Application of ADP-glucose pyrophosphorylase small subunit in regulating soybean growth period and yield
By regulating the protein content or activity of the small subunit of ADP-glucose pyrophosphorylase in soybeans, gene editing technology was used to delay the flowering time of soybeans and increase biomass, which solved the shortcomings of existing technologies in regulating the growth period and yield of soybeans, and achieved the effects of delaying flowering time and increasing biomass.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF BOTANY CHINESE ACAD OF SCI
- Filing Date
- 2025-01-20
- Publication Date
- 2026-07-21
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of crop breeding, specifically relating to the application of the small subunit of ADP-glucose pyrophosphorylase in regulating soybean growth period and yield. Background Technology
[0002] The flowering period of soybeans is precisely regulated by growth status and latitude. Currently, the most studied aspect of soybean research is the regulation of photoperiod. The core genes regulating soybean photoperiod are... E1 It is unique to soybeans. As a transcription factor, E1 represses downstream flowering genes. FT2a and FT5a The expression of ADP-glucose pyrophosphorylase negatively regulates soybean flowering. ADP-glucose pyrophosphorylase (AGPase), the first key enzyme in plant starch biosynthesis, catalyzes the conversion of glucose-1-phosphate (Glc-1-P) and ATP into ADP-glucose (ADPGlc) and inorganic pyrophosphate (PPi). The AGPase protein is a heterotetramer composed of two large subunits (AGPL; 51 kDa) and two small subunits (AGPS; 50 kDa). Reports indicate that AGPase plays an important role in plant heat tolerance, phosphorus utilization, and seed starch accumulation, with the disulfide bonds in the small subunits conferring unique regulatory functions. Currently, there are no reports on the effects of the small subunits of ADP-glucose pyrophosphorylase on crop flowering time and soybean yield. Summary of the Invention
[0003] The technical problem to be solved by this invention is how to regulate the growth period and yield of plants.
[0004] To address the aforementioned technical problems, the present invention first provides any of the following applications of proteins or substances that regulate the content or activity of said proteins: D1) Regulating plant flowering time and / or biomass; D2) Prepare products that regulate plant flowering time and / or biomass; D3) Cultivating plants with altered flowering time and / or biomass; D4) Prepare products from plants that have altered flowering time and / or biomass; The protein is AGPS1a protein and / or AGPS1b protein, wherein the AGPS1a protein is derived from soybean ( Glycine max (L.) Merr.), which are as follows: A1), A2), A3): A1) The amino acid sequence of this protein is SEQ ID No. 2; A2) A protein that has the same function as the amino acid sequence shown in SEQ ID No. 2 in the sequence listing, but with one or more amino acid residues substituted and / or deleted and / or added; A3) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2); The AGPS1b protein is derived from soybeans ( Glycine max (L.) Merr.), which are B1), B2), B3): B1) The amino acid sequence of this protein is that of SEQ ID No. 4; B2) A protein having the same function as the amino acid sequence shown in SEQ ID No. 4 in the sequence listing, with one or more amino acid residues substituted and / or deleted and / or added; B3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of B1) or B2).
[0005] The AGPS1a protein in A2) above is a protein that shares 75% or more amino acid sequence identity with the protein shown in SEQ ID No. 2 and has the same function. The AGPS1b protein in B2) above is a protein that shares 75% or more amino acid sequence identity with the protein shown in SEQ ID No. 4 and has the same function. Identity refers to the similarity of amino acid sequences. The similarity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search for the similarity of a pair of amino acid sequences to calculate the similarity value (%). The phrase "having 75% or more of the sameness" means having at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the sameness.
[0006] The proteins in A2) and B2) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.
[0007] The gene encoding the protein in A2) above can be obtained by deleting one or more amino acid residues from the codons in the DNA sequence shown in SEQ ID No. 1, and / or by performing a missense mutation of one or more base pairs, and / or by attaching a tag to its 5′ and / or 3′ ends. The gene encoding the protein in B2) above can be obtained by deleting one or more amino acid residues from the codons in the DNA sequence shown in SEQ ID No. 3, and / or by performing a missense mutation of one or more base pairs, and / or by attaching a tag to its 5′ and / or 3′ ends. The DNA molecule shown in SEQ ID No. 1 encodes the AGPS1a protein shown in SEQ ID No. 2, and the DNA molecule shown in SEQ ID No. 3 encodes the AGPS1b protein shown in SEQ ID No. 4.
[0008] The tags described in A3) and B3) can be polypeptides or proteins fused with the target protein using in vitro DNA recombination technology, to facilitate the expression, detection, tracing, and / or purification of the target protein. These tags can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag, and / or SUMO tag, etc.
[0009] In the above applications, the substance regulating the protein content or activity can be a biomaterial related to the AGPS1a protein and / or a biomaterial related to the AGPS1b protein, wherein the biomaterial related to the AGPS1a protein is any one of the following C1) to C9): C1) A nucleic acid molecule encoding the AGPS1a protein; C2) An expression cassette containing the nucleic acid molecule described in C1); C3) A recombinant vector containing the nucleic acid molecule described in C1), or a recombinant vector containing the expression cassette described in C2); C4) Recombinant microorganisms containing the nucleic acid molecules described in C1), or recombinant microorganisms containing the expression cassette described in C2), or recombinant microorganisms containing the recombinant vector described in C3); C5) A transgenic plant cell line containing the nucleic acid molecule described in C1), or a transgenic plant cell line containing the expression cassette described in C2); C6) Transgenic plant tissue containing the nucleic acid molecules described in C1), or transgenic plant tissue containing the expression cassette described in C2); C7) A transgenic plant organ containing the nucleic acid molecule described in C1), or a transgenic plant organ containing the expression cassette described in C2); C8) Nucleic acid molecules that reduce the content or activity of the AGPS1a protein; C9) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs containing the nucleic acid molecules described in C8); The biomaterial associated with the AGPS1b protein is any one of the following D1) to D9): D1) The nucleic acid molecule encoding the AGPS1b protein; D2) An expression cassette containing the nucleic acid molecules described in D1); D3) A recombinant vector containing the nucleic acid molecule described in D1), or a recombinant vector containing the expression cassette described in D2); D4) Recombinant microorganisms containing the nucleic acid molecules described in D1), or recombinant microorganisms containing the expression cassette described in D2), or recombinant microorganisms containing the recombinant vector described in D3); D5) A transgenic plant cell line containing the nucleic acid molecule described in D1), or a transgenic plant cell line containing the expression cassette described in D2); D6) Transgenic plant tissue containing the nucleic acid molecules described in D1), or transgenic plant tissue containing the expression cassette described in D2); D7) Transgenic plant organs containing the nucleic acid molecules described in D1), or transgenic plant organs containing the expression cassette described in D2); D8) Nucleic acid molecules that reduce the content or activity of the AGPS1b protein; D9) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs containing the nucleic acid molecules described in D8).
