A method for visualizing genetic transformation of hairy roots of tripterygium wilfordii based on agrobacterium rhizogenes and ruby reporter gene mediation
By combining Agrobacterium rhizogenes K599 with the RUBY reporter gene, hairy roots were induced at the wound site of Clematis chinensis stem segments using vacuum filtration and dark immersion methods. The RUBY visual reporter system was then used for screening, solving the problem of hairy root induction in woody plants and achieving efficient and low-cost gene function research and screening.
Patent Information
- Application Number
- CN202611138336.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-29
- Publication Date
- 2026-08-25
AI Technical Summary
Existing technologies are insufficient for efficiently inducing hairy roots in woody plants such as Clematis armandii, and existing screening methods are cumbersome and costly, making it difficult to meet the need for rapid screening.
Hairy roots were induced at the stem wounds of *Trifolium repens* using *Agrobacterium rhizogenes* K599 combined with the RUBY reporter gene via vacuum filtration and dark immersion. The RUBY visual reporter system for the betaine synthesis pathway was then used for non-destructive, real-time screening.
This study enabled efficient induction and rapid screening of hairy roots of *Trifolium repens*, reduced operating costs, provided an efficient and stable gene function research platform, and promoted the creation of new germplasm of medicinal plants and the industrialization of active ingredients.
Smart Images

Figure CN122629136A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant bioengineering, specifically relating to a visual genetic transformation method for the hairy roots of *Agrobacterium rhizogenes* mediated by *RUBY* reporter gene. Background Technology
[0002] *Tetrastigma hemsleyanum* Diels et Gilg, a perennial medicinal plant belonging to the Vitaceae family and the *Tetrastigma* genus, possesses properties such as clearing heat and detoxifying, reducing inflammation and relieving pain, and anti-tumor effects. However, functional genomics research on *Tetrastigma hemsleyanum* has long been limited by the lack of stable genetic transformation systems, necessitating the establishment of an efficient and rapid gene function identification platform.
[0003] Agrobacterium rhizogenes-mediated hairy root transformation technology has become one of the core methods for analyzing plant functional genes due to its ease of operation, short growth cycle, and stable inheritance of exogenous genes. Hairy roots also possess excellent physiological properties such as rapid growth rate, hormone-driven growth, genetic stability, and efficient accumulation of secondary metabolites, thus showing broad application prospects in root biology, plant-microbe interactions, and research on biosynthetic pathways of active ingredients in medicinal plants. However, existing identification systems for positive transformants of plant hairy roots generally have technical shortcomings: PCR relies on nucleic acid extraction and amplification, which is cumbersome; GUS histochemical staining requires exogenous substrates and the detection process is destructive; GFP fluorescence detection relies on fluorescence microscopy, which is lengthy and costly, making it difficult to meet the needs of rapid screening of a large number of transformants; existing hairy root induction methods rely on tissue culture technology, and the strict aseptic environment significantly increases the difficulty of operation; the woody vine *Tripterygium wilfordii* has a high degree of stem lignification, making *Agrobacterium* infection difficult and explant selection limited (conventional explants are cotyledons, leaves, or petioles), and the hairy root induction efficiency of *Tripterygium wilfordii* is fundamentally different from that of herbaceous plants, making it difficult to apply traditional hairy root transformation technology on a large scale in perennial woody plants such as *Tripterygium wilfordii*.
[0004] In recent years, the RUBY visual reporter system, based on the betaine synthesis pathway, has brought about a technological revolution in plant genetic transformation. This system integrates genes encoding three key enzymes required for betaine biosynthesis, converting the substrate tyrosine into a visible bright red betaine pigment. Its core advantages are: the detection results do not rely on any exogenous substrates, special equipment, or complex staining procedures, enabling non-destructive, real-time, and high-contrast screening of transformants, and it has no known toxic side effects on recipient cells.
