Circular RNA expressing collagen type III polypeptide and application thereof

By designing circular recombinant RNA with a specific structure, the shortcomings of traditional collagen supplementation methods have been addressed, achieving efficient expression and stability of type III collagen peptides, significantly improving skin aging, and promoting tissue repair.

CN122357564APending Publication Date: 2026-07-10DALIAN LINLIN BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
DALIAN LINLIN BIOTECHNOLOGY CO LTD
Filing Date
2026-06-06
Publication Date
2026-07-10

AI Technical Summary

Technical Problem

Traditional collagen supplementation methods suffer from low absorption and utilization rates, high purification costs, and short duration of effects. Furthermore, the translation efficiency and large-scale preparation process of circular RNA (circRNA) require further optimization, making it difficult to effectively apply to skin aging repair.

Method used

A circular recombinant RNA was designed, whose nucleotide chain consists of a promoter, a 5' homologous arm, a 3' intron, an IRES sequence, a target protein coding sequence, a 5' intron, and a 3' homologous arm connected in sequence. The circular RNA expressing type III collagen polypeptide was prepared by in vitro transcription, and type III collagen polypeptide was generated autologously using amino acids and enzymes in the cell.

Benefits of technology

It achieves efficient expression and stability of type III collagen peptides, significantly improves UV-induced skin aging, promotes tissue repair, and exhibits low immunogenicity and good biocompatibility.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122357564A_ABST
    Figure CN122357564A_ABST
Patent Text Reader

Abstract

The application discloses a kind of circular RNA of expressing collagen type III polypeptide and application thereof, belong to collagen preparation technical field.The application provides a kind of circular recombinant RNA by no-scar design, element screening, with high translation efficiency, good cyclization effect, strong expression stability, more durable, more close to nature, nucleotide chain is sequentially connected by promoter, 5'homologous arm, 3'intron, IRES sequence, target protein coding sequence, 5'intron, 3'homologous arm, nucleotide sequence is as shown in SEQ ID NO.8;Circular recombinant RNA can successfully express collagen type III peptide in ex vivo human fibroblast, mouse fibroblast and mouse in vivo, to a certain extent, reverse ultraviolet light-induced photoaging process, improve skin photoaging damage and promote tissue repair, with high cell uptake rate, strong expression stability, good persistence;Low immunogenicity, good biocompatibility and in vitro safety.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of collagen preparation technology, and in particular to a circular RNA expressing type III collagen polypeptide and its applications. Background Technology

[0002] The skin is the largest organ in the human body, serving not only as the first line of defense against external stimuli but also as a complex organ involved in immunity, perception, and metabolism. Skin aging is a complex process influenced by multiple factors, and its manifestations are not merely changes in a single dimension but involve overall alterations across all layers of the skin and facial contours. As collagen and elastin fibers in the dermis gradually degrade and become disorganized, the skin's appearance evolves from fine, shallow dynamic expression lines to deep wrinkles clearly visible even at rest. Simultaneously, weakened elasticity leads to sagging, drooping skin, and enlarged pores. Furthermore, the continued loss of collagen and elastin fibers, coupled with selective atrophy of subcutaneous fat, causes the skin to lose support, resulting in structural changes such as sunken eye sockets, temporal hollowing, and deepening nasolabial folds. Beyond these external changes, functional decline is a more intrinsic manifestation. The skin's self-repair and defense capabilities weaken, making it prone to dryness and sensitivity, and increasing the risk of infection and tumors.

[0003] Type III collagen is a crucial component for maintaining skin suppleness, elasticity, and extracellular matrix homeostasis. However, traditional collagen supplementation methods suffer from limitations such as low absorption and utilization rates, high purification costs, and short duration of effect. Compared to traditional pharmaceuticals and genetic engineering technologies, mRNA technology offers significant advantages: it does not require entry into the cell nucleus, carries no risk of genome integration, and possesses high biocompatibility. Furthermore, it can be rapidly prepared through in vitro transcription, allowing for flexible design, short production cycles, and scalable production, making it widely applicable in vaccine development, protein replacement therapy, tumor immunotherapy, and gene editing. Circular RNA (circRNA), with its covalently closed circular structure, high stability, long expression duration, and low immunogenicity, holds promise as a next-generation protein replacement therapy platform. However, its translation efficiency and scalable preparation processes still require further optimization. Summary of the Invention

[0004] The purpose of this invention is to provide a circular RNA expressing type III collagen polypeptide and its application, so as to provide a circular recombinant RNA with high expression efficiency, strong expression stability, good expression persistence and low immunogenicity of type III collagen, and to provide excellent raw materials for the preparation of skin damage / aging repair agents with better effects.

[0005] To achieve the above objectives, the present invention provides a circular RNA expressing type III collagen polypeptide, wherein the nucleotide chain of the circular recombinant RNA is composed of a promoter, a 5' homologous arm, a 3' intron, an IRES sequence, a target protein coding sequence, a 5' intron, and a 3' homologous arm connected in sequence.

