Multiplexed Covid-19 padlock assay

Abstract

Methods and systems for detecting the presence of a target nucleic acid sequence in one or more samples of a plurality of samples are described. The methods may comprise the use of linear barcoded nuc

Description

26 01 26 CROSS-REFERENCE

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 059,723, filed July 31,2020. SEQUENCE LISTING

[0002] This instant application contains a Sequence Listing which has been submitted electronically in ASCII format. Said ASCII copy, created on July 27, 2021, is named 52933-732_601_SL.txt and is 123,892 bytes in size. BACKGROUND

[0003] The COVID-19 pandemic has highlighted the shortcomings of current PCR-based molecular diagnostic testing capability. Besides a lack of precision and unacceptable false-positive / false-negative rates for many PCR-based tests, a critical flaw of existing assays is the inability to rapidly and cost-effectively scale testing to population-level monitoring of infectious disease. These shortcomings are primarily due to the limited amount of information generated by a single assay, which is usually limited to testing only a few sample replicates and is therefore insufficient for generating high precision test results. Additionally, the molecular diagnostic techniques used (primarily PCR-based) are not currently amenable for large-scale sample multiplexing. Thus, there remains an unmet need for a cost-effective method to increase the number of sample replicate tests per assay that is also compatible with a large-scale multiplexing strategy.

[0004] This disclosure relates to compositions, methods, and systems for addressing the shortcomings of current molecular diagnostic testing capabilities as they relate to population-scale monitoring of infectious disease. SUMMARY

[0005] The invention is as defined in claims 1 - 25. All other embodiments are provided for reference purposes only. Aspects disclosed herein provide methods for nucleic acid detection, said method comprising: (a) contacting a nucleic acid sequence obtained from a sample with a nucleic acid probe molecule comprising a distal end and a proximal end under conditions sufficient to couple said distal end of said nucleic acid probe molecule and said proximal end of said nucleic acid probe molecule to said nucleic acid sequence, thereby forming a circular nucleic acid probe molecule; and (b) detecting a 26 01 26 presence of said nucleic acid sequence by identifying a sequence of said circular nucleic acid probe molecule, wherein said detecting comprises performing a nucleotide binding reaction in the presence of a polymerizing enzyme between (i) said circular nucleic acid probe molecule or a derivative thereof and (ii) a nucleotide moiety comprising a detectable label, wherein said nucleotide binding reaction is performed in the absence of incorporation of said nucleotide moiety into said circular nucleic acid probe molecule or derivative thereof. In some embodiments, said circular nucleic acid probe molecule comprises a gap in a sequence thereof. In some embodiments, said method further comprises contacting said nucleic acid probe molecule with a polymerizing enzyme under conditions sufficient to perform an extension reaction, thereby filling said gap with a copy of a portion of said nucleic acid sequence. In some embodiments, said sequence of said circular nucleic acid probe molecule that is identified in (b) comprises said portion of said nucleic acid sequence. In some embodiments, said method further comprises contacting said nucleic acid probe molecule with a ligating enzyme under conditions sufficient to ligate said distal end of said nucleic acid probe molecule to said proximal end of said nucleic acid probe molecule following said extension reaction. In some embodiments, said gap comprises between 1 and 200 contiguous nucleotides in length. In some embodiments, said method further comprises contacting said nucleic acid probe molecule with a ligating enzyme under conditions sufficient to ligate said distal end of said nucleic acid probe molecule to said proximal end of said nucleic acid probe molecule, thereby forming said circular nucleic acid probe molecule. In some embodiments, said nucleic acid probe molecule is linear when unhybridized. In some embodiments, said nucleic acid sequence of said circular nucleic acid probe molecule that is identified in (b) comprises a barcode sequence that uniquely identifies said presence of said nucleic acid sequence when it is identified. In some embodiments, said method further comprises: (c) repeating (a) to (b) to identify a plurality of said nucleic acid sequence of a plurality of said circular nucleic acid probe molecule in a sample; and (d) counting a number of times each said nucleic acid sequence of said plurality of said nucleic acid sequence is identified in (c). In some embodiments, said method further comprises determining a copy number of said nucleic acid sequence in said sample, wherein said copy number of said nucleic acid sequence in said sample is proportional to said number of said times said each said nucleic acid sequence is counted in (d). In some embodiments, said method further comprises multiplexing said method comprising: (c) repeating (a) to (b) to identify a plurality of said nucleic acid sequence of a plurality of said circular nucleic acid probe molecule in said sample, wherein a first subset of said plurality of said circular nucleic acid probe molecule is different from a second subset of said plurality of said circular nucleic acid molecule; and (d) counting a number of times a first nucleic acid sequence of said first subset and a second nucleic acid sequence of said second subset are identified in (c). In some embodiments, said first subset of said plurality of said circular nucleic acid probe molecule 26 01 26 is different from said second subset of said plurality of said circular nucleic acid molecule in that: (i) said first subset comprises a different barcode sequence from said second subset; (ii) said first subset comprises a different distal end or proximal end from said second subset; or (iii) a combination of (i) and (ii). In some embodiments, said method further comprises detecting a presence of a second nucleic acid sequence in said sample, comprising: (c) contacting said second nucleic acid sequence in said sample with a second nucleic acid probe molecule under conditions sufficient to couple said second nucleic acid sequence with said second nucleic acid probe molecule, thereby forming a second circular nucleic acid probe molecule; and (d) bringing said second circular nucleic acid probe molecule or derivative thereof in contact with (i) a second polymerizing enzyme and (ii) a second nucleotide moiety comprising a second detectable label under conditions sufficient to cause a second nucleotide binding reaction to occur between said second circular nucleic acid probe molecule or derivative thereof and said second nucleotide moiety in the absence of incorporation of said second nucleotide moiety into said second circular nucleic acid probe molecule or derivative thereof, wherein said second nucleic acid sequence is different from said nucleic acid sequence detected in (b). In some embodiments, said method further comprises amplifying said circular nucleic acid probe molecule to produce said derivative thereof. In some embodiments, said amplifying comprises performing rolling circle amplification. In some embodiments, said nucleotide moiety is coupled to a polymer core in a polymernucleotide composition, forming a polymer-nucleotide conjugate. In some embodiments, said detectable label is coupled to said polymer core of said polymer-nucleotide composition. In some embodiments, said nucleotide binding reaction comprises two or more binding events between two or more of said nucleotide moiety and two or more copies of said nucleic acid sequence. In some embodiments, said detectable label comprises a fluorescent label. In some embodiments, said method further comprises detecting a presence of a second nucleic acid sequence derived from a second sample, comprising: (c) contacting said second nucleic acid sequence in said second sample with a second nucleic acid probe molecule under conditions sufficient to couple said second nucleic acid sequence with said second nucleic acid probe molecule, thereby forming a second circular nucleic acid probe molecule; and (d) bringing said second circular nucleic acid probe molecule or derivative thereof in contact with (i) a second polymerizing enzyme and (ii) a second nucleotide moiety comprising a second detectable label under conditions sufficient to cause a second nucleotide binding reaction to occur between said second circular nucleic acid probe molecule or derivative thereof and said second nucleotide moiety in the absence of incorporation of said second nucleotide moiety into said second circular nucleic acid probe molecule or derivative thereof, wherein said second nucleic acid sequence is different from said nucleic acid sequence detected in (b), thereby detecting said presence of said second nucleic acid sequence in said second sample. In some embodiments, said second sample is obtained from a different source from 26 01 26 said sample. In some embodiments, said method further comprises tracing a pathogenic infection by a pathogenic source of said nucleic acid sequence and said second nucleic acid sequence, wherein said tracing comprises comparing a first location or a first time of collection of said sample with a second location or a second time of collection of said second sample. The method of any one of claims 1-23, wherein said sample is obtained from a source comprising: (i) soil; (ii) sewage; (iii) biological tissue; (iv) food; (v) a surface of an object in contact with one or more of (i) to (iv); or (vi) any combination of (i)to(v).

[0006] Aspects disclosed herein provide systems for nucleic acid detection, said system comprising: one or more computer processors that are individually or collectively programmed to implement a method comprising: (a) contacting a nucleic acid sequence with a nucleic acid probe molecule under conditions sufficient to cause (i) a proximal end of said nucleic acid probe molecule to couple with a first portion of said nucleic acid sequence, and (ii) a distal end of said nucleic acid probe molecule to couple with a second portion of said nucleic acid sequence, thereby forming a circular nucleic acid probe molecule; and (b) bringing said circular nucleic acid probe molecule or a derivative thereof in contact with (i) a polymerizing enzyme and (ii) a nucleotide moiety comprising a detectable label under conditions sufficient to cause a nucleotide binding reaction to occur between said circular nucleic acid probe molecule or derivative thereof and said nucleotide moiety in the absence of incorporation of said nucleotide moiety into said circular nucleic acid probe molecule or derivative thereof. In some embodiments, said system further comprises said nucleic acid probe molecule, wherein said nucleic acid probe molecule comprises (i) said proximal end comprising a first nucleic acid sequence that is complementary to said first portion of said nucleic acid sequence, and (ii) said distal end comprising a second nucleic acid sequence that is complementary to said second portion of said nucleic acid sequence. In some embodiments, said system further comprises a substrate having a surface comprising a polymer layer coupled thereto, wherein said circular nucleic acid probe molecule is coupled to said polymer layer. In some embodiments, said polymer layer comprises a hydrophilic polymer. In some embodiments, said hydrophilic polymer comprises poly(ethylene glycol) (PEG), poly(vinyl alcohol) (PVA), poly(vinyl pyridine), poly(vinyl pyrrolidone) (PVP), poly(acrylic acid) (PAA), polyacrylamide, poly(N-isopropylacrylamide) (PNIPAM), poly(methyl methacrylate) (PMA), poly(2-hydroxylethyl methacrylate) (PHEMA), poly(oligo(ethylene glycol) methyl ether methacrylate) (POEGMA), polyglutamic acid (PGA), poly-lysine, poly-glucoside, streptavidin, dextran, or any combination thereof. In some embodiments, said surface comprises two or more interior surfaces of a flow cell. In some embodiments, said system further comprises a ligating enzyme or catalytically-active fragment thereof configured to ligate said proximal end of said nucleic acid probe molecule and said distal end of said nucleic acid probe molecule to form said circular nucleic acid probe molecule. In some embodiments, 26 01 26 said circular nucleic acid probe molecule comprises a gap in a nucleic acid sequence thereof. In some embodiments, said system further comprises a polymerizing enzyme configured to perform an extension reaction of said circular nucleic acid probe molecule, thereby filling said gap. In some embodiments, said gap is filled with a copy of a third portion of said nucleic acid sequence. In some embodiments, said gap comprises between 1 and 200 contiguous nucleotides in length. In some embodiments, said nucleic acid probe molecule is linear when unhybridized. In some embodiments, said method further comprises repeating (a) and (b) to identify a sequence of said circular nucleic acid probe molecule or derivative thereof, wherein said sequence comprises a barcode sequence that uniquely identifies said sequence. In some embodiments, said method further comprises: (c) repeating (a) to (b) to identify a plurality of said nucleic acid sequence of a plurality of said circular nucleic acid probe molecule in said sample; and (d) counting a number of times each sequence of said plurality of said sequence of said plurality of said circular nucleic acid probe molecule is identified in (c). In some embodiments, said system further comprises a plurality of said circular nucleic acid probe molecule comprising a first subset of said plurality of said circular nucleic acid probe molecule and a second subset of said plurality of said circular nucleic acid probe molecule, wherein said first subset is different from said second subset. In some embodiments, said method further comprises: (c) repeating (a) to (b) to identify a plurality of said nucleic acid sequence of a plurality of said circular nucleic acid probe molecule in said sample; and (d) counting a number of times a first sequence of said first subset and a second sequence of said second subset are identified in (c). The system of claim 39 or claim 40, said first subset of said plurality of said circular nucleic acid probe molecule is different from said second subset of said plurality of said circular nucleic acid probe molecule in that: (i) said first subset comprises a different barcode sequence from said second subset; (ii) said first subset comprises a different distal end or proximal end from said second subset; or (iii) a combination of (i) and (ii). In some embodiments, said system further comprises a second nucleic acid probe molecule, wherein said second nucleic acid probe molecule is configured to couple to a second nucleic acid sequence that is different from said nucleic acid sequence. In some embodiments, said method further comprises detecting a presence of said second nucleic acid in said sample, comprising: (c) contacting said second nucleic acid sequence in said sample with said second nucleic acid probe molecule under conditions sufficient to couple said second nucleic acid sequence with said second nucleic acid probe molecule, thereby forming a second circular nucleic acid probe molecule; and (b) bringing said second circular nucleic acid probe molecule or derivative thereof in contact with (i) a second polymerizing enzyme and (ii) a second nucleotide moiety comprising a second detectable label under conditions sufficient to cause a second nucleotide binding reaction to occur between said second circular nucleic acid probe molecule or derivative thereof and said second nucleotide moiety in the absence of incorporation of said second nucleotide moiety into said second 26 01 26 circular nucleic acid probe molecule or derivative thereof. In some embodiments, said nucleotide moiety is coupled to a polymer core in a polymer-nucleotide composition. In some embodiments, said detectable label is coupled to said polymer core in said polymer-nucleotide composition, forming a polymer-nucleotide conjugate. In some embodiments, said nucleotide binding reaction comprises two or more binding events between two or more of said nucleotide moiety and two or more copies of said nucleic acid sequence. In some embodiments, said detectable label comprises a fluorescent label. In some embodiments, said nucleic acid sequence is obtained from a sample comprising: (i) soil; (ii) sewage; (iii) biological tissue; (iv) food; (v) a surface of an object in contact with one or more of (i) to (iv); or (vi) any combination of (i) to (v). BRIEF DESCRIPTION OF THE DRAWINGS

[0007] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which:

[0008] Fig. 1 provides, according to some embodiments herein, a schematic illustration of a conventional padlock probe and its use for detection of single nucleotide polymorphisms (SNPs) (from New England Biolabs).

[0009] Fig. 2 provides a non-limiting example of a barcoded padlock probe of the present disclosure. Fig. 2 discloses SEQ ID NOS 7-9, respectively, in order of appearance.

[0010] Fig. 3 provides, according to some embodiments herein, a schematic illustration of the SARS-CoV-2 (COVID-19) genome (from Johns Hopkins Center for Health Security, "Comparison of National RT-PCR Primers, Probes, and Protocols for SARS-CoV-2 Diagnostics", April 13, 2020).

[0011] Fig. 4 provides, according to some embodiments herein, a non-limiting example of a workflow for a barcoded molecular inversion probe (MIP) assay.

[0012] Fig. 5 provides, according to some embodiments herein, a schematic illustration of a workflow for performing a multiplexed padlock assay of the present disclosure that indicates the approximate times required for different steps of the assay.

[0013] Fig. 6 provides, according to some embodiments herein, a schematic illustration of a multivalent binding complex formed using the multivalent binding compositions described herein.

[0014] Fig. 7 shows, according to some embodiments herein, a generalized graphical depiction of the increase in signal intensity that has been observed during binding, persistence, and washing and removal of multivalent substrates. 26 01 26

[0015] Fig. 8 provides, according to some embodiments herein, a schematic illustration of a workflow for performing a multiplexed padlock assay followed by sequencing to detect barcode sequences and demultiplex the assay data.

[0016] Figs. 9A-9C provides, according to some embodiments herein, examples of simulated data output for a multiplexed COVID-19 assay. Fig. 9A: Positive, high titer sample. Fig. 9B: Positive sample, low titer. Fig. 9C: Negative sample.

[0017] Fig. 10 schematically depicts, according to some embodiments herein, an example computer control system.

[0018] Fig. 11 provides, according to some embodiments herein, an example of image data from a study to determine the relative levels of non-specific binding of a green fluorescent dye to glass substrate surfaces treated according to different surface modification protocols.

[0019] Fig. 12 provides, according to some embodiments herein, an example of image data from a study to determine the relative levels of non-specific binding of a red fluorescent dye to glass substrate surfaces treated according to different surface modification protocols.

[0020] Fig. 13 provides, according to some embodiments herein, an example of oligonucleotide primer grafting data for substrate surfaces treated according to different surface modification protocols.

[0021] Fig. 14 provides, according to some embodiments herein, an example of images and data demonstrating “tunable” nucleic acid amplification on a low binding solid support by varying the oligonucleotide primer density on the substrate. Blue histogram: low primer density. Red histogram: high primer density. The combination of low non-specific binding and tunable nucleic acid amplification efficiency through adjustment of oligonucleotide primer density yields high CNRs and subsequent improvements in nucleic acid sequencing performance.

[0022] Fig. 15 provides, according to some embodiments herein, an example of images and data for non-specific binding of green and red fluorescent dyes to substrate surfaces treated according to different surface modification protocols. For comparison purposes, the fluorescence intensity of a clonally amplified template colony measured under the same set of experimental conditions after coupling a single Cy3-labeled nucleotide base is about 1,500 counts.

[0023] Fig. 16 provides, according to some embodiments herein, examples of fluorescence images of the low binding solid supports of the present disclosure on which tethered oligonucleotides have been amplified using different primer densities, isothermal amplification methods, and amplification buffer additives.

[0024] Fig. 17 provides, according to some embodiments herein, an example of fluorescence image and intensity data for a low-binding support of the present disclosure on which solid-phase nucleic acid 26 01 26 amplification was performed to create clonally-amplified clusters of a template oligonucleotide sequence.

[0025] Fig. 18 provides, according to some embodiments herein, a second example of fluorescence image and intensity data for a low-binding support of the present disclosure on which solid-phase nucleic acid amplification was performed to create clonally-amplified clusters of a template oligonucleotide sequence.

[0026] Fig. 19 provides, according to some embodiments herein, an example of fluorescence image and intensity data for a low-binding support of the present disclosure on which solid-phase nucleic acid amplification was performed to create clonally-amplified clusters of a template oligonucleotide sequence.

[0027] Figs. 20A-20B provide non-limiting examples of image data that demonstrate the improvements in hybridization stringency, speed, and efficacy that may be achieved through the reformulation of the hybridization buffer used for solid-phase nucleic acid amplification, as described herein. Figs. 20A provides examples of image data for two different hybridization buffer formulations and protocols. Figs. 20B provides an example of the corresponding image data obtained using a standard hybridization buffer and protocol.

[0028] Figs. 21A-21J show fluorescence images of the steps in a sequencing reaction using multivalent PEG-substrate compositions. Figs. 21 A. Red and green fluorescent images post exposure of DNA RCA templates (G and A first base) to 500 nM base labeled nucleotides (A-Cy3 and G-Cy5) in exposure buffer containing 20 nM Klenow polymerase and 2.5 mM Sr+2. Images were collected after washing with imaging buffer with the same composition as the exposure buffer but containing no nucleotides or polymerase. Contrast was scaled to maximize visualization of the dimmest signals, but no signals persisted following washing with imaging buffer (Figs. 21A, inset). Figs. 21B-21E: fluorescence images showing multivalent PEG-nucleotide (base-labeled) ligands PB1 (Figs. 21B), Figs. 21C), PB3 (Figs. 2 ID), and PB5 (Figs. 2 IE) having an effective nucleotide concentration of 500 nM after mixing in the exposure buffer and imaging in the imaging buffer as described above. Figs. 2IF: fluorescence image showing multivalent PEG-nucleotide (base-labeled) ligand PB5 at 2.5uM after mixing in the exposure buffer and imaging in the imaging buffer as above. Figs. 21G-22I: Fluorescence images showing further base discrimination by exposure of the multivalent binding composition to inactive mutants of klenow polymerase (Figs. 21G. D882H; Figs. 21H. D882E; Figs. 211. D882A) vs. the wild type Klenow (control) enzyme (Figs. 21 J).

[0029] Fig. 22 illustrates visualization of cluster amplification in a capillary lumen according to some embodiments herein. 26 01 26

[0030] Fig. 23 provides a schematic illustration of a cloud-based approach to monitoring a global pandemic according to some embodiments herein. DETAILED DESCRIPTION

[0031] While a multitude of rapid and cost-effective assays exist on the market for the detection of COVID-19, limited sample multiplexing is a common shortcoming of all current approaches. Even in a situation where the supply chain of critical assay components is ensured, most labs struggle in dealing with the onslaught of samples, resulting in unacceptable time-to-answer. These assays are of limited value in that they can diagnose a limited number of individuals while preemptively quarantining them but are ineffective for providing a real-time geographical and environmental picture of the evolution of the pandemic. Because of the aforementioned sample-throughput limitations, the current CO VID-19 testing infrastructure provides a passive, delayed view of the status of the pandemic rather than the active and pre-emptive monitoring infrastructure that is needed. The disclosed compositions, methods, and systems overcome the primary shortcoming of current molecular diagnostic testing capability - low throughput, lack of precision, unacceptable false-positive / false-negative rates, and the inability to rapidly and cost-effectively scale testing to population-level monitoring of infectious disease - by using a novel barcoded padlock probe assay or barcoded molecular inversion probe assay that leverages a proprietary sequencing platform being developed by the Applicant.

[0032] Disclosed herein are barcoded padlock assays and barcoded molecular inversion probe assays that utilize a linear nucleic acid probe molecule comprising capture sequences (e.g., targetspecific capture regions or sequences) that are complementary to specific target nucleic acid sequences. In some instances, the linear nucleic acid probe molecule comprises at padlock probe. In some instances, for example, the capture sequences may be complementary to specific COVID-19 sequences or other infectious disease pathogen sequences. In some instances, the linear nucleic acid probe molecule may comprise a probe-specific barcode sequence (located in the non-target-specific regions of the probe sequence) which is adjacent to a universal priming site, e.g., an amplification primer binding site or sequencing primer binding site, where the probe-specific barcode (or simply "probe barcode") is unique for a given pair of target-specific capture sequences. In some instances, the linear nucleic acid probe molecule may comprise a sample-specific barcode sequence (also located in the non-target-specific regions of the probe sequence) which is adjacent to a probespecific barcode sequence and to the universal priming site, e.g., an amplification primer binding site, where the sample-specific barcode (or simply "sample barcode") is unique for a given sample within a plurality of samples to be analyzed within one or more experimental runs. If the target 26 01 26 nucleic acid sequence of interest (e.g., a COVID-19 sequence) is present in the sample, the padlock probe will hybridize specifically to the target sequence (or regions thereof) thereby promoting a circularization event that may be completed by ligation. Upon ligation, the circularized nucleic acid probe molecules (e.g., the positive padlock probes), including the barcode sequence(s) contained therein, may be amplified using, for example, isothermal rolling-circle amplification (RCA). In some instances, e.g., where the padlock probe does not include a sample barcode, each sample tested may be amplified using a sample-indexed amplification primer, e.g., an amplification primer that comprises a sample-specific barcode. In the instances that rolling circle amplification is utilized, this rapidly generates concatemers which include multiple copies of the probe barcode and sample barcode sequences. The concatemers will be generated if the target nucleic acid molecules (e.g., a COVID-19 target sequence) is present in a given sample, and the number of concatemers generated will be proportional to the number of target nucleic acid sequence copies originally present in the sample. Upon completion of the padlock / amplification assay (e.g., a padlock / RCA assay requiring 1 hour to perform), a plurality of barcoded samples may be pooled, tethered to a surface within a sequencing flow cell, and loaded into a sequencer that has been configured to function as a DNA-barcode reader. After priming the concatemers at the universal priming sites, the sequence / barcode reader may be used to sequence through the probe barcode (target locus ID) and sample barcode (or sample index) for each concatemer. The sample barcodes allow for demultiplexing of the concatemer sequence data, which may then be further segregated by probe barcode(s). The detection of the sample barcode in the sequence dataset indicates the presence of the target nucleic acid sequence in a given sample, the presence of a given probe barcode sequence indicates the presence of specific target sequences (e.g., COVID-19 sequence(s) or controls), and the total number of amplified concatemers for each sample (or the copy number for a given individual probe barcode for each sample) provides the titer.

[0033] The use of sequencing to read an oligonucleotide barcode sequence provides the opportunity to implement large-scale barcode-based multiplexing. While a variety of commercially available sequencing platforms exist, most have been designed primarily for genomic applications and are not easily adaptable to low-end, short-read applications such as barcode reading.

