Mutated ncgl2165 promoter and its application in l-lysine production

Abstract

The application discloses a mutant NCgl2165 promoter and application thereof in L-lysine production, and belongs to the field of bioengineering and fermentation engineering.The mutant NCgl2165 promoter is subjected to base substitution at the positions from 477 to 488 in the-10 region relative to the original promoter.The application further discloses an expression cassette, a vector, a host cell containing the promoter and a recombinant corynebacterium glutamicum driven by the promoter pyc The application discloses a mutant NCgl2165 promoter and application thereof in L-lysine production, and belongs to the field of bioengineering and fermentation engineering.The mutant NCgl2165 promoter is subjected to base substitution at the positions from 477 to 488 in the-10 region relative to the original promoter.The application further discloses an expression cassette, a vector, a host cell containing the promoter and a recombinant corynebacterium glutamicum driven by the promoter pyc Gene expression can improve the L-lysine fermentation yield of the corynebacterium glutamicum.In a 5L fermenter, the L-lysine yield of the mutant promoter recombinant strain reaches 157.0 g / L, which is about 22.8% higher than that of the original strain.

Description

Technical Field

[0001] This invention relates to the mutant NCgl2165 promoter and its application in L-lysine production, belonging to the fields of bioengineering and fermentation engineering. Background Technology

[0002] L-Lysine is an important basic amino acid widely used in feed, food, pharmaceuticals, and chemicals. With the development of animal husbandry, the food industry, and biomanufacturing, the demand for L-lysine continues to increase. Therefore, developing microbial strains with higher L-lysine production capacity and their fermentation production methods has significant industrial value.

[0003] Corynebacterium glutamicum ( Corynebacterium glutamicum It is one of the most commonly used chassis microorganisms in industrial amino acid production and has been widely used in the fermentation production of L-glutamic acid, L-lysine and other amino acids.

[0004] pyc The gene-encoded pyruvate carboxylase catalyzes the carboxylation of pyruvate to oxaloacetate and is a crucial enzyme linking glycolysis and the synthesis of aspartic acid family amino acids. Enhancement pyc Gene expression is beneficial to increasing the supply of oxaloacetic acid and downstream aspartic amino acid precursors, thereby enhancing the ability to synthesize L-lysine.

[0005] However, the use of mutated NCgl2165 promoter substitution has not been fully disclosed in the prior art. pyc The natural promoter of the gene, and driven by this mutated promoter. pyc Technical solutions for increasing L-lysine production in Corynebacterium glutamicum through gene expression. Therefore, there is still a need to develop new promoter elements and their application methods to further improve L-lysine yield and production efficiency. Summary of the Invention

[0006] Addressing the lack of applicable technologies for enhancement pyc To address the problem of promoter elements that enhance L-lysine production capacity in Corynebacterium glutamicum and improve gene expression, this invention provides a mutant NCgl2165 promoter and its application in L-lysine production.

[0007] One object of the present invention is to provide a polynucleotide having promoter activity having a nucleotide sequence as shown in SEQ ID NO:1.

[0008] Another object of the present invention is to provide an expression cassette comprising the polynucleotide and a target gene operatively linked to the polynucleotide, preferably, the target gene encoding pyruvate carboxylase. pyc Gene.

[0009] Another object of the present invention is to provide a recombinant Corynebacterium glutamicum, wherein pyc The gene is expressed by the mutated NCgl2165 promoter, and the recombinant Corynebacterium glutamicum has an enhanced L-lysine production capacity.

[0010] Another object of the present invention is to provide a method for fermenting the production of L-lysine, the method comprising culturing recombinant Corynebacterium glutamicum containing the mutant NCgl2165 promoter in a culture medium and isolating L-lysine from the culture.

[0011] The present invention provides a mutant promoter, which is a promoter obtained by mutating positions 477-488 of the original NCgl2165 promoter sequence as shown in SEQ ID NO:2.

[0012] In one embodiment of the present invention, the 477th A is replaced by T and the 478th T is replaced by G.

[0013] In one embodiment of the present invention, the 477th to 488th positions of the mutant promoter are respectively: TGTGCTACAATC, TGTGATGTAATG, ATCCCTACAATG, TGCGCTACAATG, TGTGTTACAATG, TGTGCTACAACG, TTTGCTACAATG, TGTGCAACAATG, TGCGTTACAACG, TGTGCTACAATG.

[0014] This invention provides a polynucleotide with promoter activity, the nucleotide sequence of which is shown in SEQ ID NO:1. The polynucleotide is a mutated NCgl2165 promoter, with nucleotide substitutions at positions 477, 478, 479, 480, 481, 483, 484, and 488 relative to the original NCgl2165 promoter (SEQ ID NO:2).

[0015] In one embodiment, the mutation includes: A at position 477 being replaced by T, T at position 478 being replaced by G, C at position 479 being replaced by T, C at position 480 being replaced by G, A at position 481 being replaced by C, G at position 483 being replaced by A, T at position 484 being replaced by C, and C at position 488 being replaced by G. The original sequence of positions 477-488 of the NCgl2165 promoter is ATCCATGTAATC, and the corresponding sequence after mutation is TGTGCTACAATG.