[0006] Preferably, the nucleotide sequence of the promoter is shown in SEQ ID NO.1; the nucleotide sequence of the 5' homologous arm is shown in SEQ ID NO.2; the nucleotide sequence of the 3' intron is shown in SEQ ID NO.3; the nucleotide sequence of the IRES sequence is shown in SEQ ID NO.4; the nucleotide sequence of the target protein coding sequence is shown in SEQ ID NO.5; the nucleotide sequence of the 5' intron is shown in SEQ ID NO.6; and the nucleotide sequence of the 3' homologous arm is shown in SEQ ID NO.7.

[0007] Preferably, the nucleotide sequence of the circular recombinant RNA is shown in SEQ ID NO.8.

[0008] Preferably, after the template DNA of the target RNA is transcribed in vitro, GTP and enzyme-free water are added and incubated to obtain circular recombinant RNA; the incubation is carried out at 50-60℃ for 10-20 min.

[0009] A formulation for inducing the production of type III collagen peptides, wherein the active ingredient of the formulation is the circular RNA expressing the type III collagen peptides.

[0010] Preferably, when the preparation is injected into cells, it can utilize the amino acids and enzymes in the cells to continuously generate type III collagen polypeptides.

[0011] Application of recombinant vectors containing the above nucleotide sequences in the preparation of type III collagen peptides.

[0012] Application of engineered bacteria containing the above nucleotide sequence in the preparation of type III collagen peptides.

[0013] A type III collagen peptide, wherein the type III collagen peptide is expressed by the circular RNA expressing the above-mentioned type III collagen polypeptide.

[0014] The application of type III collagen peptides as described above in the preparation of formulations that delay skin aging and / or repair skin damage.

[0015] Therefore, the circular RNA expressing type III collagen polypeptide provided by this invention and its application have the following specific technical effects: (1) This invention provides a circular recombinant RNA with high translation efficiency, good circularization effect, strong and more persistent expression stability and closer to nature through no-scar design and element screening. The nucleotide chain consists of a promoter, a 5ˈ homologous arm, a 3ˈ intron, an IRES sequence, a target protein coding sequence, a 5ˈ intron, and a 3ˈ homologous arm connected in sequence. The nucleotide sequence is shown in SEQ ID NO. 8. (2) The circular recombinant RNA provided by the present invention can successfully express type III collagen peptides in human fibroblasts and mouse fibroblasts in vitro. It has a high uptake rate by cells, strong expression stability and good persistence. No obvious cytotoxicity was found. It has good biocompatibility and in vitro safety. (3) The circular recombinant RNA provided by the present invention can also be successfully expressed in mice, significantly improving the skin aging state of a mouse model of skin aging induced by ultraviolet (UVB+UVA), reversing the ultraviolet-induced photoaging process to a certain extent, improving skin photoaging damage and promoting tissue repair; it has low immunogenicity, good in vivo safety and tissue compatibility.

[0016] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0017] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 These are the results of agarose gel electrophoresis and capillary electrophoresis in Example 2 of this invention; where A is agarose gel electrophoresis and B is capillary electrophoresis. Figure 2 This refers to the Western blot results in Embodiment 2 of the present invention; Figure 3 These are the results of the circRNA stability study in Example 3 of this invention; where A represents HEK293T cells; B represents 3T3 cells; and C represents HDF cells; ** indicates P <0.01; *** indicates P <0.001; **** indicates P <0.0001; Figure 4 These are the results of the investigation of protein expression mediated by circRNA and linear RNA in Example 3 of the present invention; where A is a Western blot; and B is a normalized line plot of the target protein. Figure 5 These are the cytotoxicity test results from Example 3 of this invention; where A represents HEK293T cells; B represents 3T3 cells; and C represents HDF cells. Figure 6 This is the circRNA purification result in Example 4 of the present invention; Figure 7 These are the results measured by the laser particle size analyzer in Example 4 of this invention; where A is an image of the instrument measurement results for linear full-length collagen; B is an image of the instrument measurement results for HRV-rCOL3A1-2; and C is the particle size statistics result. Figure 8 These are skin photographs of mice at experimental sites on days 0, 4, 7, and 18 after drug administration in Example 4 of this invention; Figure 9 These are the results of weight monitoring of mice in each group in Example 4 of this invention; Figure 10 These are HE staining results of the skin from the experimental sites of mice in Example 4 of this invention; where A is a section image of the unirradiated group; B is a section image of the irradiated but drug-free group; C is a section image of the irradiated and injected PBS group; D is a section image of the irradiated and injected empty LNP group; E is a section image of the full-length linear collagen group; F is a section image of the HRV-rCOL3Al-2 group; G is the statistical result of dermal thickness; the scale bar is 250 μM; ** indicates P <0.01; Figure 11 These are Masson staining results of the skin from the experimental sites of mice in each group in Example 4 of this invention; where A is an image of the section; B is the statistical result of the relative collagen content; ** indicates P <0.01; Figure 12 These are the IHC results of the skin from the experimental sites of mice in each group in Example 4 of this invention; where A is an image of the slice; B shows the expression of the target protein in cells; **** indicates... P <0.0001; Figure 13 These are the ELISA results of the skin at the experimental sites of mice in each group in Example 4 of this invention; where A is TNF-α; B is IL-6; C is IL-1β; and D is a skin tissue image. Figure 14 These are the HE staining results of the heart, liver, spleen, lungs and kidneys of mice in each group in Example 4 of this invention. Detailed Implementation