[0005] Therefore, developing a novel hairy root induction system that does not rely on tissue culture and a sterile environment, and integrating RUBY reporter gene-mediated visualization screening, is of great significance for accelerating the functional analysis of *Trifolium repens* genes, promoting the creation of new germplasm of medicinal plants, and facilitating the industrialization of active ingredients. Summary of the Invention
[0006] The purpose of this invention is to provide a method for visualizing the hairy root transformation of *Tripterygium wilfordii* mediated by *Agrobacterium rhizogenes*, enabling rapid induction and screening of transgenic hairy roots without relying on tissue culture or a sterile environment. This method is simple to operate, low in cost, and quick, avoiding cumbersome aseptic procedures, and provides important technical support for gene function research of *Tripterygium wilfordii*.
[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0008] In a first aspect, the present invention provides a method for visual genetic transformation of the hairy roots of *Agrobacterium rhizogenes* mediated by *Ruby* reporter gene, comprising the following steps:
[0009] (1) Preparation of explants: Using aseptic tissue culture seedlings of Clematis chinensis as material, the lower end of the stem and the original root were removed, the base of the stem was retained and wounds were made to serve as explants;
[0010] (2) Preparation of infection solution: After activating and culturing recombinant Agrobacterium rhizogenes K599 carrying the RUBY reporter gene, the culture was resuspended in a liquid culture medium containing acetylsyringone to obtain the infection solution;
[0011] (3) Infection and co-culture: The explants were immersed in the infection solution and vacuum filtered for 5 min under a pressure of 0.08~0.12 MPa. Then, they were soaked in the dark for 14~16 h. The infected explants were then transferred to nutrient soil for co-culture.
[0012] (4) Screening of positive hairy roots: Transgenic positive hairy roots were obtained by observing whether red root-like tissue was produced at the wound site of the explant under natural light.
[0013] Preferably, the method of creating the wound in step (1) is to make three 1-1.5 cm long cuts on the epidermis at the base of the stem.
[0014] Preferably, the concentration of acetylsuccinone in step (2) is 25 mg / L, the activation culture conditions are 28℃, 100 r / min in a shaker in the dark for 2 h, and the OD600 value of the infection solution is 0.8.
[0015] Preferably, the RUBY reporter gene in step (2) is encoded by a nucleotide sequence as shown in SEQ ID NO.1, and the recombinant Agrobacterium rhizogenes K599 carrying the RUBY reporter gene contains an overexpression vector or a CRISPR / Cas9 gene knockout vector targeting the Trifolium repens ThFLS116 gene.
[0016] SEQ ID NO.1:
[0017]
[0018] Preferably, the nucleotide sequence of the ThFLS116 gene is shown in SEQ ID NO.2; and the sgRNA sequence targeted by the CRISPR / Cas9 gene knockout vector is shown in SEQ ID NO.9 and SEQ ID NO.10.
[0019] SEQ ID NO.2:
[0020]
[0021] SEQ ID NO.9:
[0022] TCTTATGAACTCCGGCGGGATGG
[0023] SEQ ID NO.10:
[0024] GAATTCCATGATTGACGATCTGG
[0025] Preferably, the co-cultivation in step (3) involves first culturing in the dark for 24 hours, and then culturing under light conditions until red hairy roots appear.
[0026] Secondly, the present invention provides the application of the above method in constructing transgenic plants with overexpression or knockout of the ThFLS116 gene of *Trifolium repens*.
[0027] Thirdly, the present invention provides the application of the above method in screening gene functions that regulate the root development and / or flavonoid synthesis metabolism of *Trifolium repens*.
[0028] Fourthly, this invention provides a method for verifying the function of the *Trifolium repens* ThFLS116 gene, comprising the following steps:
[0029] (1) Construct ThFLS116 gene overexpression vector and CRISPR / Cas9 knockout vector, and transform them into Agrobacterium rhizogenes K599 competent cells, respectively;
[0030] (2) Prepare the infection solution according to the above method and infect the explants of Trifolium repens to obtain transgenic hairy root plants with ThFLS116 overexpression and knockout.
[0031] (3) Perform phenotypic analysis on the hairy roots of transgenic plants, and count the number of roots, total root length and root diameter;
[0032] (4) The difference in flavonoid content in the hairy roots of transgenic plants and unloaded control plants was detected by LC-MS to verify the regulatory function of the ThFLS116 gene on root development and flavonoid synthesis metabolism.
