing of 16S ribosomalRNA gene amplicons [J]. Journal of visualized experiments JoVE ,90 51709.2014;(90):51709.).

[0004] To address the aforementioned issues, microbial amplicon abundance reference materials have emerged. Their core value lies in constructing a reference system with clearly defined composition, known absolute abundance, and stability, used to calibrate experimental procedures and achieve the conversion of relative abundance to absolute quantification. For example, the National Institute of Metrology of China has developed and applied for the production and application of microbial live bacteria reference materials, including 3 national primary reference materials and 15 secondary reference materials, for traceability and quality control in fields such as food safety testing, biosafety evaluation, microbial pharmaceutical manufacturing, and instrument calibration (Sui Zhiwei, Wang Ziquan, Liu Siyuan, et al. Research progress and development trend of microbial metrology technology [J]. Metrology Science and Technology, 2021, 65(06):54-59+53.). In specific applications, microbial reference materials are used for the detection of Escherichia coli in water, screening of Staphylococcus aureus in dairy products, and detection of pesticide residues (such as dimethoate and enrofloxacin) and heavy metal pollution (such as cadmium and ochratoxin A) in fruits and vegetables, providing technical support for public safety. Ideal reference materials need to closely resemble real microbial communities in composition, morphology, and matrix to simulate the behavior of real samples during DNA extraction, PCR amplification, and other processes, systematically correcting for deviations throughout the entire process. However, currently, quantitative reference materials for microbial amplicon (multi-target, multi-abundance, and different GC content) are extremely scarce internationally. Existing reference materials are insufficient to meet the calibration needs in complex scenarios, and there is a lack of a complete technical system from sequence design and synthesis verification to multi-laboratory value determination and uncertainty assessment. This results in insufficient metrological traceability and reliability of microbiome measurement results, limiting the standardization and precision development of microbiome research.

[0005] Therefore, developing a microbial multi-target amplicon abundance standard material with broad coverage, accurate and reliable values, and multiple functions, establishing its standardized construction method, and expanding its application scenarios are of great practical significance and application value for solving the bottleneck of amplicon sequencing technology, promoting the leap from relative qualitative to absolute quantitative microbiome research, and achieving cross-platform comparability of detection results. Summary of the Invention

[0006] To address the problems of existing technologies, this invention provides a multi-target amplicon abundance standard for microorganisms. By screening sequences of common human gut microbiota strains, designing and adding universal primers, and through gene synthesis, cloning, and purification processes, 14 candidate DNA fragments of different lengths are obtained. These fragments are then mixed according to a preset abundance to prepare a multi-fragment DNA mixed standard, covering not only commonly studied regions but also their natural upstream and downstream regions. This ensures the preservation of primer binding sites, local GC content, secondary structures, and potential restriction enzyme sites. This standard can systematically evaluate and correct technical biases caused by GC bias and primer bias in amplicon sequencing, effectively solving the "inaccuracy" problem of species abundance distortion in microbiome research and promoting the transition from relative qualitative to absolute quantitative research. Furthermore, this material can serve as a third-party quality control tool, embedded in the entire process from sample processing to sequencing analysis, supporting laboratory proficiency testing, reagent kit performance evaluation, and cross-platform comparability verification of test results, providing metrological support for the standardization and precision of microbiome research.

[0007] On the one hand, the present invention provides a microbial multitarget amplicon abundance standard material, the standard material containing 14 DNA fragments from human gut microbes, the fragments containing 16S sequences, 18S sequences and ITS sequences, preferably, the fragments covering the full length of 16S, the 18S V4-V5 variable region and the ITS2 region.

[0008] Specifically, the abundance range of the standard substance is 0.01%-35%, and the GC content is less than 65%. Preferably, the abundance range of the standard substance is 0.03% to 28.0%, and the GC content is less than 60%.

[0009] Specifically, the 14 DNA fragments are derived from Bacillus, Enterococcus, Salmonella, Fusobacterium, Broutella, Klebsiella, Megamonas, Penicillium, Candida, Escherichia, Saccharomyces, Bifidobacterium, Cladosporium, and Aspergillus, respectively. Preferably, the nucleotide sequences of the 14 DNA fragments are shown in SEQ ID NO.1-SEQ ID NO.14.

[0010] On the other hand, the present invention provides a method for constructing the microbial multitarget amplicon abundance standard material, comprising the following steps: screening reference sequences and adding universal primers to synthesize target DNA fragments; constructing cloning vectors and screening positive clones; PCR amplification and product purification; mixing fragments according to preset abundance and aliquoting for storage.

[0011] Specifically, the universal primers include 27F, 1492R, 515F, 1119R, ITS1F, ITS3F and ITS4R, and some fragments use the specific primer Bif164-F / Pbi R2, whose nucleotide sequences are shown in SEQ ID NO.15-SEQ ID NO.23.

[0012] Specifically, the PCR amplification uses NEB Q5 high-fidelity enzyme, and the reaction system includes 5×Q5 reaction buffer, dNTPs, primers, template and enzyme. The annealing temperature is 50℃-65℃, preferably 55℃-60℃.

[0013] Specifically, droplet digital PCR was used for fixed-value remixing, followed by aliquoting and storage at -80±5℃, with each tube containing 25-40 μL. Preferably, the concentration standard value of the DNA fragment was (4.23±1.23)×10⁻⁶. 6 copies / mL~(3.80±1.51)×10 9 copies / mL, with each tube containing 32-35 μL.

[0014] On the other hand, the present invention provides the application of the aforementioned microbial multi-target amplicon abundance standard material in correcting amplicon sequencing technology bias or in calibrating environmental microbial detection instruments.

[0015] On the other hand, the present invention provides the application of the aforementioned microbial multitarget amplicon abundance standard material in absolute quantitative analysis of microbial communities or in deep-sea detection systems.

[0016] On the other hand, the present invention provides the application of the aforementioned microbial multitarget amplicon abundance standard material in laboratory proficiency testing, in sequencing kit performance evaluation, or in cross-platform sequencing data comparability verification.