[0019] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0020] To make the objectives, technical solutions, and advantages of this application clearer, more thorough, and more complete, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings and embodiments. The following detailed descriptions are all illustrations of embodiments, intended to provide further detailed explanation of the present invention. Unless otherwise specified, all technical terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0021] All instruments, equipment, and reagents used in the examples were obtained commercially; methods and steps not described in detail in the examples are conventional techniques in the field. Female KM mice were purchased from Liaoning Changsheng Biotechnology Co., Ltd. All mice were acclimatized for one week under standard feeding conditions, and the laboratory animal management system and operating procedures were strictly followed. The feeding and handling methods of the animals during the experiment were reviewed by the Laboratory Animal Welfare and Ethics Committee of Dalian University of Technology.

[0022] Example 1 The specific steps for preparing circular RNA (HRV-rCOL3Al-2) expressing type III collagen peptides are as follows: (1) The circular RNA expressing type III collagen polypeptide consists of a promoter, a 5ˈ homologous arm, a 3ˈ intron, an IRES sequence, a target protein coding sequence, a 5ˈ intron, and a 3ˈ homologous arm connected in sequence.

[0023] The nucleotide sequence of the promoter is shown in SEQ ID NO.1; the nucleotide sequence of the 5' homologous arm is shown in SEQ ID NO.2; the nucleotide sequence of the 3' intron is shown in SEQ ID NO.3; the nucleotide sequence of the IRES sequence is shown in SEQ ID NO.4; the nucleotide sequence of the target protein coding sequence is shown in SEQ ID NO.5; the nucleotide sequence of the 5' intron is shown in SEQ ID NO.6; the nucleotide sequence of the 3' homologous arm is shown in SEQ ID NO.7. The nucleotide sequence of the circular RNA expressing type III collagen polypeptide is shown in SEQ ID NO.8.

[0024] The sequence shown in SEQ ID NO.8 was sent to the company to synthesize the nucleotide sequence of a circular RNA expressing type III collagen polypeptide. The received result was a recombinant vector containing the target sequence and pUC57-kana.

[0025] SEQ ID NO.1: TAATACGACTCACTATAGG SEQ ID NO.2: CCGTCGATTGTCCACTGGTC SEQ ID NO.3: AACAATAGATGACTTACAACTAATCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAGGCAGTAGCGAAAGCTGCAAGAGAATG SEQ ID NO.4: TTAAAACAGCGGATGGGTACCCCACCATCCGACCCACTGGGTGTAGTACTCTGGTACTTCGTACCTTTGTACGCCTGTTCTTCCCATTGTACCCTTCCTGAACTTCCAACCCAAGTAACGTTAGAAGCTCAACATTTAGTACAACAGGAAGCACCACATCCAGTGGTGTTTAGTACAAGCACTTCTGTTTCCCCGGAGCGAGGTATAGGCTGTACCCACTGCCAAAAACCTTTAACCGTTATCCGCCAACCAACTACGTAAAAGCTAGTAGTATTATGTTTTTAACTAGGCGTTCGATCAGGTGGATTTCCCCTCCACTAGTTTGGTCGATGAGGCTAGGAATTCCCCACGGGTGACCGTGTCCTAGCCTGCGTGGCGGCCAACCCAGCCCACTCACTATTTGTTTTCGCGCCCAGTTGCAAAAAGTGTCGGGGCTGGGACGCCTTTTTATAGACATGGTGTGAAGACTCGCATGTGCTTGGTTGTGATTCCTCCGGCCCCTGAATGCGGCTAACCTTAACCCTGGAGCCTTGTGTCACAAACCAGTGATGATAAGGTCGTAATGAGCAATTCCGGGACGGGACCGACTACTTTGGGTGTCCGTGTTTCTTATTTTTCTTATTATTGTCTTATGGTCACAGCATATATATAACATATACTGTGATC SEQ ID NO.5: ATGTTCAGCTTCGTGCAGAAAGGCAGCTGGCTGCTGCTGGCACTGCTGCACCCTACAATCATTCTGGCCGGCGCCAATGGACTCCCTGGCGCAGCTGGCGAAAGGGGAGCACCTGGTTTTAGAGGACCCGCCGGACCTAATGGCATTCCCGGCGAAAAAGGTCCAGCCGGCGAGCGTGGTGCTCCCGGACCTGCAGGCCCAAGAGGTGCTGCTGGCGAGCCTGGAAGAGATGGTGTTCCCGGTGGACCCGGCATGAGAGGCATGCCAGGCTCACCAGGCGGACCAGGCTCTGATGGAAAACCCGGGCCTCCTGGTAGTCAGGGCGAATCCGGTAGACCCGGACCTCCGGGACCATCAGGACCAAGAGGACAACCTGGCGTGATGGGCTTCCCTGGACCTAAGGGAAATGACGGCGCTCCCGGAAAGCATCACCATCACCATCACTAGTAG SEQ ID NO.6: AAATAATTGAGCCTTAAAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTCAGGGAAACCTAAATCTAGTTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAGTAAG SEQ ID NO.7: ACCAGTGGACAATCGACGGATAACAGCATA SEQ ID NO.8: (2) The received recombinant vector was transformed into DH5α competent cells. Then, 450 μL of SOC medium was added to a centrifuge tube, mixed well, and cultured at 37°C and 200 rpm for 60 min. After the culture, the cells were collected by centrifugation at 5000 rpm for 1 min. A portion of the supernatant was discarded, and about 100 μL of supernatant was retained. The cells were gently resuspended by pipetting and evenly spread on the surface of an LB solid plate containing 50 μg / mL kanamycin. The plate was inverted and incubated overnight at 37°C. The next day, a single colony was picked and cultured in LB liquid medium containing 50 μg / mL kanamycin at 37°C and 200 rpm for 12 h. The plasmid was extracted from the correctly sequenced bacterial culture using a kit.