[0010] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.
[0011] Those skilled in the art can readily mutate the nucleotide sequence encoding the AGPS1a or AGPS1b protein of this invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that have 75% or higher identity with the nucleotide sequence of the AGPS1a or AGPS1b protein of this invention, provided they encode and function the AGPS1a or AGPS1b protein, are derived from and equivalent to the nucleotide sequence of this invention.
[0012] In the above applications, the nucleic acid molecule described in C1) can be as follows: (c11) or (c12) c11) The coding sequence is the cDNA molecule or DNA molecule of SEQ ID No. 1 in the sequence listing; DNA molecules that have 75% or more identity with the nucleotide sequences defined by c12 and c11, and that encode the AGPS1a protein; D1) The nucleic acid molecule described may be as follows: d11) or d12): d11) The coding sequence is the cDNA molecule or DNA molecule of SEQ ID No. 3 in the sequence listing; The DNA molecule that encodes the AGPS1b protein has 75% or more identity with the nucleotide sequence defined by d12) and d11).
[0013] c11) can be the DNA molecule shown in SEQ ID No. 1 of the sequence listing. d11) can be the DNA molecule shown in SEQ ID No. 3 of the sequence listing.
[0014] As used herein, the term "identity" refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence encoding the amino acid sequence shown in SEQ ID No. 2 or SEQ ID No. 4 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.
[0015] The aforementioned 75% or more identity can be at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.
[0016] In the above applications, the expression cassette (AGPS1a gene expression cassette) containing a nucleic acid molecule encoding the AGPS1a protein described in C2) refers to DNA capable of expressing the AGPS1a protein in host cells. This DNA may include not only a promoter to initiate AGPS1a gene transcription but also a terminator to terminate AGPS1a gene transcription. The expression cassette (AGPS1b gene expression cassette) containing a nucleic acid molecule encoding the AGPS1b protein described in D2) refers to DNA capable of expressing the AGPS1b protein in host cells. This DNA may include not only a promoter to initiate AGPS1b gene transcription but also a terminator to terminate AGPS1b gene transcription. Furthermore, the expression cassette may also include an enhancer sequence. Promoters that can be used in this invention include, but are not limited to: constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: constitutive promoter 35S of cauliflower mosaic virus; wound-inducible promoters from tomatoes, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiol 120: 979-992); chemically induced promoters from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiohydroxy acid S-methyl ester)); tomato protease inhibitor II promoter (PIN2) or LAP promoter (both induced by methyl jasmonic acid); heat shock promoters (US Patent 5,187,267); tetracycline-inducible promoters (US Patent 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 200710099169.7)); and promoters specific to seed storage proteins (e.g., beta-carotene, napin, etc.). The promoters of oleosin and soybean beta-conglycin (Beachy et al. (1985) EMBO J. 4: 3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are cited in full.Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and carmine and octopine synthase terminators (see, for example: Odell et al. (1985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol.Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627.
[0017] Recombinant vectors containing the AGPS1a or AGPS1b gene expression cassette can be constructed using existing expression vectors. These plant expression vectors include binary Agrobacterium vectors and vectors suitable for plant microbombardment, such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, PSN1301, or pCAMBIA1391-Xb (CAMBIA). The plant expression vectors may also contain the 3' untranslated region of the exogenous gene, i.e., containing a polyadenylate signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylate signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor, such as Agrobacterium crown gall tumor inducing (Ti) plasmid genes (e.g., carmine synthase genes). NosThe untranslated regions transcribed at the 3' end of plant genes (such as soybean storage protein genes) have similar functions. When constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes encoding enzymes or luminescent compounds that can be expressed in plants (e.g., those encoding enzymes that produce color changes). GUS Genes, luciferase genes, etc.), antibiotic marker genes (such as those conferring resistance to kanamycin and related antibiotics). nptII Genes that confer resistance to the herbicide phosphinic acid bar Genes that confer resistance to the antibiotic hygromycin hph Genes, and the genes that confer resistance to methotrexate dhfr Genes such as EPSPS genes (which confer resistance to glyphosate) or chemical reagent resistance marker genes (such as herbicide resistance genes), and mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose, can be used. From a safety perspective, transgenic plants can be directly selected by stress screening without adding any selective marker genes.
[0018] In the above applications, the vector can be a plasmid, granule, bacteriophage, or viral vector. Specifically, the plasmid can be a pTF101 vector, a pGES201 vector, or a PAN580 vector.
[0019] C2) The recombinant vector may specifically be pTF101-AGPS1a. The pTF101-AGPS1a is a recombinant vector obtained by inserting the AGPS1a-Flag fusion gene shown in SEQ ID No. 5 downstream of the 35S promoter of the pTF101 vector.
[0020] C8) The nucleic acid molecule that reduces AGPS1a content may be an sgRNA that targets the coding gene of AGPS1a.
[0021] D8) The nucleic acid molecule that reduces AGPS1b content may be an sgRNA that targets the coding gene of AGPS1b.
[0022] The target sequence of the sgRNA described in C8) and D8) can be positions 454-476 of SEQ ID No. 1 in the sequence listing (that is, positions 454-476 of SEQ ID No. 3).
[0023] The recombinant vector described in C9) and D9) may be pGES201-agps1s, wherein pGES201-agps1s is a recombinant vector obtained by inserting the target sequence DNA fragment at positions 454-476 of SEQ ID No. 1 into the upstream of the gRNA backbone in the pGES201 vector.
[0024] In the above applications, the microorganisms can be yeast, bacteria, algae, or fungi. Among them, bacteria can be Agrobacterium, such as Agrobacterium GV3101.
[0025] In the above applications, the transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs do not include propagation material.
[0026] In the above applications, the regulation of plant biomass can be achieved by regulating the growth rate of the plant, or by regulating the synthesis and / or accumulation of starch in the plant, or by regulating the photosynthetic capacity of the plant. The cultivation of plants with altered biomass can be achieved by changing the growth rate of the plant, or by changing the synthesis and / or accumulation of starch in the plant, or by changing the photosynthetic capacity of the plant.