[0017] Compared with existing technologies, this invention has the following advantages: 1. It covers bacterial 16S, fungal 18S, and ITS sequences, retains natural molecular characteristics, and can accurately correct technical deviations such as GC bias and primer bias, solving the problem of "inaccuracy"; 2. The abundance of 14 fragments spans 0.03%-28%, simulating real microbial communities and realizing the conversion from relative abundance to absolute quantification; 3. It is non-homologous to deep-sea and other environmental microorganisms, with strong specificity, and is suitable for multi-scenario detection platforms; 4. After joint determination by multiple laboratories, it has good uniformity and stability, and the values ​​are accurate and traceable; 5. It has internal reference, external reference, and calibration functions, supports laboratory proficiency testing and reagent kit evaluation, and improves the comparability of cross-platform data; 6. It constructs a standardized process, forming a complete system from sequence design to uncertainty assessment, promoting the standardized development of microbiome research. Attached Figure Description

[0018] Figure 1 This is a schematic diagram of 16S sequence universal primer synthesis and amplification.

[0019] Figure 2 This is a diagram of 16S universal primer addition sequence synthesis.

[0020] Figure 3 This is a schematic diagram of the 18S and ITS splicing sequence.

[0021] Figure 4 This is a flowchart of the preparation process for standard substance candidates.

[0022] Figure 5 This is a graph showing the plasmid identification results.

[0023] Figure 6 This is a graph showing the results of PCR product purification and identification.

[0024] Figure 7 This is a microarray electrophoresis result of the sample shown in SEQ ID NO.1.

[0025] Figure 8 This is a Sanger sequencing alignment result of the sample shown in SEQ ID NO.13.

[0026] Figure 9 These are droplet diagrams for ddPCR under different primer and probe concentration systems. F05-G05 represent primer and probe concentrations of 700nM-125nM, H05-A06 of 700nM-250nM, C06-D06 of 700nM-500nM, F06-G06 of 900nM-125nM, A07-B07 of 900nM-250nM, and D07-E07 of 900nM-500nM.

[0027] Figure 10These are the results of digital PCR amplification at different annealing temperatures. A01-F01 represent different channels, B01-C01 represent annealing temperatures of 55℃, and D01-F01 represent annealing temperatures of 65℃.

[0028] Figure 11 The results are cross-experimental tests of the sample shown in SEQ ID NO.1. A04\B04\C04\E04\F04 represent channels 1-5. Channel 1 is the blank control, channels 2 and 3 are the test samples, and channels 4 and 5 are the mixture of the remaining samples except for the test samples. Detailed Implementation

[0029] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as a result of the description. However, these embodiments are merely illustrative and do not constitute any limitation on the scope of protection defined by the claims of the present invention.

[0030] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that the upper and lower limits of the range and each intermediate value between them are specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, are also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0031] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0032] Example 1: Design of DNA Standard Materials

[0033] This embodiment, referencing the abundance proportions of real gut microbiota, aims to design a relatively complex amplicon sequence with a minimum abundance of 0.03% and a maximum abundance of 28% as a multi-target amplicon abundance standard for microorganisms. This standard simulates a near-realistic microbial community by designing the types and abundance proportions of microorganisms, enabling it to serve as a multifunctional standard established through methods such as non-homologous internal controls, homologous external controls, calibration of various sequencing and reading instruments, and kits. The 14 DNA sequences of different lengths selected for this standard (shown as SEQ ID NO.1-SEQ ID NO.14) are derived from human gut microbiota and maintain significant non-homologous characteristics with other environmental microorganisms (especially deep-sea ecosystems). This design ensures the standard's specific recognition and differentiation capabilities in complex environmental samples, making it a universal internal control standard widely applicable to various environmental monitoring platforms (such as deep-sea in situ sequencers and environmental metagenomic detection systems) for evaluating instrument detection stability, correcting technical deviations, and achieving cross-platform and cross-batch quantitative calibration.

[0034] 1. Reference sequence screening

[0035] Generally, amplicon sequences are the most frequently studied in microbial research. For bacteria, the main focus is on the 16S sequence, while for fungi, the focus is on some variable regions on the 18S and ITS sequences. By detecting these variable regions, the types of microorganisms can be quickly and accurately identified. Therefore, the selection of standard material sequences will cover these sequences. We designed the full-length 16S, 18S, and partial ITS sequences. For the original 16S sequence of the bacteria, we connected the commonly used universal primers 27F and 1492R, which can amplify the full length, to both ends of the 16S sequence. Sequence 12 was designed for non-universal primers. This sequence is a 16S sequence and has primers that are not universal with the 16S of other bacteria - the "specific primers" Bif164-f and Pbi R2. The selected 18S and ITS sequences contain the V4-V5 variable region of the 18S sequence, which can be amplified by universal primers 515F and 1119R. ITS3F and ITS4R can amplify the ITS2 region. We downloaded the relevant sequence information from NCBI and designed complementary sequences for those lacking relevant universal primers, so that the final sequence contains the aforementioned universal primers. At the same time, when the 18S and ITS of the same bacteria were found during sequence design, these two sequences were spliced ​​together to finally obtain the sequence information of the 18S+ITS sequence (shown as SEQ ID NO.9). (See Table 1 for details).

[0036] 2. Strains selection

[0037] Microorganisms were screened based on the principle of being common and not homologous to deep-sea organisms, with priority given to screening from the human gut microbiome database hGMB and NCBI. Gut microorganisms can be divided into two main categories: fungi and bacteria. In the study of fungi and bacteria, special sequences are often studied, namely 16S for bacteria and 18S and ITS for fungi. Therefore, our sequence selection also focused on these special gene sequences. The diversity of human fungal communities is relatively low. At the genus level, Candida and yeast are the main species (NASH AK, AUCHTUNG TA, WONG MC, et al. The gut mycobiome of the HumanMicrobiome Project healthy cohort [J]. Microbiome, 2017, 5(1): 153.). Bacteria are mainly Bifidobacterium. Therefore, in the sequence screening process, common phyla and genera with a large proportion in the gut microbiome were selected as strain sequences. The classification information of the strains can be obtained from hGMB, and the sequence information can be downloaded from NCBI.