[0026] (3) The plasmid obtained in step (2) was digested with BspQI enzyme. The digestion system was prepared according to the instructions attached to the enzyme. The prepared system was placed in a 50°C water bath for 2 h. Then, 1% agarose gel electrophoresis was used to check whether the digestion was complete.

[0027] The fully digested DNA was purified using a kit to remove residual enzymes and glycerol, following the instructions provided with the kit. After confirming the DNA concentration using a Nano Drop 2000, the DNA was stored at 4°C for later use.

[0028] (4) Using the purified DNA from step (3) as a template, prepare the reaction system according to Table 1 (at room temperature), gently invert the reaction system to mix, briefly centrifuge to allow the liquid to collect at the bottom, and incubate at 37°C for 2 hours. Then add 2 μL of Dnase I, mix well, and incubate at 37°C for 15 minutes to obtain a linear recombinant RNA solution.

[0029] Add 1.6 μL of enzyme-free water and 5.5 μL of 10 mM GTP to the linear recombinant RNA solution, mix well, and then incubate at 55 °C for 15 min to achieve circularization of the linear recombinant RNA. Purify the product using a kit to obtain circular RNA expressing type III collagen peptide. After detecting the concentration with Nano Drop 2000, store at 4 °C for later use, and label it as HRV-rCOL3Al-2.

[0030] Table 1 Transcription reaction system

[0031] Example 2 The circularity rate of the circular RNA expressing type III collagen peptides obtained in Example 1 was detected by electrophoresis, as follows: (1) Capillary electrophoresis. The circular RNA expressing type III collagen peptide purified in Example 1 was diluted to 20 ng / μL with enzyme-free water. Then, 10 μL of the diluted circular RNA solution expressing type III collagen peptide was added to an enzyme-free PCR tube with 10 μL of solution buffer and mixed to make the final RNA concentration 10 ng / μL.

[0032] RNA was separated using an R1 clip and the R-4-10-04-480 separation program was selected: injection at 4kV for 10s, followed by electrophoresis at 4kV for 480s, and finally the obtained spectra were analyzed.

[0033] (2) E-gel electrophoresis. The amount of RNA loaded was 100 ng. The EX-gel 2% electrophoresis system was prepared according to Table 2. The mixture was gently mixed and incubated at 75°C for 3 min. Then, it was placed on ice for 2 min before being loaded into the EX-gel 2% electrophoresis tank for detection.

[0034] Table 2 EX-gel 2% electrophoresis system

[0035] The recombinant plasmid was detected by agarose gel electrophoresis and capillary electrophoresis, respectively. The results are as follows: Figure 1 As shown, the agarose gel electrophoresis bands and capillary electrophoresis peaks are consistent with the characteristics of circularized RNA, indicating that circularized RNA was successfully prepared with a circularization rate of approximately 60%.

[0036] Example 3 The protein expression of the circRNA prepared in Example 1 in cells was investigated, and the specific steps are as follows: (1) Preparation of circRNA-LNP.

[0037] The circRNA prepared in Example 1 was diluted to 170 ng / μL using citrate buffer. The 1273-LNP solution and the diluted circRNA were equilibrated at room temperature for 30 min. After vortexing, they were mixed at a volume ratio of circRNA to LNP of 3:1 and allowed to stand at room temperature for 10 min to obtain the circRNA-LNP solution.