[0034] Disclosed herein, in some embodiments, are sequencing platforms designed to provide high quality, high-throughput, low-cost sequencing data of short-read sequences. In some embodiments, the sequencing platforms disclose herein have a modular format that can be reconfigured to perform high-throughput DNA barcode reading and are for high-throughput molecular diagnostic assays that require sample and probe multiplexing. 26 01 26

[0035] The advantages of the disclosed methods and systems for large-scale molecular testing include, but are not limited to: 1. Unprecedented assay sensitivity and precision due to the amplification of nucleic acid target sequences at very low copy number to generate hundreds of thousands of concatemers. Each concatemer is essentially a sample replicate and can be individual addressed by sequencing a DNA barcode. The large amount of concatemer data thus accessible will ensure unprecedented assay precision and provide titer information. 2. Flexible sample and probe multiplexing strategies enabled through the use of oligonucleotide barcode sequences. The use of sequenceable oligonucleotide barcodes offers the possibility of simultaneously demultiplexing the assay (e.g., by using two or more barcoded padlock probes, each directed to a different target nucleic acid sequence or control) as well as demultiplexing virtually any number of samples to be processed in parallel. The method is expected to be very economical at modest sample batch sizes (e.g., 384-1,536 samples per experimental run), making the disclosed methods and systems particularly attractive for a decentralized model of molecular diagnostic testing. 3. Enables cloud-based analysis systems for real-time collection and consolidation of the data generated by a distributed network of sequencing instruments to facilitate population-scale testing and monitoring. The ability to deploy a decentralized network of instruments that generate millions of data points per day offers the unprecedented opportunity to monitor in real-time the evolution of infectious disease such as COVID-19 as well as other potential pandemics. Decentralized Molecular Diagnostic Assay Platform

[0036] PCR-based assays are the method of choice for rapid and cost-effective detection of COVID-19 and other viral infections. However, a major shortcoming of these assays is their insufficient throughput, especially when considering the large volume of samples that may be assayed on a regular basis for the purpose of monitoring the spread of infectious disease through a population. The primary reason for the low throughput of these methods is the lack of practical methods for high sample multiplexing. Current multiplexing strategies rely on either color discrimination or spatial separation in the wells of a microwell plate or microarray. These approaches do not scale well above a small number of multiplexed samples (about 48 / samples per run) or are very expensive to implement (1,536 samples per day using a Roche COBAS system).

[0037] The compositions, methods, and systems disclosed herein address the throughput limitations of existing molecular diagnostic testing methods by providing a scalable approach to sample multiplexing and a testing platform that allows for decentralization of molecular testing, with each testing facility able to process millions of samples per instrument per year using 26 01 26 manageable sample batch sizes of, for example, 384-1536 samples per run. Decentralization and high sample throughput, optionally paired with cloud-based analysis, will also provide the opportunity to deploy a global and real-time monitoring network for detection of infectious disease such as COVID-19. This same sample multiplexing approach may be adapted to a variety of molecular diagnostic assays, thus providing the disclosed molecular diagnostics platform with tremendous flexibility in terms of testing applications. Barcoded padlock probe assays

[0038] The disclosed compositions, methods, and systems provide a flexible and scalable approach to both simultaneous detection of multiple target analytes in a given sample and highly multiplexed sample processing. The disclosed DNA sequencing platform is configured to read short DNA barcodes in a barcoded padlock probe assay. In this assay, a probe barcode (or probe index) is used for demultiplexing the test results for one or more target nucleic acids, and a sample barcode (or sample index) is used to demultiplex the test results for two or more samples in a single test run.

[0039] There are many existing padlock probe assays for performing molecular diagnostics testing. These assays are highly sensitive and accurate, for example, to detect of RNA viruses. Padlock assays recognize, bind, and amplify an RNA target isothermally and without RNA transcription into cDNA, thereby providing a very rapid and efficient diagnostic method. Fig. 1 provides an illustration, according to some embodiments disclosed herein, of a padlock probe 101 designed to detect the presence of a single nucleotide polymorphism (SNP) 102. A linear nucleic acid probe molecule 101 (e.g., a padlock probe molecule) comprising 5'-end and 3'-end sequences 103 that are complementary to contiguous regions 104 of the target nucleic acid molecule 105 (e.g., regions spanning the SNP of interest) is hybridized 106 to the target and ligated 107 to form a circularized nucleic acid molecule 108. The circularized nucleic acid probe molecule is formed if the target is present in the sample being tested. Following an optional treatment 109 of the sample with an exonuclease to digest any remaining target nucleic acid molecules, an amplification primer binding site included in the non-complementary region 110 of the padlock probe sequence is used to amplify and detect the circularized molecule using, e.g., PCR or rolling circle amplification (RCA) 111.

[0040] Fig. 2 illustrates, according to various embodiments disclosed herein, the architecture of a barcoded padlock probe of the present disclosure. The target-specific sequence regions recognize a target locus, bringing the 5'- and 3'-ends in close proximity upon hybridization to the target when the target nucleic acid molecule is present. In addition to the target-specific sequence regions, the non-limiting example of a barcoded padlock probe molecule shown in Fig. 2 comprises two primer binding sites for use in RCA amplification and a "random" sequence that may comprise one or 26 01 26 more barcode sequences, e.g., a probe barcode sequence that is unique for each pair of targetspecific sequence regions, a sample barcode sequence that is unique for a specific sample, or any combination thereof. In the example shown in Fig. 2, the target-specific sequence regions of the probe are designed to target the Ca-Y132H sequence of the COVID-19 genome. Ligation circularizes the probe, which can be then amplified, e.g., using RCA to generate concatemer molecules comprising multiple copies of the probe sequence including the barcode sequences. These concatemers can then be pooled and loaded on a sequencing platform that has been configured to function as a highly multiplexed barcode reader. A short locus-specific probe barcode can be quickly sequenced and decoded, and the number of probe barcodes identified for a given sample will provide both improved assay accuracy as well as viral titer information.

[0041] Barcoded padlock probes targeting specific nucleic acid molecules, e.g., COVID-19 specific nucleic acid sequences, as shown in Fig. 3, may be designed to include probe barcode sequences (also referred to as "probe index" or "probe ID" sequences) in the non-targeting padlock regions to facilitate assay multiplexing and expedite the identification of multiple target sequences. In some instances, the barcoded padlock probe molecule may also comprise a sample barcode sequence. In some instances, circularization of the padlock probe will be followed by primer-indexed RCA amplification, resulting in the generation of sample-barcoded (or sample-indexed) concatemers if the target nucleic acid molecule(s) were present in the sample. These concatemers may then be loaded into a sequencing flow cell, sequenced, demultiplexed, and binned based on sample or probe barcodes. The sequencing of the sample and probe barcodes (as opposed to actual amplicons of viral genome loci) enables the use of short read lengths that drive fast time to answer and low assay cost. In some instances, the disclosed compositions, methods, and systems may enable sample-to-answer turnaround times of 2.5 hours or less, assay costs of $10 per sample or less, and sample processing throughputs of up to millions of samples per instrument per year depending on the degree of sample multiplexing implemented. Barcoded padlock probe or molecular inversion probe (MIP) design

[0042] In some instances, the barcoded padlock probe or molecular inversion probe molecules of the present disclosure may comprise a target-specific 5'-end region (or sequence), one or more primer binding regions (or sequences), one or more barcode regions (or sequences), and a target-specific 3'-end region (or sequence).

[0043] In some instances, e.g., for barcoded padlock probe molecules, the 5'-end and 3'end target specific sequences may be designed to target two adjacent (contiguous) sequences within the target nucleic acid sequence, e.g., where a ligation reaction cleaves a 5'-terminal phosphate group from the padlock probe and generates a circularized molecule by catalyzing the formation of a covalent 26 01 26 linkage between the 5'-terminal nucleotide moiety of the padlock probe and the 3'-terminal nucleotide moiety of the padlock probe.

[0044] In some instances, e.g., for barcoded molecular inversion probe molecules, the 5'-end and 3'end target specific sequences may be designed to target two adjacent but not contiguous sequences within the target nucleic acid sequence that are separated by up to, e.g., 100 nucleotides, where a primer extension / fill-in reaction initiated at one end of the probe sequence is used in conjunction with a ligation reaction to complete the formation of the circularized molecule. In some instances, the two adjacent target nucleic acid sequences may be separated by up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, or more than 100 nucleotides (or any number of nucleotides within this range). Fig. 4 provides a schematic illustration of a barcoded molecular inversion probe assay.

[0045] In some instances, the 5'-end and 3'end target specific sequences of the disclosed barcoded padlock probes and barcoded molecular inversion probes may be designed to target any of a variety of target nucleic acid sequences. In some instances, for example, they may be designed to target viral nucleic acids. In some instances, they be designed to target COVID-19 nucleic acid sequences. Fig. 3 provides an illustration of the COVID-19 genome, which comprises open reading frame (Orf) sequences, the spike gene (S) sequence; the envelope gene (E) sequence; the membrane gene (M) sequence; and the nucleocapsid gene (N) sequence. Any of these open reading frame or gene sequences, or fragments thereof, may be used in designing the barcoded padlock probe molecules of the present disclosure. In some instances, the barcoded padlock probes may be designed to target the Ca-Y132H sequence of the COVID-19 genome.

[0046] In some instances, the 5'-end and 3'end target specific sequences of the disclosed barcoded padlock probes and barcoded molecular inversion probes may be the same length. In some instances, they may be different lengths. In some instances, the 5'-end and 3'end target specific sequences of the disclosed barcoded padlock probes and barcoded molecular inversion probes may range in length from about 10 nucleotides to about 30 nucleotides. In some instances, the length of the 5'-end or 3'end target specific sequences may be at least 10, at least 11, at least 12, at least at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 nucleotides. In some instances, the length of the 5'-end or 3'end target specific sequences may be at most 30, at most 29, at most 28, at most 27, at most 26, at most 25, at most 24, at most 23, at most 22, at most 21, at most 20, at most 19, at most 18, at most 17, at most 16, at most 15, at most at most 13, at most 12, at most 11, or at most 10 nucleotides. Any of the lower and upper values described in this paragraph may be combined to form a range included within the present disclosure, for example, in some 26 01 26 instances the length of the 5'-end or 3'end target specific sequences may range from about 14 to about 26 nucleotides. It is possible that the length of the 5'-end or 3'end target specific sequences may have any value within this range, e.g., about 23 nucleotides.

[0047] In some instances, the disclosed barcoded padlock probe or molecular inversion probe molecules may comprise one, two, three, four, five, or more than five primer binding regions (or primer binding sequences or sites). In some instances, the primer binding sequences may comprise amplification primer binding sequences, sequencing primer binding sequences, universal primer binding sequences, or any combination thereof. In some instances, the one or more primer binding sequences of the disclosed padlock probe or molecular inversion probe molecules may range in length from about 10 nucleotides to about 30 nucleotides. In some instances, the length of the one or more primer binding sequences may be at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 nucleotides. In some instances, the length of the one or more primer binding sequences may be at most 30, at most 29, at most 28, at most 27, at most 26, at most 25, at most 24, at most 23, at most 22, at most 21, at most 20, at most 19, at most 18, at most 17, at most 16, at most 15, at most 14, at most 13, at most 12, at most 11, or at most 10 nucleotides. Any of the lower and upper values described in this paragraph may be combined to form a range included within the present disclosure, for example, in some instances the length of the one or more primer binding sequences may range from about 18 to about 22 nucleotides. It is possible that the length of the one or more primer binding sequences may have any value within this range, e.g., about 21 nucleotides.

[0048] In some instances, the disclosed barcoded padlock probe or molecular inversion probe molecules may comprise a probe barcode (or probe index), a sample barcode (or sample index), or both. In some instances, the disclosed barcoded padlock probe or molecular inversion probe molecules may comprise a probe barcode, and a sample barcode may be added using an indexed primer during amplification, e.g., rolling circle amplification of the circularized probe molecules.

[0049] One key advantage of the disclosed compositions, methods, and systems is the ability to attain very high target-specific probe and sample demultiplexing precision by using barcodes as proxies for sequencing. Both probe barcodes and sample index sequences may be designed according to rules that minimize the occurrence of misassignment errors or other sequencing issues. As a non-limiting example of sample barcode design, assume a conservative value of 40,000 sequencing reads per sample and 200,000,000 sequencing reads (barcodes) per sequencing run, it may be possible to process up to 5,000 samples in parallel in the same sequencing run. 26 01 26

[0050] The number of unique probe or sample index sequences of length L nucleotides is given by 4L, but additional constraints are imposed on barcode design to avoid runs of nucleotides that can hinder synthesis or sequencing. It is also important to maintain a Hamming distance (e.g., the number of nucleotide positions in two barcode sequences of equal length for which the two nucleotides are different) of greater than 1 so that a single sequencing error does not lead to an incorrect barcode identification. For example, there are 16,384 unique sequences of length 7 nucleotides, but a subset of 4,096 sequences can be selected that have a minimum Hamming distance of 2, which may fit well with the pooling of 5,000 samples in the example above and provide significant error correction capability. By extending the barcode length further (e.g. to 10-12 bases), one can generate many more unique sequences and impose a larger Hamming distance between any pair of barcode sequences. A larger Hamming distance enables both error detection and error correction. Specifically, a minimum distance of 2d+l may enable the correction of up to d sequencing errors. Given the high base-calling accuracy of Applicant's proprietary sequencing platform (to be discussed below) and the short barcode length required to be sequenced, it may be practical to enable the correction of at least 1, at least 2, or at least 3 errors. The process to design the probe or sample barcodes proceeds by first identifying a surplus of sequences meeting the specified Hamming distance requirement and other requirements followed by synthesis and empirical evaluation of quality.

[0051] In some instances, two smaller sets of indices (e.g., sets A and B) may be designed and then used to barcode samples using a pair of indices (where the total number of unique indices = | A| * |B|. Such a barcode design strategy may facilitate manufacturing of a large number of unique index sequences. There are many options for the design of the probe barcode including, for example, the use of a sequence of 3 nucleotides that differ from each other in every position. The design strategy may again be to design more than the required number of unique probes, and then test performance empirically. Since, in some instances, sample barcodes are not integrated into the padlock or molecular inversion probe but are added during an amplification step (performed by the customer), a padlock probe pool (or molecular inversion probe pool) can be generated without requiring physical probe separation at the synthesis stage. From a production standpoint, this essentially means that massively parallel synthetic approaches such as those offered by Twist Bioscience (San Francisco, CA) or Genscript (Piscataway, NJ) can be adopted for rapid and cost-effective customization of the probe pool.

[0052] In some instances, the probe barcode or sample barcode sequences of the disclosed barcoded padlock probe or molecular inversion probe molecules may range in length from about 3 nucleotides to about 20 nucleotides. In some instances, the probe barcode or sample barcode 26 01 26 sequences of the disclosed barcoded padlock probe or molecular inversion probe molecules may be at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 nucleotides. In some instances, the length of the probe barcode or sample barcode sequences may be at most 30, at most 29, at most 28, at most 27, at most 26, at most 25, at most 24, at most 23, at most 22, at most 21, at most 20, at most 19, at most 18, at most 17, at most 16, at most 15, at most 14, at most 13, at most 12, at most 11, at most 10, at most 9, at most 8, at most 7, at most 6, at most 5, at most 4, or at most 3 nucleotides. Any of the lower and upper values described in this paragraph may be combined to form a range included within the present disclosure, for example, in some instances the length of the probe barcode or sample barcode sequences may range from about 6 to about 10 nucleotides. It is possible that the length of the probe barcode or sample barcode sequences may have any value within this range, e.g., about 7 nucleotides.

[0053] In some instances, the total length of the disclosed barcoded padlock probe or molecular inversion probe molecules may range from about 50 nucleotides to about 200 nucleotides. In some instances, the total length of the disclosed probe molecules may be at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, or at least 200 nucleotides. In some instances, the total length of the disclosed probe molecules may be at most 200, at most 190, at most 180, at most 170, at most 160, at most 150, at most 140, at most 130, at most 120, at most 110, at most 100, at most 90, at most 80, at most 70, at most 60, or at most 50 nucleotides. Any of the lower and upper values described in this paragraph may be combined to form a range included within the present disclosure, for example, in some instances the total length of the disclosed probe molecules may range from about 80 to about 160 nucleotides. It is possible that the total length of the disclosed probe molecules may have any value within this range, e.g., about 126 nucleotides. Pathogens

[0054] The nucleic acids described herein comprise nucleic acid portions of pathogens from human, animal, or plant, such as fungi, bacteria, archaea, eukaryotic parasites, protozoa, or viruses, including but not limited to, filoviruses, coronaviruses, adenoviruses, retroviruses, toxin, and the like. In some embodiments, such pathogens occur naturally. In some embodiments, such pathogens may be synthesized.

[0055] In some embodiments, such viruses having nucleic acid components contemplated in this disclosure include, but are not limited to, Ebola virus, Marburg virus other filoviruses, alpha 26 01 26 coronaviruses (such as 229E and NL63), beta coronaviruses (such as OC43 and HKU1), other coronaviruses, such as MERS-CoV, SARS-COV, 2019-nCoV, a severe respiratory syndrome 2 (SARS-CoV-2), and mild respiratory illnesses (HCoV-NL63, HCoV-229E, HCoV-OC43, and HKU1), retroviruses (such as the Human Immunodeficiency Virus and Feline Immunodeficiency Virus), adenoviruses, influenza viruses (including H1N1 and H5N1 subtypes, but contemplating all subtypes and combinations of influenza viruses), poxviruses, herpesviruses, and the like.

[0056] In some embodiments, the virus comprises a coronavirus. In some embodiments, the coronavirus may be an alpha coronavirus or a beta coronavirus. In some embodiments, such alpha coronavirus is a member of the first of the four genera (alpha, beta, gamma, or delta) of coronaviruses comprising 229E and NL63. In some embodiments, such beta coronavirus is a member of the four genera (alpha, beta, gamma, and delta) of coronaviruses comprising OC43, HKU1, severe acute respiratory syndrome (SARS) coronavirus, or Middle East Respiratory Syndrome (MERS) coronavirus. In some embodiments, said SARS coronavirus is SARS-CoV, SARS-CoV-2, or a variant thereof. In some embodiments, the MERS coronavirus is MERS-CoV or a variant thereof. In some embodiments, the SARS coronavirus causes a disease or a condition, such as coronavirus disease 2019 (COVID-19) or variants.

[0057] In some embodiments, the coronavirus can be selected from the group comprising: alphacoronavirus, beta coronavirus, delta coronavirus, and gamma coronavirus. Examples of alphacoronavirus can include, but are not limited to, bat coronavirus CDPHE15, bat coronavirus HKU10, human coronavirus 229E, human coronavirus NL63, miniopterus bat coronavirus 1, miniopterus bat coronavirus HKU8, mink coronavirus 1, porcine epidemic diarrhea virus, rhinolophus bat coronavirus HKU2, and scotophilus bat coronavirus 512. Examples of beta coronavirus can include, but are not limited to, beta coronavirus 1, hedgehog coronavirus 1, human coronavirus HKU1, middle east respiratory syndrome-related coronavirus, murine coronavirus, pipistrellus bat coronavirus HKU5, rousettus bat coronavirus HKU9, severe acute respiratory syndrome-related coronavirus, tylonycteris bat coronavirus HKU4. Examples of delta coronavirus can include, but are not limited to, bulbul coronavirus HKU11, common moorhen coronavirus HKU21, coronavirus HKU15, munia coronavirus HKU13, night heron coronavirus HKU19, thrush coronavirus HKU12, white-eye coronavirus HKU16, wigeon coronavirus HKU20. Examples of gamma coronavirus can include, but are not limited to, avian coronavirus, beluga whale coronavirus SW1. Additional examples of coronavirus can include MERS-CoV, SARS-CoV, and SARS-CoV-2. In some embodiments, the coronavirus can be SARS-CoV-2.

[0058] In some embodiments, said coronavirus 2019 (COVID-19) is caused by SARS-CoV-2 virus or a variant thereof. In some embodiments, said SARS-CoV-2 virus or a variant is encoded by a nucleic 26 01 26 acid sequence -provided in any one of SEQ ID NOs: 1-4. In some embodiments, the coronavirus (or variant thereof) is encoded by a nucleic acid sequence that is at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any one of SEQ ID NOs: 1-4. In some embodiments, the coronavirus (or variant thereof) is encoded by a nucleic acid sequence that is at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1. In some embodiments, the coronavirus (or variant thereof) is encoded by a nucleic acid sequence that is at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 2. In some embodiments, the coronavirus (or variant thereof) is encoded by a nucleic acid sequence that is at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 3. In some embodiments, the coronavirus (or variant thereof) is encoded by a nucleic acid sequence that is at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4