[0027] The regulation of plant biomass can be achieved by increasing the plant's biomass, which can be done by increasing the plant's growth rate, promoting starch synthesis and / or accumulation, or increasing the plant's photosynthetic capacity. Alternatively, the regulation of plant biomass can be achieved by decreasing the plant's biomass, which can be done by inhibiting the plant's growth rate, inhibiting starch synthesis and / or accumulation, or decreasing the plant's photosynthetic capacity.
[0028] The cultivation of plants with altered biomass can be achieved by increasing the plant's growth rate, promoting starch synthesis and / or accumulation, or enhancing its photosynthetic capacity. Alternatively, the cultivation of plants with altered biomass can be achieved by decreasing the plant's biomass, which can be achieved by inhibiting the plant's growth rate, inhibiting starch synthesis and / or accumulation, or inhibiting its photosynthetic capacity.
[0029] The biomass mentioned above can be reflected in plant height and / or seed yield.
[0030] In the above applications, the substance that regulates the content or activity of the protein can be to increase the content or activity of the protein, the substance that regulates the flowering time of the plant can be to shorten the flowering time of the plant, the substance that regulates the biomass of the plant can be to increase the biomass of the plant, the change in flowering time can be to shorten the flowering time, and the change in biomass can be to increase the biomass. The substance that regulates the content or activity of the protein may reduce the content or activity of the protein; the substance that regulates the flowering time of the plant may prolong the flowering time of the plant; the substance that regulates the plant biomass may reduce the plant biomass; the change in flowering time may be a prolongation of the flowering time; and the change in biomass may be a reduction of the biomass.
[0031] The present invention also provides any of the following methods: X1) Methods to prolong the flowering time of plants include: reducing the content or activity of AGPS1a protein and / or AGPS1b protein in plants to prolong the flowering time of plants; X2) Methods for cultivating plants with extended flowering time include: reducing the content or activity of AGPS1a protein and / or AGPS1b protein in plants to obtain plants with extended flowering time; X3) Methods to increase plant biomass include: increasing the content or activity of AGPS1a and / or AGPS1b proteins in plants to increase plant biomass; X4) Methods for cultivating plants with increased biomass, including: increasing the content or activity of AGPS1a protein and / or AGPS1b protein in plants to obtain plants with increased biomass; X5) Methods for reducing plant biomass include: reducing the content or activity of AGPS1a and / or AGPS1b proteins in plants to reduce plant biomass; X6) Methods for cultivating plants with reduced biomass include: reducing the content or activity of AGPS1a protein and / or AGPS1b protein in plants to obtain target plants with reduced biomass.
[0032] Specifically, the methods described in X1), X2), X5) and X6) can be achieved by knocking out the genes encoding the AGPS1a protein and / or the AGPS1b protein; The methods described in X3) and X4) can be achieved by introducing the encoding genes of AGPS1a protein and / or AGPS1b protein into the plant.
[0033] In the above method, the gene encoding the AGPS1a protein can be the nucleic acid molecule described in C1), and the gene encoding the AGPS1b protein can be the nucleic acid molecule described in D1).
[0034] The knockout of the genes encoding AGPS1a and / or AGPS1b proteins can be achieved by editing the genes encoding AGPS1a and / or AGPS1b proteins. This editing can be performed using the CRISPR / Cas9 method.
[0035] Gene editing of the coding gene using the CRISPR / Cas9 method can be achieved by introducing a recombinant vector (such as pGES201-agps1s) that encodes Cas9 and can transcribe sgRNA that targets the coding gene into the plant and then screening to obtain the target plant whose coding gene has been edited.
[0036] In one embodiment of the present invention, the editing is as follows: AGPS1a The gene has a 19-nucleotide deletion (i.e., the deletion of positions 464-482 of SEQ ID No. 1). AGPS1b The gene is missing 2 nucleotides (i.e., missing positions 468-469 of SEQ ID No. 2).
[0037] In one embodiment of the present invention, the editing is as follows: AGPS1a The gene has a 22-nucleotide deletion (i.e., the deletion of positions 457-478 of SEQ ID No. 1). AGPS1b The gene is missing 47 nucleotides (i.e., missing positions 453-499 of SEQ ID No. 2).
[0038] The methods described in X3) and X4) can specifically utilize a recombinant expression vector containing the coding genes for the AGPS1a protein and / or AGPS1b protein, introduced into plants. The recombinant expression vector can be pTF101-AGPS1a.
[0039] The target plant is understood to include not only first-generation plants containing the AGPS1a protein and / or AGPS1b protein or their coding genes that have been altered, but also their progeny. For the target plant, the gene can be propagated within the species, or it can be transferred into other varieties of the same species using conventional breeding techniques, particularly commercial varieties. The target plant includes seeds, callus tissue, intact plants, and cells.
[0040] In the above methods, increasing plant biomass can be achieved by increasing the plant's growth rate, promoting starch synthesis and / or accumulation, or enhancing the plant's photosynthetic capacity. Decreasing plant biomass can be achieved by decreasing the plant's growth rate, inhibiting starch synthesis and / or accumulation, or reducing the plant's photosynthetic capacity.
[0041] AGPS1a protein and / or AGPS1b protein, or substances that regulate the content or activity of said proteins, are also within the scope of protection of this invention.
[0042] In this invention, the plant can be any one of M1)-M5): M1) dicotyledonous or monocotyledonous plants; M2) legumes; M3) legumes; M4) soybeans; M5) soybean.
[0043] Experiments have shown that the proteins of this invention can regulate the flowering time and biomass of plants: compared with wild-type plants, the double mutant lines obtained by editing the AGPS1a and AGPS1b genes ( agps1s-1 and agps1s-2 The flowering time of AGPS1a transgenic plants is delayed, leaves cannot synthesize and accumulate starch, plant growth is slow, and plant height is reduced. Compared with wild-type plants, AGPS1a transgenic plants have improved photosynthetic carbon fixation capacity, plant height, yield, seed size and weight. AGPS1a and AGPS1b genes have potential application value in regulating the flowering time and biomass of plants.