[0038] 3. Selection of universal primers

[0039] Literature review revealed that commonly used universal primers for amplifying the full-length 16S sequence for bacteria are 27F (SEQ ID NO. 15: AGAGTTTGATCMTGGCTCAG) and 1492R (SEQ ID NO. 16: GGTTACCTTGTTACGACT). For 18S, 515F (SEQ ID NO. 17: GTGCCAGCMGCCGCGGTAA) and 1119R (SEQ ID NO. 18: GGTGCCCTTCCGTCA) can amplify the V4-V5 variable regions of the 18S sequence. Common ITS sequences are ITS1F (SEQ ID NO. 19: CTTGGTCATTTAGAGGAAGTAA), ITS3F (SEQ ID NO. 20: GCATCGATGAAGAACGCAGC), and ITS4R (SEQ ID NO. 21: TCCTCCGCTTATTGATATGC). We designed non-universal primers accounting for 10% of the bacterial universal primers, as shown in Table 1 (SEQ ID NO. 1). The universal primers (Bif164-F and Pbi R2) shown in NO.12 (Bifidobacterium) differ from those for other genera; they can only amplify bacteria of the Bifidobacterium genus. After the universal primers are determined, the sequence information of the selected strains is compared using SnapGene to see if complementary sequences exist between the universal primers. If the sequence downloaded from NCBI contains a complementary sequence to the universal primers, it is not processed. Figure 1 Sequence synthesis can be performed directly; if upstream primers or complementary sequences to downstream primers are lacking, bases of universal primer length, such as... Figure 2 This is done to obtain the final reconstructed sequence; if the same strain has both 18S and ITS sequences, and its universal primers are inside the sequence, then the 18S and ITS sequences are spliced ​​together, such as... Figure 3 As shown, the final reconstructed sequence is obtained by splicing the sequence information corresponding to the NCBI accession number, the universal primer sequence, and the 18S and ITS sequences under two NCBI accession numbers of the same strain in a special case (as shown in SEQ ID NO. 9). The reconstructed sequence information is shown in Table 1.

[0040] Table 1. Reconstructed Sequence Information Table

[0041]

[0042] Example 2: Preparation and Dispensing of Standard Reference Materials

[0043] The preparation of this reference material strictly follows the pre-designed sequence information. The core preparation strategy is as follows: First, high-precision DNA samples of the 14 sequences in Table 1 are obtained and verified through chemical synthesis and molecular cloning techniques. Then, the purified fragments are mixed according to the concentration of the synthesized samples and the set fractions (the final added volumes to each aliquot are 0.004 μL, 0.055 μL, 0.172 μL, 0.199 μL, 2.293 μL, 0.318 μL, 0.059 μL, 0.747 μL, 1.001 μL, 0.974 μL, 1.582 μL, 14.039 μL, 7.032 μL, and 3.576 μL, respectively) to prepare the final reference material.

[0044] 1. Preparation of standard substances

[0045] Fourteen sequences were synthesized using sequence fragment synthesis. Strains containing these sequences were constructed using vectors and then subjected to Sanger sequencing. Strains with correct sequencing results were streaked twice to form single clones, which were then preserved. Simultaneously, the single clones were enriched by shaking for plasmid extraction. The target fragments were then amplified using the plasmids as templates. The products were subjected to agarose gel electrophoresis (1.5%), and the target fragments were recovered by gel extraction and purified. Finally, the purified products were identified using Sanger sequencing. Fourteen DNA samples with accurate sequence information were obtained. The flowchart for the preparation of standard material candidates is shown below. Figure 4 As shown. The specific steps are as follows:

[0046] (1) Synthesis of gene fragments: Shenzhen BGI Genomics Co., Ltd. was commissioned to complete the chemical synthesis of all target DNA fragments based on the designed sequence information. The synthesis service covers the entire process from sequence design, oligonucleotide synthesis, splicing to complete fragments.

[0047] (2) Cloning and identification of the fragment: In order to obtain a template that can be stably amplified and has a precise sequence, the synthesized fragment was cloned and identified:

[0048] i) Cloning vector construction: Using homologous recombination technology, each target fragment was ligated into a cloning vector and transformed into competent E. coli cells; the ligation reaction system of the target fragment and the vector is shown in Table 2:

[0049] Table 2. Reaction System

[0050]

[0051] Transformation method: Take 1-3 μL of plasmid with a concentration of about 100 ng / μL and add it to about 100 μL of competent cells. Gently shake and rotate to mix. Place on ice for 3 minutes, then incubate in a 42°C water bath for 90 seconds without shaking. Finally, place in an ice bath for about 3 minutes.

[0052] ii) Screening for positive clones: The transformed bacterial culture was plated on LB agar plates containing the appropriate antibiotics. The plates were incubated at 37°C for 15 minutes, then inverted and incubated at 37°C for 12-16 hours until colonies appeared. Colonies were picked from the plates and shaken at 37°C and 250 rpm for 14 hours. Positive clones were screened by PCR. The PCR reaction used a 20 μL system: 2 μL bacterial culture, 0.5 μL polymerase buffer, 3 μL buffer, and 14 μL ddH2O. The cycling parameters were: 96°C pre-denaturation for 3 min; 95°C for 15 s, 58°C for 15 s, 72°C for 20 s, 23 cycles, and a final extension at 72°C for 1 min.

[0053] iii) Sequence Validation and Plasmid Preparation: Positive clones from the initial screening were validated using Sanger sequencing. Clones with 100% sequence identity were amplified and high-purity plasmids were extracted using a plasmid extraction kit. The extracted plasmids were identified by agarose gel electrophoresis (1%) (band size equals vector plus sequence). Some results are shown below. Figure 5 As shown. The correct strains, verified by sequencing, were purified by streak purification twice to form single clones, which were then prepared into a glycerol strain library and stored at -80℃ for long-term storage.

[0054] (3) Amplification and purification of the target fragment: High-purity and high-accuracy target DNA fragments were prepared using the verified plasmid as a template to provide high-quality raw materials for the subsequent construction of standard substances. The entire process underwent rigorous optimization and multiple quality controls to ensure that the 14 fragments obtained met the requirements of standard substances in terms of sequence accuracy and physicochemical properties.

[0055] i) PCR amplification system optimization and high-fidelity enzyme selection: In the PCR amplification stage, the focus was on screening and optimizing high-fidelity DNA polymerases. This study compared two commonly used high-fidelity enzymes: NEB Q5 High-Fidelity DNA Polymerase and BGI's self-produced high-fidelity PFU enzyme. Through systematic comparison, the most suitable amplification system for this project was determined.