[0059] Table 1. Pathogen Sequences SEQ ID Antibody Region Sequence 1 >NC_0455 12.2 Severe acute respirat ory syndrome coronavi rus 2 isolate Wuhan- Hu- 1, complete genome ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAA CGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAAC TAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTG TTGCAGCCGATCATCAGCACATCTAGGTTTCGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTC CCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTTACAGGTTCGCGACGTGCTCGTAC GTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAGATGGCACTTGTGG CTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAAACGTTCGGAT GCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTC GTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCT TCTTCGTAAGAACGGTAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTAAAGTCATTTGACTTA GGCGACGAGCTTGGCACTGATCCTTATGAAGATTTTCAAGAAAACTGGAACACTAAACATAGCAGTGGTG TTACCCGTGAACTCATGCGTGAGCTTAACGGAGGGGCATACACTCGCTATGTCGATAACAACTTCTGTGG CCCTGATGGCTACCCTCTTGAGTGCATTAAAGACCTTCTAGCACGTGCTGGTAAAGCTTCATGCACTTTG TCCGAACAACTGGACTTTATTGACACTAAGAGGGGTGTATACTGCTGCCGTGAACATGAGCATGAAATTG CTTGGTACACGGAACGTTCTGAAAAGAGCTATGAATTGCAGACACCTTTTGAAATTAAATTGGCAAAGAA ATTTGACACCTTCAATGGGGAATGTCCAAATTTTGTATTTCCCTTAAATTCCATAATCAAGACTATTCAA CCAAGGGTTGAAAAGAAAAAGCTTGATGGCTTTATGGGTAGAATTCGATCTGTCTATCCAGTTGCGTCAC CAAATGAATGCAACCAAATGTGCCTTTCAACTCTCATGAAGTGTGATCATTGTGGTGAAACTTCATGGCA GACGGGCGATTTTGTTAAAGCCACTTGCGAATTTTGTGGCACTGAGAATTTGACTAAAGAAGGTGCCACT ACTTGTGGTTACTTACCCCAAAATGCTGTTGTTAAAATTTATTGTCCAGCATGTCACAATTCAGAAGTAG GACCTGAGCATAGTCTTGCCGAATACCATAATGAATCTGGCTTGAAAACCATTCTTCGTAAGGGTGGTCG CACTATTGCCTTTGGAGGCTGTGTGTTCTCTTATGTTGGTTGCCATAACAAGTGTGCCTATTGGGTTCCA CGTGCTAGCGCTAACATAGGTTGTAACCATACAGGTGTTGTTGGAGAAGGTTCCGAAGGTCTTAATGACA ACCTTCTTGAAATACTCCAAAAAGAGAAAGTCAACATCAATATTGTTGGTGACTTTAAACTTAATGAAGA GATCGCCATTATTTTGGCATCTTTTTCTGCTTCCACAAGTGCTTTTGTGGAAACTGTGAAAGGTTTGGAT TATAAAGCATTCAAACAAATTGTTGAATCCTGTGGTAATTTTAAAGTTACAAAAGGAAAAGCTAAAAAAG GTGCCTGGAATATTGGTGAACAGAAATCAATACTGAGTCCTCTTTATGCATTTGCATCAGAGGCTGCTCG TGTTGTACGATCAATTTTCTCCCGCACTCTTGAAACTGCTCAAAATTCTGTGCGTGTTTTACAGAAGGCC GCTATAACAATACTAGATGGAATTTCACAGTATTCACTGAGACTCATTGATGCTATGATGTTCACATCTG ATTTGGCTACTAACAATCTAGTTGTAATGGCCTACATTACAGGTGGTGTTGTTCAGTTGACTTCGCAGTG GCTAACTAACATCTTTGGCACTGTTTATGAAAAACTCAAACCCGTCCTTGATTGGCTTGAAGAGAAGTTT AAGGAAGGTGTAGAGTTTCTTAGAGACGGTTGGGAAATTGTTAAATTTATCTCAACCTGTGCTTGTGAAA TTGTCGGTGGACAAATTGTCACCTGTGCAAAGGAAATTAAGGAGAGTGTTCAGACATTCTTTAAGCTTGT AAATAAATTTTTGGCTTTGTGTGCTGACTCTATCATTATTGGTGGAGCTAAACTTAAAGCCTTGAATTTA 26 01 26 GGTGAAACATTTGTCACGCACTCAAAGGGATTGTACAGAAAGTGTGTTAAATCCAGAGAAGAAACTGGCC TACTCATGCCTCTAAAAGCCCCAAAAGAAATTATCTTCTTAGAGGGAGAAACACTTCCCACAGAAGTGTT AACAGAGGAAGTTGTCTTGAAAACTGGTGATTTACAACCATTAGAACAACCTACTAGTGAAGCTGTTGAA GCTCCATTGGTTGGTACACCAGTTTGTATTAACGGGCTTATGTTGCTCGAAATCAAAGACACAGAAAAGT ACTGTGCCCTTGCACCTAATATGATGGTAACAAACAATACCTTCACACTCAAAGGCGGTGCACCAACAAA GGTTACTTTTGGTGATGACACTGTGATAGAAGTGCAAGGTTACAAGAGTGTGAATATCACTTTTGAACTT GATGAAAGGATTGATAAAGTACTTAATGAGAAGTGCTCTGCCTATACAGTTGAACTCGGTACAGAAGTAA ATGAGTTCGCCTGTGTTGTGGCAGATGCTGTCATAAAAACTTTGCAACCAGTATCTGAATTACTTACACC ACTGGGCATTGATTTAGATGAGTGGAGTATGGCTACATACTACTTATTTGATGAGTCTGGTGAGTTTAAA TTGGCTTCACATATGTATTGTTCTTTCTACCCTCCAGATGAGGATGAAGAAGAAGGTGATTGTGAAGAAG AAGAGTTTGAGCCATCAACTCAATATGAGTATGGTACTGAAGATGATTACCAAGGTAAACCTTTGGAATT TGGTGCCACTTCTGCTGCTCTTCAACCTGAAGAAGAGCAAGAAGAAGATTGGTTAGATGATGATAGTCAA CAAACTGTTGGTCAACAAGACGGCAGTGAGGACAATCAGACAACTACTATTCAAACAATTGTTGAGGTTC AACCTCAATTAGAGATGGAACTTACACCAGTTGTTCAGACTATTGAAGTGAATAGTTTTAGTGGTTATTT AAAAC T T AC T GACAAT GTATACAT TAAAAAT GCAGACAT T GT GGAAGAAGC TAAAAAGGTAAAAC CAACA GTGGTTGTTAATGCAGCCAATGTTTACCTTAAACATGGAGGAGGTGTTGCAGGAGCCTTAAATAAGGCTA CTAACAATGCCATGCAAGTTGAATCTGATGATTACATAGCTACTAATGGACCACTTAAAGTGGGTGGTAG TTGTGTTTTAAGCGGACACAATCTTGCTAAACACTGTCTTCATGTTGTCGGCCCAAATGTTAACAAAGGT GAAGACATTCAACTTCTTAAGAGTGCTTATGAAAATTTTAATCAGCACGAAGTTCTACTTGCACCATTAT TATCAGCTGGTATTTTTGGTGCTGACCCTATACATTCTTTAAGAGTTTGTGTAGATACTGTTCGCACAAA TGTCTACTTAGCTGTCTTTGATAAAAATCTCTATGACAAACTTGTTTCAAGCTTTTTGGAAATGAAGAGT GAAAAGCAAGTTGAACAAAAGATCGCTGAGATTCCTAAAGAGGAAGTTAAGCCATTTATAACTGAAAGTA AACCTTCAGTTGAACAGAGAAAACAAGATGATAAGAAAATCAAAGCTTGTGTTGAAGAAGTTACAACAAC TCTGGAAGAAACTAAGTTCCTCACAGAAAACTTGTTACTTTATATTGACATTAATGGCAATCTTCATCCA GATTCTGCCACTCTTGTTAGTGACATTGACATCACTTTCTTAAAGAAAGATGCTCCATATATAGTGGGTG ATGTTGTTCAAGAGGGTGTTTTAACTGCTGTGGTTATACCTACTAAAAAGGCTGGTGGCACTACTGAAAT GCTAGCGAAAGCTTTGAGAAAAGTGCCAACAGACAATTATATAACCACTTACCCGGGTCAGGGTTTAAAT GGTTACACTGTAGAGGAGGCAAAGACAGTGCTTAAAAAGTGTAAAAGTGCCTTTTACATTCTACCATCTA TTATCTCTAATGAGAAGCAAGAAATTCTTGGAACTGTTTCTTGGAATTTGCGAGAAATGCTTGCACATGC AGAAGAAACACGCAAATTAATGCCTGTCTGTGTGGAAACTAAAGCCATAGTTTCAACTATACAGCGTAAA TATAAGGGTATTAAAATACAAGAGGGTGTGGTTGATTATGGTGCTAGATTTTACTTTTACACCAGTAAAA CAACTGTAGCGTCACTTATCAACACACTTAACGATCTAAATGAAACTCTTGTTACAATGCCACTTGGCTA TGTAACACATGGCTTAAATTTGGAAGAAGCTGCTCGGTATATGAGATCTCTCAAAGTGCCAGCTACAGTT TCTGTTTCTTCACCTGATGCTGTTACAGCGTATAATGGTTATCTTACTTCTTCTTCTAAAACACCTGAAG AACATTTTATTGAAACCATCTCACTTGCTGGTTCCTATAAAGATTGGTCCTATTCTGGACAATCTACACA ACTAGGTATAGAATTTCTTAAGAGAGGTGATAAAAGTGTATATTACACTAGTAATCCTACCACATTCCAC CTAGATGGTGAAGTTATCACCTTTGACAATCTTAAGACACTTCTTTCTTTGAGAGAAGTGAGGACTATTA AGGTGTTTACAACAGTAGACAACATTAACCTCCACACGCAAGTTGTGGACATGTCAATGACATATGGACA ACAGTTTGGTCCAACTTATTTGGATGGAGCTGATGTTACTAAAATAAAACCTCATAATTCACATGAAGGT AAAACATTTTATGTTTTACCTAATGATGACACTCTACGTGTTGAGGCTTTTGAGTACTACCACACAACTG ATCCTAGTTTTCTGGGTAGGTACATGTCAGCATTAAATCACACTAAAAAGTGGAAATACCCACAAGTTAA TGGTTTAACTTCTATTAAATGGGCAGATAACAACTGTTATCTTGCCACTGCATTGTTAACACTCCAACAA ATAGAGTTGAAGTTTAATCCACCTGCTCTACAAGATGCTTATTACAGAGCAAGGGCTGGTGAAGCTGCTA ACTTTTGTGCACTTATCTTAGCCTACTGTAATAAGACAGTAGGTGAGTTAGGTGATGTTAGAGAAACAAT GAGTTACTTGTTTCAACATGCCAATTTAGATTCTTGCAAAAGAGTCTTGAACGTGGTGTGTAAAACTTGT GGACAACAGCAGACAACCCTTAAGGGTGTAGAAGCTGTTATGTACATGGGCACACTTTCTTATGAACAAT TTAAGAAAGGTGTTCAGATACCTTGTACGTGTGGTAAACAAGCTACAAAATATCTAGTACAACAGGAGTC ACCTTTTGTTATGATGTCAGCACCACCTGCTCAGTATGAACTTAAGCATGGTACATTTACTTGTGCTAGT GAGTACACTGGTAATTACCAGTGTGGTCACTATAAACATATAACTTCTAAAGAAACTTTGTATTGCATAG ACGGTGCTTTACTTACAAAGTCCTCAGAATACAAAGGTCCTATTACGGATGTTTTCTACAAAGAAAACAG TTACACAACAACCATAAAACCAGTTACTTATAAATTGGATGGTGTTGTTTGTACAGAAATTGACCCTAAG TTGGACAATTATTATAAGAAAGACAATTCTTATTTCACAGAGCAACCAATTGATCTTGTACCAAACCAAC CATATCCAAACGCAAGCTTCGATAATTTTAAGTTTGTATGTGATAATATCAAATTTGCTGATGATTTAAA CCAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGGT GATGTGGTGGCTATTGATTATAAACACTACACACCCTCTTTTAAGAAAGGAGCTAAATTGTTACATAAAC CTATTGTTTGGCATGTTAACAATGCAACTAATAAAGCCACGTATAAACCAAATACCTGGTGTATACGTTG TCTTTGGAGCACAAAACCAGTTGAAACATCAAATTCGTTTGATGTACTGAAGTCAGAGGACGCGCAGGGA ATGGATAATCTTGCCTGCGAAGATCTAAAACCAGTCTCTGAAGAAGTAGTGGAAAATCCTACCATACAGA AAGACGTTCTTGAGTGTAATGTGAAAACTACCGAAGTTGTAGGAGACATTATACTTAAACCAGCAAATAA TAGTTTAAAAATTACAGAAGAGGTTGGCCACACAGATCTAATGGCTGCTTATGTAGACAATTCTAGTCTT ACTATTAAGAAACCTAATGAATTATCTAGAGTATTAGGTTTGAAAACCCTTGCTACTCATGGTTTAGCTG CTGTTAATAGTGTCCCTTGGGATACTATAGCTAATTATGCTAAGCCTTTTCTTAACAAAGTTGTTAGTAC AACTACTAACATAGTTACACGGTGTTTAAACCGTGTTTGTACTAATTATATGCCTTATTTCTTTACTTTA TTGCTACAATTGTGTACTTTTACTAGAAGTACAAATTCTAGAATTAAAGCATCTATGCCGACTACTATAG CAAAGAATACTGTTAAGAGTGTCGGTAAATTTTGTCTAGAGGCTTCATTTAATTATTTGAAGTCACCTAA TTTTTCTAAACTGATAAATATTATAATTTGGTTTTTACTATTAAGTGTTTGCCTAGGTTCTTTAATCTAC TCAACCGCTGCTTTAGGTGTTTTAATGTCTAATTTAGGCATGCCTTCTTACTGTACTGGTTACAGAGAAG GCTATTTGAACTCTACTAATGTCACTATTGCAACCTACTGTACTGGTTCTATACCTTGTAGTGTTTGTCT TAGTGGTTTAGATTCTTTAGACACCTATCCTTCTTTAGAAACTATACAAATTACCATTTCATCTTTTAAA 26 01 26 TGGGATTTAACTGCTTTTGGCTTAGTTGCAGAGTGGTTTTTGGCATATATTCTTTTCACTAGGTTTTTCT ATGTACTTGGATTGGCTGCAATCATGCAATTGTTTTTCAGCTATTTTGCAGTACATTTTATTAGTAATTC TTGGCTTATGTGGTTAATAATTAATCTTGTACAAATGGCCCCGATTTCAGCTATGGTTAGAATGTACATC TTCTTTGCATCATTTTATTATGTATGGAAAAGTTATGTGCATGTTGTAGACGGTTGTAATTCATCAACTT GTATGATGTGTTACAAACGTAATAGAGCAACAAGAGTCGAATGTACAACTATTGTTAATGGTGTTAGAAG GTCCTTTTATGTCTATGCTAATGGAGGTAAAGGCTTTTGCAAACTACACAATTGGAATTGTGTTAATTGT GATACATTCTGTGCTGGTAGTACATTTATTAGTGATGAAGTTGCGAGAGACTTGTCACTACAGTTTAAAA GACCAATAAATCCTACTGACCAGTCTTCTTACATCGTTGATAGTGTTACAGTGAAGAATGGTTCCATCCA TCTTTACTTTGATAAAGCTGGTCAAAAGACTTATGAAAGACATTCTCTCTCTCATTTTGTTAACTTAGAC AACCTGAGAGCTAATAACACTAAAGGTTCATTGCCTATTAATGTTATAGTTTTTGATGGTAAATCAAAAT GTGAAGAATCATCTGCAAAATCAGCGTCTGTTTACTACAGTCAGCTTATGTGTCAACCTATACTGTTACT AGATCAGGCATTAGTGTCTGATGTTGGTGATAGTGCGGAAGTTGCAGTTAAAATGTTTGATGCTTACGTT AATACGTTTTCATCAACTTTTAACGTACCAATGGAAAAACTCAAAACACTAGTTGCAACTGCAGAAGCTG AACTTGCAAAGAATGTGTCCTTAGACAATGTCTTATCTACTTTTATTTCAGCAGCTCGGCAAGGGTTTGT TGATTCAGATGTAGAAACTAAAGATGTTGTTGAATGTCTTAAATTGTCACATCAATCTGACATAGAAGTT ACTGGCGATAGTTGTAATAACTATATGCTCACCTATAACAAAGTTGAAAACATGACACCCCGTGACCTTG GTGCTTGTATTGACTGTAGTGCGCGTCATATTAATGCGCAGGTAGCAAAAAGTCACAACATTGCTTTGAT ATGGAACGTTAAAGATTTCATGTCATTGTCTGAACAACTACGAAAACAAATACGTAGTGCTGCTAAAAAG AATAACTTACCTTTTAAGTTGACATGTGCAACTACTAGACAAGTTGTTAATGTTGTAACAACAAAGATAG CACTTAAGGGTGGTAAAATTGTTAATAATTGGTTGAAGCAGTTAATTAAAGTTACACTTGTGTTCCTTTT TGTTGCTGCTATTTTCTATTTAATAACACCTGTTCATGTCATGTCTAAACATACTGACTTTTCAAGTGAA ATCATAGGATACAAGGCTATTGATGGTGGTGTCACTCGTGACATAGCATCTACAGATACTTGTTTTGCTA ACAAACATGCTGATTTTGACACATGGTTTAGCCAGCGTGGTGGTAGTTATACTAATGACAAAGCTTGCCC ATTGATTGCTGCAGTCATAACAAGAGAAGTGGGTTTTGTCGTGCCTGGTTTGCCTGGCACGATATTACGC ACAACTAATGGTGACTTTTTGCATTTCTTACCTAGAGTTTTTAGTGCAGTTGGTAACATCTGTTACACAC CATCAAAACTTATAGAGTACACTGACTTTGCAACATCAGCTTGTGTTTTGGCTGCTGAATGTACAATTTT TAAAGATGCTTCTGGTAAGCCAGTACCATATTGTTATGATACCAATGTACTAGAAGGTTCTGTTGCTTAT GAAAGTTTACGCCCTGACACACGTTATGTGCTCATGGATGGCTCTATTATTCAATTTCCTAACACCTACC TTGAAGGTTCTGTTAGAGTGGTAACAACTTTTGATTCTGAGTACTGTAGGCACGGCACTTGTGAAAGATC AGAAGCTGGTGTTTGTGTATCTACTAGTGGTAGATGGGTACTTAACAATGATTATTACAGATCTTTACCA GGAGTTTTCTGTGGTGTAGATGCTGTAAATTTACTTACTAATATGTTTACACCACTAATTCAACCTATTG GTGCTTTGGACATATCAGCATCTATAGTAGCTGGTGGTATTGTAGCTATCGTAGTAACATGCCTTGCCTA CTATTTTATGAGGTTTAGAAGAGCTTTTGGTGAATACAGTCATGTAGTTGCCTTTAATACTTTACTATTC CTTATGTCATTCACTGTACTCTGTTTAACACCAGTTTACTCATTCTTACCTGGTGTTTATTCTGTTATTT ACTTGTACTTGACATTTTATCTTACTAATGATGTTTCTTTTTTAGCACATATTCAGTGGATGGTTATGTT CACACCTTTAGTACCTTTCTGGATAACAATTGCTTATATCATTTGTATTTCCACAAAGCATTTCTATTGG TTCTTTAGTAATTACCTAAAGAGACGTGTAGTCTTTAATGGTGTTTCCTTTAGTACTTTTGAAGAAGCTG CGCTGTGCACCTTTTTGTTAAATAAAGAAATGTATCTAAAGTTGCGTAGTGATGTGCTATTACCTCTTAC GCAATATAATAGATACTTAGCTCTTTATAATAAGTACAAGTATTTTAGTGGAGCAATGGATACAACTAGC TACAGAGAAGCTGCTTGTTGTCATCTCGCAAAGGCTCTCAATGACTTCAGTAACTCAGGTTCTGATGTTC TTTACCAACCACCACAAACCTCTATCACCTCAGCTGTTTTGCAGAGTGGTTTTAGAAAAATGGCATTCCC ATCTGGTAAAGTTGAGGGTTGTATGGTACAAGTAACTTGTGGTACAACTACACTTAACGGTCTTTGGCTT GATGACGTAGTTTACTGTCCAAGACATGTGATCTGCACCTCTGAAGACATGCTTAACCCTAATTATGAAG ATTTACTCATTCGTAAGTCTAATCATAATTTCTTGGTACAGGCTGGTAATGTTCAACTCAGGGTTATTGG ACATTCTATGCAAAATTGTGTACTTAAGCTTAAGGTTGATACAGCCAATCCTAAGACACCTAAGTATAAG TTTGTTCGCATTCAACCAGGACAGACTTTTTCAGTGTTAGCTTGTTACAATGGTTCACCATCTGGTGTTT ACCAATGTGCTATGAGGCCCAATTTCACTATTAAGGGTTCATTCCTTAATGGTTCATGTGGTAGTGTTGG TTTTAACATAGATTATGACTGTGTCTCTTTTTGTTACATGCACCATATGGAATTACCAACTGGAGTTCAT GCTGGCACAGACTTAGAAGGTAACTTTTATGGACCTTTTGTTGACAGGCAAACAGCACAAGCAGCTGGTA CGGACACAACTATTACAGTTAATGTTTTAGCTTGGTTGTACGCTGCTGTTATAAATGGAGACAGGTGGTT TCTCAATCGATTTACCACAACTCTTAATGACTTTAACCTTGTGGCTATGAAGTACAATTATGAACCTCTA ACACAAGACCATGTTGACATACTAGGACCTCTTTCTGCTCAAACTGGAATTGCCGTTTTAGATATGTGTG CTTCATTAAAAGAATTACTGCAAAATGGTATGAATGGACGTACCATATTGGGTAGTGCTTTATTAGAAGA TGAATTTACACCTTTTGATGTTGTTAGACAATGCTCAGGTGTTACTTTCCAAAGTGCAGTGAAAAGAACA ATCAAGGGTACACACCACTGGTTGTTACTCACAATTTTGACTTCACTTTTAGTTTTAGTCCAGAGTACTC AATGGTCTTTGTTCTTTTTTTTGTATGAAAATGCCTTTTTACCTTTTGCTATGGGTATTATTGCTATGTC TGCTTTTGCAATGATGTTTGTCAAACATAAGCATGCATTTCTCTGTTTGTTTTTGTTACCTTCTCTTGCC ACTGTAGCTTATTTTAATATGGTCTATATGCCTGCTAGTTGGGTGATGCGTATTATGACATGGTTGGATA TGGTTGATACTAGTTTGTCTGGTTTTAAGCTAAAAGACTGTGTTATGTATGCATCAGCTGTAGTGTTACT AATCCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTG ACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCT CTGTTACTTCTAACTACTCAGGTGTAGTTACAACTGTCATGTTTTTGGCCAGAGGTATTGTTTTTATGTG TGTTGAGTATTGCCCTATTTTCTTCATAACTGGTAATACACTTCAGTGTATAATGCTAGTTTATTGTTTC TTAGGCTATTTTTGTACTTGTTACTTTGGCCTCTTTTGTTTACTCAACCGCTACTTTAGACTGACTCTTG GTGTTTATGATTACTTAGTTTCTACACAGGAGTTTAGATATATGAATTCACAGGGACTACTCCCACCCAA GAATAGCATAGATGCCTTCAAACTCAACATTAAATTGTTGGGTGTTGGTGGCAAACCTTGTATCAAAGTA GCCACTGTACAGTCTAAAATGTCAGATGTAAAGTGCACATCAGTAGTCTTACTCTCAGTTTTGCAACAAC TCAGAGTAGAATCATCATCTAAATTGTGGGCTCAATGTGTCCAGTTACACAATGACATTCTCTTAGCTAA AGATACTACTGAAGCCTTTGAAAAAATGGTTTCACTACTTTCTGTTTTGCTTTCCATGCAGGGTGCTGTA 26 01 26 GACATAAACAAGCTTTGTGAAGAAATGCTGGACAACAGGGCAACCTTACAAGCTATAGCCTCAGAGTTTA GTTCCCTTCCATCATATGCAGCTTTTGCTACTGCTCAAGAAGCTTATGAGCAGGCTGTTGCTAATGGTGA TTCTGAAGTTGTTCTTAAAAAGTTGAAGAAGTCTTTGAATGTGGCTAAATCTGAATTTGACCGTGATGCA GCCATGCAACGTAAGTTGGAAAAGATGGCTGATCAAGCTATGACCCAAATGTATAAACAGGCTAGATCTG AGGACAAGAGGGCAAAAGTTACTAGTGCTATGCAGACAATGCTTTTCACTATGCTTAGAAAGTTGGATAA TGATGCACTCAACAACATTATCAACAATGCAAGAGATGGTTGTGTTCCCTTGAACATAATACCTCTTACA ACAGCAGCCAAACTAATGGTTGTCATACCAGACTATAACACATATAAAAATACGTGTGATGGTACAACAT TTACTTATGCATCAGCATTGTGGGAAATCCAACAGGTTGTAGATGCAGATAGTAAAATTGTTCAACTTAG TGAAATTAGTATGGACAATTCACCTAATTTAGCATGGCCTCTTATTGTAACAGCTTTAAGGGCCAATTCT GCTGTCAAATTACAGAATAATGAGCTTAGTCCTGTTGCACTACGACAGATGTCTTGTGCTGCCGGTACTA CACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACTACAACACAACAAAGGGAGGTAGGTTTGTACT TGCACTGTTATCCGATTTACAGGATTTGAAATGGGCTAGATTCCCTAAGAGTGATGGAACTGGTACTATC TATACAGAACTGGAACCACCTTGTAGGTTTGTTACAGACACACCTAAAGGTCCTAAAGTGAAGTATTTAT