[0044] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description
[0045] Figure 1 . agps1s-1 and agps1s-2 Mutant gene editing and gene expression detection. (See image above.) agps1s In mutants AGPS1a and AGPS1b Gene editing status; bottom left image: WT, a gps1s Predicted lengths of AGPS1a and AGPS1b proteins in mutants; bottom right figure: WT, a gps1s In mutant leaves AGPS1a and AGPS1b Gene expression status. **: t-test p-value less than 0.01.
[0046] Figure 2 . agps1s Phenotypic observation of mutants. Left image: WT and WT after 7 days of growth following germination. agps1s Phenotypic identification of mutant plants; Middle image: WT and WT plants 7 days after germination and growth. agps1s Statistics on the height of mutant plants; Right figure: WT and WT plants 14 days after germination and growth. agps1s Starch staining of leaves of mutant plants. 7DAE: 7 days after germination and growth; **: t-test P value less than 0.01.
[0047] Figure 3 . agps1s The mutant's leaves showed a decrease in nighttime sugar content. Left image: WT and [other mutants] after 14 days of growth. agps1s Starch content in the leaves of mutant plants; Middle figure: WT and [other values] after 14 days of growth. agps1s Sucrose content in the leaves of mutant plants; right figure: WT and sucrose content after 14 days of growth. agps1s Glucose content in the leaves of mutant plants. Significant differences were found between data labeled with different letters in each figure (P < 0.05), while no significant differences were found between data labeled with the same letter.
[0048] Figure 4 . agps1s The mutant plants exhibit delayed flowering. Left image: WT and long-day conditions under short-day and long-day conditions. agps1s Flowering time of mutants; right figure: WT and under short-day and long-day conditions. agps1s mutant leaves E1 Gene expression. SD: short day (10 hours light, 14 hours dark); LD: long day (16 hours light, 8 hours dark); TUB-soybean tubulin gene; In each figure, there are significant differences between data labeled with different letters (P < 0.05), and no significant differences between data labeled with the same letter.
[0049] Figure 5 Wild type (WT) and agps1s Expression of flowering-related genes in the leaves of mutant plants.
[0050] Figure 6 RNA level detection results in plants overexpressing AGPS1a. Wm82: Williams 82.
[0051] Figure 7 Phenotypic diagrams of AGPS1a overexpressing plants. Left panel: Phenotypic characteristics of wild-type and AGPS1a overexpressing plants after 21 days of growth; Right panel: Plant height statistics of wild-type and AGPS1a overexpressing plants after 21 days of growth. Wm82: Williams 82.
[0052] Figure 8 Overexpression of AGPS1a increased net photosynthetic rate, transpiration rate, and stomatal conductance; Left panel: Net photosynthetic rate of wild-type and AGPS1a-overexpressing plants; Middle panel: Transpiration rate of wild-type and AGPS1a-overexpressing plants; Right panel: Stomatal conductance of wild-type and AGPS1a-overexpressing plants. Wm82: Williams 82.
[0053] Figure 9 Overexpression of AGPS1a increased leaf starch content. Significant differences existed between data labeled with different letters (P < 0.05), while no significant differences existed between data labeled with the same letter. Wm82: Williams 82.
[0054] Figure 10Overexpression of AGPS1a increased yield per plant, seed size, and 100-seed weight. Top left panel: Seed phenotype of wild-type and AGPS1a-overexpressing plants; Top right panel: Seed weight per 100 seeds of wild-type and AGPS1a-overexpressing plants; Bottom left panel: Seed size phenotype of wild-type and AGPS1a-overexpressing plants; Bottom right panel: Seed length, width, and thickness of wild-type and AGPS1a-overexpressing plants. Wm82: Williams 82.
[0055] Figure 11 Map showing the localization of AGPS1a protein in chloroplasts. 35S-GFP: positive control PAN580 vector; AGPS1a-GFP: PAN580-AGPS1a-GFP vector. Detailed Implementation
[0056] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following embodiments are commercially available. All quantitative experiments in the following embodiments were performed in at least three replicates, and the results were averaged.
[0057] The following examples used SPSS 11.5 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. The t-test was used. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and ns indicates no significant difference.
[0058] Example 1 AGPS1a and AGPS1b Construction and phenotypic identification of gene knockout soybeans This embodiment involves knocking out the soybean... AGPS1a Gene( Glyma.14G009300 )and AGPS1b Gene( Glyma.02G304500 ),Discover AGPS1a and AGPS1b Genes can regulate starch synthesis and accumulation, plant growth rate, and flowering time and plant height. In soybean HC-6 (Huachun 6), AGPS1a The CDS sequence of the gene is shown in SEQ ID No. 1, encoding the AGPS1a protein shown in SEQ ID No. 2; AGPS1b The CDS sequence of the gene is shown in SEQ ID No. 3, encoding the AGPS1b protein shown in SEQ ID No. 4.
[0059] 1. agps1s Acquisition and molecular identification of mutants exist AGPS1a and AGPS1b Design a target sequence (5′-GCTTATGCAAGCAACATGGGTGG-3′) at the same location on the second exon of the gene. Figure 1 Gene editing was performed using CRISPR-Cas9. The target sequence DNA fragment was inserted upstream of the gRNA backbone in the pGES201 vector (Bai M, Yuan J, Kuang H, Gong P, Li S, Zhang Z, Liu B, Sun J, Yang M, Yang L, Wang D, Song S, Guan Y. Plant Biotechnol. J. 2020 Mar;18(3):721-731. Generation of a multiplex mutagenesis population via pooled CRISPR-Cas9 in soya bean.), resulting in the recombinant vector pGES201-agps1s. pGES201-agps1s can transcribe the targeted gene. AGPS1a and AGPS1b The sgRNA of a gene.
[0060] pGES201-agps1s were introduced into Agrobacterium GV3101, and genetic transformation was performed using soybean HC-6 as the recipient plant. Two variants were obtained through transformation screening. AGPS1a and AGPS1b A double-gene knockout mutant in which both genes are knocked out, i.e. agps1s mutant ( agps1s-1 and agps1s-2 () Figure 1 PCR amplification and sequencing were performed near the target sequences of the two genes, and the sequence changes of the two mutants are as follows: agps1s-1 Mutant: Compared to soybean HC-6, AGPS1a The gene has a 19-nucleotide deletion (i.e., the deletion of positions 464-482 of SEQ ID No. 1). AGPS1b The gene has a 2-nucleotide deletion (i.e., the deletion of positions 468-469 of SEQ ID No. 2). agps1s-2 Mutant: Compared to soybean HC-6, AGPS1a The gene has a 22-nucleotide deletion (i.e., the deletion of positions 457-478 of SEQ ID No. 1). AGPS1b The gene is missing 47 nucleotides (i.e., missing positions 453-499 of SEQ ID No. 2).