[0038] The lipid composition of 1273-LNP is 50% SM-102, 10% DSPC, 38.5% Cholesterol and 1.5% PEG2000-DMG. All the above components were dissolved in anhydrous ethanol in molar percentage to obtain 1273-LNP solution, which was stored in a refrigerator at 4°C.

[0039] (2) Transfecting cells.

[0040] Human fibroblasts (HDF), human embryonic kidney cells (HEK293T), and mouse fibroblasts (3T3) were cultured in a 37°C incubator containing 5% CO2 until the cell density reached 80%. Then, HDF cells, HEK293T cells, and 3T3 cells were seeded into 12-well plates at a density of 1.5 × 10⁶ cells per well. 5 Cells were cultured under the conditions described above. The culture medium used was DMEM complete medium containing 10% fetal bovine serum (FBS, Gibco) and 1% penicillin-streptomycin (Gibco).

[0041] Add 200 μL of culture medium (DMEM complete medium: DMEM basal medium volume ratio of 1:1) to the circRNA-LNP solution prepared in step (1), vortex mix, and then add HDF cells, HEK293T cells and 3T3 cells cultured for 24 h for transfection. The amount of circRNA used per well is 2.5 μg. After gently mixing, continue to culture for 24 h.

[0042] Then, Western blot was used to detect collagen peptide expression, and the results are as follows: Figure 2 As shown, circRNA can successfully express the corresponding collagen peptides in HEK293T cells, HDF cells, and 3T3 cells.

[0043] (3) Examine the stability of circRNA.

[0044] Total RNA was extracted from cells transfected for 48 hours in step (2) using a kit. After passing quality testing, the RNA was reverse transcribed into cDNA using a kit, and then qPCR was performed using the SYBR method. Three-well parallel experiments were designed for each sample, and the ΔΔCt method was used for relative quantification. The primer sequences for qPCR are shown in SEQ ID NO.9 and SEQ ID NO.10.

[0045] SEQ ID NO.9: GTGGACCCCGGCATGAGAGG SEQ ID NO.10:GGGTCTACCGGATTCGCCC The results are as follows Figure 3 As shown, HEK293T cells had the highest transfection efficiency, and 3T3 cells and HDF cells could also take up circRNA to a certain extent. This also indicates that circRNA has high stability and was not completely degraded after 48 hours.

[0046] (4) Comparison of protein expression mediated by circRNA and linear RNA.

[0047] HEK293T cells were seeded in 6-well plates and cultured for 24 hours until cell adhesion. Then, cells were transfected with circRNA and the linear recombinant RNA prepared in Example 1, respectively. Cell samples from each group were collected at 12, 24, 48, 72, and 96 hours post-transfection for Western blot analysis. The results are as follows: Figure 4 As shown, protein expression mediated by linear RNA peaked at 12 h post-transfection, then gradually declined over time, exhibiting a significant attenuation at 48 h. In contrast, protein expression mediated by circRNA showed a slower decline and a longer overall duration, maintaining a high level for 24–48 h, demonstrating more persistent and stable expression characteristics than linear RNA. These results indicate that circRNA exhibits superior expression persistence in HEK293T cells compared to linear RNA, providing a basis for its subsequent functional studies and applications.

[0048] (5) CCK-8 assay for cytotoxicity.

[0049] After the cells adhered, the original culture medium was discarded and replaced with half-serum culture medium. Blank wells, control wells, and transfection drug wells were also prepared. Blank wells contained only culture medium and CCK-8 reagent, without cells; control wells contained cells and culture medium, without any treatment; and transfection drug wells contained cells transfected with circRNA prepared in Example 1 for 24 hours. Each group was prepared in triplicate to ensure the reliability of the experimental results.

[0050] Cell viability was calculated using Equation I below. The results are as follows: Figure 5 As shown, compared with the control group, the relative cell viability of each experimental group remained above 80%, and the differences were not statistically significant. P >0.05), indicating that the above treatment did not cause significant cytotoxicity under the experimental conditions and has good biocompatibility and in vitro safety.

[0051] Cell viability (%) = [(Experimental group OD - Blank group OD) / (Control group OD - Blank group OD)] × 100% (Formula I).

[0052] Example 4 The protein expression of the circRNA prepared in Example 1 was investigated in vivo, and the specific steps are as follows: (1) The circRNA prepared in Example 1 was purified by IP-RPHPLC, and the results are as follows: Figure 6 As shown.

[0053] (2) Using the method in step (1) of Example 3, circRNA-LNP was prepared from the purified circRNA in step (1). After dialysis to remove ethanol, the average particle size and dispersion of the particles were measured using a laser particle size analyzer. The RNA concentration in the dialysis-treated circRNA-LNP preparation was detected using the Quant-iT™ RiboGreen RNA Quantitative Kit, and the encapsulation efficiency of the circRNA was calculated accordingly (encapsulation efficiency = (RNA concentration after LNP rupture - RNA concentration before LNP rupture) / RNA concentration after LNP rupture). At the same time, the injection volume required for subsequent animal experiments was further calculated based on the actual measured encapsulation concentration.