ACTTTATTAAAGGATTAAACAACCTAAATAGAGGTATGGTACTTGGTAGTTTAGCTGCCACAGTACGTCT ACAAGCTGGTAATGCAACAGAAGTGCCTGCCAATTCAACTGTATTATCTTTCTGTGCTTTTGCTGTAGAT GCTGCTAAAGCTTACAAAGATTATCTAGCTAGTGGGGGACAACCAATCACTAATTGTGTTAAGATGTTGT GTACACACACTGGTACTGGTCAGGCAATAACAGTTACACCGGAAGCCAATATGGATCAAGAATCCTTTGG TGGTGCATCGTGTTGTCTGTACTGCCGTTGCCACATAGATCATCCAAATCCTAAAGGATTTTGTGACTTA AAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTACACTTAAAAACACAG TCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCA GTCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCA CAGGCACTAGTACTGATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAGTAGCTGGTTTTGCTAA ATTCCTAAAAACTAATTGTTGTCGCTTCCAAGAAAAGGACGAAGATGACAATTTAATTGATTCTTACTTT GTAGTTAAGAGACACACTTTCTCTAACTACCAACATGAAGAAACAATTTATAATTTACTTAAGGATTGTC CAGCTGTTGCTAAACATGACTTCTTTAAGTTTAGAATAGACGGTGACATGGTACCACATATATCACGTCA ACGTCTTACTAAATACACAATGGCAGACCTCGTCTATGCTTTAAGGCATTTTGATGAAGGTAATTGTGAC ACATTAAAAGAAATACTTGTCACATACAATTGTTGTGATGATGATTATTTCAATAAAAAGGACTGGTATG ATTTTGTAGAAAACCCAGATATATTACGCGTATACGCCAACTTAGGTGAACGTGTACGCCAAGCTTTGTT AAAAACAGTACAATTCTGTGATGCCATGCGAAATGCTGGTATTGTTGGTGTACTGACATTAGATAATCAA GATCTCAATGGTAACTGGTATGATTTCGGTGATTTCATACAAACCACGCCAGGTAGTGGAGTTCCTGTTG TAGATTCTTATTATTCATTGTTAATGCCTATATTAACCTTGACCAGGGCTTTAACTGCAGAGTCACATGT TGACACTGACTTAACAAAGCCTTACATTAAGTGGGATTTGTTAAAATATGACTTCACGGAAGAGAGGTTA AAACTCTTTGACCGTTATTTTAAATATTGGGATCAGACATACCACCCAAATTGTGTTAACTGTTTGGATG ACAGATGCATTCTGCATTGTGCAAACTTTAATGTTTTATTCTCTACAGTGTTCCCACCTACAAGTTTTGG ACCACTAGTGAGAAAAATATTTGTTGATGGTGTTCCATTTGTAGTTTCAACTGGATACCACTTCAGAGAG CTAGGTGTTGTACATAATCAGGATGTAAACTTACATAGCTCTAGACTTAGTTTTAAGGAATTACTTGTGT ATGCTGCTGACCCTGCTATGCACGCTGCTTCTGGTAATCTATTACTAGATAAACGCACTACGTGCTTTTC AGTAGCTGCACTTACTAACAATGTTGCTTTTCAAACTGTCAAACCCGGTAATTTTAACAAAGACTTCTAT GACTTTGCTGTGTCTAAGGGTTTCTTTAAGGAAGGAAGTTCTGTTGAATTAAAACACTTCTTCTTTGCTC AGGATGGTAATGCTGCTATCAGCGATTATGACTACTATCGTTATAATCTACCAACAATGTGTGATATCAG ACAACTACTATTTGTAGTTGAAGTTGTTGATAAGTACTTTGATTGTTACGATGGTGGCTGTATTAATGCT AACCAAGTCATCGTCAACAACCTAGACAAATCAGCTGGTTTTCCATTTAATAAATGGGGTAAGGCTAGAC TTTATTATGATTCAATGAGTTATGAGGATCAAGATGCACTTTTCGCATATACAAAACGTAATGTCATCCC TACTATAACTCAAATGAATCTTAAGTATGCCATTAGTGCAAAGAATAGAGCTCGCACCGTAGCTGGTGTC TCTATCTGTAGTACTATGACCAATAGACAGTTTCATCAAAAATTATTGAAATCAATAGCCGCCACTAGAG GAGCTACTGTAGTAATTGGAACAAGCAAATTCTATGGTGGTTGGCACAACATGTTAAAAACTGTTTATAG TGATGTAGAAAACCCTCACCTTATGGGTTGGGATTATCCTAAATGTGATAGAGCCATGCCTAACATGCTT AGAATTATGGCCTCACTTGTTCTTGCTCGCAAACATACAACGTGTTGTAGCTTGTCACACCGTTTCTATA GATTAGCTAATGAGTGTGCTCAAGTATTGAGTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACC AGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTTTTAACATTTGTCAAGCTGTC ACGGCCAATGTTAATGCACTTTTATCTACTGATGGTAACAAAATTGCCGATAAGTATGTCCGCAATTTAC AACACAGACTTTATGAGTGTCTCTATAGAAATAGAGATGTTGACACAGACTTTGTGAATGAGTTTTACGC ATATTTGCGTAAACATTTCTCAATGATGATACTCTCTGACGATGCTGTTGTGTGTTTCAATAGCACTTAT GCATCTCAAGGTCTAGTGGCTAGCATAAAGAACTTTAAGTCAGTTCTTTATTATCAAAACAATGTTTTTA TGTCTGAAGCAAAATGTTGGACTGAGACTGACCTTACTAAAGGACCTCATGAATTTTGCTCTCAACATAC AATGCTAGTTAAACAGGGTGATGATTATGTGTACCTTCCTTACCCAGATCCATCAAGAATCCTAGGGGCC GGCTGTTTTGTAGATGATATCGTAAAAACAGATGGTACACTTATGATTGAACGGTTCGTGTCTTTAGCTA TAGATGCTTACCCACTTACTAAACATCCTAATCAGGAGTATGCTGATGTCTTTCATTTGTACTTACAATA CATAAGAAAGCTACATGATGAGTTAACAGGACACATGTTAGACATGTATTCTGTTATGCTTACTAATGAT AACACTTCAAGGTATTGGGAACCTGAGTTTTATGAGGCTATGTACACACCGCATACAGTCTTACAGGCTG TTGGGGCTTGTGTTCTTTGCAATTCACAGACTTCATTAAGATGTGGTGCTTGCATACGTAGACCATTCTT ATGTTGTAAATGCTGTTACGACCATGTCATATCAACATCACATAAATTAGTCTTGTCTGTTAATCCGTAT GTTTGCAATGCTCCAGGTTGTGATGTCACAGATGTGACTCAACTTTACTTAGGAGGTATGAGCTATTATT GTAAATCACATAAACCACCCATTAGTTTTCCATTGTGTGCTAATGGACAAGTTTTTGGTTTATATAAAAA TACATGTGTTGGTAGCGATAATGTTACTGACTTTAATGCAATTGCAACATGTGACTGGACAAATGCTGGT GATTACATTTTAGCTAACACCTGTACTGAAAGACTCAAGCTTTTTGCAGCAGAAACGCTCAAAGCTACTG AGGAGACATTTAAACTGTCTTATGGTATTGCTACTGTACGTGAAGTGCTGTCTGACAGAGAATTACATCT TTCATGGGAAGTTGGTAAACCTAGACCACCACTTAACCGAAATTATGTCTTTACTGGTTATCGTGTAACT AAAAACAGTAAAGTACAAATAGGAGAGTACACCTTTGAAAAAGGTGACTATGGTGATGCTGTTGTTTACC 26 01 26 GAGGTACAACAACTTACAAATTAAATGTTGGTGATTATTTTGTGCTGACATCACATACAGTAATGCCATT AAGTGCACCTACACTAGTGCCACAAGAGCACTATGTTAGAATTACTGGCTTATACCCAACACTCAATATC TCAGATGAGTTTTCTAGCAATGTTGCAAATTATCAAAAGGTTGGTATGCAAAAGTATTCTACACTCCAGG GACCACCTGGTACTGGTAAGAGTCATTTTGCTATTGGCCTAGCTCTCTACTACCCTTCTGCTCGCATAGT GTATACAGCTTGCTCTCATGCCGCTGTTGATGCACTATGTGAGAAGGCATTAAAATATTTGCCTATAGAT AAATGTAGTAGAATTATACCTGCACGTGCTCGTGTAGAGTGTTTTGATAAATTCAAAGTGAATTCAACAT TAGAACAGTATGTCTTTTGTACTGTAAATGCATTGCCTGAGACGACAGCAGATATAGTTGTCTTTGATGA AATTTCAATGGCCACAAATTATGATTTGAGTGTTGTCAATGCCAGATTACGTGCTAAGCACTATGTGTAC ATTGGCGACCCTGCTCAATTACCTGCACCACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATT TCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCC TGCTGAAATTGTTGACACTGTGAGTGCTTTGGTTTATGATAATAAGCTTAAAGCACATAAAGACAAATCA GCTCAATGCTTTAAAATGTTTTATAAGGGTGTTATCACGCATGATGTTTCATCTGCAATTAACAGGCCAC AAATAGGCGTGGTAAGAGAATTCCTTACACGTAACCCTGCTTGGAGAAAAGCTGTCTTTATTTCACCTTA TAATTCACAGAATGCTGTAGCCTCAAAGATTTTGGGACTACCAACTCAAACTGTTGATTCATCACAGGGC TCAGAATATGACTATGTCATATTCACTCAAACCACTGAAACAGCTCACTCTTGTAATGTAAACAGATTTA ATGTTGCTATTACCAGAGCAAAAGTAGGCATACTTTGCATAATGTCTGATAGAGACCTTTATGACAAGTT GCAATTTACAAGTCTTGAAATTCCACGTAGGAATGTGGCAACTTTACAAGCTGAAAATGTAACAGGACTC TTTAAAGATTGTAGTAAGGTAATCACTGGGTTACATCCTACACAGGCACCTACACACCTCAGTGTTGACA CTAAATTCAAAACTGAAGGTTTATGTGTTGACATACCTGGCATACCTAAGGACATGACCTATAGAAGACT CATCTCTATGATGGGTTTTAAAATGAATTATCAAGTTAATGGTTACCCTAACATGTTTATCACCCGCGAA GAAGCTATAAGACATGTACGTGCATGGATTGGCTTCGATGTCGAGGGGTGTCATGCTACTAGAGAAGCTG TTGGTACCAATTTACCTTTACAGCTAGGTTTTTCTACAGGTGTTAACCTAGTTGCTGTACCTACAGGTTA TGTTGATACACCTAATAATACAGATTTTTCCAGAGTTAGTGCTAAACCACCGCCTGGAGATCAATTTAAA CACCTCATACCACTTATGTACAAAGGACTTCCTTGGAATGTAGTGCGTATAAAGATTGTACAAATGTTAA GTGACACACTTAAAAATCTCTCTGACAGAGTCGTATTTGTCTTATGGGCACATGGCTTTGAGTTGACATC TATGAAGTATTTTGTGAAAATAGGACCTGAGCGCACCTGTTGTCTATGTGATAGACGTGCCACATGCTTT TCCACTGCTTCAGACACTTATGCCTGTTGGCATCATTCTATTGGATTTGATTACGTCTATAATCCGTTTA TGATTGATGTTCAACAATGGGGTTTTACAGGTAACCTACAAAGCAACCATGATCTGTATTGTCAAGTCCA TGGTAATGCACATGTAGCTAGTTGTGATGCAATCATGACTAGGTGTCTAGCTGTCCACGAGTGCTTTGTT AAGCGTGTTGACTGGACTATTGAATATCCTATAATTGGTGATGAACTGAAGATTAATGCGGCTTGTAGAA AGGTTCAACACATGGTTGTTAAAGCTGCATTATTAGCAGACAAATTCCCAGTTCTTCACGACATTGGTAA CCCTAAAGCTATTAAGTGTGTACCTCAAGCTGATGTAGAATGGAAGTTCTATGATGCACAGCCTTGTAGT GACAAAGCTTATAAAATAGAAGAATTATTCTATTCTTATGCCACACATTCTGACAAATTCACAGATGGTG TATGCCTATTTTGGAATTGCAATGTCGATAGATATCCTGCTAATTCCATTGTTTGTAGATTTGACACTAG AGTGCTATCTAACCTTAACTTGCCTGGTTGTGATGGTGGCAGTTTGTATGTAAATAAACATGCATTCCAC ACACCAGCTTTTGATAAAAGTGCTTTTGTTAATTTAAAACAATTACCATTTTTCTATTACTCTGACAGTC CATGTGAGTCTCATGGAAAACAAGTAGTGTCAGATATAGATTATGTACCACTAAAGTCTGCTACGTGTAT AACACGTTGCAATTTAGGTGGTGCTGTCTGTAGACATCATGCTAATGAGTACAGATTGTATCTCGATGCT TATAACATGATGATCTCAGCTGGCTTTAGCTTGTGGGTTTACAAACAATTTGATACTTATAACCTCTGGA ACACTTTTACAAGACTTCAGAGTTTAGAAAATGTGGCTTTTAATGTTGTAAATAAGGGACACTTTGATGG ACAACAGGGTGAAGTACCAGTTTCTATCATTAATAACACTGTTTACACAAAAGTTGATGGTGTTGATGTA GAATTGTTTGAAAATAAAACAACATTACCTGTTAATGTAGCATTTGAGCTTTGGGCTAAGCGCAACATTA AACCAGTACCAGAGGTGAAAATACTCAATAATTTGGGTGTGGACATTGCTGCTAATACTGTGATCTGGGA CTACAAAAGAGATGCTCCAGCACATATATCTACTATTGGTGTTTGTTCTATGACTGACATAGCCAAGAAA CCAACTGAAACGATTTGTGCACCACTCACTGTCTTTTTTGATGGTAGAGTTGATGGTCAAGTAGACTTAT TTAGAAATGCCCGTAATGGTGTTCTTATTACAGAAGGTAGTGTTAAAGGTTTACAACCATCTGTAGGTCC CAAACAAGCTAGTCTTAATGGAGTCACATTAATTGGAGAAGCCGTAAAAACACAGTTCAATTATTATAAG AAAGTTGATGGTGTTGTCCAACAATTACCTGAAACTTACTTTACTCAGAGTAGAAATTTACAAGAATTTA AACCCAGGAGTCAAATGGAAATTGATTTCTTAGAATTAGCTATGGATGAATTCATTGAACGGTATAAATT AGAAGGCTATGCCTTCGAACATATCGTTTATGGAGATTTTAGTCATAGTCAGTTAGGTGGTTTACATCTA CTGATTGGACTAGCTAAACGTTTTAAGGAATCACCTTTTGAATTAGAAGATTTTATTCCTATGGACAGTA CAGTTAAAAACTATTTCATAACAGATGCGCAAACAGGTTCATCTAAGTGTGTGTGTTCTGTTATTGATTT ATTACTTGATGATTTTGTTGAAATAATAAAATCCCAAGATTTATCTGTAGTTTCTAAGGTTGTCAAAGTG ACTATTGACTATACAGAAATTTCATTTATGCTTTGGTGTAAAGATGGCCATGTAGAAACATTTTACCCAA AATTACAATCTAGTCAAGCGTGGCAACCGGGTGTTGCTATGCCTAATCTTTACAAAATGCAAAGAATGCT ATTAGAAAAGTGTGACCTTCAAAATTATGGTGATAGTGCAACATTACCTAAAGGCATAATGATGAATGTC GCAAAATATACTCAACTGTGTCAATATTTAAACACATTAACATTAGCTGTACCCTATAATATGAGAGTTA TACATTTTGGTGCTGGTTCTGATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAGACAGTGGTTGCCTAC GGGTACGCTGCTTGTCGATTCAGATCTTAATGACTTTGTCTCTGATGCAGATTCAACTTTGATTGGTGAT TGTGCAACTGTACATACAGCTAATAAATGGGATCTCATTATTAGTGATATGTACGACCCTAAGACTAAAA ATGTTACAAAAGAAAATGACTCTAAAGAGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCT AGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATG GGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTG GATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTG GAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTA AGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAG GTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAA CAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCA ATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCA 26 01 26 GTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATG TCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGC TTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCC CTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCAT TTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGC GAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTC AAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTA TTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTAT TAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCA GGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATA ATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTT GAAATCCTTCACTGTAGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATT GTTAGATTTCCTAATATTACAAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTG TTTATGCTTGGAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATC ATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTAT GCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTG ATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTC TAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGA GATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACT TTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACT TTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAAC AAATGTGTCAATTTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTC TGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATGCTGTCCGTGATCCACAGACACTTGA GATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCAGGAACAAATACTTCTAAC CAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTA CTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGC TGAACATGTCAACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACT CAGACTAATTCTCCTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTG GTGCAGAAAATTCAGTTGCTTACTCTAATAACTCTATTGCCATACCCACAAATTTTACTATTAGTGTTAC CACAGAAATTCTACCAGTGTCTATGACCAAGACATCAGTAGATTGTACAATGTACATTTGTGGTGATTCA ACTGAATGCAGCAATCTTTTGTTGCAATATGGCAGTTTTTGTACACAATTAAACCGTGCTTTAACTGGAA TAGCTGTTGAACAAGACAAAAACACCCAAGAAGTTTTTGCACAAGTCAAACAAATTTACAAAACACCACC AATTAAAGATTTTGGTGGTTTTAATTTTTCACAAATATTACCAGATCCATCAAAACCAAGCAAGAGGTCA TTTATTGAAGATCTACTTTTCAACAAAGTGACACTTGCAGATGCTGGCTTCATCAAACAATATGGTGATT GCCTTGGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTTTTGCCACC TTTGCTCACAGATGAAATGATTGCTCAATACACTTCTGCACTGTTAGCGGGTACAATCACTTCTGGTTGG ACCTTTGGTGCAGGTGCTGCATTACAAATACCATTTGCTATGCAAATGGCTTATAGGTTTAATGGTATTG GAGTTACACAGAATGTTCTCTATGAGAACCAAAAATTGATTGCCAACCAATTTAATAGTGCTATTGGCAA AATTCAAGACTCACTTTCTTCCACAGCAAGTGCACTTGGAAAACTTCAAGATGTGGTCAACCAAAATGCA CAAGCTTTAAACACGCTTGTTAAACAACTTAGCTCCAATTTTGGTGCAATTTCAAGTGTTTTAAATGATA TCCTTTCACGTCTTGACAAAGTTGAGGCTGAAGTGCAAATTGATAGGTTGATCACAGGCAGACTTCAAAG TTTGCAGACATATGTGACTCAACAATTAATTAGAGCTGCAGAAATCAGAGCTTCTGCTAATCTTGCTGCT ACTAAAATGTCAGAGTGTGTACTTGGACAATCAAAAAGAGTTGATTTTTGTGGAAAGGGCTATCATCTTA TGTCCTTCCCTCAGTCAGCACCTCATGGTGTAGTCTTCTTGCATGTGACTTATGTCCCTGCACAAGAAAA GAACTTCACAACTGCTCCTGCCATTTGTCATGATGGAAAAGCACACTTTCCTCGTGAAGGTGTCTTTGTT TCAAATGGCACACACTGGTTTGTAACACAAAGGAATTTTTATGAACCACAAATCATTACTACAGACAACA CATTTGTGTCTGGTAACTGTGATGTTGTAATAGGAATTGTCAACAACACAGTTTATGATCCTTTGCAACC TGAATTAGACTCATTCAAGGAGGAGTTAGATAAATATTTTAAGAATCATACATCACCAGATGTTGATTTA GGTGACATCTCTGGCATTAATGCTTCAGTTGTAAACATTCAAAAAGAAATTGACCGCCTCAATGAGGTTG CCAAGAATTTAAATGAATCTCTCATCGATCTCCAAGAACTTGGAAAGTATGAGCAGTATATAAAATGGCC ATGGTACATTTGGCTAGGTTTTATAGCTGGCTTGATTGCCATAGTAATGGTGACAATTATGCTTTGCTGT ATGACCAGTTGCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACG ACTCTGAGCCAGTGCTCAAAGGAGTCAAATTACATTACACATAAACGAACTTATGGATTTGTTTATGAGA ATCTTCACAATTGGAACTGTAACTTTGAAGCAAGGTGAAATCAAGGATGCTACTCCTTCAGATTTTGTTC GCGCTACTGCAACGATACCGATACAAGCCTCACTCCCTTTCGGATGGCTTATTGTTGGCGTTGCACTTCT TGCTGTTTTTCAGAGCGCTTCCAAAATCATAACCCTCAAAAAGAGATGGCAACTAGCACTCTCCAAGGGT GTTCACTTTGTTTGCAACTTGCTGTTGTTGTTTGTAACAGTTTACTCACACCTTTTGCTCGTTGCTGCTG GCCTTGAAGCCCCTTTTCTCTATCTTTATGCTTTAGTCTACTTCTTGCAGAGTATAAACTTTGTAAGAAT AATAATGAGGCTTTGGCTTTGCTGGAAATGCCGTTCCAAAAACCCATTACTTTATGATGCCAACTATTTT CTTTGCTGGCATACTAATTGTTACGACTATTGTATACCTTACAATAGTGTAACTTCTTCAATTGTCATTA CTTCAGGTGATGGCACAACAAGTCCTATTTCTGAACATGACTACCAGATTGGTGGTTATACTGAAAAATG GGAATCTGGAGTAAAAGACTGTGTTGTATTACACAGTTACTTCACTTCAGACTATTACCAGCTGTACTCA ACTCAATTGAGTACAGACACTGGTGTTGAACATGTTACCTTCTTCATCTACAATAAAATTGTTGATGAGC CTGAAGAACATGTCCAAATTCACACAATCGACGGTTCATCCGGAGTTGTTAATCCAGTAATGGAACCAAT TTATGATGAACCGACGACGACTACTAGCGTGCCTTTGTAAGCACAAGCTGATGAGTACGAACTTATGTAC TCATTCGTTTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTAT TCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGT GAGTCTTGTAAAACCTTCTTTTTACGTTTACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTCCTGAT CTTCTGGTCTAAACGAACTAAATATTATATTAGTTTTTCTGTTTGGAACTTTAATTTTAGCCATGGCAGA 26 01 26 TTCCAACGGTACTATTACCGTTGAAGAGCTTAAAAAGCTCCTTGAACAATGGAACCTAGTAATAGGTTTC CTATTCCTTACATGGATTTGTCTTCTACAATTTGCCTATGCCAACAGGAATAGGTTTTTGTATATAATTA AGTTAATTTTCCTCTGGCTGTTATGGCCAGTAACTTTAGCTTGTTTTGTGCTTGCTGCTGTTTACAGAAT AAATTGGATCACCGGTGGAATTGCTATCGCAATGGCTTGTCTTGTAGGCTTGATGTGGCTCAGCTACTTC ATTGCTTCTTTCAGACTGTTTGCGCGTACGCGTTCCATGTGGTCATTCAATCCAGAAACTAACATTCTTC TCAACGTGCCACTCCATGGCACTATTCTGACCAGACCGCTTCTAGAAAGTGAACTCGTAATCGGAGCTGT GATCCTTCGTGGACATCTTCGTATTGCTGGACACCATCTAGGACGCTGTGACATCAAGGACCTGCCTAAA GAAATCACTGTTGCTACATCACGAACGCTTTCTTATTACAAATTGGGAGCTTCGCAGCGTGTAGCAGGTG ACTCAGGTTTTGCTGCATACAGTCGCTACAGGATTGGCAACTATAAATTAAACACAGACCATTCCAGTAG CAGTGACAATATTGCTTTGCTTGTACAGTAAGTGACAACAGATGTTTCATCTCGTTGACTTTCAGGTTAC TATAGCAGAGATATTACTAATTATTATGAGGACTTTTAAAGTTTCCATTTGGAATCTTGATTACATCATA AACCTCATAATTAAAAATTTATCTAAGTCACTAACTGAGAATAAATATTCTCAATTAGATGAAGAGCAAC CAATGGAGATTGATTAAACGAACATGAAAATTATTCTTTTCTTGGCACTGATAACACTCGCTACTTGTGA GCTTTATCACTACCAAGAGTGTGTTAGAGGTACAACAGTACTTTTAAAAGAACCTTGCTCTTCTGGAACA TACGAGGGCAATTCACCATTTCATCCTCTAGCTGATAACAAATTTGCACTGACTTGCTTTAGCACTCAAT TTGCTTTTGCTTGTCCTGACGGCGTAAAACACGTCTATCAGTTACGTGCCAGATCAGTTTCACCTAAACT GTTCATCAGACAAGAGGAAGTTCAAGAACTTTACTCTCCAATTTTTCTTATTGTTGCGGCAATAGTGTTT ATAACACTTTGCTTCACACTCAAAAGAAAGACAGAATGATTGAACTTTCATTAATTGACTTCTATTTGTG CTTTTTAGCCTTTCTGCTATTCCTTGTTTTAATTATGCTTATTATCTTTTGGTTCTCACTTGAACTGCAA GATCATAATGAAACTTGTCACGCCTAAACGAACATGAAATTTCTTGTTTTCTTAGGAATCATCACAACTG TAGCTGCATTTCACCAAGAATGTAGTTTACAGTCATGTACTCAACATCAACCATATGTAGTTGATGACCC GTGTCCTATTCACTTCTATTCTAAATGGTATATTAGAGTAGGAGCTAGAAAATCAGCACCTTTAATTGAA TTGTGCGTGGATGAGGCTGGTTCTAAATCACCCATTCAGTACATCGATATCGGTAATTATACAGTTTCCT GTTTACCTTTTACAATTAATTGCCAGGAACCTAAATTGGGTAGTCTTGTAGTGCGTTGTTCGTTCTATGA AGACTTTTTAGAGTATCATGACGTTCGTGTTGTTTTAGATTTCATCTAAACGAACAAACTAAAATGTCTG ATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAG TAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGTTTACCCAATAATACT GCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGACAAGGCGTTC CAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGG TGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCT GGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAA AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAAC ATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGT AGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCA ATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGG TAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGG CAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCC AAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACA ATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACG TGGTTGACCTACACAGGTGCCATCAAATTGGATGACAAAGATCCAAATTTCAAAGATCAAGTCATTTTGC TGAATAAGCATATTGACGCATACAAAACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGC TGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAGCAAACTGTGACTCTTCTTCCTGCTGCAGAT TTGGATGATTTCTCCAAACAATTGCAACAATCCATGAGCAGTGCTGACTCAACTCAGGCCTAAACTCATG CAGACCACACAAGGCAGATGGGCTATATAAACGTTTTCGCTTTTCCGTTTACGATATATAGTCTACTCTT GTGCAGAATGAATTCTCGTAACTACATAGCACAAGTAGATGTAGTTAACTTTAATCTCACATAGCAATCT TTAATCAGTGTGTAACATTAGGGAGGACTTGAAAGAGCCACCACATTTTCACCGAGGCCACGCGGAGTAC GATCGAGTGTACAGTGAACAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTAATGTGTAAAATTAAT TTTAGTAGTGCTATCCCCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAA 2 Severe acute respirat ory syndrome coronavi rus 2 isolate SARS-CoV-2 / human / BGD / G039 392 / 2021 / complete genome ATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTTACAGGTTC GCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAA AGATGGCACTTGTGGCTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTC ATCAAACGTTCGGATGCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAG GCATTCAGTACGGTCGTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGC TTACCGCAAGGTTCTTCTTCGTAAGAACGGTAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTA AAGTCATTTGACTTAGGCGACGAGCTTGGCACTGATCCTTATGAAGATTTTCAAGAAAACTGGAACACTA AACATAGCAGTGGTGTTACCCGTGAACTCATGCGTGAGCTTAACGGAGGGGCATACACTCGCTATGTCGA TAACAACTTCTGTGGCCCTGATGGCTACCCTCTTGAGTGCATTAAAGACCTTCTAGCACGTGCTGGTAAA GCTTCATGCACTTTGTCTGAACAACTGGACTTTATTGACACTAAGAGGGGTGTATACTGCTGCCGTGAAC ATGAGCATGAAATTGCTTGGTACACGGAACGTTCTGAAAAGAGCTATGAATTGCAGACACCTTTTGAAAT TAAATTGGCAAAGAAATTTGACACCTTCAATGGGGAATGTCCAAATTTTGTATTTCCCTTAAATTCCATA ATCAAGACTATTCAACCAAGGGTTGAAAAGAAAAAGCTTGATGGCTTTATGGGTAGAATTCGATCTGTCT ATCCAGTTGCGTCACCAAATGAATGCAACCAAATGTGCCTTTCAACTCTCATGAAGTGTGATCATTGTGG TGAAACTTCATGGCAGACGGGCGATTTTGTTAAAGCCACTTGCGAATTTTGTGGCACTGAGAATTTGACT AAAGAAGGTGCCACTACTTGTGGTTACTTACCCCAAAATGCTGTTGTTAAAATTTATTGTCCAGCATGTC ACAATTCAGAAGTAGGACCTGAGCATAGTCTTGCCGAATACCATAATGAATCTGGCTTGAAAACCATTCT TCGTAAGGGTGGTCGCACTATTGCCTTTGGAGGCTGTGTGTTCTCTTATGTTGGTTGCCATAACAAGTGT GCCTATTGGGTTCCACGTGCTAGCGCTAACATAGGTTGTAACCATACAGGTGTTGTTGGAGAAGGTTCCG AAGGTCTTAATGACAACCTTCTTGAAATACTCCAAAAAGAGAAAGTCAACATCAATATTGTTGGTGACTT 26 01 26 TAAACTTAATGAAGAGATCGCCATTATTTTGGCATCTTTTTCTGCTTCCACAAGTGCTTTTGTGGAAACT GTGAAAGGTTTGGATTATAAAGCATTCAAACAAATTGTTGAATCCTGTGGTAATTTTAAAGTTACAAAAG GAAAAGCTAAAAAAGGTGCCTGGAATATTGGTGAACAGAAATCAATACTGAGTCCTCTTTATGCATTTGC ATCAGAGGCTGCTCGTGTTGTACGATCAATTTTCTCCCGCACTCTTGAAACTGCTCAAAATTCTGTGCGT GTTTTACAGAAGGCCGCTATAACAATACTAGATGGAATTTCACAGTATTCACTGAGACTCATTGATGCTA TGATGTTCACATCTGATTTGGCTACTAACAATCTAGTTGTAATGGCCTACATTACAGGTGGTGTTGTTCA GTTGACTTCGCAGTGGCTAACTAACATCTTTGGCACTGTTTATGAAAAACTCAAACCCGTCCTTGATTGG CTTGAAGAGAAGTTTAAGGAAGGTGTAGAGTTTCTTAGAGACGGTTGGGAAATTGTTAAATTTATCTCAA CCTGTGCTTGTGAAATTGTCGGTGGACAAATTGTCACCTGTGCAAAGGAAATTAAGGAGAGTGTTCAGAC ATTCTTTAAGCTTGTAAATAAATTTTTGGCTTTGTGTGCTGACTCTATCATTATTGGTGGAGCTAAACTT AAAGCCTTGAATTTAGGTGAAACATTTGTCACGCACTCAAAGGGATTGTACAGAAAGTGTGTTAAATCCA GAGAAGAAACTGGCCTACTCATGCCTCTAAAAGCCCCAAAAGAAATTATCTTCTTAGAGGGAGAAACACT TCCCACAGAAGTGTTAACAGAGGAAGTTGTCTTGAAAACTGGTGATTTACAACCATTAGAACAACCTACT AGTGAAGCTGTTGAAGCTCCATTGGTTGGTACACCAGTTTGTATTAACGGGCTTATGTTGCTCGAAATCA AAGACACAGAAAAGTACTGTGCCCTTGCACCTAATATGATGGTAACAAACAATACCTTCACACTCAAAGG CGGTGCACCAACAAAGGTTACTTTTGGTGATGACACTGTGATAGAAGTGCAAGGTTACAAGAGTGTGAAT ATCACTTTTGAACTTGATGAAAGGATTGATAAAGTACTTAATGAGAAGTGCTCTGCCTATACAGTTGAAC TCGGTACAGAAGTAAATGAGTTCGCCTGTGTTGTGGCAGATGCTGTCATAAAAACTTTGCAACCAGTATC TGAATTACTTACACCACTGGGCATTGATTTAGATGAGTGGAGTATGGCTACATACTACTTATTTGATGAG TCTGGTGAGTTTAAATTGGCTTCACATATGTATTGTTCTTTTTACCCTCCAGATGAGGATGAAGAAGAAG GTGATTGTGAAGAAGAAGAGTTTGAGCCATCAACTCAATATGAGTATGGTACTGAAGATGATTACCAAGG TAAACCTTTGGAATTTGGTGCCACTTCTGCTGCTCTTCAACCTGAAGAAGAGCAAGAAGAAGATTGGTTA GATGATGATAGTCAACAAACTGTTGGTCAACAAGACGGCAGTGAGGACAATCAGACAACTATTATTCAAA CAATTGTTGAGGTTCAACCTCAATTAGAGATGGAACTTACACCAGTTGTTCAGACTATTGAAGTGAATAG TTTTAGTGGTTATTTAAAACTTACTGACAATGTATACATTAAAAATGCAGACATTGTGGAAGAAGCTAAA AAGGTAAAACCAACAGTGGTTGTTAATGCAGCCAATGTTTACCTTAAACATGGAGGAGGTGTTGCAGGAG CCTTAAATAAGGCTACTAACAATGCCATGCAAGTTGAATCTGATGATTACATAGCTACTAATGGACCACT TAAAGTGGGTGGTAGTTGTGTTTTAAGCGGACACAATCTTGCTAAACACTGTCTTCATGTTGTCGGCCCA AATGTTAACAAAGGTGAAGACATTCAACTTCTTAAGAGTGCTTATGAAAATTTTAATCAGCACGAAGTTC TACTTGCACCATTATTATCAGCTGGTATTTTTGGTGCTGACCCTATACATTCTTTAAGAGTTTGTGTAGA TACTGTTCGCACAAATGTCTACTTAGCTGTCTTTGATAAAAATCTCTATGACAAACTTGTTTCAAGCTTT TTGGAAATGAAGAGTGAAAAGCAAGTTGAACAAAAGATCGCTGAGATTCCTAAAGAGGAAGTTAAGCCAT TTATAACTGAAAGTAAACCTTCAGTTGAACAGAGAAAACAAGATGATAAGAAAATCAAAGCTTGTGTTGA AGAAGTTACAACAACTCTGGAAGAAACTAAGTTCCTCACAGAAAACTTGTTACTTTATATTGACATTAAT GGCAATCTTCATCCAGATTCTGCCACTCTTGTTAGTGACATTGACATCACTTTCTTAAAGAAAGATGCTC CATATATAGTGGGTGATGTTGTTCAAGAGGGTGTTTTAACTGCTGTGGTTATACCTACTAAAAAGGCTGG TGGCACTACTGAAATGCTAGCGAAAGCTTTGAGAAAAGTGCCAACAGACAATTATATAACCACTTACCCG GGTCAGGGTTTAAATGGTTACACTGTAGAGGAGGCAAAGACAGTGCTTAAAAAGTGTAAAAGTGCCTTTT ACATTCTACCATCTATTATCTCTAATGAGAAGCAAGAAATTCTTGGAACTGTTTCTTGGAATTTGCGAGA AATGCTTGCACATGCAGAAGAAACACGCAAATTAATGCCTGTCTGTGTGGAAACTAAAGCCATAGTTTCA ACTATACAGCGTAAATATAAGGGTATTAAAATACAAGAGGGTGTGGTTGATTATGGTGCTAGATTTTACT TTTACACCAGTAAAACAACTGTAGCGTCACTTATCAACACACTTAACGATCTAAATGAAACTCTTGTTAC AATGCCACTTGGCTATGTAACACATGGCTTAAATTTGGAAGAAGCTGCTCGGTATATGAGATCTCTCAAA GTGCCAGCTACAGTTTCTGTTTCTTCACCTGATGCTGTTACAGCGTATAATGGTTATCTTACTTCTTCTT CTAAAACACCTGAAGAACATTTTATTGAAACCATCTCACTTGCTGGTTCCTATAAAGATTGGTCCTATTC TGGACAATCTACACAACTAGGTATAGAATTTCTTAAGAGAGGTGATAAAAGTGTATATTACACTAGTAAT CCTACCACATTCCACCTAGATGGTGAAGTTATCACCTTTGACAATCTTAAGACACTTCTTTCTTTGAGAG AAGTGAGGACTATTAAGGTGTTTACAACAGTAGACAACATTAACCTCCACACGCAAGTTGTGGACATGTC AATGACATATGGACAACAGTTTGGTCCAACTTATTTGGATGGAGCTGATGTTACTAAAATAAAACCTCAT AATTCACATGAAGGTAAAACATTTTATGTTTTACCTAATGATGACACTCTACGTGTTGAGGCTTTTGAGT ACTACCACACAACTGATCCTAGTTTTCTGGGTAGGTACATGTCAGCATTAAATCACACTAAAAAGTGGAA ATACCCACAAGTTAATGGTTTAACTTCTATAAAATGGGCAGATAACAACTGTTATCTTGCCACTGCATTG TTAACACTCCAACAAATAGAGTTGAAGTTTAATCCACCTGCTCTACAAGATGCTTATTACAGAGCAAGGG CTGGTGAAGCTGATAACTTTTGTGCACTTATCTTAGCCTACTGTAATAAGACAGTAGGTGAGTTAGGTGA TGTTAGAGAAACAATGAGTTACTTGTTTCAACATGCCAATTTAGATTCTTGCAAAAGAGTCTTGAACGTG GTGTGTAAAACTTGTGGACAACAGCAGACAACCCTTAAGGGTGTAGAAGCTGTTATGTACATGGGCACAC TTTCTTATGAACAATTTAAGAAAGGTGTTCAGATACCTTGTACGTGTGGTAAACAAGCTACAAAATATCT AGTACAACAGGAGTCACCTTTTGTTATGATGTCAGCACCACCTGCTCAGTATGAACTTAAGCATGGTACA TTTACTTGTGCTAGTGAGTACACTGGTAATTACCAGTGTGGTCACTATAAACATATAACTTCTAAAGAAA CTTTGTATTGCATAGACGGTGCTTTACTTACAAAGTCCTCAGAATACAAAGGTCCTATTACGGATGTTTT CTACAAAGAAAACAGTTACACAACAACCATAAAACCAGTTACTTATAAATTGGATGGTGTTGTTTGTACA GAAATTGACCCTAAGTTGGACAATTATTATAAGAAAGACAATTCTTATTTTACAGAGCAACCAATTGATC TTGTACCAAACCAACCATATCCAAACGCAAGCTTCGATAATTTTAAGTTTGTATGTGATAATATCAAATT TGCTGATGATTTAAACCAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTC CCTGACTTAAATGGTGATGTGGTGGCTATTGATTATAAACACTACACACCCTCTTTTAAGAAAGGAGCTA AATTGTTACATAAACCTATTGTTTGGCATGTTAACAATGCAACTAATAAAGCCACGTATAAACCAAATAC CTGGTGTATACGTTGTCTTTGGAGCACAAAACCAGTTGAAACATCAAATTCGTTTGATGTACTGAAGTCA GAGGACGCGCAGGGAATGGATAATCTTGCCTGCGAAGATCTAAAACCAGTCTCTGAAGAAGTAGTGGAAA ATCCTACCATACAGAAAGACGTTCTTGAGTGTAATGTGAAAACTACCGAAGTTGTAGGAGACATTATACT 26 01 26 TAAACCAGCAAATAATAGTTTAAAAATTACAGAAGAGGTTGGCCACACAGATCTAATGGCTGCTTATGTA GACAATTCTAGTCTTACTATTAAGAAACCTAATGAATTATCTAGAGTATTAGGTTTGAAAACCCTTGCTA CTCATGGTTTAGCTGCTGTTAATAGTGTCCCTTGGGATACTATAGCTAATTATGCTAAGCCTTTTCTTAA CAAAGTTGTTAGTACAACTACTAACATAGTTACACGGTGTTTAAACCGTGTTTGTACTAATTATATGCCT TATTTCTTTACTTTATTGCTACAATTGTGTACTTTTACTAGAAGTACAAATTCTAGAATTAAAGCATCTA TGCCGACTACTATAGCAAAGAATACTGTTAAGAGTGTCGGTAAATTTTGTCTAGAGGCTTCATTTAATTA TTTGAAGTCACCTAATTTTTCTAAACTGATAAATATTACAATTTGGTTTTTACTATTAAGTGTTTGCCTA GGTTCTTTAATCTACTCAACCGCTGCTTTAGGTGTTTTAATGTCTAATTTAGGCATGCCTTCTTACTGTA CTGGTTACAGAGAAGGCTATTTGAACTCTACTAATGTCACTATTGCAACCTACTGTACTGGTTCTATACC TTGTAGTGTTTGTCTTAGTGGTTTAGATTCTTTAGACACCTATCCTTCTTTAGAAACTATACAAATTACC ATTTCATCTTTTAAATGGGATTTAACTGCTTTTGGCTTAGTTGCAGAGTGGTTTTTGGCATATATTCTTT TCACTAGGTTTTTCTATGTACTTGGATTGGCTGCAATCATGCAATTGTTTTTCAGCTATTTTGCAGTACA TTTTATTAGTAATTCTTGGCTTATGTGGTTAATAATTAATCTTGTACAAATGGCCCCGATTTCAGCTATG GTTAGAATGTACATCTTCTTTGCATCATTTTATTATGTATGGAAAAGTTATGTGCATGTTGTAGACGGTT GTAATTCATCAACTTGTATGATGTGTTACAAACGTAATAGAGCAACAAGAGTCGAATGTACAACTATTGT TAATGGTGTTAGAAGGTCCTTTTATGTCTATGCTAATGGAGGTAAAGGCTTTTGCAAACTACACAATTGG AATTGTGTTAATTGTGATACATTCTGTGCTGGTAGTACATTTATTAGTGATGAAGTTGCGAGAGACTTGT CACTACAGTTTAAAAGACCAATAAATCCTACTGACCAGTCTTCTTACATCGTTGATAGTGTTACAGTGAA GAATGGTTCCATCCATCTTTACTTTGATAAAGCTGGTCAAAAGACTTATGAAAGACATTCTCTCTCTCAT TTTGTTAACTTAGACAACCTGAGAGCTAATAACACTAAAGGTTCATTGCCTATTAATGTTATAGTTTTTG ATGGTAAATCAAAATGTGAAGAATCATCTGCAAAATCAGCGTCTGTTTACTACAGTCAGCTTATGTGTCA ACCTATACTGTTACTAGATCAGGCATTAGTGTCTGATGTTGGTGATAGTGCGGAAGTTGCAGTTAAAATG TTTGATGCTTACGTTAATACGTTTTCATCAACTTTTAACGTACCAATGGAAAAACTCAAAACACTAGTTG CAACTGCAGAAGCTGAACTTGCAAAGAATGTGTCCTTAGACAATGTCTTATCTACTTTTATTTCAGCAGC TCGGCAAGGGTTTGTTGATTCAGATGTAGAAACTAAAGATGTTGTTGAATGTCTTAAATTGTCACATCAA TCTGACATAGAAGTTACTGGCGATAGTTGTAATAACTATATGCTCACCTATAACAAAGTTGAAAACATGA CACCCCGTGACCTTGGTGCTTGTATTGACTGTAGTGCGCGTCATATTAATGCGCAGGTAGCAAAAAGTCA CAACATTGCTTTGATATGGAACGTTAAAGATTTCATGTCATTGTCTGAACAACTACGAAAACAAATACGT AGTGCTGCTAAAAAGAATAACTTACCTTTTAAGTTGACATGTGCAACTACTAGACAAGTTGTTAATGTTG TAACAACAAAGATAGCAC T TAAGGGT GGTAAAAT T GT TAATAAT T GGT T GAAGCAGT TAAT TAAAGT TAC ACTTGTGTTCCTTTTTGTTGCTGCTATTTTCTATTTAATAACACCTGTTCATGTCATGTCTAAACATACT GACTTTTCAAGTGAAATCATAGGATACAAGGCTATTGATGGTGGTGTCACTCGTGACATAGCATCTACAG ATACTTGTTTTGCTAACAAACATGCTGATTTTGACACATGGTTTAGCCAGCGTGGTGGTAGTTATACTAA TGACAAAGCTTGCCCATTGATTGCTGCAGTCATAACAAGAGAAGTGGGTTTTGTCGTGCCTGGTTTGCCT GGCACGATATTACGCACAACTAATGGTGACTTTTTGCATTTCTTACCTAGAGTTTTTAGTGCAGTTGGTA ACATCTGTTACACACCATCAAAACTTATAGAGTACACTGACTTTGCAACATCAGCTTGTGTTTTGGCTGC TGAATGTACAATTTTTAAAGATGCTTCTGGTAAGCCAGTACCATATTGTTATGATACCAATGTACTAGAA GGTTCTGTTGCTTATGAAAGTTTACGCCCTGACACACGTTATGTGCTCATGGATGGCTCTATTATTCAAT TTCCTAACACCTACCTTGAAGGTTCTGTTAGAGTGGTAACAACTTTTGATTCTGAGTACTGTAGGCACGG CACTTGTGAAAGATCAGAAGCTGGTGTTTGTGTATCTACTAGTGGTAGATGGGTACTTAACAATGATTAT TACAGATCTTTACCAGGAGTTTTCTGTGGTGTAGATGCTGTAAATTTACTTACTAATATGTTTACACCAC TAATTCAACCTATTGGTGCTTTGGACATATCAGCATCTATAGTAGCTGGTGGTATTGTAGCTATCGTAGT AACATGCCTTGCCTACTATTTTATGAGGTTTAGAAGAGCTTTTGGTGAATACAGTCATGTAGTTGCCTTT AATACTTTACTATTCCTTATGTCATTCACTGTACTCTGTTTAACACCAGTTTACTCATTCTTACCTGGTG TTTATTCTGTTATTTACTTGTACTTGACATTTTATCTTACTAATGATGTTTCTTTTTTAGCACATATTCA GTGGATGGTTATGTTCACACCTTTAGTACCTTTCTGGATAACAATTGCTTATATCATTTGTATTTCCACA AAGCATTTCTATTGGTTCTTTAGTAATTACCTAAAGAGACGTGTAGTCTTTAATGGTGTTTCCTTTAGTA CTTTTGAAGAAGCTGCGCTGTGCACCTTTTTGTTAAATAAAGAAATGTATCTAAAGTTGCGTAGTGATGT