[0061] agps1s-1 and agps1s-2The gene sequence was shortened due to the premature termination of its reading frame caused by the deletion of nucleotides, resulting in a shorter predicted protein length. Figure 1 (Lower left image).
[0062] Design separately AGPS1a and AGPS1b Gene-specific primers were used, and qPCR was employed to detect the expression levels of these two genes in two mutants, using soybean HC-6 (WT) as a control. Results showed... agps1s-1 and agps1s-2 middle AGPS1a and AGPS1b Gene expression was significantly reduced ( Figure 1 (Lower right image). Explanation agps1s-1 and agps1s-2 All achieved AGPS1a and AGPS1b Simultaneous gene knockout.
[0063] Used AGPS1a The gene primers are: AGPS1a-F: 5′-GAGGGGCGTATAATTGAATTTGCT-3′; AGPS1a-R: 5′-TCACGAGCAGGTCTAACATCACA-3′.
[0064] Used AGPS1b The gene primers are: AGPS1b-F: 5′-GTTCTCACTCAATTCAATTCCGCC-3′; AGPS1b-R: 5′-TCAAAAAGCCACAAATACTGCCTG-3′.
[0065] The internal reference gene is the TUB gene, and the primers are: TUB-F: 5′- TCTTGGACAACGAAGCCATCT -3′; TUB-R: 5′- GGTGAGGGACGAAATGATCT -3′.
[0066] 2. agps1s Phenotypic identification of mutants 1) agps1s Mutant plants grow slowly Plant two agps1s The mutant and soybean HC-6 (WT) were cultured under the following conditions: light intensity of 400 µmol photons m -2 s -1 Under light, the temperature is 28°C for 12 hours, and under darkness, the temperature is 25°C for 12 hours, with a humidity of 50%.
[0067] Seven days after sprouting from the soil, two agps1s The mutant's plant height was significantly lower than that of soybean HC-6 (WT). Figure 2 (Chinese map), indicating agps1s The mutant plants grow slowly ( Figure 2 (Middle left image).
[0068] After sprouting and growing for 14 days, leaves were taken at the end of the light period and at the end of the dark period for starch staining. It was found that regardless of whether it was at the end of the light period or the end of the dark period... agps1s The mutant plant has almost no starch accumulation in its leaves. Figure 2 (Right image in the middle) Explanation AGPS1a and AGPS1b Gene knockout prevents the plant's leaves from synthesizing and accumulating starch.
[0069] 2) agps1s The mutant leaves have decreased sugar content at night. Plant two agps1s The mutant and soybean HC-6 (WT) were cultured under the following conditions: light intensity of 400 µmol photons m -2 s -1 Under light, the temperature is 28°C for 12 hours, and under darkness, the temperature is 25°C for 12 hours, with a humidity of 50%.
[0070] After germination and 14 days of growth, the WT and [other parameters] at the end of light and the end of darkness [were observed]. agps1s The starch, sucrose, and glucose content in the leaves of the mutant were measured, and the results showed that regardless of whether it was at the end of the light or the end of the dark period, agps1s The starch content in the leaves of mutant plants was significantly lower than that of wild-type plants. Figure 3 (Middle left image); End of illumination period agps1s The sucrose content in the leaves of the mutant plants was no different from that of the wild type, but the end of the dark period agps1s The sucrose content in the leaves of mutant plants was significantly lower than that of wild-type plants. Figure 3 (Middle map); End of illumination period agps1s The mutant plants had significantly higher glucose content in their leaves than the wild type, but the end of the dark period agps1s The glucose content in the leaves of mutant plants was significantly lower than that of wild-type plants. Figure 3 (Right-middle figure). The above results indicate that... agps1s The mutant synthesizes sugar normally during periods of light but is unable to form starch for storage, resulting in significantly lower sugar content at night compared to the wild type, leading to carbon starvation.
[0071] 3) AGPS1a and AGPS1b Double mutant of gene delays flowering time Plant two agps1s The mutant was cultured with soybean HC-6 (WT) under the following conditions: short day (10 hours light, 14 hours dark) and long day (16 hours light, 8 hours dark).
[0072] Under short-day and long-day conditions, statistical WT and agps1s Flowering time of mutants ( Figure 4 (Middle left image), it was found that compared to the wild type, agps1s The flowering time of the mutant is delayed by about 2 weeks under short-day conditions and by about 4 weeks under long-day conditions.
[0073] Testing WT and agps1s In mutant leaves E1 Gene expression levels were found under short-day conditions. E1 Genes that should not be expressed but are actually agps1s Expression was observed in the mutant; under long-day conditions agps1s In mutant leaves E1 Gene expression was also significantly higher than that of the wild type. Figure 4 (Right image in the middle)
[0074] The inventors further tested WT and WT after 25 days of growth (one week before WT flowered). agps1s Mutant plant leaves related to flowering E1 , FT2a , FT5a Expression of genes such as the FUL family over 24 hours ( Figure 5 The results showed that... agps1s In addition to flowering inhibitors, the leaves of mutant plants also contain flowering inhibitors. E1 Besides the increased expression level, the expression levels of other flowering-related genes all decreased. These results indicate that... AGPS1a and AGPS1b Gene mutations affect E1 Gene expression levels can delay the flowering time of plants.
[0075] Used E1 The gene primers are: E1 -F: 5′-CACTCAAATTAAGCCCTTTCA-3′; E1 -R: 5′-TTCATCTCCTCTTCATTTTTGTTG-3′.
[0076] FT2a The gene primers are: FT2a -F: 5′-ATCCCGATGCACCTAGCCCA-3′; FT2a -R: 5′-ACACCAAACGATGAATCCCCA-3′.
[0077] FT5a The gene primers are: FT5a -F: 5′-AGCCCGAACCCTTCAGTAGGGA-3′; FT5a-R: 5′-GGTGATGACAGTGTCTCTGCCCA-3′.
[0078] FUL1a The gene primers are: FUL1a -F: 5′-AAGAGAGACTCACGGTCAT-3′; FUL1a -R: 5′-AATAGAAGGACGTAGCACCC-3′.
[0079] FUL1b The gene primers are: FUL1b -F: 5′-CCCACAACAACACTAGCTCTCA-3′; FUL1b -R: 5′-AGTAGTAGCACCCTTCAATT-3′.