[0033] Preferably, the overexpression vector is pCAMBIA3302-ThFLS116, and the CRISPR / Cas9 knockout vector is pIB2-ThFLS116.
[0034] Preferably, the flavonoids in step (4) include apigenin-7-glucoside, noriheptacortin, 5-hydroxy-4,7-dimethoxyflavone and icariin.
[0035] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0036] This invention utilizes the characteristics of Agrobacterium rhizogenes K599 to directly induce transgenic hairy roots at the wound site of infected *Trifolium repens* seedlings, without relying on tissue culture or a sterile environment, making the operation simple and inexpensive. Furthermore, this invention overcomes the technical bottleneck of hairy root transformation in the woody vine *Trifolium repens*. Due to the high degree of lignification in *Trifolium repens* stems and the difficulty of Agrobacterium infection, directly applying existing injection or soaking methods suitable for herbaceous plants cannot effectively induce hairy roots. Therefore, this invention, targeting the anatomical characteristics of lignified stem segments of *Trifolium repens*, employs vacuum filtration combined with dark soaking to force the Agrobacterium infection solution into the deep layers of lignified tissue, combined with systematic optimization of the Agrobacterium infection concentration (OD). 600 By identifying the value and type of Agrobacterium, we successfully overcame the technical barriers unique to this species, resulting in a positive hairy root induction rate of up to 20% for *Trifolium repens*.
[0037] This invention introduces the RUBY visualization reporting system, which reveals that successfully transformed hairy roots exhibit a distinct red phenotype due to the accumulation of betalains. This phenotype is visible to the naked eye under natural light, eliminating the need for expensive equipment such as fluorescence microscopes or destructive detection methods like chemical color development. This enables non-destructive, real-time, and high-throughput screening of transformants, significantly reducing experimental costs and operational barriers.
[0038] This invention provides an efficient, stable, and visualized technical platform for the study of *Tripterygium wilfordii* gene function (such as root development and verification of stress resistance genes), secondary metabolite production, and variety improvement using gene editing technologies such as CRISPR / Cas9. Using the visualized transformation system established in this invention, the novel *Tripterygium wilfordii* gene ThFLS116 (SEQ ID NO.2) was cloned and functionally verified for the first time. Phenotypic analysis showed that the total root length and number of lateral roots were significantly reduced in ThFLS116 gene overexpression lines, while the root diameter was significantly increased in CRISPR / Cas9 knockout lines, demonstrating that this gene has a species-specific root development regulatory pattern in *Tripterygium wilfordii*. Simultaneously, LC-MS detection revealed that the ThFLS116 gene can specifically regulate the synthesis and metabolism of flavonoid active components in *Tripterygium wilfordii*. These findings provide important gene resources and a theoretical basis for molecular breeding and targeted regulation of active components in *Tripterygium wilfordii*. Attached Figure Description
[0039] Figure 1 This is a plasmid map carrying the RUBY reporter gene in Example 1 of the present invention.
[0040] Figure 2PCR identification of five Agrobacterium rhizogenes transformed with pCAMBIA3302-RUBY. M: marker; 1: K599-RUBY; 2: MSU440-RUBY; 3: C58C1-RUBY; 4: Ar.Qual-RUBY; 5: Ar.1193-RUBY.
[0041] Figure 3 This is a schematic diagram of inducing hairy roots of *Trifolium repens* using the injection method.
[0042] Figure 4 This is a schematic diagram of inducing hairy roots of *Trifolium repens* using leaflets.
[0043] Figure 5 This is a schematic diagram of the infection process in aseptic seedlings of *Trifolium repens*.
[0044] Figure 6 Three-leaf clover plants with red hairy roots were obtained after infection with Agrobacterium rhizogenes K599-RUBY.
[0045] Figure 7 PCR identification of the RUBY reporter gene in the *Trifolium repens* compound plant. M: marker; 1: leaf; 2: stem; 3: white root; 4: red root; 5: wild-type *Trifolium repens* root.