[0054] Laser particle size analyzer measurement results are as follows Figure 7 As shown, the synthesized circRNA-LNP particles are all less than 150 nm in size, indicating that they are uniform in size, concentrated in distribution, and that the particle size meets the requirements for subsequent animal experiments.

[0055] The calculated encapsulation efficiency and drug delivery volume are shown in Table 3.

[0056] Table 3 Encapsulation efficiency and dosing volume of circRNA-LNP

[0057] (3) Construct an animal model of photoaging.

[0058] Eighteen female KM mice, aged 10-11 weeks and weighing 20-24g each, were acclimatized for one week. Hair was then shaved from the back of each mouse within a 3cm x 3cm area using an electric shaver. The mice were then randomly divided into six groups: no irradiation; irradiation without drug administration; irradiation with PBS injection (same volume per mouse as the experimental group); irradiation with empty LNP injection (1 / 3 volume per mouse of the experimental group); linear full-length collagen group; and HRV-rCOL3A1-2 group.

[0059] The non-irradiation group received no UV light exposure, while the other five groups received UV lamp irradiation three times a week (Monday, Wednesday, and Friday). The UV lamps consisted of two UVA lamps and four UVB lamps. Before each UV irradiation session, all mice were re-anesthetized and shaved to ensure consistent irradiation area and light exposure. The UV lamps were preheated for 15 minutes to ensure stable irradiation intensity. A vertical distance of 30 cm between the UV lamps and the mouse's back skin was maintained, ensuring good ventilation. Irradiation time was increased progressively: 20, 40, and 60 minutes per session in weeks 2-4, respectively; from week 5 onwards, the irradiation time was fixed at 80 minutes per session until week 12. The entire modeling period lasted 12 weeks, with a cumulative UVA irradiation dose of 151.20 J / cm². 2The cumulative UVB irradiation dose was 22.68 J / cm². 2 .

[0060] (4) After irradiation, all mice in each group were placed in a warm environment and returned to their original cages after they were fully awake. During the modeling process, the mice's diet, defecation, mental state, skin damage and recovery were continuously monitored and recorded by taking pictures.

[0061] Visual observation revealed that the skin on the backs of mice in the non-irradiated group was normal in appearance, uniform in color, smooth in surface, and had good elasticity. In contrast, the skin on the backs of mice in all model groups showed obvious photoaging phenotypes, mainly manifested as rough and thickened skin, decreased or lost elasticity, deeper and more severe wrinkles, accompanied by telangiectasia, desquamation, and leather-like changes.

[0062] Sectioning revealed that the skin histological structure of mice in the non-irradiated group was intact, with normal epidermal thickness and clear layers. Dermal collagen fibers exhibited a typical wavy arrangement, with a dense and uniform structure. Blood vessel morphology was normal, and cell composition and quantity were within the normal range. In contrast, all model groups showed significant pathological changes in their skin tissue, mainly manifested as irregular thickening of the epidermis, degeneration of dermal collagen fibers, significantly disordered arrangement, thickening, curling, and breakage of collagen bundles, and uneven distribution. Simultaneously, telangiectasia, proliferation of skin appendages, and inflammatory cell infiltration were observed. After approximately 12 weeks of continuous modeling, the skin on the backs of the mice exhibited typical photoaging phenotypes, accompanied by a decrease in collagen fiber content and significant pathological aging changes in the skin tissue, indicating that the photoaging animal model was successfully established and ready for subsequent drug intervention.

[0063] Treatment was administered on days 0, 4, 7, and 18 after 12 weeks of modeling, via intradermal multi-point injection. Following administration, the appearance of the mouse dorsal skin was continuously photographed, and the weight changes of mice in each group were monitored simultaneously to assess skin improvement and overall tolerability during treatment.

[0064] The results are as follows Figure 8As shown in the figure. At the end of the modeling process, except for the non-irradiated group, all other groups of mice showed similar degrees of wrinkle formation, rough skin, melanin deposition, and decreased elasticity, indicating that the model was successfully established. The non-irradiated group did not receive UVB / UVA irradiation throughout the experiment, and their skin remained close to its initial state. The irradiated but drug-free group received light irradiation without effective intervention, and the skin aging manifestations persisted without significant improvement. The main manifestations were significantly deepened dynamic wrinkles, rough surface texture, scattered fine bumps and unevenness, and significantly reduced skin elasticity. Although the irradiated PBS group and the vehicle control group did not receive therapeutic drugs, their skin condition improved to some extent. The improvement in the PBS group was more likely due to the mechanical stimulation and transient hydration caused by the injection; while the improvement in the irradiated and injected empty LNP group, in addition to the programmed effect, may also be related to the mild local immunomodulation induced by lipid nanoparticles, material-tissue interaction, and improvement of the skin microenvironment.