[0016] The present invention also provides the application of the mutant promoter, the expression cassette, or the vector in improving the expression level of the target protein.

[0017] The present invention also provides the application of the mutant promoter, the expression cassette, or the vector in the preparation of products for increasing the expression level of a target protein.

[0018] The promoter described in this invention refers to a non-translated nucleic acid sequence located upstream of the coding region of a gene. This sequence contains at least an RNA polymerase binding site and has the activity of initiating the transcription of downstream genes into mRNA. The promoter sequence may also include a 5' untranslated region, which may contain transcription factor binding sites.

[0019] Based on the aforementioned promoter, the present invention provides an expression cassette containing the mutated NCgl2165 promoter. The expression cassette may be recombinant DNA obtained by operably linking a target gene downstream of the promoter, or recombinant DNA obtained by operably linking a target gene downstream of the promoter and operably linking other transcriptional or translational regulatory elements upstream or downstream.

[0020] This invention does not impose any particular limitation on the target gene. The promoter provided by this invention can drive transcription of any gene in microorganisms. When a gene has an expression intensity requirement matching the promoter, the promoter can be used. As a preferred embodiment of this invention, the promoter is used to drive transcription. pyc Gene expression was used to increase the expression level of pyruvate carboxylase in Corynebacterium glutamicum. pyc Genes can be located on chromosomes or on vectors that can replicate or integrate into host cells.

[0021] The present invention provides an expression cassette containing the above-mentioned mutant promoter.

[0022] The present invention also provides a vector containing the above-described mutant promoter or the above-described expression cassette.

[0023] The present invention also provides a vector containing the NCgl2165 promoter with the aforementioned mutation or the expression cassette. The vector may be an expression vector or a cloning vector, including but not limited to plasmid vectors, phage vectors, transposon vectors, and integration vectors for homologous recombination.

[0024] The technical effect of the mutant promoter described in this invention does not solely stem from conventional replacement of the -10 region, but rather from a specific combination of mutations obtained after grouped site-directed saturation mutation screening of the NCgl2165 promoter region from positions 477-488. This combination of mutations simultaneously enhances reporter gene expression, pycTranscriptional levels and L-lysine fermentation yields, relative to the original promoter and pyc The remarkable technical effects of natural promoters.

[0025] The present invention also provides a method for increasing the expression level of a target protein, the method comprising: constructing a recombinant plasmid expressing the target protein using the above-mentioned mutant promoter; or inserting the above-mentioned mutant promoter in series with the promoter originally contained in the plasmid to express the target protein.

[0026] The present invention also provides a recombinant vector containing the above-mentioned mutant promoter and a gene encoding pyruvate carboxylase.

[0027] In one embodiment of the present invention, the nucleotide sequence encoding the pyruvate carboxylase gene is shown in SEQ ID NO:7.

[0028] The present invention also provides a recombinant bacterium containing the above-mentioned mutant promoter, expression cassette, vector, or recombinant vector.

[0029] The present invention also provides that the recombinant bacteria are based on L-amino acid producing strains as chassis cells.

[0030] The present invention also provides that the recombinant bacteria is based on Corynebacterium glutamicum CICC 20655 as the chassis cell.

[0031] The present invention also provides recombinant Corynebacterium glutamicum containing the mutated NCgl2165 promoter, and pyc Gene expression is driven by the mutated NCgl2165 promoter.

[0032] In one embodiment, the recombinant Corynebacterium glutamicum chromosome pyc The natural promoter of the gene was replaced by the mutated NCgl2165 promoter.

[0033] The aforementioned replacement promoter can be implemented using conventional methods in the art. For example, the upstream and downstream fragments of the replacement promoter and the mutated NCgl2165 promoter can be ligated into a homologous recombination vector, introduced into the starting strain, and the replacement promoter in the starting strain can be achieved through homologous recombination. pyc Gene primitive promoter.

[0034] The present invention also provides a method for preparing L-amino acids, wherein the method comprises using the above-mentioned recombinant bacteria as a catalyst, wherein the recombinant bacteria are L-amino acid producing strains as chassis cells, and fermentation is carried out to prepare L-amino acids.

[0035] The present invention also provides a method for producing L-lysine by fermentation, the method comprising the step of culturing the recombinant Corynebacterium glutamicum in a culture medium. Specifically, the method includes: inoculating the recombinant Corynebacterium glutamicum into a seed culture medium for seed culture to obtain a seed liquid; inoculating the seed liquid into a fermentation culture medium for culture to obtain a fermentation broth; and separating and extracting L-lysine from the fermentation broth.

[0036] Beneficial effects The mutated NCgl2165 promoter provided by this invention can drive pyc The gene is expressed in Corynebacterium glutamicum. This promoter is used to regulate... pyc Gene expression can enhance pyruvate carboxylation and increase the supply of precursors required for L-lysine synthesis.