[0080] FUL2a The gene primers are: FUL2a -F: 5′-CTAATGAAGAAAACTCCAACCTCA-3′; FUL2a -R: 5′-GGTATAGTCACCGTCAAATGCCT-3′.
[0081] FUL2b The gene primers are: FUL2b -F: 5′-GTAATGAAGAAAACTCCAACGTCGA-3′; FUL2b -R: 5′-GCAGTCAGAAACGTCACACA-3′.
[0082] FUL3a The gene primers are: FUL3a -F: 5′-GACTGAAGGTCCACATACTG-3′; FUL3a -R: 5′-TGTCATAATATCACATGTCAC-3′.
[0083] FUL3b The gene primers are: FUL3b -F: 5′-CAATGCAAGGAGGAACACCA-3′; FUL3b -R: 5′-GAGCAGTTATTAAGCTCGGCAT-3′.
[0084] The internal reference gene is the TUB gene, and the primers are: TUB-F: 5′- TCTTGGACAACGAAGCCATCT -3′; TUB-R: 5′- GGTGAGGGACGAAATGATCT -3′.
[0085] 4) Conclusion The inventor, through soybeans AGPS1a and AGPS1b Studies of double mutant plants have found that knockout AGPS1a and AGPS1b Genes can alter the expression patterns of flowering-related genes, delaying soybean flowering and preventing the plant's leaves from synthesizing and accumulating starch, thus slowing plant growth and reducing plant height.
[0086] Example 2: Construction and phenotypic identification of soybeans overexpressing AGPS1a. 1. Construction of soybean with AGPS1a overexpression The AGPS1a-Flag fusion gene shown in SEQ ID No. 5 was inserted downstream of the 35S promoter of the pTF101 vector (described in the article "Paz, MM, Shou, H., Guo, Z., Zhang, Z., Banerjee, A., Wang, K. (2004) Assessment of conditions affecting Agrobacterium-mediated soybean transformation using the cotyledonary nodeexplant. Euphytica 136: 167-176.", where it is referred to as pTF101.1), resulting in the recombinant vector pTF101-AGPS1a. The recombinant vector pTF101-AGPS1a contains the AGPS1a-Flag fusion gene shown in SEQ ID No. 5 and expresses the AGPS1a-Flag fusion protein shown in SEQ ID No. 6. The expression of the AGPS1a-Flag fusion gene is driven by the 35S promoter.
[0087] Among them, the AGPS1a-Flag fusion gene shown in SEQ ID No. 5 encodes the AGPS1a-Flag fusion protein shown in SEQ ID No. 6, and amino acids 1-515 of SEQ ID No. 6 are the sequence of the AGPS1a protein.
[0088] The recombinant vector pTF101-AGPS1a was introduced into Agrobacterium GV3101 to obtain recombinant Agrobacterium GV3101 / pTF101-AGPS1a. Using recombinant Agrobacterium GV3101 / pTF101-AGPS1a, genetic transformation was performed on soybean cultivar Williams 82 as the recipient plant to obtain AGPS1a overexpressing transgenic T0 generation plants. Two generations of self-pollination were then performed to obtain the AGPS1a transgenic T2 generation homozygous lines AGPS1a-OE1 and AGPS1a-OE2.
[0089] Detection of AGPS1a gene expression level in transgenic plants: Total RNA was extracted from V1 leaves of soybeans at stage V2 (AGPS1a-OE1 and AGPS1a-OE2), and cDNA was obtained by reverse transcription. qRT-PCR was then performed, with the wild-type cultivar Williams 82 as a control. The constitutively expressed soybean gene eEF-1alpha (TEFS1, accession number X56856) was used as an internal control to homogenize the cDNA concentration in the samples. Real-time quantitative PCR (RT-qPCR) analysis was then performed using gene-specific primers. -△△CT The expression of AGPS1a and AGPS1b genes was analyzed by a method, with each sample group being repeated three times.
[0090] The RT-qPCR primers for the AGPS1a gene are: AGPS1a-F: 5′-GAGGGGCGTATAATTGAATTTGCT-3′; AGPS1a-R: 5′-TCACGAGCAGGTCTAACATCACA-3′.
[0091] The RT-qPCR primers for the AGPS1b gene are: AGPS1b-F: 5′-GTTCTCACTCAATTCAATTCCGCC -3′; AGPS1b-R: 5′-TCAAAAAGCCACAAATACTGCCTG -3′.
[0092] Soybean gene translation elongation factor eEF-1alpha ( TEFS1 The specific primer sequences for the gene are: TEFS1-F: 5′-TGCAAAGGAGGCTGCTAACT-3′; TEFS1-R: 5′-CAGCATCACCGTTCTTCAAA-3′.
[0093] The results are as follows Figure 6 As shown, the results indicate that, compared to Williams 82, AGPS1a-OE1... AGPS1a Gene expression levels increased 1.5-2 times in AGPS1a-OE2. AGPS1a Gene expression levels increased approximately 2.5-fold in the AGPS1a transgenic lines. AGPS1a Gene expression levels increased significantly. AGPS1b There was no significant change in gene expression levels.
[0094] 2. Phenotypic identification of soybeans overexpressing AGPS1a 1) Plant height phenotypic detection: Seeds of wild-type soybean varieties Williams 82, AGPS1a-OE1, and AGPS1a-OE2 were sown in cultivation soil (a 1:1 mixture of potting soil and vermiculite) under a light intensity of 400 µmol photons / m². -2 s -1 After growing for 21 days under conditions of 28℃ for 12 hours under light and 25℃ for 12 hours under darkness, and 50% humidity, the phenotype was recorded and the plant height (i.e., the length from the cotyledon node to the apical meristem) was counted.
[0095] Plant height and fruit set Figure 7 As shown, the results indicate that, based on phenotypic observation, the plant height of AGPS1a-OE1 and AGPS1a-OE2 is significantly higher than that of the soybean variety Williams 82.
[0096] 2) Photosynthetic capacity test: Seeds of wild-type soybean varieties Williams 82, AGPS1a-OE1, and AGPS1a-OE2 were sown in cultivation soil (a 1:1 mixture of potting soil and vermiculite) under a light intensity of 400 µmol photons / m². -2 s -1 Soybeans were cultivated at 28°C for 12 hours under light, 25°C for 12 hours under darkness, and 50% humidity until they reached stage V3.