[0056] High-fidelity enzyme comparison experiment design: The same plasmid template and primer combination were used. A uniform amplification program was employed: 98℃ pre-denaturation for 30 seconds; 35 cycles (98℃ 10 seconds, 60℃ 30 seconds, 72℃ 30 seconds); final extension at 72℃ for 5 minutes. A comprehensive evaluation of the amplified products' yield, accuracy, and fragment integrity was performed.

[0057] Technical parameter comparison and analysis: NEB Q5 High-Fidelity DNA Polymerase exhibits superior overall performance, with a fidelity approximately 200 times that of ordinary Taq enzymes and an error rate of 2.8 × 10⁻⁶. -7 In comparison, while PFU enzymes offered comparable fidelity, their amplification efficiency was slightly lower than that of Q5 enzymes. Sanger sequencing of the amplified products confirmed that the sequence amplified using Q5 enzymes was 100% identical to the reference sequence, with no base errors detected.

[0058] Final optimized reaction system: Based on the above comparison results, a 25 μL standard reaction system was selected, and its specific composition is shown in Table 3.

[0059] Table 3. Optimized reaction system

[0060]

[0061] The system was verified by three independent repeated experiments, showing good reproducibility.

[0062] ii) Product purification and identification: The PCR products were separated by agarose gel electrophoresis (1.5%). Target bands of the same size as the target fragment were excised and purified using an agarose gel DNA recovery kit. A small amount of the purified product was verified by agarose gel electrophoresis (1.5%). Some results are shown below. Figure 6 The fragment shown is the correct size and has good purity.

[0063] iii) Final quality control: The purified final DNA product is subjected to Sanger sequencing again to ensure that no mutations were introduced during the amplification and purification process.

[0064] Through the aforementioned rigorously optimized processes and quality control measures, 14 DNA samples with completely accurate sequences and meeting the required purity were successfully prepared. These samples met the stringent requirements for standard substances in terms of concentration, purity, and sequence accuracy.

[0065] (4) Determination of DNA fragment purity and sequence information

[0066] The 14 DNA sequences prepared above underwent systematic quality testing, which included two key parts: fragment purity analysis and Sanger sequencing verification. Multiple quality controls ensured that each DNA sample met the stringent requirements for the preparation of standard substances.

[0067] i) Purity detection of DNA fragments

[0068] Sample pretreatment: The 14 purified PCR products obtained in step (3) were diluted with TE buffer (10 mM Tris-HCl, 1 mM EDTA) at pH 8.0. Each sample was vortexed for 30 seconds, briefly centrifuged, and then a standardized DNA suspension of the corresponding volume was prepared for use.

[0069] Microarray detection workflow: Microarray preparation: Using an Agilent high-sensitivity DNA microarray, add 9 μL of gel-dye mixture to each well. Sample loading: Accurately transfer 1 μL from each standardized sample into the designated sample well. Instrument analysis: Microfluidic electrophoresis analysis is performed using an Agilent 2100 Bioanalyzer.

[0070] Quality Control Standards and Results: Purity Judgment: Qualified samples must exhibit a single main peak at the expected size in the electrophoresis pattern, without primer dimers (<100bp) or non-specific amplification products or other contaminating peaks; Integrity Confirmation: The size of the fragment corresponding to the main peak must be consistent with the designed sample length, with fluctuations controlled within ±5%. Results are as follows: Figure 7 As shown, the first and third peaks represent the measurement range, the middle peak represents the length of the target sequence, and a single peak indicates good purity of the substance.

[0071] The test results showed that all 14 samples met the above quality control standards, proving that each DNA sample had high purity and good integrity, and met the requirements for subsequent preparation of standard substances.

[0072] ii) Fragment DNA Sanger sequencing information detection: To ensure sequence accuracy to the greatest extent, this study adopted a multiple validation strategy: ① Tripartite validation: Each sample was sent to two authoritative sequencing institutions, Sangon Biotech and Riboxin, for independent validation and compared with the monoclonal plasmid sequencing results provided by BGI; ② Bidirectional sequencing: Each sample was sequenced in both forward and reverse directions to ensure full-length sequence coverage; ③ Repeated testing: Two independently prepared samples were provided by each institution for sequencing.

[0073] Sequence analysis quality control: ① Sequence alignment: Use BioEdit software to align the sequencing peaks with the reference sequence; ② Quality assessment: The sequencing peaks must be clear, with low background noise, and Q values ​​greater than 30; ③ Consistency standard: The sequencing results from the three institutions must be 100% consistent with the reference sequence, and the forward and reverse sequencing results must be completely consistent.

[0074] Fourteen samples (SEQ ID NO.1-SEQ ID NO.14) underwent purity testing and multiplexing verification using the aforementioned system. The Sanger sequencing alignment results for sample SEQ ID NO.13 are as follows: Figure 8 As shown, this ensures that the 14 sequences meet the stringent requirements of standard reference materials in terms of concentration, purity, and sequence accuracy, laying a solid foundation for the construction of high-quality standard reference materials.

[0075] 2. Dispensing and Storage

[0076] To ensure the excellent stability and consistency of the reference materials during storage and use, this application establishes a standardized dispensing process and strict storage conditions. All operations are performed in a clean environment that meets the requirements of molecular biology experiments, minimizing exogenous contamination and nucleic acid degradation.

[0077] (1) Pre-packaging and concentration standardization

[0078] Initial concentration determination

[0079] Absolute quantification of 14 DNA candidates was performed using droplet digital PCR technology, and their copy number concentrations were accurately determined as shown in Table 4; three technical replicates were set for each sample. Dilution calculation and preparation: Based on the ddPCR results, the required dilution volume for each sample was determined using a standard calculation formula: the target was set at 1050 ng to meet the sample introduction requirements of current sequencing platforms.

[0080] Table 4. Preliminary Values ​​for Copy Number Concentration

[0081]

[0082] (2) Preservation and packaging

[0083] TE buffer (10 mM Tris-HCl, 1 mM EDTA) at pH 8.0 was used as the standard dilution and storage medium. All dispensing operations were performed in a biosafety cabinet to ensure a sterile environment. The specific procedure is as follows:

[0084] i) Sample pretreatment: Place the DNA stock solution stored at -80℃ on ice to thaw slowly; after it is completely thawed, use a vortex mixer to shake at 3000 rpm for 10 seconds to ensure that the solution is homogeneous; collect the droplets on the tube wall by short-term centrifugation.