[0037] In the 5 L fermenter validation, with pyc Compared to the starting strain where gene expression is driven by the natural promoter, the NCgl2165 promoter mutated in this invention drives gene expression. pyc The L-lysine yield of the recombinant Corynebacterium glutamicum expressed by the gene was increased from 127.9 g / L to 157.0 g / L, and the sugar-acid conversion rate was increased from 38.9% to 50.0%, representing an increase of approximately 22.8% in yield and approximately 28.6% in sugar-acid conversion rate. Therefore, the mutant promoter, expression cassette, recombinant microorganism, and culture method of the present invention can be used for industrial fermentation production of L-lysine. Attached Figure Description

[0038] Figure 1 Original NCgl2165 promoter P 2165-WT With the mutated NCgl2165 promoter P 2165-M A schematic diagram of sequence alignment.

[0039] Figure 2 : Mutant NCgl2165 promoter replacement pyc A schematic diagram of the construction of recombinant Corynebacterium glutamicum, which is a natural promoter of the gene.

[0040] Figure 3 : pyc The gene expression of the starting strain Cgl-lys, driven by a natural promoter, and pyc OD of recombinant Corynebacterium glutamicum MMEC-P2165M, whose gene expression is driven by the mutant NCgl2165 promoter, in a 5 L fermenter 562 and L-lysine yield; where A is the OD of the optimal batch. 562 B represents the production of L-lysine. Detailed Implementation

[0041] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, where specific conditions are not specified, are generally performed under conventional conditions in the art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those familiar with the art.

[0042] The strain Cgl-lys (Corynebacterium glutamicum) involved in the following examples Corynebacterium glutamicum The strain used for L-lysine production in this application was purchased from CICC, with the identification number CICC 20655.

[0043] The culture media involved in the following examples are as follows: LB liquid medium: 10 g tryptone, 5 g yeast extract, 10 g sodium chloride, adjust pH to 6.8-7.2 with sodium hydroxide, bring volume to 1 L with distilled water, and sterilize at 121 °C for 20 min. For solid medium, add 20 g agar powder.

[0044] LBGB medium: 10 g tryptone, 5 g yeast extract, 10 g sodium chloride, 5 g glucose, 18.5 g brain and heart extract, adjust pH to 7.5 with sodium hydroxide, bring volume to 1 L with distilled water, and sterilize at 115 °C for 15 min. Add 20 g agar powder to prepare the solid medium.

[0045] LBHIS medium: 5 g tryptone, 2.5 g yeast extract, 5 g sodium chloride, 18.5 g brain and heart extract, 91 g D-sorbitol. Adjust pH to 7.5 with sodium hydroxide, bring volume to 1 L with distilled water, and sterilize at 115 °C for 15 min. For solid medium preparation, add 20 g agar powder.

[0046] Epo medium: 10 g tryptone, 5 g yeast extract, 10 g sodium chloride, 1 g Tween 80, 25 g glycine, 0.4 g isoniazid. Adjust pH to 7.5 with sodium hydroxide, bring volume to 1 L with distilled water, and sterilize at 115 °C for 15 min. For solid medium preparation, add 20 g agar powder.

[0047] Primary seed culture medium: urea 2.5 g, ammonium sulfate 5 g, potassium dihydrogen phosphate 0.5 g, dipotassium hydrogen phosphate 0.5 g, magnesium sulfate heptahydrate 0.5 g, yeast extract powder 1.8 g, tryptone 5 g, ferrous sulfate heptahydrate 6 mg, manganese sulfate monohydrate 4 mg, biotin 0.2 mg, vitamin B1 0.2 mg, glucose 40 g. Adjust the pH to 7.5 with sodium hydroxide, bring the volume to 1 L with distilled water, and sterilize at 115 °C for 15 min.

[0048] Secondary seed culture medium: 8 g ammonium sulfate, 0.8 g potassium dihydrogen phosphate, 0.8 g dipotassium hydrogen phosphate, 0.5 g magnesium sulfate heptahydrate, 10 mg ferrous sulfate heptahydrate, 4 mg manganese sulfate monohydrate, 0.02 mg biotin, 2 mg vitamin B1, 40 g glucose. Adjust the pH to 7.5 with sodium hydroxide, bring the volume to 1 L with distilled water, and sterilize at 115 °C for 15 min.

[0049] Fermentation medium: 8 g ammonium sulfate, 1 g potassium dihydrogen phosphate, 1 g dipotassium hydrogen phosphate, 0.5 g magnesium sulfate heptahydrate, 3 g yeast extract powder, 20 mg ferrous sulfate heptahydrate, 4 mg manganese sulfate monohydrate, 0.02 mg biotin, 2 mg vitamin B1, 60 g glucose, 0.5 mL defoamer, pH adjusted to 7.5 with sodium hydroxide, and brought to a final volume of 1 L with distilled water. Sterilize at 115 °C for 15 min.

[0050] The detection methods involved in the following embodiments are as follows: Cell concentration assay: Dilute an appropriate amount of fermentation broth and measure the OD using a UV spectrophotometer at a wavelength of 562 nm. 562 express.

[0051] L-Lysine production detection: Take 1 mL of fermentation broth, centrifuge at 12000 rpm for 5 min, collect the supernatant and dilute appropriately with deionized water. After filtration through a 0.22 μm filter membrane, determine the L-lysine content using an amino acid analyzer or high-performance liquid chromatography. Establish a standard curve by preparing 0.5 g / L, 1.0 g / L, 2.0 g / L, 5.0 g / L, and 10.0 g / L standard solutions of L-lysine hydrochloride. Calculate the L-lysine concentration in the fermentation broth according to the standard curve.