[0065] In contrast, the skin appearance of mice in the other treatment groups showed more significant improvement over time. The Linear-collagen group showed a reduction in both dynamic and static wrinkles, and a slight decrease in skin roughness, with an overall appearance superior to the PBS and vehicle control groups; however, some skin areas remained yellowish and rough. The HRV-rCOL3A1-2 group showed near-complete disappearance of dynamic wrinkles, with only a few superficial fine lines remaining in static wrinkles. Surface roughness was significantly improved, skin elasticity was significantly enhanced, and the overall appearance tended to be smooth and even, reversing the UV-induced photoaging process to some extent.

[0066] (5) Mouse weight monitoring results are as follows Figure 9 As shown, the weight changes of mice in each group were small during the administration and observation period, with a consistent overall trend and no significant abnormal weight loss, indicating that the prepared circRNA-LNP preparation has good in vivo safety and did not produce significant toxic side effects.

[0067] (6) After the experiment, mice were euthanized in accordance with animal experiment ethics requirements. The skin on the back was fully exposed, and full-thickness skin tissue of uniform size was cut from the pre-marked area to ensure that the sampling site, area and depth of each group were consistent as much as possible. After removing subcutaneous fat and excess connective tissue, a portion was immediately fixed in 4% paraformaldehyde at room temperature for 24 hours. Then, paraffin sections were prepared, and HE staining, Masson staining and IHC detection were performed on the sections. The other portion was detected by ELISA to detect immune factors.

[0068] HE staining results are as follows Figure 10As shown, the normal control group had intact skin tissue structure, normal epidermal thickness, neatly arranged cells, uniform distribution of collagen fibers in the dermis, and clear appendage structure. The model group showed significant photoaging-related pathological changes in its skin tissue, manifested as irregular thickening of the epidermis, thickening of the stratum corneum, loose dermal structure, disordered collagen fiber arrangement, accompanied by telangiectasia and inflammatory cell infiltration. After treatment, the epidermal thickness in the treatment group tended to normalize, while the dermal thickness was significantly higher than that in the model group (…). P <0.05), improved collagen fiber arrangement, reduced inflammatory infiltration, and significantly restored overall tissue morphology compared to the model group.

[0069] Masson staining results Figure 11 As shown, in the normal group of mice, collagen fibers in the dermis showed obvious staining, abundant distribution, and a neat, dense, continuous bundle distribution, with an intact dermal structure. In the model group, collagen fiber staining was significantly weakened, collagen content was reduced, and the arrangement was disordered and loose. Breakage, curling, and uneven distribution were observed in some areas, indicating significant degradation and structural damage to dermal collagen fibers after UV irradiation. Compared with the model group, the collagen fiber content and arrangement in the PBS and LNP groups showed some improvement, but overall recovery was limited, with reduced collagen fibers, irregular arrangement, and localized loosening still observed.

[0070] The treatment group showed enhanced dermal collagen fiber staining compared to the model group, with increased collagen deposition, significantly denser and more continuous fiber arrangement, more uniform distribution, and deeper collagen fiber staining. P <0.001), better dermal structure recovery, indicating that circRNA-LNP can alleviate collagen degradation caused by photoaging and promote dermal matrix reconstruction to a certain extent.

[0071] IHC results as follows Figure 12 As shown, the target protein expression in the normal group skin tissue was normally distributed, with moderate positive staining intensity and clear localization. The positive expression in the model group was significantly abnormal compared to the normal group, indicating successful establishment of the photoaging model. Although the PBS and LNP groups showed improvement compared to the model group, the overall effect was limited, and the increase in positive cells was not significant. Compared to the model group, the expression of type III collagen in the HRV-rCOL3A1-2 treatment group was increased to varying degrees. Further semi-quantitative analysis of IHC images using ImageJ was performed, with the percentage of positive cells representing collagen expression levels. The HRV-rCOL3A1-2 group showed stronger positive staining and significantly higher collagen content than the model group (…). P The value <0.0001 indicates that the constructed treatment system can effectively improve photoaging.

[0072] The combined results of various staining studies firstly indicate that ultraviolet irradiation can induce typical photoaging changes in mouse skin, including epidermal thickening, dermal structural disorder, collagen fiber reduction, and abnormal expression of related proteins. After treatment with HRV-rCOL3A1-2, it was observed that the drug promoted the regeneration of type III collagen, thereby restoring support and elasticity to the skin tissue, reducing wrinkles, thickening the dermis, and alleviating the overall skin condition. It significantly improved photoaging damage and promoted tissue repair.

[0073] ELISA test results are as follows: Figure 13 As shown, the levels of TNF-α, IL-6, and IL-1β in each group of samples did not increase significantly, and there were no statistically significant differences compared with the blank control group. P >0.05). Furthermore, the skin tissue in each group remained structurally intact, with the epidermis, dermis, and appendages clearly visible, and no obvious inflammatory cell infiltration, vasodilation, or tissue edema. These results indicate that administration did not significantly activate the inflammatory response or induce any significant abnormal immune response. Overall, the expression of inflammatory factors in each group remained at a relatively stable level, indicating that the circRNA-LNP formulation prepared in this invention has good biocompatibility and safety.