[0085] ii) Dilution and mixing: Using a metered pipette, accurately transfer the calculated volume of DNA sample and TE preservation solution into a sterile container and mix. Place the mixture in a shaker at 4°C and shake at 150 rpm for 60 minutes to ensure thorough mixing.

[0086] iii) Aliquoting: Using a pipette, accurately aliquot the well-mixed DNA solution into pre-chilled 0.5 mL sterile cryovials. Aliquot volume per tube: 32 μL.

[0087] iv) Storage and management: Number the dispensed standard substances by batch and seal 100 tubes in a dedicated cryopreservation box; immediately transfer them to an ultra-low temperature freezer at -80℃ for storage, with temperature fluctuations controlled within ±5℃.

[0088] The standardized dispensing and storage process described above ensures that this reference material maintains good stability and metrological consistency during storage, laying a solid foundation for subsequent homogeneity testing, stability monitoring, and metrological evaluation.

[0089] Table 5. Specific Volume Required for Each Sequence

[0090]

[0091] 3. Preliminary concentration determination of standard substances

[0092] To confirm the quality of the dispensing process and ensure good consistency among the dispensing units, this study conducted a preliminary homogeneity assessment of the dispensed standard substances.

[0093] (1) Experimental procedure: Eleven tubes of samples from the same batch were used, and the concentration was determined using a high-sensitivity fluorescence quantitative method. Qubit... TM 4.0 fluorometer and Qubit TM Absolute quantification was performed using the dsDNA HS Assay Kit. The kit's operating procedure was strictly followed: 199 μL of working solution was mixed with 1 μL of standard sample, incubated at room temperature in the dark for 2 minutes, and then analyzed. Two technical replicates were performed for each sample, and the average value was taken as the concentration measured in that tube.

[0094] (2) Results and Analysis: The concentration of the 11 standard reference tubes was 33.39 ng / μL, with an RSD of 4.0%. This initially indicates that the concentration variation between each dispensing unit is minimal. The excellent concentration consistency between each dispensing unit preliminarily proves the stability of the dispensing process and the uniformity of the dispensing results of this standard reference.

[0095] Table 6. Qubit detection results of standard substances

[0096]

[0097] Example 3: Establishment and Optimization of the Fixed Value Method

[0098] To ensure accurate and reliable absolute quantification of 14 sequences, this study established a complete quantification methodology based on droplet digital PCR (ddPCR) technology. This system covers the entire process from primer and probe design and reaction condition optimization to specificity verification. Through systematic methodological comparison and condition optimization, optimal quantitative analysis results were obtained for each gene sequence. The entire study adopted a phased and progressive optimization strategy: first, primer and probe design at the bioinformatics level was completed; then, the experimental methods were established and optimized; and finally, the reliability of the methods was confirmed through rigorous validation experiments.

[0099] 1. Primer design

[0100] We obtained 14 synthesized gene sequences from the company and used NCBI, Premier 3 plus, and DNAMAN software to design primers and probes. We designed the corresponding primers and probes in accordance with the principles of primer design and probe design.

[0101] Primer design strictly follows these principles: primer length 18-24bp, with 20bp being the optimal choice; Tm value 58-60℃, with the difference in Tm value between upstream and downstream primers not exceeding 2℃; GC content 30-80%.

[0102] The probe design principles include: length 13-25bp; GC content 30-80%; and the use of specific primer pairs in Table 7 to amplify the corresponding target sequences in the mixed samples separately.

[0103] Table 7. Specific Primer Table

[0104]

[0105]

[0106] 2. Establishment and optimization of digital PCR determination method

[0107] (1) Optimization of amplification conditions

[0108] Primer concentration optimization: Three primer concentration gradients were set: 700 and 900 nmol / L, and probe concentrations: 125 nmol / L, 250 nmol / L, and 500 nmol / L. Primer concentrations were screened based on the distinctness of the distinction between positive and negative droplet clusters in the digital PCR one-dimensional plot. Taking the sample sequence shown in SEQ ID NO.5 as an example, the results of analyzing the digital PCR scatter plot are as follows... Figure 9 As shown, the horizontal axis, Event Number (number of events / droplet number), represents the cumulative number of the total number of droplets detected. The vertical axis, Ch1 Amplitude (fluorescence amplitude / fluorescence intensity), represents the relative fluorescence signal intensity detected in each droplet, reflecting the amplification of the target DNA / RNA in that droplet. The higher the value, the more target molecules are contained in the droplet or the higher the amplification efficiency. When the primer-probe combination concentration is 700-500 nmol / L, the separation of positive and negative droplet clusters is the clearest and the signal-to-noise ratio is the highest. Therefore, this is determined to be the optimal primer-probe concentration.

[0109] (2) Annealing temperature optimization: Digital PCR experiments were conducted at annealing temperatures of 55℃ and 60℃. The separation degree of positive and negative droplet clusters was compared to select the optimal annealing temperature. For example, the fragment amplification efficiency was highest and the droplet cluster separation effect was best at annealing at 55.0℃; therefore, 55.0℃ was chosen as the annealing temperature. Experimental results are as follows: Figure 10 As shown in Table 8, the optimal PCR reaction conditions for 14 sequences were obtained through optimization of primer and probe concentrations and annealing temperatures.

[0110] Table 8. Summary of Primer Concentration-Probe Concentration-Annealing Temperature

[0111] (3) Primer and probe homogenization

[0112] Due to the varying primer and probe concentrations, the primers and probes were homogenized to facilitate subsequent detection. The synthesized primer and probe powders were uniformly dissolved in ddH2O to a concentration of 10 nM. For primers with a concentration of 700 nM, 7 volumes of 10 nM primer were added to 2 volumes of ddH2O for a 7 / 9 dilution. No dilution was required for 900 nM primers. For probes with a concentration of 125 nM, a 10 nM solution was diluted 0.25 times. For probes with a concentration of 250 nM, a 10 nM solution was diluted 0.5 times. No dilution was required for 500 nM probes. The primers and probes for each sequence were mixed at a ratio of 1.8 μL each of upstream and downstream primers and 1 μL of probe, vortexed for 30 seconds, and then briefly separated.

