An enzyme digestion-fluorescent quantitative PCR detection method

By using the enzyme digestion-quantitative real-time PCR method, which employs restriction endonucleases and a blocking system, the problems of insufficient sensitivity and specificity in quantitative real-time PCR detection are solved. This simplifies primer design and screening processes and improves the detection efficiency and accuracy of high-GC templates.

CN122445778APending Publication Date: 2026-07-24南昌大学第一附属医院
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
南昌大学第一附属医院
Filing Date
2026-06-25
Publication Date
2026-07-24

AI Technical Summary

Technical Problem

Existing quantitative real-time PCR technology suffers from insufficient sensitivity and non-specific amplification when detecting low-frequency mutations and weak methylation changes. Furthermore, primer design and screening are time-consuming, and the sulfite conversion process is complex, affecting detection accuracy.

Method used

The enzyme digestion-fluorescence quantitative PCR method was adopted. The reaction system was digested with restriction endonucleases, and primers and probes that were perfectly matched with the template were designed. The reaction was carried out in a closed system to avoid non-specific amplification and simplify the primer design and screening process.

Benefits of technology

It improves the sensitivity and specificity of detection, simplifies the operation process, and reduces detection costs and time. It is particularly suitable for the detection of templates with high GC content, such as TERT gene promoter and CpG island methylation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122445778A_ABST
    Figure CN122445778A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of fluorescent quantitative PCR, and provides an enzyme digestion-fluorescent quantitative PCR detection method. The method comprises the following steps: step one, configuring a reaction mixture, wherein the reaction mixture comprises amplification reagents, a restriction endonuclease, Taq DNA polymerase, UDG enzyme, primers and a probe; and step two, setting a reaction program and a reaction system. Non-target templates in a qPCR reaction system are degraded by enzyme digestion of a restriction endonuclease, thereby reducing non-specific amplification; the proportion of target templates is increased, thereby avoiding the interference of non-target templates and improving detection sensitivity and detection stability. In particular, the method can effectively detect high GC content templates, such as TERT gene promoters or CpG island methylation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of quantitative real-time PCR technology, and particularly relates to an enzyme digestion-quantitative real-time PCR detection method. Background Technology

[0002] Quantitative real-time PCR (qPCR) uses fluorescence signals to quantify a target template in real time, using the Ct value to correspond to the initial copy number of the template. Due to its ease of use and low cost, it is widely used in molecular detection. Gene mutation detection and methylation detection have received significant attention in molecular detection, as they are both related to epigenetics or genetic variations and are core technologies in precision medicine, cancer diagnosis, and life science research. Gene mutation detection typically uses ARMS-qPCR, employing primers that can only amplify mutated templates. Methylation detection usually involves transforming unmethylated sequences in the sample and then performing qPCR amplification using primers that match the transformed methylated template.

[0003] qPCR testing offers good sensitivity and specificity, but a balance between these two aspects remains crucial. Whether detecting low-frequency mutations or subtle methylation changes, sufficiently high sensitivity is essential; insufficient sensitivity can lead to missed detections. qPCR amplification inherently carries a risk of non-specific amplification. In mutation detection, primer dimers or amplification of non-target sequences can cause non-specificity issues. In methylation detection, bisulfite treatment significantly reduces DNA sequence complexity (converting C to T), increasing the risk of non-specific primer binding. When non-specific amplification signals and weak positive signals are difficult to distinguish, accurate determination of the sample's positivity or positivity becomes impossible. Furthermore, designing and screening suitable primers requires significant time. Methylation detection, in particular, necessitates a lengthy template transformation process prior to qPCR experiments. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides an enzyme digestion-fluorescent quantitative PCR detection method, which aims to solve the problems mentioned in the background art.

[0005] This invention provides an enzyme digestion-fluorescent quantitative PCR detection method, comprising the following steps: Step 1: Prepare the reaction mixture, which includes amplification reagents, restriction endonuclease, Taq DNA polymerase, UDG enzyme, primers, and probes; wherein the sequence of the primers is shown in SEQ ID NO.2 or SEQ ID NO.3, and the sequence of the probe is shown in SEQ ID NO.5; The sequence of the primer is as shown in SEQ ID NO. 8 or SEQ ID NO. 9, and the sequence of the probe is as shown in SEQ ID NO. 10; Step 2: Set up the reaction program and reaction system; The steps in the reaction procedure include enzyme digestion, pre-denaturation, and denaturation.

[0006] Furthermore, the amplification reagent includes buffer, dNTPs, dUTP, monovalent cations, divalent cations, and additives.