GCTATTACCTCTTACGCAATATAATAGATACTTAGCTCTTTATAATAAGTACAAGTATTTTAGTGGAGCA ATGGATACAACTAGCTACAGAGAAGCTGCTTGTTGTCATCTCGCAAAGGCTCTCAATGACTTCAGTAACT CAGGTTCTGATGTTCTTTACCAACCACCACAAACCTCTATCACCTCAGCTGTTTTGCAGAGTGGTTTTAG AAAAATGGCATTCCCATCTGGTAAAGTTGAGGGTTGTATGGTACAAGTAACTTGTGGTACAACTACACTT AACGGTCTTTGGCTTGATGACGTAGTTTACTGTCCAAGACATGTGATCTGCACCTCTGAAGACATGCTTA ACCCTAATTATGAAGATTTACTCATTCGTAAGTCTAATCATAATTTCTTGGTACAGGCTGGTAATGTTCA ACTCAGGGTTATTGGACATTCTATGCAAAATTGTGTACTTAAGCTTAAGGTTGATACAGCCAATCCTAAG ACACCTAAGTATAAGTTTGTTCGCATTCAACCAGGACAGACTTTTTCAGTGTTAGCTTGTTACAATGGTT CACCATCTGGTGTTTACCAATGTGCTATGAGGCCCAATTTCACTATTAAGGGTTCATTCCTTAATGGTTC ATGTGGTAGTGTTGGTTTTAACATAGATTATGACTGTGTCTCTTTTTGTTACATGCACCATATGGAATTA CCAACTGGAGTTCATGCTGGCACAGACTTAGAAGGTAACTTTTATGGACCTTTTGTTGACAGGCAAACAG CACAAGCAGCTGGTACGGACACAACTATTACAGTTAATGTTTTAGCTTGGTTGTACGCTGCTGTTATAAA TGGAGACAGGTGGTTTCTCAATCGATTTACCACAACTCTTAATGACTTTAACCTTGTGGCTATGAAGTAC AATTATGAACCTCTAACACAAGACCATGTTGACATACTAGGACCTCTTTCTGCTCAAACTGGAATTGCCG TTTTAGATATGTGTGCTTCATTAAAAGAATTACTGCAAAATGGTATGAATGGACGTACCATATTGGGTAG TGCTTTATTAGAAGATGAATTTACACCTTTTGATGTTGTTAGACAATGCTCAGGTGTTACTTTCCAAAGT GCAGTGAAAAGAACAATCAAGGGTACACACCACTGGTTGTTACTCACAATTTTGACTTCACTTTTAGTTT TAGTCCAGAGTACTCAATGGTCTTTGTTCTTTTTTTTGTATGAAAATGCCTTTTTACCTTTTGCTATGGG TATTATTGCTATGTCTGCTTTTGCAATGATGTTTGTCAAACATAAGCATGCATTTCTCTGTTTGTTTTTG TTACCTTCTCTTGCCACTGTAGCTTATTTTAATATGGTCTATATGCCTGCTAGTTGGGTGATGCGTATTA TGACATGGTTGGATATGGTTGATACTAGTTTGAAGCTAAAAGACTGTGTTATGTATGCATCAGCTGTAGT 26 01 26 GTTACTAATCCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAAT GTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTA TAATCTCTGTTACTTCTAACTACTCAGGTGTAGTTACAACTGTCATGTTTTTGGCCAGAGGTATTGTTTT TATGTGTGTTGAGTATTGCCCTATTTTCTTCATAACTGGTAATACACTTCAGTGTATAATGCTAGTTTAT TGTTTCTTAGGCTATTTTTGTACTTGTTACTTTGGCCTCTTTTGTTTACTCAACCGCTACTTTAGACTGA CTCTTGGTGTTTATGATTACTTAGTTTCTACACAGGAGTTTAGATATATGAATTCACAGGGACTACTCCC ACCCAAGAATAGCATAGATGCCTTCAAACTCAACATTAAATTGTTGGGTGTTGGTGGCAAACCTTGTATC AAAGTAGCCACTGTACAGTCTAAAATGTCAGATGTAAAGTGCACATCAGTAGTCTTACTCTCAGTTTTGC AACAACTCAGAGTAGAATCATCATCTAAATTGTGGGCTCAATGTGTCCAGTTACACAATGACATTCTCTT AGCTAAAGATACTACTGAAGCCTTTGAAAAAATGGTTTCACTACTTTCTGTTTTGCTTTCCATGCAGGGT GCTGTAGACATAAACAAGCTTTGTGAAGAAATGCTGGACAACAGGGCAACCTTACAAGCTATAGCCTCAG AGTTTAGTTCCCTTCCATCATATGCAGCTTTTGCTACTGCTCAAGAAGCTTATGAGCAGGCTGTTGCTAA TGGTGATTCTGAAGTTGTTCTTAAAAAGTTGAAGAAGTCTTTGAATGTGGCTAAATCTGAATTTGACCGT GATGCAGCCATGCAACGTAAGTTGGAAAAGATGGCTGATCAAGCTATGACCCAAATGTATAAACAGGCTA GATCTGAGGACAAGAGGGCAAAAGTTACTAGTGCTATGCAGACAATGCTTTTCACTATGCTTAGAAAGTT GGATAATGATGCACTCAACAACATTATCAACAATGCAAGAGATGGTTGTGTTCCCTTGAACATAATACCT CTTACAACAGCAGCCAAACTAATGGTTGTCATACCAGACTATAACACATATAAAAATACGTGTGATGGTA CAACATTTACTTATGCATCAGCATTGTGGGAAATCCAACAGGTTGTAGATGCAGATAGTAAAATTGTTCA ACTTAGTGAAATTAGTATGGACAATTCACCTAATTTAGCATGGCCTCTTATTGTAACAGCTTTAAGGGCC AATTCTGCTGTCAAATTACAGAATAATGAGCTTAGTCCTGTTGCACTACGACAGATGTCTTGTGCTGCCG GTACTACACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACTACAACACAACAAAGGGAGGTAGGTT TGTACTTGCACTGTTATCCGATTTACAGGATTTGAAATGGGCTAGATTCCCTAAGAGTGATGGAACTGGT ACTATCTATACAGAACTGGAACCACCTTGTAGGTTTGTTACAGACACACCTAAAGGTCCTAAAGTGAAGT ATTTATACTTTATTAAAGGATTAAACAACCTAAATAGAGGTATGGTACTTGGTAGTTTAGCTGCCACAGT ACGTCTACAAGCTGGTAATGCAACAGAAGTGCCTGCCAATTCAACTGTATTATCTTTCTGTGCTTTTGCT GTAGATGCTGCTAAAGCTTACAAAGATTATCTAGCTAGTGGGGGACAACCAATCACTAATTGTGTTAAGA TGTTGTGTACACACACTGGTACTGGTCAGGCAATAACAGTTACACCGGAAGCCAATATGGATCAAGAATC CTTTGGTGGTGCATCGTGTTGTCTGTACTGCCGTTGCCACATAGATCATCCAAATCCTAAAGGATTTTGT GACTTAAAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTACACTTAAAA ACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCAT GCTTCAGTCAGCTGATGCACAATCGTTTTTAAACCGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCG TGCGGCACAGGCACTAGTACTGATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAGTAGCTGGTT TTGCTAAATTCCTAAAAACTAATTGTTGTCGCTTCCAAGAAAAGGACGAAGATGACAATTTAATTGATTC TTACTTTGTAGTTAAGAGACACACTTTCTCTAACTACCAACATGAAGAAACAATTTATAATTTACTTAAG GATTGTCCAGCTGTTGCTAAACATGACTTCTTTAAGTTTAGAATAGACGGTGACATGGTACCACATATAT CACGTCAACGTCTTACTAAATACACAATGGCAGACCTCGTCTATGCTTTAAGGCATTTTGATGAAGGTAA TTGTGACACATTAAAAGAAATACTTGTCACATACAATTGTTGTGATGATGATTATTTCAATAAAAAGGAC TGGTATGATTTTGTAGAAAACCCAGATATATTACGCGTATACGCCAACTTAGGTGAACGTGTACGCCAAG CTTTGTTAAAAACAGTACAATTCTGTGATGCCATGCGAAATGCTGGTATTGTTGGTGTACTGACATTAGA TAATCAAGATCTCAATGGTAACTGGTATGATTTCGGTGATTTCATACAAACCACGCCAGGTAGTGGAGTT CCTGTTGTAGATTCTTATTATTCATTGTTAATGCCTATATTAACCTTGACCAGGGCTTTAACTGCAGAGT CACATGTTGACACTGACTTAACAAAGCCTTACATTAAGTGGGATTTGTTAAAATATGACTTCACGGAAGA GAGGTTAAAACTCTTTGACCGTTATTTTAAATATTGGGATCAGACATACCACCCAAATTGTGTTAACTGT TTGGATGACAGATGCATTCTGCATTGTGCAAACTTTAATGTTTTATTCTCTACAGTGTTCCCACTTACAA GTTTTGGACCACTAGTGAGAAAAATATTTGTTGATGGTGTTCCATTTGTAGTTTCAACTGGATACCACTT CAGAGAGCTAGGTGTTGTACATAATCAGGATGTAAACTTACATAGCTCTAGACTTAGTTTTAAGGAATTA CTTGTGTATGCTGCTGACCCTGCTATGCACGCTGCTTCTGGTAATCTATTACTAGATAAACGCACTACGT GCTTTTCAGTAGCTGCACTTACTAACAATGTTGCTTTTCAAACTGTCAAACCTGGTAATTTTAACAAAGA CTTCTATGACTTTGCTGTGTCTAAGGGTTTCTTTAAGGAAGGAAGTTCTGTTGAATTAAAACACTTCTTC TTTGCTCAGGATGGTAATGCTGCTATCAGCGATTATGACTACTATCGTTATAATCTACCAACAATGTGTG ATATCAGACAACTACTATTTGTAGTTGAAGTTGTTGATAAGTACTTTGATTGTTACGATGGTGGCTGTAT TAATGCTAACCAAGTCATCGTCAACAACCTAGACAAATCAGCTGGTTTTCCATTTAATAAATGGGGTAAG GCTAGACTTTATTATGATTCAATGAGTTATGAGGATCAAGATGCACTTTTCGCATATACAAAACGTAATG TCATCCCTACTATAACTCAAATGAATCTTAAGTATGCCATTAGTGCAAAGAATAGAGCTCGCACCGTAGC TGGTGTCTCTATCTGTAGTACTATGACCAATAGACAGTTTCATCAAAAATTATTGAAATCAATAGCCGCC ACTAGAGGAGCTACTGTAGTAATTGGAACAAGCAAATTCTATGGTGGTTGGCACAACATGTTAAAAACTG TTTATAGTGATGTAGAAAACCCTCATCTTATGGGTTGGGATTATCCTAAATGTGATAGAGCCATGCCTAA CATGCTTAGAATTATGGCCTCACTTGTTCTTGCTCGCAAACATACAACGTGTTGTAGCTTGTCACACCGT TTCTATAGATTAGCTAATGAGTGTGCTCAAGTATTGAGTGAAATGGTCATGTGTGGCGGTTCACTATATG TTAAACCAGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTTTTAACATTTGTCA AGCTGTCACGGCCAATGTTAATGCACTTTTATCTACTGATGGTAACAAAATTGCCGATAAGTATGTCCGC AATTTACAACACAGACTTTATGAGTGTCTCTATAGAAATAGAGATGTTGACACAGACTTTGTGAATGAGT TTTACGCATATTTGCGTAAACATTTCTCAATGATGATACTCTCTGACGATGCTGTTGTGTGTTTCAATAG CACTTATGCATCTCAAGGTCTAGTGGCTAGCATAAAGAACTTTAAGTCAGTTCTTTATTATCAAAACAAT GTTTTTATGTCTGAAGCAAAATGTTGGACTGAGACTGACCTTACTAAAGGACCTCATGAATTTTGCTCTC AACATACAATGCTAGTTAAACAGGGTGATGATTATGTGTACCTTCCTTACCCAGATCCATCAAGAATCCT AGGGGCCGGCTGTTTTGTAGATGATATCGTAAAAACAGATGGTACACTTATGATTGAACGGTTCGTGTCT TTAGCTATAGATGCTTACCCACTTACTAAACATCCTAATCAGGAGTATGCTGATGTCTTTCATTTGTACT TACAATACATAAGAAAGCTACATGATGAGTTAACAGGACACATGTTAGACATGTATTCTGTTATGCTTAC 26 01 26 TAATGATAACACCTCAAGGTATTGGGAACCTGAGTTTTATGAGGCTATGTACACACCGCATACAGTCTTA CAGGCTGTTGGGGCTTGTGTTCTTTGCAATTCACAGACTTCATTAAGATGTGGTGCTTGCATACGTAGAC CATTCTTATGTTGTAAATGCTGTTACGACCATGTCATATCAACATCACATAAATTAGTCTTGTCTGTTAA TCCGTATGTTTGCAATGCTCCAGGTTGTGATGTCACAGATGTGACTCAACTTTACTTAGGAGGTATGAGC TATTATTGTAAATCACATAAACCATCCATTAGTTTTCCATTGTGTGCTAATGGACAAGTTTTTGGTTTAT ATAAAAATACATGTGTTGGTAGCGATAATGTTACTGACTTTAATGCAATTGCAACATGTGACTGGACAAA TGCTGGTGATTACATTTTAGCTAACACCTGTACTGAAAGACTCAAGCTTTTTGCAGCAGAAACGCTCAAA GCTACTGAGGAGACATTTAAACTGTCTTATGGTATTGCTACTGTACGTGAAGTGCTGTCTGACAGAGAAT TACATCTTTCATGGGAAGTTGGTAAACCTAGACCACCACTTAACCGAAATTATGTCTTTACTGGTTATCG TGTAACTAAAAACAGTAAAGTACAAATAGGAGAGTACACCTTTGAAAAAGGTGACTATGGTGATGCTGTT GTTTACCGAGGTACAACAACTTACAAATTAAATGTTGGTGATTATTTTGTGCTGACATCACATACAGTAA TGCCATTAAGTGCACCTACACTAGTGCCACAAGAGCACTATGTTAGAATTACTGGCTTATACCCAACACT CAATATCTCAGATGAGTTTTCTAGCAATGTTGCAAATTATCAAAAGGTTGGTATGCAAAAGTATTCTACA CTCCAGGGACCACCTGGTACTGGTAAGAGTCATTTTGCTATTGGCCTAGCTCTCTACTACCCTTCTGCTC GCATAGTGTATACAGCTTGCTCTCATGCCGCTGTTGATGCACTATGTGAGAAGGCATTAAAATATTTGCC TATAGATAAATGTAGTAGAATTATACCTGCACGTGCTCGTGTAGAGTGTTTTGATAAATTCAAAGTGAAT TCAACATTAGAACAGTATGTCTTTTGTACTGTAAATGCATTGCCTGAGACGACAGCAGATATAGTTGTCT TTGATGAAATTTCAATGGCCACAAATTATGATTTGAGTGTTGTCAATGCCAGATTACGTGCTAAGCACTA TGTGTACATTGGCGACCCTGCTCAATTACCTGCACCACGCACATTGCTAACTAAGGGCACACTAGAACCA GAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGC GTTGTCCTGCTGAAATTGTTGACACTGTGAGTGCTTTGGTTTATGATAATAGGCTTAAAGCACATAAAGA CAAATCAGCTCAATGCTTTAAAATGTTTTATAAGGGTGTTATCACGCATGATGTTTCATCTGCAATTAAC AGGCCACAAATAGGCGTGGTAAGAGAATTCCTTACACGTAACCCTGCTTGGAGAAAAGCTGTCTTTATTT CACCTTATAATTCACAGAATGCTGTAGCCTCAAAGATTTTGGGACTACCAACTCAAACTGTTGATTCATC ACAGGGCTCAGAATATGACTATGTCATATTCACTCAAACCACTGAAACAGCTCACTCTTGTAATGTAAAC AGATTTAATGTTGCTATTACCAGAGCAAAAGTAGGCATACTTTGCATAATGTCTGATAGAGACCTTTATG ACAAGTTGCAATTTACAAGTCTTGAAATTCCACGTAGGAATGTGGCAACTTTACAAGCTGAAAATGTAAC AGGACTCTTTAAAGATTGTAGTAAGGTAATCACTGGGTTACATCCTACACAGGCACCTACACACCTCAGT GTTGACACTAAATTCAAAACTGAAGGTTTATGTGTTGACATACCTGGCATACCTAAGGACATGACCTATA GAAGACTCATCTCTATGATGGGTTTTAAAATGAATTATCAAGTTAATGGTTACCCTAACATGTTTATCAC CCGCGAAGAAGCTATAAGACATGTACGTGCATGGATTGGCTTCGATGTCGAGGGGTGTCATGCTACTAGA GAAGCTGTTGGTACCAATTTACCTTTACAGCTAGGTTTTTCTACAGGTGTTAACCTAGTTGCTGTACCTA CAGGTTATGTTGATACACCTAATAATACAGATTTTTCCAGAGTTAGTGCTAAACCACCGCCTGGAGATCA ATTTAAACACCTCATACCACTTATGTACAAAGGACTTCCTTGGAATGTAGTGCGTATAAAGATTGTACAA ATGTTAAGTGACACACTTAAAAATCTCTCTGACAGAGTCGTATTTGTCTTATGGGCACATGGCTTTGAGT TGACATCTATGAAGTATTTTGTGAAAATAGGACCTGAGCGCACCTGTTGTCTATGTGATAGACGTGCCAC ATGCTTTTCCACTGCTTCAGACACTTATGCCTGTTGGCATCATTCTATTGGATTTGATTACGTCTATAAT CCGTTTATGATTGATGTTCAACAATGGGGTTTTACAGGTAACCTACAAAGCAACCATGATCTGTATTGTC AAGTCCATGGTAATGCACATGTAGCTAGTTGTGATGCAATCATGACTAGGTGTCTAGCTGTCCACGAGTG CTTTGTTAAGCGTGTTGACTGGACTATTGAATATCCTATAATTGGTGATGAACTGAAGATTAATGCGGCT TGTAGAAAGGTTCAACACATGGTTGTTAAAGCTGCATTATTAGCAGACAAATTCCCAGTTCTTCACGACA TTGGTAACCCTAAAGCTATTAAGTGTGTACCTCAAGCTGATGTAGAATGGAAGTTCTATGATGCACAGCC TTGTAGTGACAAAGCTTATAAAATAGAAGAATTATTCTATTCTTATGCCACACATTCTGACAAATTCACA GATGGTGTATGCCTATTTTGGAATTGCAATGTCGATAGATATCCTGCTAATTCCATTGTTTGTAGATTTG ACACTAGAGTGCTATCTAACCTTAACTTGCCTGGTTGTGATGGTGGCAGTTTGTATGTAAATAAACATGC ATTCCACACACCAGCTTTTGATAAAAGTGCTTTTGTTAATTTAAAACAATTACCATTTTTCTATTACTCT GACAGTCCATGTGAGTCTCATGGAAAACAAGTAGTGTCAGATATAGATTATGTACCACTAAAGTCTGCTA CGTGTATAACACGTTGCAATTTAGGTGGTGCTGTCTGTAGACATCATGCTAATGAGTACAGATTGTATCT CGATGCTTATAACATGATGATCTCAGCTGGCTTTAGCTTGTGGGTTTACAAACAATTTGATACTTATAAC CTCTGGAACACTTTTACAAGACTTCAGAGTTTAGAAAATGTGGCTTTTAATGTTGTAAATAAGGGACACT TTGATGGACAACAGGGTGAAGTACCAGTTTCTATCATTAATAACACTGTTTACACAAAAGTTGATGGTGT TGATGTAGAATTGTTTGAAAATAAAACAACATTACCTGTTAATGTAGCATTTGAGCTTTGGGCTAAGCGC AACATTAAACCAGTACCAGAGGTGAAAATACTCAATAATTTGGGTGTGGACATTGCTGCTAATACTGTGA TCTGGGACTACAAAAGAGATGCTCCAGCACATATATCTACTATTGGTGTTTGTTCTATGACTGACATAGC CAAGAAACCAACTGAAACGATTTGTGCACCACTCACTGTCTTTTTTGATGGTAGAGTTGATGGTCAAGTA GACTTATTTAGAAATGCCCGTAATGGTGTTCTTATTACAGAAGGTAGTGTTAAAGGTTTACAACCATCTG TAGGTCCCAAACAAGCTAGTCTTAATGGAGTCACATTAATTGGAGAAGCCGTAAAAACACAGTTCAATTA TTATAAGAAAGTTGATGGTGTTGTCCAACAATTACCTGAAACTTACTTTACTCAGAGTAGAAATTTACAA GAATTTAAACCCAGGAGTCAAATGGAAATTGATTTCTTAGAATTAGCTATGGATGAATTCATTGAACGGT ATAAATTAGAAGGCTATGCCTTCGAACATATCGTTTATGGAGATTTTAGTCATAGTCAGTTAGGTGGTTT ACATCTACTGATTGGACTAGCTAAACGTTTTAAGGAATCACCTTTTGAATTAGAAGATTTTATTCCTATG GACAGTACAGTTAAAAACTATTTCATAACAGATGCGCAAACAGGTTCATCTAAGTGTGTGTGTTCTGTTA TTGATTTATTACTTGATGATTTTGTTGAAATAATAAAATCCCAAGATTTATCTGTAGTTTCTAAGGTTGT CAAAGTGACTATTGACTATACAGAAATTTCATTTATGCTTTGGTGTAAAGATGGCCATGTAGAAACATTT TACCCAAAATTACAATCTAGTCAAGCGTGGCAACCGGGTGTTGCTATGCCTAATCTTTACAAAATGCAAA GAATGCTATTAGAAAAGTGTGACCTTCAAAATTATGGTGATAGTGCAACATTACCTAAAGGCATAATGAT GAATGTCGCAAAATATACTCAACTGTGTCAATATTTAAACACATTAACATTAGCTGTACCCTATAATATG AGAGTTATACATTTTGGTGCTGGTTCTGATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAGACAGTGGT TGCCTACGGGTACGCTGCTTGTCGATTCAGATCTTAATGACTTTGTCTCTGATGCAGATTCAACTTTGAT 26 01 26 TGGTGATTGTGCAACTGTACATACAGCTAATAAATGGGATCTCATTATTAGTGATATGTACGACCCTAAG ACTAAAAATGTTACAAAAGAAAATGACTCTAAAGAGGGTTTTTTCACTTACATTTGTGGGTTTATACAAC AAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAA GCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTT TTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACA TATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCT TAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTT AGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACT AA 3 Severe acute respirat ory syndrome coronavi rus 2 isolate SARS- CoV-2 / human / ZAF / R030 06 / 2020, complete genome ATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTTACAGGTTC GCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAA AGATGGCACTTGTGGCTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTC ATCAAACGTTCGGATGCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAG GCATTCAGTACGGTCGTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGC TTACCGCAAGGTTCTTCTTCGTAAGAACGGTAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTA AAGTCATTTGACTTAGGCGACGAGCTTGGCACTGATCCTTATGAAGATTTTCAAGAAAACTGGAACACTA AACATAGCAGTGGTGTTACCCGTGAACTCATGCGTGAGCTTAACGGAGGGGCATACACTCGCTATGTCGA TAACAACTTCTGTGGCCCTGATGGCTACCCTCTTGAGTGCATTAAAGACCTTCTAGCACGTGCTGGTAAA GCTTCATGCACTTTGTCCGAACAACTGGACTTTATTGACACTAAGAGGGGTGTATACTGCTGCCGTGAAC ATGAGCATGAAATTGCTTGGTACACGGAACGTTCTGAAAAGAGCTATGAATTGCAGACACCTTTTGAAAT TAAATTGGCAAAGAAATTTGACACCTTCAATGGGGAATGTCCAAATTTTGTATTTCCCTTAAATTCCATA ATCAAGACTATTCAACCAAGGGTTGAAAAGAAAAAGCTTGATGGCTTTATGGGTAGAATTCGATCTGTCT ATCCAGTTGCGTCACCAAATGAATGCAACCAAATGTGCCTTTCAACTCTCATGAAGTGTGATCATTGTGG TGAAACTTCATGGCAGACGGGCGATTTTGTTAAAGCCACTTGCGAATTTTGTGGCACTGAGAATTTGACT AAAGAAGGTGCCACTACTTGTGGTTACTTACCCCAAAATGCTGTTGTTAAAATTTATTGTCCAGCATGTC ACAATTCAGAAGTAGGACCTGAGCATAGTCTTGCCGAATACCATAATGAATCTGGCTTGAAAACCATTCT TCGTAAGGGTGGTCGCACTATTGCCTTTGGAGGCTGTGTGTTCTCTTATGTTGGTTGCCATAACAAGTGT