[0046] Figure 8 The color development of empty vector K599-pCAMBIA3302, empty vector K599-pIB2, overexpression vector K599-pCAMBIA3302-ThFLS116, and knockout vector K599-pIB2-ThFLS116 in tobacco leaves at 24h, 36h, 48h, and 60h. In the top image, the left side of the leaf shows red expression of the knockout empty vector RUBY, and the right side shows red expression of the overexpression empty vector RUBY. In the bottom image, the left side of the leaf shows red expression of RUBY in the pCAMBIA3302-ThFLS116 vector, and the right side shows red expression of RUBY in the pIB2-ThFLS116 vector.
[0047] Figure 9 The three types of plants are complexes of *Trifolium repens* with transgenic hairy roots: a) empty vector plant wt-3302; b) empty vector plant wt-pib2; c) overexpressing plant FLS-OE; d) knockout plant FLS-KO.
[0048] Figure 10 The results are statistical results of the hairy root phenotype of Clematis armandii; a, b, c: statistical results of root number, total root length and root diameter of overexpressing plants and unexpressed plants; d, e, f: statistical results of root number, total root length and root diameter of knockout plants and unexpressed plants.
[0049] Figure 11Results of flavonoid content determination in the hairy roots of knockout plants FLS-KO and empty plants. Detailed Implementation
[0050] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise defined, the technical terms used below have the same meaning as understood by those skilled in the art.
[0051] Materials and Methods:
[0052] Plant material: The seedlings of *Trifolium repens* were obtained from Lishui Academy of Agricultural Sciences and sterile tissue culture seedlings were obtained through tissue culture, which served as the material source for this invention.
[0053] Strains and vectors: Agrobacterium rhizogenes K599, MSU440, C58C1, Ar.1193, and Ar.Qual competent cells were all purchased from Weidi Biotechnology Co., Ltd. Unless otherwise specified, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field.
[0054] Example 1: A visual genetic transformation method for hairy roots of *Agrobacterium rhizogenes* mediated by Agrobacterium rhizogenes and the RUBY reporter gene.
[0055] Transformation of Agrobacterium competent cells using the freeze-thaw method: (1) Take K599, MSU440, C58C1, Ar.1193 and Ar.Qual Agrobacterium competent cells stored at -80℃ and place them in an ice-water bath; (2) Add 1 μg pCAMBIA3302-RUBY (plasmid map shown) to every 100 μL of competent cells. Figure 1 (3) Add 700 μL of antibiotic-free LB liquid medium and culture at 28℃ with shaking for 2-3 h; (4) Centrifuge at 6000 r / min for 1 min to collect the bacteria, remove 600 μL of LB liquid medium and keep 100 μL of supernatant, and resuspend by pipetting; (5) Spread the bacterial solution on LB plates containing the corresponding concentration of antibiotics (different Agrobacterium species and their resistance are shown in Table 1), invert and place in a 28℃ incubator for 2-3 days; (6) Pick a single colony and expand it in LB liquid medium containing the corresponding antibiotic. Take 2 μL of the expanded bacterial solution as a template and perform PCR amplification using RUBY reporter gene primers. The results show that all 5 Agrobacterium species obtained by transformation can amplify the RUBY fragment ( Figure 2 ).
[0056] Table 1. Different Agrobacterium types and their corresponding antibiotic resistance
[0057]
[0058] Preparation of infection solution: The five transformed Agrobacterium species K599-RUBY, MSU440-RUBY, Ar.Qual-RUBY, Ar.1193-RUBY, and C58C1-RUBY were streaked into LB solid medium containing the corresponding antibiotics for activation. Single colonies were picked and cultured in LB liquid medium containing the corresponding antibiotics with shaking (28℃, 200 r / min) until the OD value reached 0.8-1.0. Take 50 mL of bacterial suspension into a 50 mL centrifuge tube, centrifuge at 5000 r / min for 10 min, discard the supernatant, and collect the bacterial cells; resuspend the bacterial cells in MS liquid medium containing 25 mg / L AS in a clean bench, centrifuge at 5000 r / min for 10 min, discard the supernatant, and collect the bacterial cells; resuspend the bacterial cells in MS liquid medium containing 25 mg / L AS in a clean bench and dilute to an OD value of 0.8; incubate the obtained bacterial suspension in a shaker at 24℃ and 80 r / min in the dark for 2 h to prepare the infection solution.