[0007] Further, the restriction endonuclease is at least one of Xma I, Sma I, Nha XI, BssH II, or Acc II.

[0008] Furthermore, when detecting the TERT C250T mutant, the sequence of the TERT C250T mutant is shown in SEQ ID NO.1, the sequence of the primer is shown in SEQ ID NO.2 or SEQ ID NO.3, and the sequence of the probe is shown in SEQ ID NO.5.

[0009] Furthermore, when detecting CXCR4 gene methylation, the sequence of the CXCR4 gene is shown in SEQ ID NO.7, the sequence of the primer is shown in SEQ ID NO.8 or SEQ ID NO.9, and the sequence of the probe is shown in SEQ ID NO.10.

[0010] Furthermore, the reaction system is 10-50 µL, and the sample loading volume is 3-10 µL.

[0011] Furthermore, the concentration of the primer is 200-500 nM, and the concentration of the probe is 200-500 nM.

[0012] Furthermore, the amount of Xma I added was 1-10 U.

[0013] Furthermore, in the reaction procedure, the enzyme digestion temperature is 30-60℃, the enzyme digestion time is 15-60 min, the denaturation temperature is 94-96℃, the annealing temperature is 60-66℃, and the number of cycles is 40-50 cycles.

[0014] Furthermore, the reaction system is a one-step closed system.

[0015] The present invention has the following beneficial effects: (1) By using restriction endonucleases to degrade non-target templates in the qPCR reaction system, non-specific amplification is reduced; the proportion of target templates is increased, interference from non-target templates is avoided, and detection sensitivity and stability are improved. In particular, it can effectively detect templates with high GC content, such as TERT gene promoters or CpG island methylation.

[0016] (2) Design primers that perfectly match the template, reducing the workload of primer design and screening. In mutation detection, there is no need to introduce additional mismatches for screening and optimization, avoiding the decrease in amplification efficiency caused by mismatches. In methylation detection, there is no need to perform sulfite conversion, avoiding inaccurate detection results due to insufficient conversion efficiency during the conversion process; there is no need to design primers for the converted template, reducing the design difficulty.

[0017] (3) All reactions are completed in a closed system, without the need for opening the lid, thus avoiding contamination, reducing manual operation, and requiring no additional testing equipment. The operation is simple and easy to apply. Attached Figure Description

[0018] Exemplary embodiments of the present invention can be more fully understood by referring to the following figures: Figure 1 This is the amplification curve of real-time enzyme digestion-fluorescence quantitative PCR in Example 1 of the present invention.

[0019] Figure 2 This shows the distribution of Ct values ​​in Embodiment 1 of the present invention.

[0020] Figure 3 This is the amplification curve of real-time enzyme digestion-fluorescence quantitative PCR in Example 2 of the present invention. Detailed Implementation

[0021] To make the technical problems, solutions, and beneficial effects of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. The specific embodiments described herein are merely illustrative and are not intended to limit the scope of the invention.

[0022] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains; the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the invention.

[0023] Example 1: TERT C250T gene mutations were detected using an enzyme digestion-quantitative real-time PCR method.

[0024] 1. Primer and probe design TERT promoter mutations occur in various solid tumors, such as glioblastoma, thyroid cancer, and melanoma. They are associated with poor prognosis, including high tumor invasion, tumor recurrence, and death, and can be used to aid in diagnosis, risk stratification, and treatment decision-making. There are two common TERT mutation sites: -124 (chr5:295, 228 C>T) and -146 (chr5:295, 250 C>T) upstream of the transcription start site.

[0025] The GC content of the TERT gene promoter region is as high as 86%, far exceeding the overall GC content of human genomic DNA. Its template is difficult to fully open, and secondary structures affect amplification efficiency; high-GC primers are prone to misannealing, resulting in non-specific amplification. Therefore, weak positive amplification of the TERT gene is unstable and difficult to distinguish from non-specific amplification of wild-type samples. In existing technologies, if strong mismatch primers or strong PCR inhibitors are selected to suppress non-specific amplification, it will affect the amplification of positive templates; if weak mismatch primers or PCR enhancers are selected to detect weak positive samples, random non-specific amplification will occur.

[0026] Based on the TERT C250T mutant sequence (SEQ ID NO.1), primers (Primer 1, Primer 2) and probe (Probe 1) that perfectly match the mutant template were designed. An ARMS primer (Primer 3) was also designed as a control group. Specific sequence information is shown in Table 1.