GCCTATTGGGTTCCACGTGCTAGCGCTAACATAGGTTGTAACCATACAGGTGTTGTTGGAGAAGGTTCCG AAGGTCTTAATGACAACCTTCTTGAAATACTCCAAAAAGAGAAAGTCAACATCAATATTGTTGGTGACTT TAAACTTAATGAAGAGATCGCCATTATTTTGGCATCTTTTTCTGCTTCCACAAGTGCTTTTGTGGAAACT GTGAAAGGTTTGGATTATAAAGCATTCAAACAAATTGTTGAATCCTGTGGTAATTTTAAAGTTACAAAAG GAAAAGCTAAAAAAGGTGCCTGGAATATTGGTGAACAGAAATCAATACTGAGTCCTCTTTATGCATTTGC ATCAGAGGCTGCTCGTGTTGTACGATCAATTTTCTCCCGCACTCTTGAAACTGCTCAAAATTCTGTGCGT GTTTTACAGAAGGCCGCTATAACAATACTAGATGGAATTTCACAGTATTCACTGAGACTCATTGATGCTA TGATGTTCACATCTGATTTGGCTACTAACAATCTAGTTGTAATGGCCTACATTACAGGTGGTGTTGTTCA GTTGACTTCGCAGTGGCTAACTAACATCTTTGGCACTGTTTATGAAAAACTCAAACCCGTCCTTGATTGG CTTGAAGAGAAGTTTAAGGAAGGTGTAGAGTTTCTTAGAGACGGTTGGGAAATTGTTAAATTTATCTCAA CCTGTGCTTGTGAAATTGTCGGTGGACAAATTGTCACCTGTGCAAAGGAAATTAAGGAGAGTGTTCAGAC ATTCTTTAAGCTTGTAAATAAATTTTTGGCTTTGTGTGCTGACTCTATCATTATTGGTGGAGCTAAACTT AAAGCCTTGAATTTAGGTGAAACATTTGTCACGCACTCAAAGGGATTGTACAGAAAGTGTGTTAAATCCA GAGAAGAAACTGGCCTACTCATGCCTCTAAAAGCCCCAAAAGAAATTATCTTCTTAGAGGGAGAAACACT TCCCACAGAAGTGTTAACAGAGGAAGTTGTCTTGAAAACTGGTGATTTACAACCATTAGAACAACCTACT AGTGAAGCTGTTGAAGCTCCATTGGTTGGTACACCAGTTTGTATTAACGGGCTTATGTTGCTCGAAATCA AAGACACAGAAAAGTACTGTGCCCTTGCACCTAATATGATGGTAACAAACAATACCTTCACACTCAAAGG CGGTGCACCAACAAAGGTTACTTTTGGTGATGACACTGTGATAGAAGTGCAAGGTTACAAGAGTGTGAAT ATCACTTTTGAACTTGATGAAAGGATTGATAAAGTACTTAATGAGAAGTGCTCTGCCTATACAGTTGAAC TCGGTACAGAAGTAAATGAGTTCGCCTGTGTTGTGGCAGATGCTGTCATAAAAACTTTGCAACCAGTATC TGAATTACTTACACCACTGGGCATTGATTTAGATGAGTGGAGTATGGCTACATACTACTTATTTGATGAG TCTGGTGAGTTTAAATTGGCTTCACATATGTATTGTTCTTTTTACCCTCCAGATGAGGATGAAGAAGAAG GTGATTGTGAAGAAGAAGAGTTTGAGCCATCAACTCAATATGAGTATGGTACTGAAGATGATTACCAAGG TAAACCTTTGGAATTTGGTGCCACTTCTGCTGCTCTTCAACCTGAAGAAGAGCAAGAAGAAGATTGGTTA GATGATGATAGTCAACAAACTGTTGGTCAACAAGACGGCAGTGAGGACAATCAGACAACTACTATTCAAA CAATTGTTGAGGTTCAACCTCAATTAGAGATGGAACTTACACCAGTTGTTCAGACTATTGAAGTGAATAG TTTTAGTGGTTATTTAAAACTTACTGACAATGTATACATTAAAAATGCAGACATTGTGGAAGAAGCTAAA AAGGTAAAACCAACAGTGGTTGTTAATGCAGCCAATGTTTACCTTAAACATGGAGGAGGTGTTGCAGGAG CCTTAAATAAGGCTACTAACAATGCCATGCAAGTTGAATCTGATGATTACATAGCTACTAATGGACCACT TAAAGTGGGTGGTAGTTGTGTTTTAAGCGGACACAATCTTGCTAAACACTGTCTTCATGTTGTCGGCCCA AATGTTAACAAAGGTGAAGACATTCAACTTCTTAAGAGTGCTTATGAAAATTTTAATCAGCACGAAGTTC TACTTGCACCATTATTATCAGCTGGTATTTTTGGTGCTGACCCTATACATTCTTTAAGAGTTTGTGTAGA TACTGTTCGCACAAATGTCTACTTAGCTGTCTTTGATAAAAATCTCTATGACAAACTTGTTTCAAGCTTT TTGGAAATGAAGAGTGAAAAGCAAGTTGAACAAAAGATCGCTGAGATTCCTAAAGAGGAAGTTAAGCCAT TTATAACTGAAAGTAAACCTTCAGTTGAACAGAGAAAACAAGATGATAAGAAAATCAAAGCTTGTGTTGA AGAAGTTACAACAACTCTGGAAGAAACTAAGTTCCTCACAGAAAACTTGTTACTTTATATTGACATTAAT GGCAATCTTCATCCAGATTCTGCCACTCTTGTTAGTGACATTGACATCACTTTCTTAAAGAAAGATGCTC CATATATAGTGGGTGATGTTGTTCAAGAGGGTGTTTTAACTGCTGTGGTTATACCTACTAAAAAGGCTGG TGGCACTACTGAAATGCTAGCGAAAGCTTTGAGAAAAGTGCCAACAGACAATTATATAACCACTTACCCG GGTCAGGGTTTAAATGGTTACACTGTAGAGGAGGCAAAGACAGTGCTTAAAAAGTGTAAAAGTGCCTTTT ACATTCTACCATCTATTATCTCTAATGAGAAGCAAGAAATTCTTGGAACTGTTTCTTGGAATTTGCGAGA 26 01 26 AATGCTTGCACATGCAGAAGAAACACGCAAATTAATGCCTGTCTGTGTGGAAACTAAAGCCATAGTTTCA ACTATACAGCGTAAATATAAGGGTATTAAAATACAAGAGGGTGTGGTTGATTATGGTGCTAGATTTTACT TTTACACCAGTAAAACAACTGTAGCGTCACTTATCAACACACTTAACGATCTAAATGAAACTCTTGTTAC AATGCCACTTGGCTATGTAACACATGGCTTAAATTTGGAAGAAGCTGCTCGGTATATGAGATCTCTCAAA GTGCCAGCTACAGTTTCTGTTTCTTCACCTGATGCTGTTACAGCGTATAATGGTTATCTTACTTCTTCTT CTAAAACACCTGAAGAACATTTTATTGAAACCATCTCACTTGCTGGTTCCTATAAAGATTGGTCCTATTC TGGACAATCTACACAACTAGGTATAGAATTTCTTAAGAGAGGTGATAAAAGTGTATATTACACTAGTAAT CCTACCACATTCCACCTAGATGGTGAAGTTATCACCTTTGACAATCTTAAGACACTTCTTTCTTTGAGAG AAGTGAGGACTATTAAGGTGTTTACAACAGTAGACAACATTAACCTCCACACGCAAGTTGTGGACATGTC AATGACATATGGACAACAGTTTGGTCCAACTTATTTGGATGGAGCTGATGTTACTAAAATAAAACCTCAT AATTCACATGAAGGTAAAACATTTTATGTTTTACCTAATGATGACACTCTACGTGTTGAGGCTTTTGAGT ACTACCACACAACTGATCCTAGTTTTCTGGGTAGGTACATGTCAGCATTAAATCACACTAAAAAGTGGAA ATACCCACAAGTTAATGGTTTAACTTCTATTAAATGGGCAGATAACAACTGTTATCTTGCCACTGCATTG TTAACACTCCAACAAATAGAGTTGAAGTTTAATCCACCTGCTCTACAAGATGCTTATTACAGAGCAAGGG CTGGTGAAGCTGCTAACTTTTGTGCACTTATCTTAGCCTACTGTAATAAGACAGTAGGTGAGTTAGGTGA TGTTAGAGAAACAATGAGTTACTTGTTTCAACATGCCAATTTAGATTCTTGCAAAAGAGTCTTGAACGTG GTGTGTAAAACTTGTGGACAACAGCAGACAACCCTTAAGGGTGTAGAAGCTGTTATGTACATGGGCACAC TTTCTTATGAACAATTTAAGAAAGGTGTTCAGATACCTTGTACGTGTGGTAAACAAGCTACAAAATATCT AGTACAACAGGAGTCACCTTTTGTTATGATGTCAGCACCACCTGCTCAGTATGAACTTAAGCATGGTACA TTTACTTGTGCTAGTGAGTACACTGGTAATTACCAGTGTGGTCACTATAAACATATAACTTCTAAAGAAA CTTTGTATTGCATAGACGGTGCTTTACTTACAAAGTCCTCAGAATACAAAGGTCCTATTACGGATGTTTT CTACAAAGAAAACAGTTACACAACAACCATAAAACCAGTTACTTATAAATTGGATGGTGTTGTTTGTACA GAAATTGACCCTAAGTTGGACAATTATTATAAGAAAGACAATTCTTATTTCACAGAGCAACCAATTGATC TTGTACCAAACCAACCATATCCAAACGCAAGCTTCGATAATTTTAAGTTTGTATGTGATAATATCAAATT TGCTGATGATTTAAACCAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTC CCTGACTTAAATGGTGATGTGGTGGCTATTGATTATAAACACTACACACCCTCTTTTAAGAAAGGAGCTA AATTGTTACATAAACCTATTGTTTGGCATGTTAACAATGCAACTAATAAAGCCACGTATAAACCAAATAC CTGGTGTATACGTTGTCTTTGGAGCACAAAACCAGTTGAAACATCAAATTCGTTTGATGTACTGAAGTCA GAGGACGCGCAGGGAATGGATAATCTTGCCTGCGAAGATCTAAAACCAGTCTCTGAAGAAGTAGTGGAAA ATCCTACCATACAGAAAGACGTTCTTGAGTGTAATGTGAAAACTACCGAAGTTGTAGGAGACATTATACT TAAACCAGCAAATAATAGTTTAAAAATTACAGAAGAGGTTGGCCACACAGATCTAATGGCTGCTTATGTA GACAATTCTAGTCTTACTATTAAGAAACCTAATGAATTATCTAGAGTATTAGGTTTGAAAACCCTTGCTA CTCATGGTTTAGCTGCTGTTAATAGTGTCCCTTGGGATACTATAGCTAATTATGCTAAGCCTTTTCTTAA CAAAGTTGTTAGTACAACTACTAACATAGTTACACGGTGTTTAAACCGTGTTTGTACTAATTATATGCCT TATTTCTTTACTTTATTGCTACAATTGTGTACTTTTACTAGAAGTACAAATTCTAGAATTAAAGCATCTA TGCCGACTACTATAGCAAAGAATACTGTTAAGAGTGTCGGTAAATTTTGTCTAGAGGCTTCATTTAATTA TTTGAAGTCACCTAATTTTTCTAAACTGATAAATATTATAATTTGGTTTTTACTATTAAGTGTTTGCCTA GGTTCTTTAATCTACTCAACCGCTGCTTTAGGTGTTTTAATGTCTAATTTAGGCATGCCTTCTTACTGTA CTGGTTACAGAGAAGGCTATTTGAACTCTACTAATGTCACTATTGCAACCTACTGTACTGGTTCTATACC TTGTAGTGTTTGTCTTAGTGGTTTAGATTCTTTAGACACCTATCCTTCTTTAGAAACTATACAAATTACC ATTTCATCTTTTAAATGGGATTTAACTGCTTTTGGCTTAGTTGCAGAGTGGTTTTTGGCATATATTCTTT TCACTAGGTTTTTCTATGTACTTGGATTGGCTGCAATCATGCAATTGTTTTTCAGCTATTTTGCAGTACA TTTTATTAGTAATTCTTGGCTTATGTGGTTAATAATTAATCTTGTACAAATGGCCCCGATTTCAGCTATG GTTAGAATGTACATCTTCTTTGCATCATTTTATTATGTATGGAAAAGTTATGTGCATGTTGTAGACGGTT GTAATTCATCAACTTGTATGATGTGTTACAAACGTAATAGAGCAACAAGAGTCGAATGTACAACTATTGT TAATGGTGTTAGAAGGTCCTTTTATGTCTATGCTAATGGAGGTAAAGGCTTTTGCAAACTACACAATTGG AATTGTGTTAATTGTGATACATTCTGTGCTGGTAGTACATTTATTAGTGATGAAGTTGCGAGAGACTTGT CACTACAGTTTAAAAGACCAATAAATCCTACTGACCAGTCTTCTTACATCGTTGATAGTGTTACAGTGAA GAATGGTTCCATCCATCTTTACTTTGATAAAGCTGGTCAAAAGACTTATGAAAGACATTCTCTCTCTCAT TTTGTTAACTTAGACAACCTGAGAGCTAATAACACTAAAGGTTCATTGCCTATTAATGTTATAGTTTTTG ATGGTAAATCAAAATGTGAAGAATCATCTGCAAAATCAGCGTCTGTTTACTACAGTCAGCTTATGTGTCA ACCTATACTGTTACTAGATCAGGCATTAGTGTCTGATGTTGGTGATAGTGCGGAAGTTGCAGTTAAAATG TTTGATGCTTACGTTAATACGTTTTCATCAACTTTTAACGTACCAATGGAAAAACTCAAAACACTAGTTG CAACTGCAGAAGCTGAACTTGCAAAGAATGTGTCCTTAGACAATGTCTTATCTACTTTTATTTCAGCAGC TCGGCAAGGGTTTGTTGATTCAGATGTAGAAACTAAAGATGTTGTTGAATGTCTTAAATTGTCACATCAA TCTGACATAGAAGTTACTGGCGATAGTTGTAATAACTATATGCTCACCTATAACAAAGTTGAAAACATGA CACCCCGTGACCTTGGTGCTTGTATTGACTGTAGTGCGCGTCATATTAATGCGCAGGTAGCAAAAAGTCA CAACATTGCTTTGATATGGAACGTTAAAGATTTCATGTCATTGTCTGAACAACTACGAAAACAAATACGT AGTGCTGCTAAAAAGAATAACTTACCTTTTAAGTTGACATGTGCAACTACTAGACAAGTTGTTAATGTTG TAACAACAAAGATAGCAC T TAAGGGT GGTAAAAT T GT TAATAAT T GGT T GAAGCAGT TAAT TAAAGT TAC ACTTGTGTTCCTTTTTGTTGCTGCTATTTTCTATTTAATAACACCTGTTCATGTCATGTCTAAACATACT GACTTTTCAAGTGAAATCATAGGATACAAGGCTATTGATGGTGGTGTCACTCGTGACATAGCATCTACAG ATACTTGTTTTGCTAACAAACATGCTGATTTTGACACATGGTTTAGCCAGCGTGGTGGTAGTTATACTAA TGACAAAGCTTGCCCATTGATTGCTGCAGTCATAACAAGAGAAGTGGGTTTTGTCGTGCCTGGTTTGCCT GGCACGATATTACGCACAACTAATGGTGACTTTTTGCATTTCTTACCTAGAGTTTTTAGTGCAGTTGGTA ACATCTGTTACACACCATCAAAACTTATAGAGTACACTGACTTTGCAACATCAGCTTGTGTTTTGGCTGC TGAATGTACAATTTTTAAAGATGCTTCTGGTAAGCCAGTACCATATTGTTATGATACCAATGTACTAGAA GGTTCTGTTGCTTATGAAAGTTTACGCCCTGACACACGTTATGTGCTCATGGATGGCTCTATTATTCAAT TTCCTAACACCTACCTTGAAGGTTCTGTTAGAGTGGTAACAACTTTTGATTCTGAGTACTGTAGGCACGG 26 01 26 CACTTGTGAAAGATCAGAAGCTGGTGTTTGTGTATCTACTAGTGGTAGATGGGTACTTAACAATGATTAT TACAGATCTTTACCAGGAGTTTTCTGTGGTGTAGATGCTGTAAATTTACTTACTAATATGTTTACACCAC TAATTCAACCTATTGGTGCTTTGGACATATCAGCATCTATAGTAGCTGGTGGTATTGTAGCTATCGTAGT AACATGCCTTGCCTACTATTTTATGAGGTTTAGAAGAGCTTTTGGTGAATACAGTCATGTAGTTGCCTTT AATACTTTACTATTCCTTATGTCATTCACTGTACTCTGTTTAACACCAGTTTACTCATTCTTACCTGGTG TTTATTCTGTTATTTACTTGTACTTGACATTTTATCTTACTAATGATGTTTCTTTTTTAGCACATATTCA GTGGATGGTTATGTTCACACCTTTAGTACCTTTCTGGATAACAATTGCTTATATCATTTGTATTTCCACA AAGCATTTCTATTGGTTCTTTAGTAATTACCTAAAGAGACGTGTAGTCTTTAATGGTGTTTCCTTTAGTA CTTTTGAAGAAGCTGCGCTGTGCACCTTTTTGTTAAATAAAGAAATGTATCTAAAGTTGCGTAGTGATGT GCTATTACCTCTTACGCAATATAATAGATACTTAGCTCTTTATAATAAGTACAAGTATTTTAGTGGAGCA ATGGATACAACTAGCTACAGAGAAGCTGCTTGTTGTCATCTCGCAAAGGCTCTCAATGACTTCAGTAACT CAGGTTCTGATGTTCTTTACCAACCACCACAAACCTCTATCACCTCAGCTGTTTTGCAGAGTGGTTTTAG AAAAATGGCATTCCCATCTGGTAAAGTTGAGGGTTGTATGGTACAAGTAACTTGTGGTACAACTACACTT AACGGTCTTTGGCTTGATGACGTAGTTTACTGTCCAAGACATGTGATCTGCACCTCTGAAGACATGCTTA ACCCTAATTATGAAGATTTACTCATTCGTAAGTCTAATCATAATTTCTTGGTACAGGCTGGTAATGTTCA ACTCAGGGTTATTGGACATTCTATGCAAAATTGTGTACTTAAGCTTAAGGTTGATACAGCCAATCCTAAG ACACCTAAGTATAAGTTTGTTCGCATTCAACCAGGACAGACTTTTTCAGTGTTAGCTTGTTACAATGGTT CACCATCTGGTGTTTACCAATGTGCTATGAGGCCCAATTTCACTATTAAGGGTTCATTCCTTAATGGTTC ATGTGGTAGTGTTGGTTTTAACATAGATTATGACTGTGTCTCTTTTTGTTACATGCACCATATGGAATTA CCAACTGGAGTTCATGCTGGCACAGACTTAGAAGGTAACTTTTATGGACCTTTTGTTGACAGGCAAACAG CACAAGCAGCTGGTACGGACACAACTATTACAGTTAATGTTTTAGCTTGGTTGTACGCTGCTGTTATAAA TGGAGACAGGTGGTTTCTCAATCGATTTACCACAACTCTTAATGACTTTAACCTTGTGGCTATGAAGTAC AATTATGAACCTCTAACACAAGACCATGTTGACATACTAGGACCTCTTTCTGCTCAAACTGGAATTGCCG TTTTAGATATGTGTGCTTCATTAAAAGAATTACTGCAAAATGGTATGAATGGACGTACCATATTGGGTAG TGCTTTATTAGAAGATGAATTTACACCTTTTGATGTTGTTAGACAATGCTCAGGTGTTACTTTCCAAAGT GCAGTGAAAAGAACAATCAAGGGTACACACCACTGGTTGTTACTCACAATTTTGACTTCACTTTTAGTTT TAGTCCAGAGTACTCAATGGTCTTTGTTCTTTTTTTTGTATGAAAATGCCTTTTTACCTTTTGCTATGGG TATTATTGCTATGTCTGCTTTTGCAATGATGTTTGTCAAACATAAGCATGCATTTCTCTGTTTGTTTTTG TTACCTTCTCTTGCCACTGTAGCTTATTTTAATATGGTCTATATGCCTGCTAGTTGGGTGATGCGTATTA TGACATGGTTGGATATGGTTGATACTAGTTTGTCTGGTTTTAAGCTAAAAGACTGTGTTATGTATGCATC AGCTGTAGTGTTACTAATCCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACA CTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGT GGGCTCTTATAATCTCTGTTACTTCTAACTACTCAGGTGTAGTTACAACTGTCATGTTTTTGGCCAGAGG TATTGTTTTTATGTGTGTTGAGTATTGCCCTATTTTCTTCATAACTGGTAATACACTTCAGTGTATAATG CTAGTTTATTGTTTCTTAGGCTATTTTTGTACTTGTTACTTTGGCCTCTTTTGTTTACTCAACCGCTACT TTAGACTGACTCTTGGTGTTTATGATTACTTAGTTTCTACACAGGAGTTTAGATATATGAATTCACAGGG ACTACTCCCACCCAAGAATAGCATAGATGCCTTCAAACTCAACATTAAATTGTTGGGTGTTGGTGGCAAA CCTTGTATCAAAGTAGCCACTGTACAGTCTAAAATGTCAGATGTAAAGTGCACATCAGTAGTCTTACTCT CAGTTTTGCAACAACTCAGAGTAGAATCATCATCTAAATTGTGGGCTCAATGTGTCCAGTTACACAATGA CATTCTCTTAGCTAAAGATACTACTGAAGCCTTTGAAAAAATGGTTTCACTACTTTCTGTTTTGCTTTCC ATGCAGGGTGCTGTAGACATAAACAAGCTTTGTGAAGAAATGCTGGACAACAGGGCAACCTTACAAGCTA TAGCCTCAGAGTTTAGTTCCCTTCCATCATATGCAGCTTTTGCTACTGCTCAAGAAGCTTATGAGCAGGC TGTTGCTAATGGTGATTCTGAAGTTGTTCTTAAAAAGTTGAAGAAGTCTTTGAATGTGGCTAAATCTGAA TTTGACCGTGATGCAGCCATGCAACGTAAGTTGGAAAAGATGGCTGATCAAGCTATGACCCAAATGTATA AACAGGCTAGATCTGAGGACAAGAGGGCAAAAGTTACTAGTGCTATGCAGACAATGCTTTTCACTATGCT TAGAAAGTTGGATAATGATGCACTCAACAACATTATCAACAATGCAAGAGATGGTTGTGTTCCCTTGAAC ATAATACCTCTTACAACAGCAGCCAAACTAATGGTTGTCATACCAGACTATAACACATATAAAAATACGT GTGATGGTACAACATTTACTTATGCATCAGCATTGTGGGAAATCCAACAGGTTGTAGATGCAGATAGTAA AATTGTTCAACTTAGTGAAATTAGTATGGACAATTCACCTAATTTAGCATGGCCTCTTATTGTAACAGCT TTAAGGGCCAATTCTGCTGTCAAATTACAGAATAATGAGCTTAGTCCTGTTGCACTACGACAGATGTCTT GTGCTGCCGGTACTACACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACTACAACACAACAAAGGG AGGTAGGTTTGTACTTGCACTGTTATCCGATTTACAGGATTTGAAATGGGCTAGATTCCCTAAGAGTGAT GGAACTGGTACTATCTATACAGAACTGGAACCACCTTGTAGGTTTGTTACAGACACACCTAAAGGTCCTA AAGTGAAGTATTTATACTTTATTAAAGGATTAAACAACCTAAATAGAGGTATGGTACTTGGTAGTTTAGC TGCCACAGTACGTCTACAAGCTGGTAATGCAACAGAAGTGCCTGCCAATTCAACTGTATTATCTTTCTGT GCTTTTGCTGTAGATGCTGCTAAAGCTTACAAAGATTATCTAGCTAGTGGGGGACAACCAATCACTAATT GTGTTAAGATGTTGTGTACACACACTGGTACTGGTCAGGCAATAACAGTTACACCGGAAGCCAATATGGA TCAAGAATCCTTTGGTGGTGCATCGTGTTGTCTGTACTGCCGTTGCCACATAGATCATCCAAATCCTAAA GGATTTTGTGACTTAAAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTA CACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCG CGAACCCATGCTTCAGTCAGCTGATGCACAATCGTTTTTAAACCGGGTTTGCGGTGTAAGTGCAGCCCGT CTTACACCGTGCGGCACAGGCACTAGTACTGATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAG TAGCTGGTTTTGCTAAATTCCTAAAAACTAATTGTTGTCGCTTCCAAGAAAAGGATGAAGATGACAATTT AATTGATTCTTACTTTGTAGTTAAGAGACACACTTTCTCTAACTACCAACATGAAGAAACAATTTATAAT TTACTTAAGGATTGTCCAGCTGTTGCTAAACATGACTTCTTTAAGTTTAGAATAGACGGTGACATGGTAC CACATATATCACGTCAACGTCTTACTAAATACACAATGGCAGACCTCGTCTATGCTTTAAGGCATTTTGA TGAAGGTAATTGTGACACATTAAAAGAAATACTTGTCACATACAATTGTTGTGATGATGATTATTTCAAT AAAAAGGACTGGTATGATTTTGTAGAAAACCCAGATATATTACGCGTATACGCCAACTTAGGTGAACGTG TACGCCAAGCTTTGTTAAAAACAGTACAATTCTGTGATGCCATGCGAAATGCTGGTATTGTTGGTGTACT 26 01 26 GACATTAGATAATCAAGATCTCAATGGTAACTGGTATGATTTCGGTGATTTCATACAAACCACGCCAGGT AGTGGAGTTCCTGTTGTAGATTCTTATTATTCATTGTTAATGCCTATATTAACCTTGACCAGGGCTTTAA CTGCAGAGTCACATGTTGACACTGACTTAACAAAGCCTTACATTAAGTGGGATTTGTTAAAATATGACTT CACGGAAGAGAGGTTAAAACTCTTTGACCGTTATTTTAAATATTGGGATCAGACATACCACCCAAATTGT GTTAACTGTTTGGATGACAGATGCATTCTGCATTGTGCAAACTTTAATGTTTTATTCTCTACAGTGTTCC CACTTACAAGTTTTGGACCACTAGTGAGAAAAATATTTGTTGATGGTGTTCCATTTGTAGTTTCAACTGG ATACCACTTCAGAGAGCTAGGTGTTGTACATAATCAGGATGTAAACTTACATAGCTCTAGACTTAGTTTT AAGGAATTACTTGTGTATGCTGCTGACCCTGCTATGCACGCTGCTTCTGGTAATCTATTACTAGATAAAC