[0059] Different methods were used to induce hairy roots in *Trifolium repens*, as detailed below:
[0060] Injection-induced hairy roots of *Trifolium repens*: Five prepared infection solutions were injected into the leaves and axillary buds of live *Trifolium repens* plants using a disposable sterile syringe, and the plants were treated in the dark for 24 hours. Figure 3 After (A) in the above steps, the plants were placed in an artificial growth chamber for cultivation, and the induction of hairy roots was observed daily. The results showed that the injection method could not induce hairy roots in *Trifolium repens*, and the injection site turned brown. Figure 3 (B in the image, the red circle indicates the injection site).
[0061] The following steps were taken to induce hairy roots using leaves of *Trifolium repens* as explants: (1) Cut sterile leaves of *Trifolium repens* seedlings in a clean bench, cut the leaves into 1cm square pieces and make wounds on the leaf surface, and pre-culture them in MS solid medium with 0.5mg / L NAA for 2 days; (2) Place the pre-cultured sterile seedling leaves in the infection solution and infect them at room temperature by shaking at 80 r / min for 30 min; (3) Remove the infected leaves in a clean bench and blot the bacterial solution on the leaf surface with sterile filter paper, and co-culture them in MS solid medium with 0.5 mg / L NAA and 25 mg / L AS for 2 days; (4) After co-culturing the explants with *Agrobacterium* for 2-3 days (white bacterial spots grow around the wounds of the *Trifolium repens* explants), remove the explants from the medium in a clean bench and place them in MS liquid medium with 300 mg / L Ti (termethin), and infect them at room temperature by shaking at 80 r / min for 30 min. After rinsing with sterile water three times, the surface moisture of the explant is dried and cultured in MS medium containing 0.5 mg / L NAA and 300 mg / L Ti. (5) When the hairy roots grow to about 2 cm, they can be cut off and cultured in solid medium containing B5, 0.5 mg / L 6-BA, 0.5 mg / L KT, and 300 mg / L Ti. The subculture medium is changed once a month, and the concentration of antibiotic Ti in the medium is gradually reduced. After multiple subcultures, Agrobacterium is completely killed, and Ti is no longer added to the medium.
[0062] The results showed that approximately 25 days after K599 infection, noticeable small red spots would appear at the wound site on the leaves. Figure 4 In the case of A), red hairy roots grow in about 45 days. Figure 4 In the study, the positive rate of Agrobacterium rhizogenes (B) was only 5.2%, and the remaining Agrobacterium rhizogenes failed to induce red hairy roots. Subsequently, the induced red hairy roots were cut off and cultured in subculture medium. The hairy roots could not branch and eventually turned brown and died.
[0063] Induction of hairy roots from living *Trifolium repens* stem segments: Experimental procedure as follows Figure 5 As shown, the specific steps are as follows: (1) Take a 4-week-old healthy tissue culture sterile seedling of *Trifolium repens* cultured in the laboratory, and use a scalpel to obliquely cut off the lower end of the stem and all the original roots of the tissue culture seedling, retaining the part above the stem base, and make appropriate cuts at the base to improve the infection efficiency; (2) Pour the prepared Agrobacterium infection solution into the tissue culture glass bottle, immerse the wounded *Trifolium repens* stem base in the infection solution, vacuum filter for 5 min, and soak in the dark for 16 h; (3) Take out the *Trifolium repens* stem segment and insert it into sterilized nutrient soil (peat soil: perlite: vermiculite = 4:1:1 (v:v:v)) and culture in the dark for 24 h. As a result, after 21 days of culture, red hairy roots grew, forming a sharp contrast with a small number of white non-transformed roots. Figure 6The infection efficiency of the five Agrobacterium species was statistically analyzed, i.e., the number of strains that grew red hairy roots / the total number of strains. The results showed that K599 induced the highest positive rate of hairy roots, which was 17% (Table 2). Therefore, Agrobacterium rhizogenes K599 was selected as the strain for genetic transformation of Clematis chinensis, and living Clematis chinensis stem segments were selected as explant materials for subsequent experiments.