[0113] Therefore, the ddPCR reaction system for the microbial multitarget amplicon abundance standard material was determined as follows: 10 μL of 2×ddPCRProbes Supermix, 1.8 μL each of forward and reverse primers, 1 μL of probe, 4 μL of DNA template, and ddH2O added to bring the volume to 20 μL. The ddPCR reaction system and PCR procedure for the microbial multitarget amplicon abundance standard material are shown in the table below:

[0114] Table 9. ddPCR reaction system

[0115]

[0116] Table 10. PCR Reaction Procedure

[0117]

[0118] 3. Methods and Specificity Validation

[0119] To verify the specificity of the established probe-based detection method and the amplification system, a crossover experiment was designed among 14 samples, and a blank control was set up.

[0120] First, a certain volume of each individual sample is aspirated. Then, the remaining 13 samples (excluding the individual sample) are mixed together and simultaneously detected using the designed primers. Each sample is tested twice. The specificity of the established ddPCR method means that each specific primer can only amplify the target sequence and cannot non-specifically amplify other sequences. Figure 11 As shown, when using the primers of SEQ ID NO.1, only the PCR reaction result of the template shown in SEQ ID NO.1 was positive, while the PCR reaction results of the templates shown in SEQ ID NO.2-SEQ ID NO.14 were all negative. This indicates that the established ddPCR detection method for gene sequence 1 is highly targeted and has good specificity for detecting this DNA template.

[0121] The same crossover experimental method was used to detect 14 gene sequences, and the ddPCR detection results were the same as described above, showing good specificity. The specific results are shown in the figure below. The results indicate that this ddPCR detection method can be used for subsequent detection of standard substances and determination of characteristic values.

[0122] 4. Establishment of the constant value method

[0123] (1) Fourteen sets of highly specific primers were obtained through bioinformatics pre-design and rigorous validation.

[0124] (2) Through system optimization, the optimal reaction conditions for primer and probe concentration and annealing temperature for each sequence were determined. Finally, the method for determining the values ​​of 14 sequences was established.

[0125] Example 4: Uniformity Assessment

[0126] Homogeneity assessment principles and statistical methods: The properties of a standard substance should be homogeneous, meaning that its properties remain unchanged within a specified subdivision range. Following the technical requirements for homogeneity assessment of standard substances in the national metrological technical specification JJF 1343-2022 "Assessment of Standard Substance Values ​​and Homogeneity and Stability," a certain number of the smallest packaging units are randomly selected (sampling can be done using the method shown in the random number table). High-precision testing methods are used to measure each sample under the same controlled experimental conditions, thus ensuring that the differences between samples are fully reflected by the sample inhomogeneity.

[0127] The homogeneity of the standard materials was detected using digital PCR. Eleven tubes of microbial multi-target amplicon abundance standard materials were randomly selected and tripled for each tube using a Bio-Rad digital PCR instrument. The eleven tubes were thawed until free of ice crystals, equilibrated to room temperature, vortexed for 30 seconds, and then briefly centrifuged. Each tube was diluted by weight on a balance to bring the sample stock solution to the detection range (10^2-10^3) ​​suitable for the Bio-Rad instrument. The primer, probe, and mix droplet digital PCR system was prepared according to the instructions of each digital PCR instrument. The prepared PCR premix was vortexed and centrifuged. Then, the sample was mixed with the PCR reaction solution. The PCR amplification conditions were set according to the instructions of each instrument, with the annealing temperature set to the optimized temperature. The corresponding readout channels (FAM and HEX) for the probes were selected. After naming the experiment, the droplet generation and readout were performed. Analysis of variance (F-test) was used for statistical analysis of the data. Analysis of variance (ANOVA) is used to determine whether there are systematic differences between the measured values ​​of each group by comparing the between-group variance and the within-group variance. If the ratio of the two is less than the critical value of the statistical test, the sample is considered to be homogeneous.

[0128] 1. Uniformity assessment scheme

[0129] Based on the number of units dispensed, a certain number of units were randomly selected from the initial, middle, and final stages of the standard substance dispensing process for homogeneity analysis. The microbial multi-target amplicon abundance standard substance was dispensed into 200 tubes each, and 11 tubes were randomly selected for homogeneity assessment, labeled as 1-11.

[0130] 2. Measurement Method

[0131] Each sample was measured under the same controlled experimental conditions, so that the differences between the samples were fully reflected by the inhomogeneity of the samples.

[0132] Since this standard is composed of a mixture of DNA fragments prepared using the same research and development process, according to the national metrological technical specification "JJF1343-2022", for standard substances with multiple properties, the homogeneity of all properties can be assessed by selecting a smaller number of properties when the following conditions are met: Therefore, the characteristic values ​​of 14 fragments (the fixed values ​​for each tube, the number of randomly selected tubes determined based on the total amount dispensed, and the number of randomly selected tubes repeated three times per tube, for a total of 33 data points measured by digital PCR) were selected for homogeneity verification. This study used the droplet digital PCR method to assess the homogeneity of the standard substance.

[0133] 3. Test Results and Statistical Analysis

[0134] Eleven aliquoted samples were selected, and the values ​​of 14 fragments were measured. The data are shown in Table 11, categorized according to significance level. The value is 0.05, the between-group degrees of freedom and the within-group degrees of freedom are (10, 22), and the critical value F is obtained from the table. 0.05(10,22) =2.30, then calculate the F value and compare it with it. If F <F 0.05(11,22) This indicates no significant differences within or between groups, suggesting that the standard material sample is homogeneous. The results show that the values ​​of all 14 fragments satisfy F... <F 0.05 (v1,v2) indicates that the differences between and within groups meet the actual usage requirements. Uncertainty arising from non-uniformity is taken into account in the uncertainty assessment section.

[0135] Table 11. Homogeneity results of the sample shown in SEQ ID NO.1 in the standard reference.

[0136]

[0137] Example 5, Stability Assessment

[0138] The short-term and long-term stability of the reference material was evaluated according to the stability evaluation method in JJF 1343-2022 "Assessment of Standard Reference Material Values, Homogeneity, and Stability". The stability evaluation was carried out by measuring the characteristic values ​​of the reference material at different times, and plotting the relationship between the characteristic values ​​and time with time as the X-axis and the characteristic values ​​as the Y-axis.

[0139] Calculate using the following formula Statistical value:

[0140]

[0141] Compare it with a 95% confidence probability and a degree of freedom of Twin-tailed student Comparison of distribution critical values, if If it is greater than this critical value, it indicates the slope A significant difference from 0 indicates an observed trend of instability. If If the value is less than this critical value, no instability is observed.