[0052] Formula for calculating sugar-acid conversion rate: Sugar-acid conversion rate (%) = (L-lysine production (g)) / (total glucose consumption (g)) × 100%.

[0053] Example 1: Obtaining the mutant NCgl2165 promoter Based on the upstream sequence of the NCgl2165 gene in the genome of Corynebacterium glutamicum ATCC 13032 from the NCBI database, the original NCgl2165 promoter with a length of 527 bp was obtained and named P. 2165-WT (SEQ ID NO: 2).

[0054] The original NCgl2165 promoter sequence P 2165-WT(SEQ ID NO: 2) cgaagatttgttttacagactgtgacgtaaggggagcggtgcgctcactgggatttcaggtatccatcaatcggtgtgcttcctggcaattgttgtggattttttaaagaacatttctacggaaactagct gcatgttcattccgctttgcaaagttttgcaaagaattatcgggtagtttcccgcgagatgtgatgtttctctcacgtttgacgcgaatcgcataaaactacaggtctgatgtccttttggtgagggtttga tgaaaaatctagccaccattattttgaagagaattgtggaaatccaagactgaaaactcgaaaagttaatcgctggccagtgattgaattcattgattcttgagcgtaaagggggaggaaaaggaaaaaatt ccagggaaaggtggttcaaagtaccggttggacggtaatgtgcaattcggatatatcaatagccccgcggtttcatgttgaatccatgtaatcgaaaaacacatcggggcccacacgaggaggattattaaa Based on promoter element prediction and sequence alignment, P was determined. 2165-WT The region from position 477 to 488 of the original NCgl2165 promoter is located in the -10 region of the promoter, and the original sequence of this region is ATCCATGTAATC. Since the -10 region is involved in RNA polymerase recognition and transcription initiation, this region was selected as the region for promoter activity modification in this embodiment.

[0055] The specific steps are as follows: (1) P 2165-WT (The original NCgl2165 promoter) was ligated upstream of the promoterless mKate reporter gene, and then ligated to the pECXK99E plasmid. Kpn I, Xba I restriction site, to obtain reporter plasmid pECXK99E-P 2165-WT -mKate.

[0056] The sequence of the mKate reporter gene (SEQ ID NO:3) is as follows: atgtcagaattaattaaagaaaatatgcacatgaaattatatatggaaggtactgtcaacaatcatcatttcaaatgcacatccgaaggtgaaggtaaaccatatgaaggcacacaaacaatgcgcatcaaagcagttgaaggtggacccctgccctttgcgtttgacattct cgcaacgagctttatgtacgggtctaaaacttttatcaatcacacccaaggcattcctgacttttttaaacagtcctttcctgaaggctttacctgggaacgtgtaacaacttatgaagatggcggtgtacttacagcaactcaagatacgagtttacaagatggctgtctga tttacaatgttaaaatccgtggcgtaaatttcccgagtaacggacccgtaatgcaaaaaaaaactcttggttgggaagcatcaacagaaaccttatatcctgcggacggtggcttagaaggacgcgcagacatggcactgaaattagttggaggcggtcatttaatctgcaac ctgaaaacaacctatcgttccaaaaaacccgctaaaaaccttaaaatgcctggagtatactatgttgatcgtcgcttagaacgtattaaagaagctgataaagaaacctacgttgaacaacatgaagtagccgtagcccgttattgtgaccttccgtcgaaattaggacatcgt (2) pECXK99E-P obtained in step (1) 2165-WT Using -mKate as a template, complementary mutant primers containing the degenerate base N were designed for the -10 region (positions 477-488) of the original NCgl2165 promoter (Table 1), where N represents an equimolar mixture of A, T, C, and G. To reduce the single-sample library size and improve screening coverage, the 12 consecutive bases from position 477-488 were divided into three 4bp windows to construct grouped site-directed saturation mutant libraries, as shown in Table 1.

[0057] Table 1: Design and screening results of NCgl2165 promoter-10 region grouped site-directed saturation mutant libraries

[0058] Site-directed saturation mutagenesis PCR was performed using a 50 μL reaction system: 25 μL of 2× high-fidelity PCR premix, 1.25 μL of 10 μmol / L upstream degenerate primer, 1.25 μL of 10 μmol / L downstream degenerate primer, and template plasmid pECXK99E-P. 2165-WT 10-50 ng of mKate, 1.5 μL of DMSO, and nuclease-free water to a final volume of 50 μL. The PCR reaction program was as follows: 98 ℃ pre-denaturation for 30 s; 98 ℃ denaturation for 10 s, 58 ℃ annealing for 15 s, and 72 ℃ extension for 30 s / kb, for a total of 25 cycles; followed by a final extension at 72 ℃ for 5 min.

[0059] (3) After PCR, add 20 U to the amplification product. Dpn I. Digest at 37 ℃ for 1 h to remove methylated template plasmid pECXK99E-P 2165-WT -mKate; After column purification of the digestion product, take 5-10 μL for conversion. E. coli DH5α competent cells were cultured at 37 °C for 12–16 h on LB plates containing 25 μg / mL kanamycin.