[0064] Table 2. Positive rates of Agrobacterium-induced hairy roots of Clematis armandii by different Agrobacterium types
[0065]
[0066] Identification of transgenic hairy roots of *Trifolium repens*: DNA was extracted from leaves, stems, white roots, and red roots of *Trifolium repens* composite plants using the TPS method. Amplification was performed using RUBY reporter gene primers, followed by agarose gel electrophoresis. Wild-type *Trifolium repens* roots were used as a control group. The PCR amplification system consisted of: 2× Taq Master Mix, 10 μL; Ruby-F (10 μM), 1 μL; Ruby-R (10 μM), 1 μL; template DNA (approximately 50 ng), 1 μL; and ddH2O to a final volume of 20 μL. The PCR amplification program was as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 sec, 60℃ annealing for 30 sec, 72℃ extension for 1 min, with 30 cycles; after cycling, a final extension at 72℃ for 5 min, followed by incubation at 4℃. The results showed that the leaves, stems, and white roots of the *Trifolium repens* compound plant did not show the target band for RUBY; only the red hairy roots could amplify the RUBY reporter gene (fragment size approximately 3951 bp), indicating that RUBY was successfully integrated into the transgenic hairy root genome. Figure 7 ).
[0067] Example 2: Hairy root induction by bacterial suspensions with different OD values
[0068] This embodiment uses *Agrobacterium rhizogenes* K599 containing the pCAMBIA3302-Ruby vector obtained in Example 1. The *Agrobacterium rhizogenes* bacterial suspension was prepared according to the method in Example 1, with the only difference being that during the resuspension process, the bacterial pellet was resuspended in MS liquid medium (pH 6.0) containing 25 mg / L acetylsuccine and 0.01% Silwet-77, and the OD was adjusted accordingly. 600 The OD values were adjusted to 0.2, 0.4, 0.6, 0.8, and 1.0, and activated at room temperature for 2 hours before use to obtain different OD values. 600The bacterial inoculum was then used to infect the stems of *Trifolium repens* with leaves at each concentration, following the method described in Example 1. After inoculation, the stems were cultured and induced for 21 days as described in Example 1, and the induction of hairy roots was observed and statistically analyzed. The induction rate was calculated as the percentage of infected stem segments producing red hairy roots out of the total number of stem segments. The results are shown in Table 3. 600 The highest induction efficiency (20%) was achieved when the OD value was 0.8; followed by... 600 When the value is 1.0, the induction efficiency is 17.5%; therefore, the OD is determined. 600 =0.8 is the optimal infection concentration.
[0069] Table 3. Effects of different OD values of the inoculum on the induction of hairy roots in *Trifolium repens*
[0070]
[0071] Example 3: Construction of ThFLS116 gene editing and overexpression transgenic materials based on the established system
[0072] In this embodiment, a CRISPR / Cas9 vector and an overexpression vector for the target gene ThFLS116 were constructed, transformed into competent Agrobacterium rhizogenes cells, and explants were prepared by transfection. Phenotypic data were analyzed. The difference in the content of flavonoids, a medicinal component, between transgenic plants and empty vector plants was detected by LC-MS to verify gene function. The nucleotide sequence of sgRNA and the primers for constructing the overexpression and CRISPR / Cas9 vectors are shown in Table 4.
[0073] Table 4 Primers for constructing overexpression vectors and CRISPR / Cas9 vectors
[0074]
[0075] cDNA synthesis and target fragment amplification: Total RNA was extracted from *Tripterygium wilfordii* using the FastPure Universal Plant Total RNA Isolation Kit (Vazyme, Nanjing). cDNA was synthesized by reverse transcription using the FastKing cDNA First-Strand Synthesis Kit (TIANGEN, Beijing). Specific experimental procedures are detailed in the instruction manual. Using the quality-tested *Tripterygium wilfordii* cDNA as a template, PCR amplification was performed using the ThFLS116 primer for the target gene. The target fragment was purified by agarose gel electrophoresis.