[0097] Photosynthetic parameter measurement: The materials were allowed to dark adapt for at least 20 minutes, and the CO2 concentration in the leaf chamber of the GFS3000 photosynthesis meter was set to 410 ppm, the humidity to 40%, the leaf temperature to 25℃, and the light intensity to 1500 μmol photonsm. -2 s -2 Meanwhile, adjust the instrument. After the CO2 and H2O in the gas chamber stabilize, put the leaf into the leaf chamber (avoid trapping the main leaf vein), clamp it tightly, and start the GFS3000 measurement after it stabilizes. Stop the measurement when the net photosynthetic rate (Pn) parameter stabilizes (the difference in Pn at 5 consecutive measurement points is within 1 unit).
[0098] The results are as follows Figure 8 As shown, overexpression AGPS1a The net photosynthetic rate of the plants was significantly higher than that of the wild type (Wm82). Figure 8 (Middle left image), overexpression AGPS1a The plant's transpiration rate and stomatal conductance were also higher than the wild type (Wm82). Figure 8 (Middle and right figures). The results indicate overexpression. AGPS1a It increases the plant's photosynthetic capacity.
[0099] 3) Detection of starch content: Seeds of wild-type soybean varieties Williams 82, AGPS1a-OE1, and AGPS1a-OE2 were sown in cultivation soil (a 1:1 mixture of potting soil and vermiculite) under a light intensity of 400 µmol photons / m². -2 s -1 Soybeans were cultivated to stage V3 under the following conditions: 28°C for 12 hours under light, 25°C for 12 hours under darkness, and 50% humidity.
[0100] End of light exposure: After 12 hours of light exposure, the starch accumulation in the leaves reached its maximum level. V2 leaves of Williams 82, AGPS1a-OE1 and AGPS1a-OE2 plants were taken to obtain V2 leaves of Williams 82, AGPS1a-OE1 and AGPS1a-OE2 plants at the end of the light exposure period.
[0101] End of darkness: After 12 hours of darkness, the starch in the leaves is consumed and the accumulation reaches the minimum level. V2 leaves of Williams 82, AGPS1a-OE1 and AGPS1a-OE2 plants are taken to obtain V2 leaves of Williams 82, AGPS1a-OE1 and AGPS1a-OE2 plants at the end of the dark period.
[0102] Approximately 0.03 g of sample (i.e., V2 leaves) was weighed and ground in a mortar. The starch content of the leaves was determined using a starch content assay kit (Solepro, catalog number: BC0700). Three biological replicates were performed for V2 leaves from Williams 82, AGPS1a-OE1, and AGPS1a-OE2 plants at the end of the light period and for V2 leaves from Williams 82, AGPS1a-OE1, and AGPS1a-OE2 plants at the end of the dark period.
[0103] The results are as follows Figure 9 As shown, the results indicate that overexpression AGPS1a It increases the amount of starch accumulated in the plant's leaves.
[0104] 4) Production measurement: Seeds of wild-type soybean varieties Williams 82, AGPS1a-OE1, and AGPS1a-OE2 were sown in cultivation soil (a 1:1 mixture of potting soil and vermiculite) under a light intensity of 400 µmol photons / m². -2 s -1Soybean plants were grown to full maturity under the following conditions: 28℃ for 12 hours under light, 25℃ for 12 hours under darkness, and 50% humidity. The phenotypes of the progeny of soybean varieties Williams 82, AGPS1a-OE1, and AGPS1a-OE2 were observed and recorded. Ten soybean seeds from different lines were compared side-by-side, and their phenotypes and area were recorded. Individual seeds from different soybean lines were laid out flat for comparison, and their phenotypes and area were recorded. The average length and width of seeds from different lines and the weight of 100 seeds from different varieties were measured. Results are expressed as mean ± standard deviation. A t-test was used, with P < 0.05 (*) indicating a significant difference, P < 0.01 (**) indicating a highly significant difference, and P < 0.001 (***) indicating a highly significant difference.
[0105] 100-seed weight calculation: After the above-mentioned potted soybean seeds matured, the seeds harvested from each plant were dried at 37℃ for one week, and the 100-seed weight (i.e., the 100-seed weight of thoroughly dried seeds) was measured. Seeds from 20 plants of each line were taken, and 50 seeds of each line were weighed. The biological experiment was repeated three times, and the weight was converted to 100-seed weight.
[0106] The results are as follows Figure 10 As shown, in both lines overexpressing the AGPS1a gene, the seed spread area per soybean plant was significantly higher than that of the wild-type Williams 82. Figure 10 (Top left image); The 100-seed weight of soybeans was significantly higher than that of wild-type Williams 82 ( Figure 10 (Top right bar chart); the length of ten soybeans side by side was significantly longer than that of wild-type Williams 82 ( Figure 10 (Lower left image); the length and width of the soybeans were significantly greater than those of the wild-type Williams 82. Figure 10 (Top right bar chart).
[0107] The above results indicate that overexpression of AGPS1a has a positive regulatory effect on traits such as photosynthetic carbon fixation capacity, plant height, yield, seed size, and weight in soybean. This gene has potential application value in improving the photosynthetic capacity and yield of crops such as soybean.
[0108] Example 3: Subcellular localization of AGPS1a The AGPS1a coding gene, represented by positions 1-1545 of SEQ ID No. 1, was inserted between the 35S promoter and the GFP gene in the PAN580 vector to obtain the recombinant vector PAN580-AGPS1a-GFP. In this recombinant vector, the AGPS1a coding gene was fused with the GFP gene to form the fusion gene AGPS1a-GFP. The 35S promoter drives the expression of the fusion gene AGPS1a-GFP, expressing the fusion protein AGPS1a-GFP. Transient expression analysis was performed by transforming the PAN580-AGPS1a-GFP vector into Arabidopsis protoplasts, using the PAN580 vector as a positive control. The results showed that the AGPS1a protein is distributed in chloroplasts (results). Figure 11 As shown in the figure, this indicates that the AGPS1a protein is located in chloroplasts.