[0074] (7) After the experiment was completed, the mice were euthanized in accordance with the requirements of animal experiment ethics. Samples were taken from the heart, liver, spleen, lungs and kidneys for HE staining analysis.

[0075] HE staining results are as follows Figure 14 As shown, the major organ structures of mice in each group were basically intact, with no obvious inflammatory pathological changes. Specifically, in the heart tissue, the myocardial fibers were regularly arranged, the cell morphology was normal, and no obvious inflammatory cell infiltration, congestion, edema, or necrosis was observed in the interstitium; in the liver tissue, the hepatic lobule structure was clear and intact, the hepatocytes were relatively regularly arranged, and no obvious inflammatory cell infiltration, cell edema, degeneration, or necrosis was observed; in the spleen tissue, the white pulp and red pulp were clearly demarcated, the overall structure was intact, and no obvious tissue disorder or inflammatory response was observed; in the lung tissue, the alveolar structure was clear, the alveolar septa were not significantly widened, and no obvious inflammatory cell infiltration, congestion, edema, or hemorrhage was observed in the bronchi and pulmonary interstitium; in the kidney tissue, the glomeruli and renal tubules were intact, the renal interstitium was not significantly widened, and no obvious inflammatory cell infiltration, degeneration, or necrosis or other pathological abnormalities were observed. Overall, no significant inflammatory damage was observed in the major organs of each group, indicating that the circRNA-LNP preparation prepared in this invention has good in vivo safety and tissue compatibility.

[0076] Therefore, this invention provides a circular recombinant RNA with high translation efficiency, good circularization effect, strong and persistent expression stability, and closer resemblance to natural RNA through no-scar design and element screening. The nucleotide chain consists of a promoter, a 5' homologous arm, a 3' intron, an IRES sequence, a target protein coding sequence, a 5' intron, and a 3' homologous arm connected in sequence, as shown in SEQ ID NO. 8. The circular recombinant RNA can successfully express type III collagen peptides in human fibroblasts, mouse fibroblasts, and mice in vitro. It can reverse the UV-induced photoaging process to a certain extent, improve skin photoaging damage, and promote tissue repair. It has high cellular uptake rate, strong expression stability, and good persistence. It has low immunogenicity, good biocompatibility, and good in vitro safety.

[0077] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. A circular RNA expressing type III collagen polypeptide, characterized in that: The nucleotide chain of the circular recombinant RNA consists of a promoter, a 5' homologous arm, a 3' intron, an IRES sequence, a target protein coding sequence, a 5' intron, and a 3' homologous arm connected in sequence.

2. The circular RNA expressing type III collagen polypeptide according to claim 1, characterized in that: The nucleotide sequence of the promoter is shown in SEQ ID NO.1; the nucleotide sequence of the 5' homologous arm is shown in SEQ ID NO.2; the nucleotide sequence of the 3' intron is shown in SEQ ID NO.3; the nucleotide sequence of the IRES sequence is shown in SEQ ID NO.4; the nucleotide sequence of the target protein coding sequence is shown in SEQ ID NO.5; the nucleotide sequence of the 5' intron is shown in SEQ ID NO.6; and the nucleotide sequence of the 3' homologous arm is shown in SEQ ID NO.

7.

3. The circular RNA expressing type III collagen polypeptide according to claim 1, characterized in that: The nucleotide sequence of the circular recombinant RNA is shown in SEQ ID NO.

8.

4. The circular RNA expressing type III collagen polypeptide according to claim 1, characterized in that: After in vitro transcription of the template DNA of the target RNA, GTP and enzyme-free water are added and incubated to obtain circular recombinant RNA; the incubation is carried out at 50-60℃ for 10-20 min.

5. A formulation for inducing the production of type III collagen peptides, characterized in that: The active ingredient of the preparation is the circular RNA expressing type III collagen polypeptide as described in any one of claims 1-4.

6. The formulation for inducing the production of type III collagen peptides according to claim 5, characterized in that: When the preparation is injected into cells, the amino acids and enzymes in the cells can be used to continuously generate type III collagen peptides.

7. Use of a recombinant vector comprising the nucleotide sequence of any one of claims 1-4 in the preparation of type III collagen peptides.

8. The use of engineered bacteria comprising the nucleotide sequence of any one of claims 1-4 in the preparation of type III collagen peptides.

9. A type III collagen peptide, characterized in that: The type III collagen peptide is expressed by the circular RNA expressing the type III collagen polypeptide as described in any one of claims 1-4.

10. The use of the type III collagen peptide as described in claim 9 in the preparation of formulations for delaying skin aging and / or repairing skin damage.