[0076] Two gRNAs were designed using NCBI to prevent off-target effects. The knockout vector gRNA fragment was obtained through two rounds of PCR amplification. The first round of amplification used the osGRNA-u6 plasmid as a template, and the PCR amplification program was: 98℃ for 3 min; (98℃, 10 s, 42℃, 10 s, 72℃, 5 s) for 10 cycles. The second round of amplification used the product of the first round of amplification as a template, and the amplification program was: 98℃, 15 s, 62℃, 10 s, 72℃, 5 s for a total of 20 cycles, and stored at 4℃.
[0077] Vector construction: Based on the sequence characteristics of the expression vector pCAMBIA3302 and the target gene ThFLS116, the vector was linearized using the restriction endonuclease XhoI; based on the characteristics of the knockout vector pIB2 and the gRNA fragment, the vector was linearized using the restriction endonuclease BsaI. The digestion system consisted of 1 µg plasmid DNA, 1 µL restriction endonuclease, 1 µL 10× cut buffer, and ddH2O to a final volume of 10 µL. The required amounts of vector and insert fragment for the recombination reaction were calculated according to the seamless cloning kit requirements, and the recombination reaction system was prepared as follows: 4 µL 2×GM Uni buffer, 1 µL Uni EM, 1 µL linearized vector fragment, and 4 µL target fragment. The overexpression vector pCAMBIA3302-ThFLS116 and the gene knockout vector pIB2-ThFLS116 were constructed through homologous recombination. The ligation products were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. After the sequencing results were verified to be correct, 5 µL of the ligation product was transformed into E. coli and plated on LB agar plates containing 100 mg / L kanamycin.
[0078] Verification of transient expression efficiency and creation of transgenic composite plants: The obtained overexpression vector pCAMBIA3302-ThFLS116-RUBY, knockout vector pIB2-ThFLS116-RUBY, empty vector pCAMBIA3302-RUBY, and empty vector pIB2-RUBY were transformed into K599 competent cells. Infection solution (OD) was prepared according to the method in Example 1. 600 =0.8), using a disposable sterile syringe to draw up the infection solution prepared above, and injecting it into the leaves of 3-4 week old wild-type tobacco potted seedlings, which were then placed in a growth chamber for light cultivation. The leaves were observed and photographed every 12 hours. The results showed that red ( ) appeared on the tobacco leaves after 36 hours. Figure 8 This indicates that the RUBY reporter gene in the constructed recombinant can be expressed normally and can be used for subsequent infection experiments.
[0079] In addition, transgenic composite plants were induced based on the visual genetic transformation system of Trifolium repens hairy roots established in Example 1. The overexpressing plant was named FLS-OE, the knockout plant was named FLS-KO, and the empty vector plants were named wt-3302 and wt-pib2. Figure 9 ).
[0080] Phenotypic analysis: Statistical significance analysis was performed using IBM SPSS Statistics 20 on the total root length, lateral root number, and root diameter of the red hairy roots of *Trifolium repens*. The results showed that the total root length and lateral root number of the ThFLS116 overexpressing line FLS-OE were significantly less than those of the ThFLS116 knockout line FLS-KO; while the root diameter of the ThFLS116 knockout line was significantly greater than that of the ThFLS116 overexpressing line and the wild-type line. Figure 10 ).
[0081] Flavonoid content determination: The flavonoid content was determined by ultra-high performance liquid chromatography-tandem mass spectrometry (UPLC-MS / MS) using FLS-KO hairy roots induced by induction. The results showed that the contents of apigenin-7-glucoside and nobiletin in FLS-KO hairy roots were significantly upregulated compared to those in untreated induced roots, while the contents of 5-hydroxy-4,7-dimethoxyflavone (7,4'-Di-O-methylapigenin) and icariside I were significantly downregulated. Figure 11 ).