[0027] SEQ ID NO.1: GCGCTGTCGGGGCCAGGCCGGGCTCCCAGTGGATTCGCGGGCACAGACGCCCAGGACCGCGCTTCCCACGTGGCGGAGGGACTGGGGACCCGGGCACCCGTCCTCCTTCACCTTCCAGTCCGCCTCCTCCGCGCGGACCCCGCCCCGTCCCGACCCCTTCCGGGTCCCCGGCCCAGCCCCCTCCGGGCCCTCCCAGCCCCTCCCCTTCCTTTCCG.

[0028] Table 1. TERT C250T mutant sequence information

[0029] 2. Reaction system Restriction endonuclease: Xma I enzyme (C / CCGGG) can recognize the TERT C250T wild-type sequence (SEQ ID NO. 6), but cannot recognize the TERT C250T mutant sequence, and has no cleavage site on the amplicon.

[0030] SEQ ID NO.6: GCGCTGTCGGGGCCAGGCCGGGCTCCCAGTGGATTCGCGGGCACAGACGCCCAGGACCGCGCTTCCCACGTGGCGGAGGGACTGGGGACCCGGGCACCCGTCCTGCCCCTTCACCTTCCAGTCCGCCTCCTCCGCGCGGACCCCGCCCCGTCCCGACCCCTCCCGGGTCCCCGGCCCAGCCCCCTCCGGGCCCTCCCAGCCCCTCCCTCCTTCCTCG; The enzyme cleavage site is CCGGG.

[0031] The components of the prepared reaction solution are shown in Table 2. The reaction solution contains amplification reagents, restriction endonucleases, Taq DNA polymerase, and UDG enzyme. These detection enzymes are commercially available. The reaction solution also contains primers and probes for the internal reference gene for quality control. Group 1 (Group 1-A: 5U of Xma I enzyme added, Group 1-B: no Xma I enzyme added), Group 3 (1U of Xma I enzyme), Group 4 (10U of Xma I enzyme), and Group 5 (5U of Xma I enzyme) are the experimental groups, and Group 2 (no Xma I enzyme added) is the control group.

[0032] Table 2 Components of the reaction solution in Example 1

[0033] 3. Reaction Procedure The qPCR reaction program settings for each group are as shown in Table 3. The specific reaction steps are as follows: Stage 1 is the enzyme digestion stage; Stage 2 is the pre-denaturation and restriction enzyme inactivation stage; Stage 3 is the pre-amplification stage, where Step 1 is denaturation and Step 2 is annealing; Stage 4 is the normal signal collection stage, where Step 1 is denaturation, Step 2 is annealing, and signal collection occurs. Among them, Groups 1, 3, and 4 are consistent with the qPCR reaction program settings in Table 3, Group 2 skips Stage 1 enzyme digestion, and Group 5 uses reaction programs with different enzyme digestion times (30 min and 60 min).

[0034] Table 3 qPCR reaction procedure

[0035] 4. Results Analysis Comparison of test results Groups 1-5 were tested on wild-type samples (WT), positive samples (P), weakly positive samples (L), and blank samples (NTC). The test results are shown in Tables 4-6, and the amplification curves are shown in the figures. Figure 1 As shown.

[0036] The results showed that the mutation frequency of weakly positive samples was 1-3%. Table 4 shows that the Ct values ​​of positive samples (P and L) from group 1-A (with endonuclease) and group 1-B (without endonuclease) were not significantly different, although the Ct value of group 1-A was smaller in some samples (such as P2). This indicates that group 1-A has an advantage in detecting positive samples. However, in WT samples, the Ct value of group 1-B was significantly smaller than that of group 1-A, indicating significant non-specific amplification, and the Ct value of WT could not be distinguished from that of L. This means that group 1-B has poor specificity and cannot distinguish between positive and negative samples based on Ct value. The Ct values ​​of group 2 were all greater than those of groups 1-A and 1-B, indicating poor amplification efficiency, and the Ct value of L2 could not be distinguished from the Ct values ​​of WT1 and WT3, with no obvious amplification curve.

[0037] In summary, the enzyme digestion-fluorescence quantitative PCR detection method of the present invention can achieve the expected purpose, degrade wild-type template, reduce non-specific amplification, stably amplify positive samples, detect weaker positive samples, and improve sensitivity.