[0060] For each group library, at least 1000 single clones were collected, and the colonies were scraped and plasmids were extracted to prepare P. 2165-WT Three saturated mutant plasmid libraries grouped at positions 477-480, 481-484, and 485-488: pECXK99E- P 2165（477-480）mut -mKate、pECXK99E- P 2165（481-484）mut -mKate、pECXK99E-P 2165（485-488）mut -mKate.

[0061] (4) Electroporate the plasmid libraries obtained in step (3) into Corynebacterium glutamicum Cgl-lys ( C. glutamicum CICC 20655 competent cells were cultured at 30 °C for 36 h on LBHIS plates containing kanamycin (concentration: 50 μg / mL).

[0062] Single colonies were picked and inoculated into 96-well deep-well plates and cultured in LBGB medium at 30 °C and 800 rpm for 18 h. The OD of the strains in the fermentation broth was then measured. 562 and mKate fluorescence intensity (excitation wavelength 588 nm, emission wavelength 645 nm), expressed as fluorescence intensity / OD 562 (FI / OD) 562( ) was used as an indicator of relative promoter activity. For each library, the top 5% of clones with the highest relative activity were selected for promoter region PCR amplification and Sanger sequencing to determine the optimal base combinations for each window.

[0063] (5) Based on the sequencing results of the three grouped libraries, the following mutant combinations with positive effects were obtained, as shown in Table 2.

[0064] Table 2: Effects of NCgl2165 promoter mutants containing different sequences (positions 477-488)

[0065] The results show: The optimal combination is to combine TGTG obtained from Lib-477-480, CTAC obtained from Lib-481-484, and AATG obtained from Lib-485-488 to obtain a combined mutant promoter with the sequence TGTGCTACAATG at positions 477-488. This combined mutant promoter was further reconstructed using site-directed mutagenesis PCR or artificial synthesis, and its full-length sequence was confirmed by sequencing as shown in SEQ ID NO:1, and named P. 2165-M .

[0066] Mutated NCgl2165 promoter P 2165-M Sequence (SEQ ID NO:1): cgaagatttgttttacagactgtgacgtaaggggagcggtgcgctcactgggatttcaggtatccatcaatcggtgtgcttcctggcaattgttgtggattttttaaagaacatttctacggaaactagct gcatgttcattccgctttgcaaagttttgcaaagaattatcgggtagtttcccgcgagatgtgatgtttctctcacgtttgacgcgaatcgcataaaactacaggtctgatgtccttttggtgagggtttga tgaaaaatctagccaccattattttgaagagaattgtggaaatccaagactgaaaactcgaaaagttaatcgctggccagtgattgaattcattgattcttgagcgtaaagggggaggaaaaggaaaaaatt ccagggaaaggtggttcaaagtaccggttggacggtaatgtgcaattcggatatatcaatagccccgcggtttcatgttgatgtgctacaatggaaaaaacacatcggggcccacacgaggaggattattaaa Mutated NCgl2165 promoter (P) 2165-M ) and the original NCgl2165 promoter (P 2165-WT ) differential sites such as Figure 1 As shown in Table 3.

[0067] Table 3: Mutated NCgl2165 promoter (P 2165-M ) and the original NCgl2165 promoter (P 2165-WT ) differential sites

[0068] Example 2: Activity characterization of the mutant NCgl2165 promoter To verify the mutant NCgl2165 promoter (P 2165-M The activation activity of the original NCgl2165 promoter (P) will be enhanced. 2165-WT ) and the mutated NCgl2165 promoter (P 2165-M The promoter activity characterization vectors were constructed by linking the vectors upstream of the reporter gene and the empty vector control (CK). pyc Gene promoter P pycControl. The above vectors were introduced into Corynebacterium glutamicum host cells and cultured under the same conditions. Reporter gene expression signals were detected to characterize the relative promoter activity of different promoters. The specific steps are as follows: (1) Construction of recombinant vector P respectively 2165-WT (Original NCgl2165 promoter: SEQ ID NO:2), P 2165-M (The promoter after the NCgl2165 mutation: SEQ ID NO:1), P pyc ( pyc After the gene promoter is ligated upstream of the promoterless mKate reporter gene, it is ligated to the pECXK99E plasmid. Kpn I, Xba I restriction site, to obtain reporter plasmid pECXK99E-P 2165-WT -mKate、pECXK99E-P 2165-M -mKate、pECXK99E-P pyc -mKate.

[0069] pyc The gene promoter sequence (SEQ ID NO:4) is as follows: tgcaaagtttagaaatattttaagaggtaagatgtctgcaggtggaagcgtttaaatgcgttaaacttggccaaatgtggcaacctttgcaaggtgaaaaactggggcggggttagatcctggggggtttatttcattcactttggcttg aagtcgtgcaggtcaggggagtgttgcccgaaaacattgagaggaaaacaaaaaccgatgtttgattgggggaatcgggggttacgatactaggacgcagtgactgctatcacccttggcggtctcttgttgaaaggaataattactcta (2) pECXK99E-P 2165-WT -mKate、pECXK99E- P 2165-M -mKate、pECXK99E-P pyc -mKate and empty vector plasmid pECXK99E were introduced into Corynebacterium glutamicum host cells Cgl-lys ( C. glutamicum Recombinant strains were prepared from CICC20655: C. glutamicum CICC 20655 / pECXK99E-P 2165-WT-mKate、 C. glutamicum CICC 20655 / pECXK99E- P 2165-M -mKate、 C. glutamicum CICC 20655 / pECXK99E-P pyc -mKate、 C. glutamicum CICC 20655 / pECXK99E.