[0082] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. A method for visual genetic transformation of the hairy roots of *Agrobacterium rhizogenes* mediated by *Ruby* reporter gene, characterized in that, Includes the following steps: (1) Preparation of explants: Using aseptic tissue culture seedlings of Clematis chinensis as material, the lower end of the stem and the original root were removed, the base of the stem was retained and wounds were made to serve as explants; (2) Preparation of infection solution: After activating and culturing recombinant Agrobacterium rhizogenes K599 carrying the RUBY reporter gene, the culture was resuspended in a liquid culture medium containing acetylsyringone to obtain the infection solution; (3) Infection and co-culture: The explants were immersed in the infection solution and vacuum filtered for 5 to 10 min under a pressure of 0.08 to 0.12 MPa. Then, they were soaked in the dark for 14 to 16 h. The infected explants were then transferred to nutrient soil for co-culture. (4) Screening of positive hairy roots: Transgenic positive hairy roots were obtained by observing whether red root-like tissue was produced at the wound site of the explant under natural light.
2. The method for visual genetic transformation of hairy roots of *Clerodendrum trifoliata* mediated by *Agrobacterium rhizogenes* and the RUBY reporter gene according to claim 1, characterized in that, The method of creating the wound in step (1) is to make three 1-1.5cm scars on the epidermis at the base of the stem.
3. According to the method for visual genetic transformation of hairy roots of *Agrobacterium rhizogenes* mediated by *Ruby* reporter gene as described in claim 1, the concentration of acetylsyringone in step (2) is 25 mg / L, and the activation culture conditions are 28℃, 100 r / min shaker culture in the dark for 2 h, and the OD of the infection solution is... 600 The value is 0.
8.
4. The method for visual genetic transformation of hairy roots of Clematis terniflora mediated by Agrobacterium rhizogenes and RUBY reporter gene according to claim 1, wherein the RUBY reporter gene in step (2) is encoded by the nucleotide sequence shown in SEQ ID NO.1, and the recombinant Agrobacterium rhizogenes K599 carrying the RUBY reporter gene contains an overexpression vector or a CRISPR / Cas9 gene knockout vector targeting the Clematis terniflora ThFLS116 gene.
5. The method for visual genetic transformation of hairy roots of Clematis chinensis mediated by Agrobacterium rhizogenes and RUBY reporter gene according to claim 4, wherein the nucleotide sequence of the ThFLS116 gene is shown in SEQ ID NO.2; and the sgRNA sequence targeted by the CRISPR / Cas9 gene knockout vector is shown in SEQ ID NO.9 and SEQ ID NO.
10.
6. According to the method for visual genetic transformation of hairy roots of Clematis armandii mediated by Agrobacterium rhizogenes and RUBY reporter gene as described in claim 1, the co-culture in step (3) is to first culture in the dark for 24 h, and then culture under light conditions until red hairy roots appear.
7. The application of the method according to any one of claims 1-6 in constructing transgenic plants with overexpression or knockout of the ThFLS116 gene of *Trifolium repens*.
8. The application of the method according to any one of claims 1-6 in screening for gene functions that regulate the root development and / or flavonoid synthesis metabolism of *Trifolium repens*.
9. A method for verifying the function of the *Trifolium repens* ThFLS116 gene, characterized in that, Includes the following steps: (1) Construct ThFLS116 overexpression vector and CRISPR / Cas9 knockout vector, and transform them into Agrobacterium rhizogenes K599 competent cells, respectively; (2) Prepare an infection solution according to any one of claims 1-6 and infect the explants of *Trifolium repens* to obtain transgenic hairy root plants with ThFLS116 overexpression and knockout; (3) Perform phenotypic analysis on the hairy roots of transgenic plants, and count the number of roots, total root length and root diameter; (4) The difference in flavonoid content in the hairy roots of transgenic plants and unloaded control plants was detected by LC-MS to verify the regulatory function of the ThFLS116 gene on root development and flavonoid synthesis metabolism.
10. The method according to claim 9, characterized in that, The flavonoids mentioned in step (4) include apigenin-7-glucoside, noriheptacortin, 5-hydroxy-4,7-dimethoxyflavone and icariin.