[0038] Table 4. Ct values ​​of target gene amplification in Groups 1-A, 1-B, and 2

[0039] The effect of restriction endonuclease amount in enzyme digestion-quantitative PCR detection method The enzyme amounts in groups 3, 1-A, and 4 were 1U, 5U, and 10U, respectively. The results for positive samples remained stable across groups with different enzyme amounts. However, the WT test results showed that the Ct value in group 3 was approximately 2 Ct values ​​lower than that in groups 1-A and 4, while the difference between groups 1-A and 4 was minimal. Therefore, the enzyme amount range is 5-10U.

[0040] Table 5. Ct values ​​of target gene amplification under different enzyme concentrations

[0041] The effect of enzyme digestion time in the enzyme digestion-fluorescent quantitative PCR detection method Enzyme digestion times ranging from 15 min to 60 min showed clear differentiation between positive samples and weakly positive (WT) samples based on the ΔCt value. However, with prolonged digestion time, the Ct value and ΔCt value of WT samples increased, as did the difference between them and weakly positive samples. To conserve reaction time, a digestion time of 30 min was optimal, and UDG enzyme also has a contamination-preventing effect.

[0042] Table 6. Ct values ​​of amplification at different enzyme digestion times

[0043] Note: ΔCt=Ct(FAM)-Ct(VIC), where FAM: fluorescence for target gene detection, and VIC: fluorescence for internal reference gene detection.

[0044] 5. Sample testing Clinical samples were tested according to the optimal reaction system (5 U enzyme) and reaction procedure (30 min enzyme digestion time). The clinical samples included 10 TERT C250T positive samples, TERT C228T positive samples, and wild-type samples. All clinical samples were FFPE samples, and nucleic acid was extracted using a paraffin extraction kit. The extracted nucleic acid was diluted to 10 ng / µL, and 3 µL was added to the above reaction system. The reaction procedure in Table 3 was used for the experiment. The detection results are shown in Table 7, and the distribution of the obtained Ct values ​​is as follows: Figure 2 As shown.

[0045] The results showed that all TERT C250T positive samples were detected, and the results were consistent with the comparative methodology. Sample 250-5 was severely degraded, showing no obvious amplification curve in the internal reference gene (VIC) channel, but a clear amplification curve in the target gene (FAM) channel, indicating a TERT C250T positive result, consistent with the comparative methodology. The ΔCt distribution of the TERT C250T positive samples differed significantly from that of the TERT C228T and WT samples. Therefore, the enzyme digestion-fluorescent quantitative PCR detection method of this invention has good specificity, no cross-reactivity with TERT C228T, and can be used for the detection of TERT C250T.

[0046] Table 7. Ct values ​​for sample testing

[0047] Example 2: The methylation status of the CXCR4 gene was detected by enzyme digestion-quantitative real-time PCR.

[0048] 1. Primer and probe design In the genome, epigenetic modifications of DNA methylation are not randomly distributed; they are highly concentrated in specific CpG island regions. These CpG islands depend on high GC base content and frequent CpG dinucleotide occurrences. Therefore, templates, which serve as the primary carriers of methylation, are inherently high in GC. Detecting the corresponding regions (high GC content) of the CXCR4 gene methylation status using an enzyme digestion-quantitative real-time PCR method can improve detection sensitivity and specificity, and eliminates the need for transformation, saving time and economic costs.

[0049] Based on the CXCR4 gene sequence (SEQ ID NO.7), primers (Primer 4, Primer 5) and probe (Probe 2) that perfectly match the template were designed. The specific sequences are shown in Table 8.

[0050] SEQ ID NO.7: TACCTCTGGAACACTCCAGACTGAAATGTTTCCTCTTTTGATATAGAAAAGAGGGATCGTGTGTAGAGTGCAGTCTGGGCAATCCCTCTCCTCGGGACCATTTCGGGGTGGGGGCCTCTGGGGTCCGTGTCGCGACGCGCGCCTCGGTCCCAGCTATCTCCGCAGCGGCCACCCCGCCTGCGGACGCAGTTTCTCGGCCCCGCCCCACACTC;

[0051] The enzyme cleavage site is CGCG.

[0052] Table 8 CXCR4 gene sequence information

[0053] 2. Reaction system and reaction procedure Acc II endonuclease (CG / CG) can recognize unmethylated sequences but not methylated sequences. Therefore, it can be used to detect the methylation status of the CXCR4 gene. The restriction site is CGCG, which has two restriction sites in the amplicon and can degrade unmethylated sequences.