[0142] Uncertainty introduced by stability

[0143] 1. Short-term stability analysis

[0144] Microbial multitarget amplicon abundance standards are typically transported under dry ice or ice pack conditions. To assess the stability of the standards during transport, five genes were selected, and a temperature of 4°C was set. Short-term stability tests were conducted at day 0, day 3, day 5, and day 7. The copy number concentration of the standards was detected using digital PCR, with two replicate measurements per tube.

[0145] Linear fitting analysis was performed on the copy number concentration monitoring data of microbial multitarget amplicon abundance standard substances under different storage conditions. As shown in the table below, the amount of standard substances under 4℃ conditions did not show a significant upward or downward trend over time.

[0146] Table 12 shows the short-term stability test results of SEQ ID NO.6 and SEQ ID NO.7 at 4℃.

[0147]

[0148] 2. Long-term stability analysis

[0149] Microbial multitarget amplicon abundance standard reference was stored at -80℃. Sampling was conducted at 0, 1, 2, 4, 6, and 12 months. The copy number concentration of the standard reference samples at each time point was determined using digital PCR. Linear fitting analysis was performed on the long-term stability measurement data according to ISO Guide 35 and JJF 1343-2022, "Assignment of Standard Reference Materials and Evaluation of Homogeneity and Stability".

[0150] The stability of the microbial multitarget amplicon abundance standard material has been monitored over one year, and its long-term stability will be continuously monitored. The digital PCR results for the stability of 14 genes in the microbial multitarget amplicon abundance standard material are shown in the table below:

[0151] Table 13. Long-term stability test results of samples shown in SEQ ID NO.1 and SEQ ID NO.2 at -80℃.

[0152]

[0153] Based on the long-term stability results in the table above, under storage conditions of -80℃, the values ​​of the microbial multi-target amplicon abundance standard material remain within one year. The slope is not significant. Therefore, no instability was observed.

[0154] Example 6: Standard Reference Material Determination

[0155] 1. Screening and verification by joint value-setting laboratories

[0156] A multi-laboratory joint assay was used to determine the values ​​of 14 genes. The main principles for selecting laboratories were: first, whether they had the relevant measurement capabilities; second, whether they were representative of the industry or field; and third, consideration of different digital PCR platforms. We selected the following 8 laboratories and 4 models of testing instruments from several fields, including agriculture, third-party testing centers, testing companies, and metrology institutions, as shown in Table 14.

[0157] Table 14. Joint Value Setting Laboratory Numbers and Instrument Models

[0158]

[0159] The organizing unit, the National Institute of Metrology (NIM), distributed blind samples (human (male) genomic DNA quantification standard, GBW09856) to the nine participating institutions. Upon receiving the blind samples, the participating institutions conducted quantification experiments according to the organizing unit's quantification scheme and submitted their measurement results. The organizing unit compiled the measurement results and compared them with the blind sample results. The results of this blind sample test showed that the measurement results of all nine participating laboratories did not exceed the quantification range of the certified reference material and had acceptable repeatability. These laboratories possess basic and reliable detection capabilities in DNA quantification, meeting the initial requirements for participating in this multi-gene joint quantification study.

[0160] 2. Standard reference value determination scheme

[0161] The digital PCR reaction system established using primers designed for 14 sequences exhibits good specificity and can be used for standard material determination studies. Based on the preliminary determination results of the stock solution (as shown in Table 4), the 14 sample sequences were determined using digital PCR to configure the mixed standard material. Three tubes of standard material were randomly selected and diluted 100-fold, 10-fold, 100-fold, and 10-fold using a balance, resulting in a 10^3-fold dilution for sample SEQ ID NO.1 and a 10^6-fold dilution for SEQ ID NO.2-SEQ ID NO.14. The 14 gene sequences in the diluted standard material were measured twice. The Dixon criterion was used to check for any suspicious values. The mean and standard deviation of the measured data were examined for statistical significance. If no statistical significance was found, the overall mean and standard deviation were calculated. Specifically, the microbial multi-target amplicon abundance standard material was aliquoted into Sample 1, Sample 2, and Sample 3. Two replicates were performed per tube using each digital PCR instrument, providing a total of 28 data points from the 14 sequences. Samples 1, 2, and 3 were aliquoted and thawed until free of ice crystals. After equilibration to room temperature, they were vortexed for 30 seconds and then briefly centrifuged. Gravimetric dilution was performed on a balance to bring the sample stock solution to the detection range of each digital PCR instrument. The primer, probe, and mix were prepared according to the instructions of each digital PCR instrument to create the droplet digital PCR system. The prepared PCR premix was vortexed and centrifuged. Then, the samples were mixed with the PCR reaction solution. Following the instructions of each instrument, the PCR amplification conditions were set, including the optimized annealing temperature. The corresponding readout channel (FAM and HEX) for the probe was selected. After naming the experiment, the experiment was initiated to generate and read droplets.

[0162] 3. Standard reference value determination

[0163] In accordance with the requirements of JJF 1343-2022 "Assessment and Evaluation of Homogeneity and Stability of Standard Reference Materials", digital PCR was used to assess the values ​​of the standard reference materials. Nine laboratories participated in the collaborative assessment. Each laboratory independently measured three sample units under repeatability conditions, with each sample unit measured twice, resulting in a total of nine sets (six values ​​per set) of raw measurements.

[0164] During the data statistical processing stage, the following steps are performed:

[0165] Cochrane Test: First, the Cochrane test was used to test the homogeneity of variances for the nine groups of data. The test showed that the variances of each group were within the significance range. There was no significant difference at C=0.05 (C max <C 临界 This indicates that the measurement precision of the nine laboratories is consistent, and the data can be further merged for analysis.

[0166] Grubbs' test: After confirming consistent precision within the group, the results of each laboratory unit were calculated, yielding 54 independent data points. The Grubbs' test was used to test for outliers in this group. The test rule is as follows: If a measured value x... i There are residuals ,when At that time, It should be removed. It depends on the number of measurements and the given significance level. The relevant values. No outliers were found, and the means from all laboratories have been retained.

[0167] Shapiro-Wilk test: The Shapiro-Wilk method was used to test the normality of the nine laboratory data points retained after the above test. The test results show that the data follow a normal distribution.