[0070] (3) The recombinant strains prepared in step (2) were cultured at 30 °C for 36 h on LBHIS plates containing kanamycin (concentration: 50 μg / mL); Single colonies were picked and inoculated into 96-well deep-well plates and cultured in LBGB medium at 30 °C and 800 rpm for 18 h. The OD of the strains in the fermentation broth was then measured. 562 And mKate fluorescence intensity, by calculating mKate fluorescence intensity (FI) versus OD 562 The ratios were used to characterize the activities of different promoters. The results are shown in Table 4. Table 4: Mutated NCgl2165 promoter P 2165-M With the original NCgl2165 promoter P 2165-WT Activity characterization

[0071] The above results indicate that: The average detection value of the empty vector control (CK) was 51.04; pyc The average detection value of the promoter was 59.54; the original NCgl2165 promoter (P 2165-WT The average detection value was 111.95; while the mutant NCgl2165 promoter (P) 2165-M The average detection value reached 2380.84.

[0072] With the original NCgl2165 promoter (P 2165-WT Compared to the mutated NCgl2165 promoter (P), 2165-M The initiation activity was increased by approximately 21.27 times; compared with pyc Compared to the mutated NCgl2165 promoter (P... 2165-M The initiation activity of the mutant NCgl2165 promoter was increased by approximately 39.99 times; compared with the empty vector control, the mutant NCgl2165 promoter (P) showed significantly increased initiation activity. 2165-M The detection value increased by approximately 46.65 times.

[0073] It can be seen that the mutated NCgl2165 promoter (P) 2165-M Compared to the original NCgl2165 promoter (P) 2165-WTIt has significantly enhanced initiation activity and can significantly improve the expression level of downstream genes.

[0074] Therefore, this mutant promoter (P) 2165-M It can be used as a highly active promoter to drive target gene expression, and is particularly suitable for driving gene expression. pyc Gene expression was used to enhance L-lysine production capacity in Corynebacterium glutamicum.

[0075] Example 3: Using the NCgl2165 mutant promoter P 2165-M replace pyc Natural promoter P pyc Recombinant vector construction The specific steps are as follows: NCgl2165 mutant promoter P 2165-M replace pyc The construction process of the natural promoter of recombinant Corynebacterium glutamicum is as follows: Figure 2 As shown.

[0076] Based on the preferred mutation combination obtained in Example 1, the mutant NCgl2165 promoter P was artificially synthesized. 2165-M (SEQ ID NO:1). When using PCR reconstruction, the original promoter P is used. 2165-WT Using a template, a promoter fragment P containing the combined mutation at positions 477-488 was amplified using complementary primers containing the target mutation. 2165-M The PCR products were digested with DpnI, purified, and sequenced for confirmation before being used for subsequent vector construction.

[0077] Corynebacterium glutamicum (Cgl-lys) C. glutamicum Using CICC 20655 genomic DNA as a template, amplification was performed separately. pyc The upstream and downstream homologous arms of the gene promoter (SEQ ID NO:4) replacement site, each homologous arm being 800-1100 bp in length; simultaneously amplifying P 2165-M Promoter fragment (SEQ ID NO:1). The upstream homologous arm, P... 2165-M The promoter fragment, downstream homologous arm, and linearized pK18mobsacB vector were ligated via homologous recombination (the pyc promoter was replaced with the NCgl2165 mutant promoter; the pyc gene fragment was not included in the recombinant vector construction process), resulting in... pyc Promoter replacement vector pK18mobsacB-ΔP pyc :: P 2165-M .

[0078] The upstream and downstream homologous arm sequences involved are as follows: Upstream homologous arm (SEQ ID NO:5): Downstream homologous arm (SEQ ID NO:6): PCR amplification system: 25 μL of 2× high-fidelity PCR premix, 1.25 μL of 10 μmol / L upstream primer, 1.25 μL of 10 μmol / L downstream primer, 10-50 ng of template DNA, and nuclease-free water to a final volume of 50 μL.

[0079] PCR amplification conditions were as follows: 98 ℃ pre-denaturation for 30 s; 98 ℃ denaturation for 10 s, 55-60 ℃ annealing for 15 s, 72 ℃ extension for 30 s / kb, for a total of 30 cycles; final extension at 72 ℃ for 5 min; storage at 4 ℃. PCR products were purified by agarose gel electrophoresis after confirming correct size.

[0080] The homologous recombination ligation system consisted of 20 μL of the following: 50-100 ng of linearized pK18mobsacB vector, upstream homologous arm, promoter fragment and downstream homologous arm added in a molar ratio of 1:3:3:3, 10 μL of homologous recombinase premix, and nuclease-free water added to a final volume of 20 μL. The mixture was reacted at 50 °C for 30 min to obtain the ligation product.