[0054] The prepared reaction system includes amplification reagents, restriction endonucleases, Taq DNA polymerase, UDG enzyme, primers, and probes. These detection enzymes are commercially available. The reaction solution components are shown in Table 9, and the reaction procedure is shown in Table 10. The specific reaction steps are as follows: Stage 1 is the enzyme digestion stage; Stage 2 is the pre-denaturation and endonuclease inactivation stage; Stage 3 is the pre-amplification stage, where Step 1 involves denaturation and Step 2 involves annealing; Stage 4 is the normal signal collection stage, where Step 1 involves denaturation, Step 2 involves annealing, and signal collection.

[0055] Table 9. Components of the reaction solution in Example 2

[0056] Table 10 Reaction Procedure

[0057] The test results are shown in Table 11. The results indicate that the Ct values ​​of methylated cell line nucleic acids differed by less than 2 between groups 6-A and 6-B, while the Ct values ​​of unmethylated cell line nucleic acids differed by more than 8 between groups 6-A and 6-B. Enzymatic digestion significantly degraded the unmethylated cell line nucleic acid template.

[0058] Amplification curve as shown Figure 3As shown, the results indicate that the amplification curves of methylated and unmethylated samples in group 6-B almost overlap; however, the amplification curves of unmethylated samples in group 6-A are significantly delayed compared to group 6-B, and also differ considerably from the amplification curves of methylated samples. Therefore, the methylation status of clinical samples can be distinguished by the amplified Ct value. The enzyme digestion-quantitative real-time PCR detection method can also detect the methylation status of the CXCR4 gene without the need for a cumbersome transformation process.

[0059] Table 11 Ct values ​​for target gene amplification

[0060] In summary, the use of restriction endonucleases in quantitative real-time PCR can play a significant role in molecular detection: solving the detection problem of high GC templates, improving detection specificity and sensitivity; reducing experimental steps, increasing detection efficiency, and saving manpower and resources.

[0061] The above description is merely an embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for detecting enzyme digestion-fluorescent quantitative PCR, characterized in that, Includes the following steps: Step 1: Prepare the reaction mixture, which includes amplification reagents, restriction endonuclease, Taq DNA polymerase, UDG enzyme, primers, and probes; wherein the sequence of the primers is shown in SEQ ID NO.2 or SEQ ID NO.3, and the sequence of the probe is shown in SEQ ID NO.5; The sequence of the primer is as shown in SEQ ID NO. 8 or SEQ ID NO. 9, and the sequence of the probe is as shown in SEQ ID NO. 10; Step 2: Set up the reaction program and reaction system; The steps in the reaction procedure include enzyme digestion, pre-denaturation, and denaturation.

2. The enzyme digestion-fluorescence quantitative PCR detection method as described in claim 2, characterized in that, The amplification reagents include buffer, dNTPs, dUTP, monovalent cations, divalent cations, and additives.

3. The enzyme digestion-fluorescent quantitative PCR detection method as described in claim 3, characterized in that, The restriction endonuclease is at least one of Xma I, Sma I, Nha XI, BssH II, or Acc II.

4. The enzyme digestion-fluorescent quantitative PCR detection method as described in claim 3, characterized in that, When detecting the TERTC250T mutant, the sequence of the TERTC250T mutant is shown in SEQ ID NO.1, the sequence of the primer is shown in SEQ ID NO.2 or SEQ ID NO.3, and the sequence of the probe is shown in SEQ ID NO.

5.

5. The enzyme digestion-fluorescent quantitative PCR detection method as described in claim 3, characterized in that, When detecting CXCR4 gene methylation, the sequence of the CXCR4 gene is shown in SEQ ID NO.7, the sequence of the primer is shown in SEQ ID NO.8 or SEQ ID NO.9, and the sequence of the probe is shown in SEQ ID NO.

10.

6. The enzyme digestion-fluorescent quantitative PCR detection method as described in claim 4 or 5, characterized in that, The reaction system is 10-50 µL, and the sample loading volume is 3-10 µL.

7. The enzyme digestion-fluorescent quantitative PCR detection method as described in claim 6, characterized in that, The concentration of the primer is 200-500 nM, and the concentration of the probe is 200-500 nM.

8. The enzyme digestion-fluorescence quantitative PCR detection method as described in claim 7, characterized in that, The addition amount of Xma I is 1-10U.

9. The enzyme digestion-fluorescent quantitative PCR detection method as described in claim 8, characterized in that, The reaction procedure includes an enzyme digestion temperature of 30-60℃, an enzyme digestion time of 15-60 min, a denaturation temperature of 94-96℃, an annealing temperature of 60-66℃, and a cycle number of 40-50 cycles.

10. The enzyme digestion-fluorescent quantitative PCR detection method as described in claim 9, characterized in that, The reaction system is a one-step closed system.