[0168] Based on the above systematic verification, all data involved in the value determination were of reliable quality and met the requirements of parameter statistics, as shown in Table 15. Therefore, the arithmetic mean of the results from the nine laboratories was used as the standard value of this reference material.

[0169] Table 15 shows the value results for the sample shown in SEQ ID NO.1.

[0170]

[0171] Example 7: Uncertainty Assessment

[0172] The uncertainty in the copy number concentration determination of this standard reference mainly comes from the following three aspects: uncertainty introduced by the determination process (uchar): including the repeatability of the measurement method (Type A assessment) and systematic errors such as balance weighing and droplet volume (Type B assessment). Through assessments of the uncertainty introduced by method repeatability, balance, droplet volume deviation, homogeneity, stability, combined standard uncertainty, expanded uncertainty, and reference sequence abundance uncertainty, Table 16 (uncertainty components of the microbial multitarget amplicon abundance standard reference) and Table 17 (calculation table of reference sequence abundance uncertainty) are obtained.

[0173] Table 16. Uncertainty Components of Microbial Multitarget Amplicon Abundance Standard Material

[0174]

[0175] Taking a coverage factor k equal to 2, at a 95% confidence level, according to the formula... The expanded uncertainty (U) of the standard material can be obtained, and the specific results are shown in the table below. Analysis shows that the relative expanded uncertainty corresponding to the gene copy number concentration characteristic value of the microbial multitarget amplicon abundance standard material is % (k=2), where Ci represents the standard value of the i-th sequence, and Ui is the standard uncertainty of the i-th sequence.

[0176] Table 17. Calculation of Abundance Uncertainty of Reference Sequence

[0177]

[0178] Example 8, Results Analysis

[0179] The prepared microbial multitarget amplicon abundance standard material was characterized and analyzed using digital PCR. The standard values ​​of the copy number concentration of each gene in the microbial multitarget amplicon abundance standard material and the expanded uncertainty are shown in Tables 18 and 19.

[0180] Table 18. Standard values ​​and reference sequence information for each sequence of microbial multitarget amplicon abundance standard materials

[0181]

[0182] Table 19. Relative abundance and expansion uncertainty among target sequences in microbial multitarget amplicon abundance standard materials

[0183]

[0184] Based on the principle of digital PCR: the target gene is encapsulated in tens of thousands of nanoliter-sized droplets, and the signal is amplified by PCR amplification. By counting the droplets with fluorescent signals, the absolute quantification of the initial target gene copy number is achieved through Poisson distribution. Therefore, this method can trace back to the natural unit 1 through molecular counting. This traceability approach has been approved by the Nucleic Acid Analysis Working Group (NAWG) of the International Committee on the Quality of Materials (CCQM). Furthermore, the balances used for sample dilution during the determination process have undergone metrological verification, further ensuring the traceability of the measurement results.

[0185] This application successfully developed a microbial multi-target amplicon abundance standard material containing 14 sequences. The nucleotide sequences of each sequence are shown in SEQ ID NO.1-SEQ ID NO.14, with the abundance increasing sequentially. The GC content of each sequence is less than 60%, and the lowest concentration standard value is (4.23±1.23)×10. 6 The highest number of copies / mL was (3.80±1.51)×10. 9copies / mL (k=2). The relative uncertainty of synthesis for each sequence ranged from 8.87% to 19.26%; the abundance ranged from 0.03% to 28.0%, with corresponding uncertainties of 0.005% to 2.7% (k=2). Sequence information for all sequences was confirmed and is provided as nominal characteristics.

[0186] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A microbial multi-target amplicon abundance standard, characterized in that, The standard material contains 14 DNA fragments derived from human gut microbiota, the fragments including 16S, 18S, and ITS sequences.

2. The microbial multi-target amplicon abundance standard material according to claim 1, characterized in that, The abundance range of the standard substance is 0.01%-35%, and the GC content is less than 65%. Preferably, the abundance range of the standard substance is 0.03% to 28.0%, and the GC content is less than 60%.

3. The microbial multi-target amplicon abundance standard material according to claim 1, characterized in that, The 14 DNA fragments are derived from Bacillus, Enterococcus, Salmonella, Fusobacterium, Broutella, Klebsiella, Megamonas, Penicillium, Candida, Escherichia, Saccharomyces, Bifidobacterium, Cladosporium, and Aspergillus, respectively. Preferably, the nucleotide sequences of the 14 DNA fragments are shown in SEQ ID NO.1-SEQ ID NO.

14.

4. A method for constructing a microbial multi-target amplicon abundance standard as described in any one of claims 1-3, characterized in that, The process includes the following steps: screening reference sequences and adding universal primers to synthesize target DNA fragments; constructing cloning vectors and screening positive clones; PCR amplification and product purification; mixing fragments at preset abundance levels and aliquoting for storage.

5. The construction method according to claim 4, characterized in that, The universal primers include 27F, 1492R, 515F, 1119R, ITS1F, ITS3F and ITS4R, and some fragments use the specific primer Bif164-F / Pbi R2, whose nucleotide sequences are shown in SEQ ID NO.15-SEQ ID NO.

23.

6. The construction method according to claim 5, characterized in that, The PCR amplification uses a high-fidelity enzyme, and the reaction system contains 5× high-fidelity enzyme reaction buffer, dNTPs, primers, template and enzyme. The annealing temperature is 50℃-65℃, preferably 55℃-60℃.

7. The construction method according to claim 4, characterized in that, Microdroplet digital PCR was used for fixed-value remixing, followed by aliquoting and storage at -80±5℃, with each tube containing 25-40 μL. Preferably, the concentration standard value of the DNA fragment is (4.23±1.23)×10⁻⁶. 6 copies / mL~(3.80±1.51)×10 9 copies / mL, with each tube containing 32-35 μL.

8. The application of the microbial multi-target amplicon abundance standard material according to any one of claims 1-3 in correcting amplicon sequencing technology bias or in calibrating environmental microbial detection instruments.

9. The application of the microbial multitarget amplicon abundance standard material according to any one of claims 1-3 in the absolute quantitative analysis of microbial communities or in a deep-sea detection system.

10. The application of the microbial multitarget amplicon abundance standard material according to any one of claims 1-3 in laboratory proficiency testing, in performance evaluation of sequencing kits, or in cross-platform sequencing data comparability verification.

Images