[0081] Transformation and validation: Take 5-10 μL of the ligation product for transformation. E. coli DH5α competent cells were incubated on ice for 25-30 min, then heat-shocked at 42℃ for 45-90 s, followed by an ice incubation for 2-3 min. 0.75-1 mL of LB medium was added, and the cells were incubated at 37℃ for 45-90 min. The cells were then plated on LB agar plates containing 50 μg / mL kanamycin and incubated at 37℃ for 12-16 h. Single colonies were picked for colony PCR verification, and plasmids were extracted and sequenced. The correctly sequenced plasmids were named pK18mobsacB-ΔP. pyc ::P 2165-M .

[0082] Meanwhile, the recombinant vector was prepared according to the above method: using the original P 2165-WT promoter (SEQ ID NO:2) replacement pyc Natural promoter of gene: pK18mobsacB-ΔP pyc :: P 2165-WT .

[0083] Example 4: pyc Construction of Recombinant Corynebacterium glutamicum with Gene Promoter Replacement NCgl2165 mutant promoter P 2165-M replace pyc The construction process of the natural promoter of recombinant Corynebacterium glutamicum is as follows: Figure 2 As shown (will) C. glutamicumThe promoter of the pyc gene on the CICC 20655 genome was replaced with the NCgl2165 mutant promoter. The specific process is as follows: The pK18mobsacB-ΔP obtained in Example 3 were respectively... pyc :: P 2165-M pK18mobsacB-ΔP pyc ::P 2165-WT Plasmid electroporation into Corynebacterium glutamicum Cgl-lys ( C. glutamicum In CICC 20655 competent cells, the first homologous recombination single crossover was obtained through screening; then, through antibiotic-free culture and sucrose reverse selection, the second homologous recombination double crossover was obtained, resulting in chromosome... pyc The natural promoter of the gene was mutated by the NCgl2165 promoter P 2165-M Or the original P 2165-WT Startup replacement.

[0084] pyc The gene sequence (SEQ ID NO:7) is as follows: Among them, Corynebacterium glutamicum Cgl-lys ( C. glutamicum The method for preparing CICC 20655 transformation competent cells is as follows: 1) Inoculate 400 μL of Corynebacterium glutamicum into LBGB medium and incubate at 220 rpm and 30℃ for 12 h; 2) Transfer 2 mL of bacterial culture to 50 mL of Epo medium and incubate at 220 rpm and 30℃ for 5 h; 3) Incubate the bacterial culture in an ice-water bath for 30 min, then centrifuge at 6000 rpm and 4℃ for 6 min; 4) Take about 30 mL of pre-chilled 10% glycerol, fully suspend the bacterial cells, and centrifuge at 5000 rpm and 4℃ for 6 min; then wash twice with pre-chilled 10% glycerol; 5) Resuspend the cells in 400 μL of pre-chilled 10% glycerol, aliquot into 1.5 mL centrifuge tubes, 100 μL per tube, approximately 5 tubes. Store at -80℃ after preparation and thaw before use.

[0085] The electroporation method for competent Corynebacterium glutamicum is as follows: 1) Take 5-10 μL of plasmid pK18mobsacB-ΔP pre-cooled on ice. pyc :: P 2165-M or pK18mobsacB-ΔP pyc :: P 2165-WT 1) Mix with competent cells and incubate on ice for 10 min; 2) Add to a pre-chilled 2 mm electroporation cuvette and electroporate twice at 2.5 kV; add 1 mL of preheated LBHIS medium, mix well, and transfer to a 1.5 mL centrifuge tube, heat shock at 46℃ for 5-6 min; 3) Incubate at 30℃ and 220 rpm for 4-6 h; 4) Centrifuge at 5000 rpm for 2 min and collect the bacterial cells; 5) Aspirate the supernatant until approximately 100 μL of bacterial culture remains, mix well, and spread on an LBHIS plate containing 50 μg / mL kanamycin; incubate at 30℃ for approximately 36 h. Pick single colonies for colony PCR verification to obtain the first homologous recombination single exchanger.

[0086] Verified single exchangers were inoculated into antibiotic-free LBGB liquid medium and cultured at 30 °C and 220 rpm for 2–3 h. After 1–2 passages, the culture was plated onto LBGB plates containing 10–15% sucrose and without kanamycin, and cultured at 30 °C for 24–36 h. Sucrose-resistant clones were picked and inoculated onto LBGB plates containing 50 μg / mL kanamycin and those without kanamycin, respectively, to screen for sucrose-resistant and kanamycin-sensitive candidate double exchangers. Recombinant strains were prepared according to the above method: C. glutamicum CICC 20655ΔP pyc :: P 2165-M - pyc (named MMEC-P)2165-M ), C. glutamicum CICC 20655ΔP pyc :: P 2165-WT - pyc (named MMEC-P) 2165-WT ).