[0109] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. Any of the following applications of proteins or substances that regulate the content or activity of said proteins: D1) Regulating plant flowering time and / or biomass; D2) Prepare products that regulate plant flowering time and / or biomass; D3) Cultivating plants with altered flowering time and / or biomass; D4) Prepare products from plants that have altered flowering time and / or biomass; The protein is AGPS1a protein and / or AGPS1b protein, wherein the AGPS1a protein is as follows: A1), A2), A3). A1) The amino acid sequence of this protein is SEQ ID No. 2; A2) A protein that has the same function as the amino acid sequence shown in SEQ ID No. 2 in the sequence listing, but with one or more amino acid residues substituted and / or deleted and / or added; A3) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2); The AGPS1b protein is as follows: (B1), (B2), (B3) B1) The amino acid sequence of this protein is that of SEQ ID No. 4; B2) A protein having the same function as the amino acid sequence shown in SEQ ID No. 4 in the sequence listing, with one or more amino acid residues substituted and / or deleted and / or added; B3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of B1) or B2).
2. The application according to claim 1, characterized in that: The substance regulating the content or activity of the protein is a biomaterial associated with the AGPS1a protein and / or a biomaterial associated with the AGPS1b protein, wherein the biomaterial associated with the AGPS1a protein is any one of C1) to C9) below: C1) A nucleic acid molecule encoding the AGPS1a protein; C2) An expression cassette containing the nucleic acid molecule described in C1); C3) A recombinant vector containing the nucleic acid molecule described in C1), or a recombinant vector containing the expression cassette described in C2); C4) Recombinant microorganisms containing the nucleic acid molecules described in C1), or recombinant microorganisms containing the expression cassette described in C2), or recombinant microorganisms containing the recombinant vector described in C3); C5) A transgenic plant cell line containing the nucleic acid molecule described in C1), or a transgenic plant cell line containing the expression cassette described in C2); C6) Transgenic plant tissue containing the nucleic acid molecules described in C1), or transgenic plant tissue containing the expression cassette described in C2); C7) A transgenic plant organ containing the nucleic acid molecule described in C1), or a transgenic plant organ containing the expression cassette described in C2); C8) Nucleic acid molecules that reduce the content or activity of the AGPS1a protein; C9) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs containing the nucleic acid molecules described in C8); The biomaterial associated with the AGPS1b protein is any one of the following D1) to D9): D1) The nucleic acid molecule encoding the AGPS1b protein; D2) An expression cassette containing the nucleic acid molecules described in D1); D3) A recombinant vector containing the nucleic acid molecule described in D1), or a recombinant vector containing the expression cassette described in D2); D4) Recombinant microorganisms containing the nucleic acid molecules described in D1), or recombinant microorganisms containing the expression cassette described in D2), or recombinant microorganisms containing the recombinant vector described in D3); D5) A transgenic plant cell line containing the nucleic acid molecule described in D1), or a transgenic plant cell line containing the expression cassette described in D2); D6) Transgenic plant tissue containing the nucleic acid molecules described in D1), or transgenic plant tissue containing the expression cassette described in D2); D7) Transgenic plant organs containing the nucleic acid molecules described in D1), or transgenic plant organs containing the expression cassette described in D2); D8) Nucleic acid molecules that reduce the content or activity of the AGPS1b protein; D9) Expression cassettes, recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues, or transgenic plant organs containing the nucleic acid molecules described in D8).
3. The application according to claim 2, characterized in that: C1) The nucleic acid molecule described is as follows (c11) or (c12): c11) The coding sequence is the cDNA molecule or DNA molecule of SEQ ID No. 1 in the sequence listing; DNA molecules that have 75% or more identity with the nucleotide sequences defined by c12 and c11, and that encode the AGPS1a protein; D1) The nucleic acid molecule described is as follows (d11) or (d12): d11) The coding sequence is the cDNA molecule or DNA molecule of SEQ ID No. 3 in the sequence listing; The DNA molecule that encodes the AGPS1b protein has 75% or more identity with the nucleotide sequence defined by d12) and d11).
4. The application according to any one of claims 1-3, characterized in that: The regulation of plant biomass is achieved by regulating the plant's growth rate, or by regulating the synthesis and / or accumulation of starch in the plant, or by regulating the plant's photosynthetic capacity. The cultivation of plants with altered biomass is achieved by changing the plant's growth rate, or by changing the synthesis and / or accumulation of starch in the plant, or by changing the plant's photosynthetic capacity.
5. The application according to any one of claims 1-4, characterized in that: The biomass is reflected in plant height and / or seed yield.
6. The application according to any one of claims 1-5, characterized in that: The substance that regulates the content or activity of the protein is to increase the content or activity of the protein; the substance that regulates the flowering time of the plant is to shorten the flowering time of the plant; the substance that regulates the biomass of the plant is to increase the biomass of the plant; the change in flowering time is to shorten the flowering time; and the change in biomass is to increase the biomass. The substance that regulates the content or activity of the protein is to reduce the content or activity of the protein; the substance that regulates the flowering time of the plant is to prolong the flowering time of the plant; the substance that regulates the biomass of the plant is to reduce the biomass of the plant; the change in flowering time is to prolong the flowering time; and the change in biomass is to reduce the biomass.
7. Any of the following methods: X1) Methods to prolong the flowering time of plants include: To reduce the content or activity of the protein described in claim 1 in plants, thereby extending the flowering time of plants; X2) A method for cultivating plants with extended flowering time, comprising: reducing the content or activity of the protein described in claim 1 in the plant to obtain a plant with extended flowering time; X3) A method for increasing plant biomass, including: increasing the content or activity of the protein described in claim 1 in the plant to increase plant biomass; X4) A method for cultivating plants with increased biomass, comprising: increasing the content or activity of the protein described in claim 1 in the plant to obtain a target plant with increased biomass; X5) A method for reducing plant biomass, comprising: reducing the content or activity of the protein described in claim 1 in the plant to achieve a reduction in plant biomass; X6) A method for cultivating plants with reduced biomass, comprising: reducing the content or activity of the protein described in claim 1 in the plant to obtain a target plant with reduced biomass.
8. The method according to claim 7, characterized in that: The methods described in X1), X2), X5), and X6) are achieved by knocking out the gene encoding the protein; The methods described in X3) and X4) are achieved by introducing the gene encoding the protein into the plant.
9. The application according to any one of claims 1-6, or the method according to claim 7 or 8, characterized in that: The plant is any one of M1)-M5): M1) Dicotyledons or monocotyledons; M2) Leguminosae (family Fabales); M3) Leguminosae (family legumes); M4) Soybean species; M5) soybeans.
10. The protein of claim 1 or any of the substances in claims 1-3 that regulate the content or activity of the protein.
Citation Information
Patent Citations
CN101063139A
CN101063139B
US5057422A
US5187267A