[0087] Table 5: Strains used in the embodiments of the present invention

[0088] Table 6: Primers used in the embodiments of the present invention

[0089] Example 5: Test of the ability of recombinant bacteria to produce L-lysine through fermentation (1) Seed liquid preparation The starting strain Cgl-lys and the MMEC-P prepared in Example 4 were respectively used. 2165-M MMEC-P 2165-WT Activate the culture by streaking on LBGB solid plates and incubate at 30 °C for 24–28 h. Pick a single colony and inoculate it into 50 mL of primary seed culture medium, and incubate at 30 °C and 200 rpm with shaking for 12 h to obtain primary seed culture. Then, transfer the culture to secondary seed culture medium at an inoculation rate of 10% (v / v) and incubate at 30 °C and 200 rpm for 8–10 h to obtain secondary seed culture.

[0090] (2) Fermentation culture in a 5 L fermenter The secondary seed culture was inoculated at a rate of 10% (v / v) into a 5 L fermenter containing fermentation medium (working volume 3.0 L). The fermentation temperature was 30 °C, the aeration rate was 1 vvm, the initial stirring speed was 300 rpm, and the pH was controlled at 7.0 ± 0.1. During fermentation, dissolved oxygen was maintained at no less than 30% by adjusting the stirring speed. Glucose solution was added during fermentation to maintain residual sugar at 0-10 g / L. The fermentation cycle was 48 h, yielding the fermentation broth.

[0091] After centrifuging the fermentation broth to remove bacterial cells, the L-lysine content was determined according to the above detection method. The same seed culture preparation and 5 L fermenter fermentation culture method were used, and the biological replication was performed three times.

[0092] Fermentation test results are shown in Table 7 and Figure 3 As shown.

[0093] Table 7: Fermentation Test Results

[0094] The results show: Two strains of bacteria in a 5 L fermenter ( Figure 3 In MMEC-P 2165-M The growth of the recombinant strain was lower than that of the Cgl-lys control strain, but the acid production intensity was significantly improved in the later stage.

[0095] Specific indicators are shown in Table 6. Compared with the Cgl-lys control strain, MMEC-P 2165-M The recombinant strain showed a significant increase in L-lysine production. After 48 h of fermentation, the control strain Cgl-lys ( C. glutamicum The average yield of L-lysine in CICC 20655 was 127.9 g / L, with the MMEC-P promoter of the mutated NCgl2165 being tested. 2165-M The average yield of L-lysine from the recombinant strain reached 157.0 g / L, which was about 22.8% higher than that of the control.

[0096] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A mutant promoter, characterized in that, The mutant promoter is a promoter obtained by mutating positions 477-488 of the original NCgl2165 promoter sequence, as shown in SEQ ID NO:

2. Preferably, the 477th A is replaced by T, and the 478th T is replaced by G; Preferably, the 477th to 488th positions of the mutant promoter are: TGTGCTACAATC, TGTGATGTAATG, ATCCCTACAATG, TGCGCTACAATG, TGTGTTACAATG, TGTGCTACAACG, TTTGCTACAATG, TGTGCAACAATG, TGCGTTACAACG, TGTGCTACAATG. Preferably, the nucleotide sequence of the mutant promoter is shown in SEQ ID NO:

1.

2. An expression box, characterized in that, The expression cassette contains the mutant promoter as described in claim 1.

3. A carrier, characterized in that, The vector contains the mutant promoter of claim 1 or the expression cassette of claim 2.

4. The use of the mutant promoter of claim 1, the expression cassette of claim 2, or the vector of claim 3 in improving the expression level of the target protein.

5. The use of the mutant promoter of claim 1, the expression cassette of claim 2, or the vector of claim 3 in the preparation of products for increasing the expression level of a target protein.

6. A method for increasing the expression level of a target protein, characterized in that, The method is as follows: constructing a recombinant plasmid expressing the target protein using the mutant promoter described in claim 1; or inserting the mutant promoter described in claim 1 in series with the promoter originally contained in the plasmid to express the target protein.

7. A recombinant vector, characterized in that, The recombinant vector contains the mutant promoter of claim 1 and the gene encoding pyruvate carboxylase; Preferably, the nucleotide sequence encoding the pyruvate carboxylase gene is shown in SEQ ID NO:

7.

8. A recombinant bacterium, characterized in that, The recombinant bacteria contain the mutant promoter of claim 1, the expression cassette of claim 2, the vector of claim 3, or the recombinant vector of claim 7; Preferably, the recombinant bacteria uses L-amino acid producing strains as chassis cells.

9. The recombinant bacteria according to claim 8, characterized in that, The recombinant bacteria used Corynebacterium glutamicum CICC20655 as the chassis cell; Preferably, the recombinant bacteria are Corynebacterium glutamicum CICC 20655 as the chassis cells, and... C. glutamicum The promoter of the pyc gene on the CICC 20655 genome is replaced with the NCgl2165 mutant promoter; the nucleotide sequence of the pyc gene promoter is shown in SEQ ID NO:4, and the nucleotide sequence of the NCgl2165 mutant promoter is shown in SEQ ID NO:

1.

10. A method for preparing L-amino acids, characterized in that, The method involves using the recombinant bacteria described in claim 8 or 9 as a catalyst, wherein the recombinant bacteria are L-amino acid producing strains as chassis cells, and L-amino acids are prepared by fermentation.

Images