GCACTACGTGCTTTTCAGTAGCTGCACTTACTAACAATGTTGCTTTTCAAACTGTCAAACCCGGTAATTT TAACAAAGACTTCTATGACTTTGCTGTGTCTAAGGGTTTCTTTAAGGAAGGAAGTTCTGTTGAATTAAAA CACTTCTTCTTTGCTCAGGATGGTAATGCTGCTATCAGCGATTATGACTACTATCGTTATAATCTACCAA CAATGTGTGATATCAGACAACTACTATTTGTAGTTGAAGTTGTTGATAAGTACTTTGATTGTTACGATGG TGGCTGTATTAATGCTAACCAAGTCATCGTCAACAACCTAGACAAATCAGCTGGTTTTCCATTTAATAAA TGGGGTAAGGCTAGACTTTATTATGATTCAATGAGTTATGAGGATCAAGATGCACTTTTCGCATATACAA AACGTAATGTCATCCCTACTATAACTCAAATGAATCTTAAGTATGCCATTAGTGCAAAGAATAGAGCTCG CACCGTAGCTGGTGTCTCTATCTGTAGTACTATGACCAATAGACAGTTTCATCAAAAATTATTGAAATCA ATAGCCGCCACTAGAGGAGCTACTGTAGTAATTGGAACAAGCAAATTCTATGGTGGTTGGCACAACATGT TAAAAACTGTTTATAGTGATGTAGAAAACCCTCACCTTATGGGTTGGGATTATCCTAAATGTGATAGAGC CATGCCTAACATGCTTAGAATTATGGCCTCACTTGTTCTTGCTCGCAAACATACAACGTGTTGTAGCTTG TCACACCGTTTCTATAGATTAGCTAATGAGTGTGCTCAAGTATTGAGTGAAATGGTCATGTGTGGCGGTT CACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTTTTAA CATTTGTCAAGCTGTCACGGCCAATGTTAATGCACTTTTATCTACTGATGGTAACAAAATTGCCGATAAG TATGTCCGCAATTTACAACACAGACTTTATGAGTGTCTCTATAGAAATAGAGATGTTGACACAGACTTTG TGAATGAGTTTTACGCATATTTGCGTAAACATTTCTCAATGATGATACTCTCTGACGATGCTGTTGTGTG TTTCAATAGCACTTATGCATCTCAAGGTCTAGTGGCTAGCATAAAGAACTTTAAGTCAGTTCTTTATTAT CAAAACAATGTTTTTATGTCTGAAGCAAAATGTTGGACTGAGACTGACCTTACTAAAGGACCTCATGAAT TTTGCTCTCAACATACAATGCTAGTTAAACAGGGTGATGATTATGTGTACCTTCCTTACCCAGATCCATC AAGAATCCTAGGGGCCGGCTGTTTTGTAGATGATATCGTAAAAACAGATGGTACACTTATGATTGAACGG TTCGTGTCTTTAGCTATAGATGCTTACCCACTTACTAAACATCCTAATCAGGAGTATGCTGATGTCTTTC ATTTGTACTTACAATACATAAGAAAGCTACATGATGAGTTAACAGGACACATGTTAGACATGTATTCTGT TATGCTTACTAATGATAACACTTCAAGGTATTGGGAACCTGAGTTTTATGAGGCTATGTACACACCGCAT ACAGTCTTACAGGCTGTTGGGGCTTGTGTTCTTTGCAATTCACAGACTTCATTAAGATGTGGTGCTTGCA TACGTAGACCATTCTTATGTTGTAAATGCTGTTACGACCATGTCATATCAACATCACATAAATTAGTCTT GTCTGTTAATCCGTATGTTTGCAATGCTCCAGGTTGTGATGTCACAGATGTGACTCAACTTTACTTAGGA GGTATGAGCTATTATTGTAAATCACATAAACCACCCATTAGTTTTCCATTGTGTGCTAATGGACAAGTTT TTGGTTTATATAAAAATACATGTGTTGGTAGCGATAATGTTACTGACTTTAATGCAATTGCAACATGTGA CTGGACAAATGCTGGTGATTACATTTTAGCTAACACCTGTACTGAAAGACTCAAGCTTTTTGCAGCAGAA ACGCTCAAAGCTACTGAGGAGACATTTAAACTGTCTTATGGTATTGCTACTGTACGTGAAGTGCTGTCTG ACAGAGAATTACATCTTTCATGGGAAGTTGGTAAACCTAGACCACCACTTAACCGAAATTATGTCTTTAC TGGTTATCGTGTAACTAAAAACAGTAAAGTACAAATAGGAGAGTACACCTTTGAAAAAGGTGACTATGGT GATGCTGTTGTTTACCGAGGTACAACAACTTACAAATTAAATGTTGGTGATTATTTTGTGCTGACATCAC ATACAGTAATGCCATTAAGTGCACCTACACTAGTGCCACAAGAGCACTATGTTAGAATTACTGGCTTATA CCCAACACTCAATATCTCAGATGAGTTTTCTAGCAATGTTGCAAATTATCAAAAGGTTGGTATGCAAAAG TATTCTACACTCCAGGGACCACCTGGTACTGGTAAGAGTCATTTTGCTATTGGCCTAGCTCTCTACTACC CTTCTGCTCGCATAGTGTATACAGCTTGCTCTCATGCCGCTGTTGATGCACTATGTGAGAAGGCATTAAA ATATTTGCCTATAGATAAATGTAGTAGAATTATACCTGCACGTGCTCGTGTAGAGTGTTTTGATAAATTC AAAGTGAATTCAACATTAGAACAGTATGTCTTTTGTACTGTAAATGCATTGCCTGAGACGACAGCAGATA TAGTTGTCTTTGATGAAATTTCAATGGCCACAAATTATGATTTGAGTGTTGTCAATGCCAGATTACGTGC TAAGCACTATGTGTACATTGGCGACCCTGCTCAATTACCTGCACCACGCACATTGCTAACTAAGGGCACA CTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAA CTTGTCGGCGTTGTCCTGCTGAAATTGTTGACACTGTGAGTGCTTTGGTTTATGATAATAAGCTTAAAGC ACATAAAGACAAATCAGCTCAATGCTTTAAAATGTTTTATAAGGGTGTTATCACGCATGATGTTTCATCT GCAATTAACAGGCCACAAATAGGCGTGGTAAGAGAATTCCTTACACGTAACCCTGCTTGGAGAAAAGCTG TCTTTATTTCACCTTATAATTCACAGAATGCTGTAGCCTCAAAGATTTTGGGACTACCAACTCAAACTGT TGATTCATCACAGGGCTCAGAATATGACTATGTCATATTCACTCAAACCACTGAAACAGCTCACTCTTGT AATGTAAACAGATTTAATGTTGCTATTACCAGAGCAAAAGTAGGCATACTTTGCATAATGTCTGATAGAG ACCTTTATGACAAGTTGCAATTTACAAGTCTTGAAATTCCACGTAGGAATGTGGCAACTTTACAAGCTGA AAATGTAACAGGACTCTTTAAAGATTGTAGTAAGGTAATCACTGGGTTACATCCTACACAGGCACCTACA CACCTCAGTGTTGACACTAAATTCAAAACTGAAGGTTTATGTGTTGACATACCTGGCATACCTAAGGACA TGACCTATAGAAGACTCATCTCTATGATGGGTTTTAAAATGAATTATCAAGTTAATGGTTACCCTAACAT GTTTATCACCCGCGAAGAAGCTATAAGACATGTACGTGCATGGATTGGCTTCGATGTCGAGGGGTGTCAT GCTACTAGAGAAGCTGTTGGTACCAATTTACCTTTACAGCTAGGTTTTTCTACAGGTGTTAACCTAGTTG CTGTACCTACAGGTTATGTTGATACACCTAATAATACAGATTTTTCCAGAGTTAGTGCTAAACCACCGCC TGGAGATCAATTTAAACACCTCATACCACTTATGTACAAAGGACTTCCTTGGAATGTAGTGCGTATAAAG ATTGTACAAATGTTAAGTGACACACTTAAAAATCTCTCTGACAGAGTCGTATTTGTCTTATGGGCACATG GCTTTGAGTTGACATCTATGAAGTATTTTGTGAAAATAGGACCTGAGCGCACCTGTTGTCTATGTGATAG ACGTGCCACATGCTTTTCCACTGCTTCAGACACTTATGCCTGTTGGCATCATTCTATTGGATTTGATTAC GTCTATAATCCGTTTATGATTGATGTTCAACAATGGGGTTTTACAGGTAACCTACAAAGCAACCATGATC TGTATTGTCAAGTCCATGGTAATGCACATGTAGCTAGTTGTGATGCAATCATGACTAGGTGTCTAGCTGT 26 01 26 CCACGAGTGCTTTGTTAAGCGTGTTGACTGGACTATTGAATATCCTATAATTGGTGATGAACTGAAGATT AATGCGGCTTGTAGAAAGGTTCAACACATGGTTGTTAAAGCTGCATTATTAGCAGACAAATTCCCAGTTC TTCACGACATTGGTAACCCTAAAGCTATTAAGTGTGTACCTCAAGCTGATGTAGAATGGAAGTTCTATGA TGCACAGCCTTGTAGTGACAAAGCTTATAAAATAGAAGAATTATTCTATTCTTATGCCACACATTCTGAC AAATTCACAGATGGTGTATGCCTATTTTGGAATTGCAATGTCGATAGATATCCTGCTAATTCCATTGTTT GTAGATTTGACACTAGAGTGCTATCTAACCTTAACTTGCCTGGTTGTGATGGTGGCAGTTTGTATGTAAA TAAACATGCATTCCACACACCAGCTTTTGATAAAAGTGCTTTTGTTAATTTAAAACAATTACCATTTTTC TATTACTCTGACAGTCCATGTGAGTCTCATGGAAAACAAGTAGTGTCAGATATAGATTATGTACCACTAA AGTCTGCTACGTGTATAACACGTTGCAATTTAGGTGGTGCTGTCTGTAGACATCATGCTAATGAGTACAG ATTGTATCTCGATGCTTATAACATGATGATCTCAGCTGGCTTTAGCTTGTGGGTTTACAAACAATTTGAT ACTTATAACCTCTGGAACACTTTTACAAGACTTCAGAGTTTAGAAAATGTGGCTTTTAATGTTGTAAATA AGGGACACTTTGATGGACAACAGGGTGAAGTACCAGTTTCTATCATTAATAACACTGTTTACACAAAAGT TGATGGTGTTGATGTAGAATTGTTTGAAAATAAAACAACATTACCTGTTAATGTAGCATTTGAGCTTTGG GCTAAGCGCAACATTAAACCAGTACCAGAGGTGAAAATACTCAATAATTTGGGTGTGGACATTGCTGCTA ATACTGTGATCTGGGACTACAAAAGAGATGCTCCAGCACATATATCTACTATTGGTGTTTGTTCTATGAC TGACATAGCCAAGAAACCAACTGAAACGATTTGTGCACCACTCACTGTCTTTTTTGATGGTAGAGTTGAT GGTCAAGTAGACTTATTTAGAAATGCCCGTAATGGTGTTCTTATTACAGAAGGTAGTGTTAAAGGTTTAC AACCATCTGTAGGTCCCAAACAAGCTAGTCTTAATGGAGTCACATTAATTGGAGAAGCCGTAAAAACACA GTTCAATTATTATAAGAAAGTTGATGGTGTTGTCCAACAATTACCTGAAACTTACTTTACTCAGAGTAGA AATTTACAAGAATTTAAACCCAGGAGTCAAATGGAAATTGATTTCTTAGAATTAGCTATGGATGAATTCA TTGAACGGTATAAATTAGAAGGCTATGCCTTCGAACATATCGTTTATGGAGATTTTAGTCATAGTCAGTT AGGTGGTTTACATCTACTGATTGGACTAGCTAAACGTTTTAAGGAATCACCTTTTGAATTAGAAGATTTT ATTCCTATGGACAGTACAGTTAAAAACTATTTCATAACAGATGCGCAAACAGGTTCATCTAAGTGTGTGT GTTCTGTTATTGATTTATTACTTGATGATTTTGTTGAAATAATAAAATCCCAAGATTTATCTGTAGTTTC TAAGGTTGTCAAAGTGACTATTGACTATACAGAAATTTCATTTATGCTTTGGTGTAAAGATGGCCATGTA GAAACATTTTACCCAAAATTACAATCTAGTCAAGCGTGGCAACCGGGTGTTGCTATGCCTAATCTTTACA AAATGCAAAGAATGCTATTAGAAAAGTGTGACCTTCAAAATTATGGTGATAGTGCAACATTACCTAAAGG CATAATGATGAATGTCGCAAAATATACTCAACTGTGTCAATATTTAAACACATTAACATTAGCTGTACCC TATAATATGAGAGTTATACATTTTGGTGCTGGTTCTGATAAAGGAGTTGCACCAGGTACAGCTGTTTTAA GACAGTGGTTGCCTACGGGTACGCTGCTTGTCGATTCAGATCTTAATGACTTTGTCTCTGATGCAGATTC AACTTTGATTGGTGATTGTGCAACTGTACATACAGCTAATAAATGGGATCTCATTATTAGTGATATGTAC GACCCTAAGACTAAAAATGTTACAAAAGAAAATGACTCTAAAGAGGGTTTTTTCACTTACATTTGTGGGT TTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGA TCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCT GAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATG CAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAA ATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTA TCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTG TTAACAACTAA 4 Severe acute respirat ory syndrome coronavi rus 2 isolate SARS-CoV-2 / human / BRA / LRV-SARS.CoV 2.1 / 2020 / complete genome ATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTTACAGGTTC GCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAA AGATGGCACTTGTGGCTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTC ATCAAACGTTCGGATGCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAG GCATTCAGTACGGTCGTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGC TTACCGCAAGGTTCTTCTTCGTAAGAACGGTAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTA AAGTCATTTGACTTAGGCGACGAGCTTGGCACTGATCCTTATGAAGATTTTCAAGAAAACTGGAACACTA AACATAGCAGTGGTGTTACCCGTGAACTCATGCGTGAGCTTAACGGAGGGGCATACACTCGCTATGTCGA TAACAACTTCTGTGGCCCTGATGGCTACCCTCTTGAGTGCATTAAAGACCTTCTAGCACGTGCTGGTAAA GCTTCATGCACTTTGTCCGAACAACTGGACTTTATTGACACTAAGAGGGGTGTATACTGCTGCCGTGAAC ATGAGCATGAAATTGCTTGGTACACGGAACGTTCTGAAAAGAGCTATGAATTGCAGACACCTTTTGAAAT TAAATTGGCAAAGAAATTTGACACCTTCAATGGGGAATGTCCAAATTTTGTATTTCCCTTAAATTCCATA ATCAAGACTATTCAACCAAGGGTTGAAAAGAAAAAGCTTGATGGCTTTATGGGTAGAATTCGATCTGTCT ATCCAGTTGCGTCACCAAATGAATGCAACCAAATGTGCCTTTCAACTCTCATGAAGTGTGATCATTGTGG TGAAACTTCATGGCAGACGGGCGATTTTGTTAAAGCCACTTGCGAATTTTGTGGCACTGAGAATTTGACT AAAGAAGGTGCCACTACTTGTGGTTACTTACCCCAAAATGCTGTTGTTAAAATTTATTGTCCAGCATGTC ACAATTCAGAAGTAGGACCTGAGCATAGTCTTGCCGAATACCATAATGAATCTGGCTTGAAAACCATTCT TCGTAAGGGTGGTCGCACTATTGCCTTTGGAGGCTGTGTGTTCTCTTATGTTGGTTGCCATAACAAGTGT GCCTATTGGGTTCCACGTGCTAGCGCTAACATAGGTTGTAACCATACAGGTGTTGTTGGAGAAGGTTCCG AAGGTCTTAATGACAACCTTCTTGAAATACTCCAAAAAGAGAAAGTCAACATCAATATTGTTGGTGACTT TAAACTTAATGAAGAGATCGCCATTATTTTGGCATCTTTTTCTGCTTCCACAAGTGCTTTTGTGGAAACT GTGAAAGGTTTGGATTATAAAGCATTCAAACAAATTGTTGAATCCTGTGGTAATTTTAAAGTTACAAAAG GAAAAGCTAAAAAAGGTGCCTGGAATATTGGTGAACAGAAATCAATACTGAGTCCTCTTTATGCATTTGC ATCAGAGGCTGCTCGTGTTGTACGATCAATTTTCTCCCGCACTCTTGAAACTGCTCAAAATTCTGTGCGT GTTTTACAGAAGGCCGCTATAACAATACTAGATGGAATTTCACAGTATTCACTGAGACTCATTGATGCTA TGATGTTCACATCTGATTTGGCTACTAACAATCTAGTTGTAATGGCCTACATTACAGGTGGTGTTGTTCA GTTGACTTCGCAGTGGCTAACTAACATCTTTGGCACTGTTTATGAAAAACTCAAACCCGTCCTTGATTGG CTTGAAGAGAAGTTTAAGGAAGGTGTAGAGTTTCTTAGAGACGGTTGGGAAATTGTTAAATTTATCTCAA CCTGTGCTTGTGAAATTGTCGGTGGACAAATTGTCACCTGTGCAAAGGAAATTAAGGAGAGTGTTCAGAC ATTCTTTAAGCTTGTAAATAAATTTTTGGCTTTGTGTGCTGACTCTATCATTATTGGTGGAGCTAAACTT 26 01 26 AAAGCCTTGAATTTAGGTGAAACATTTGTCACGCACTCAAAGGGATTGTACAGAAAGTGTGTTAAATCCA GAGAAGAAACTGGCCTACTCATGCCTCTAAAAGCCCCAAAAGAAATTATCTTCTTAGAGGGAGAAACACT TCCCACAGAAGTGTTAACAGAGGAAGTTGTCTTGAAAACTGGTGATTTACAACCATTAGAACAACCTACT AGTGAAGCTGTTGAAGCTCCATTGGTTGGTACACCAGTTTGTATTAACGGGCTTATGTTGCTCGAAATCA AAGACACAGAAAAGTACTGTGCCCTTGCACCTAATATGATGGTAACAAACAATACCTTCACACTCAAAGG CGGTGCACCAACAAAGGTTACTTTTGGTGATGACACTGTGATAGAAGTGCAAGGTTACAAGAGTGTGAAT ATCACTTTTGAACTTGATGAAAGGATTGATAAAGTACTTAATGAGAAGTGCTCTGCCTATACAGTTGAAC TCGGTACAGAAGTAAATGAGTTCGCCTGTGTTGTGGCAGATGCTGTCATAAAAACTTTGCAACCAGTATC TGAATTACTTACACCACTGGGCATTGATTTAGATGAGTGGAGTATGGCTACATACTACTTATTTGATGAG TCTGGTGAGTTTAAATTGGCTTCACATATGTATTGTTCTTTTTACCCTCCAGATGAGGATGAAGAAGAAG GTGATTGTGAAGAAGAAGAGTTTGAGCCATCAACTCAATATGAGTATGGTACTGAAGATGATTACCAAGG TAAACCTTTGGAATTTGGTGCCACTTCTGCTGCTCTTCAACCTGAAGAAGAGCAAGAAGAAGATTGGTTA GATGATGATAGTCAACAAACTGTTGGTCAACAAGACGGCAGTGAGGACAATCAGACAACTACTATTCAAA CAATTGTTGAGGTTCAACCTCAATTAGAGATGGAACTTACACCAGTTGTTCAGACTATTGAAGTGAATAG TTTTAGTGGTTATTTAAAACTTACTGACAATGTATACATTAAAAATGCAGACATTGTGGAAGAAGCTAAA AAGGTAAAACCAACAGTGGTTGTTAATGCAGCCAATGTTTACCTTAAACATGGAGGAGGTGTTGCAGGAG CCTTAAATAAGGCTACTAACAATGCCATGCAAGTTGAATCTGATGATTACATAGCTACTAATGGACCACT TAAAGTGGGTGGTAGTTGTGTTTTAAGCGGACACAATCTTGCTAAACACTGTCTTCATGTTGTCGGCCCA AATGTTAACAAAGGTGAAGACATTCAACTTCTTAAGAGTGCTTATGAAAATTTTAATCAGCACGAAGTTC TACTTGCACCATTATTATCAGCTGGTATTTTTGGTGCTGACCCTATACATTCTTTAAGAGTTTGTGTAGA TACTGTTCGCACAAATGTCTACTTAGCTGTCTTTGATAAAAATCTCTATGACAAACTTGTTTCAAGCTTT TTGGAAATGAAGAGTGAAAAGCAAGTTGAACAAAAGATCGCTGAGATTCCTAAAGAGGAAGTTAAGCCAT TTATAACTGAAAGTAAACCTTCAGTTGAACAGAGAAAACAAGATGATAAGAAAATCAAAGCTTGTGTTGA AGAAGTTACAACAACTCTGGAAGAAACTAAGTTCCTCACAGAAAACTTGTTACTTTATATTGACATTAAT GGCAATCTTCATCCAGATTCTGCCACTCTTGTTAGTGACATTGACATCACTTTCTTAAAGAAAGATGCTC CATATATAGTGGGTGATGTTGTTCAAGAGGGTGTTTTAACTGCTGTGGTTATACCTACTAAAAAGGCTGG TGGCACTACTGAAATGCTAGCGAAAGCTTTGAGAAAAGTGCCAACAGACAATTATATAACCACTTACCCG GGTCAGGGTTTAAATGGTTACACTGTAGAGGAGGCAAAGACAGTGCTTAAAAAGTGTAAAAGTGCCTTTT ACATTCTACCATCTATTATCTCTAATGAGAAGCAAGAAATTCTTGGAACTGTTTCTTGGAATTTGCGAGA AATGCTTGCACATGCAGAAGAAACACGCAAATTAATGCCTGTCTGTGTGGAAACTAAAGCCATAGTTTCA ACTATACAGCGTAAATATAAGGGTATTAAAATACAAGAGGGTGTGGTTGATTATGGTGCTAGATTTTACT TTTACACCAGTAAAACAACTGTAGCGTCACTTATCAACACACTTAACGATCTAAATGAAACTCTTGTTAC AATGCCACTTGGCTATGTAACACATGGCTTAAATTTGGAAGAAGCTGCTCGGTATATGAGATCTCTCAAA GTGCCAGCTACAGTTTCTGTTTCTTCACCTGATGCTGTTACAGCGTATAATGGTTATCTTACTTCTTCTT CTAAAACACCTGAAGAACATTTTATTGAAACCATCTCACTTGCTGGTTCCTATAAAGATTGGTCCTATTC TGGACAATCTACACAACTAGGTATAGAATTTCTTAAGAGAGGTGATAAAAGTGTATATTACACTAGTAAT CCTACCACATTCCACCTAGATGGTGAAGTTATCACCTTTGACAATCTTAAGACACTTCTTTCTTTGAGAG AAGTGAGGACTATTAAGGTGTTTACAACAGTAGACAACATTAACCTCCACACGCAAGTTGTGGACATGTC AATGACATATGGACAACAGTTTGGTCCAACTTATTTGGATGGAGCTGATGTTACTAAAATAAAACCTCAT AATTCACATGAAGGTAAAACATTTTATGTTTTACCTAATGATGACACTCTACGTGTTGAGGCTTTTGAGT ACTACCACACAACTGATCCTAGTTTTCTGGGTAGGTACATGTCAGCATTAAATCACACTAAAAAGTGGAA ATACCCACAAGTTAATGGTTTAACTTCTATTAAATGGGCAGATAACAACTGTTATCTTGCCACTGCATTG TTAACACTCCAACAAATAGAGTTGAAGTTTAATCCACCTGCTCTACAAGATGCTTATTACAGAGCAAGGG CTGGTGAAGCTGCTAACTTTTGTGCACTTATCTTAGCCTACTGTAATAAGACAGTAGGTGAGTTAGGTGA TGTTAGAGAAACAATGAGTTACTTGTTTCAACATGCCAATTTAGATTCTTGCAAAAGAGTCTTGAACGTG GTGTGTAAAACTTGTGGACAACAGCAGACAACCCTTAAGGGTGTAGAAGCTGTTATGTACATGGGCACAC TTTCTTATGAACAATTTAAGAAAGGTGTTCAGATACCTTGTACGTGTGGTAAACAAGCTACAAAATATCT AGTACAACAGGAGTCACCTTTTGTTATGATGTCAGCACCACCTGCTCAGTATGAACTTAAGCATGGTACA TTTACTTGTGCTAGTGAGTACACTGGTAATTACCAGTGTGGTCACTATAAACATATAACTTCTAAAGAAA CTTTGTATTGCATAGACGGTGCTTTACTTACAAAGTCCTCAGAATACAAAGGTCCTATTACGGATGTTTT CTACAAAGAAAACAGTTACACAACAACCATAAAACCAGTTACTTATAAATTGGATGGTGTTGTTTGTACA GAAATTGACCCTAAGTTGGACAATTATTATAAGAAAGACAATTCTTATTTCACAGAGCAACCAATTGATC TTGTACCAAACCAACCATATCCAAACGCAAGCTTCGATAATTTTAAGTTTGTATGTGATAATATCAAATT TGCTGATGATTTAAACCAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTC CCTGACTTAAATGGTGATGTGGTGGCTATTGATTATAAACACTACACACCCTCTTTTAAGAAAGGAGCTA AATTGTTACATAAACCTATTGTTTGGCATGTTAACAATGCAACTAATAAAGCCACGTATAAACCAAATAC CTGGTGTATACGTTGTCTTTGGAGCACAAAACCAGTTGAAACATCAAATTCGTTTGATGTACTGAAGTCA GAGGACGCGCAGGGAATGGATAATCTTGCCTGCGAAGATCTAAAACCAGTCTCTGAAGAAGTAGTGGAAA ATCCTACCATACAGAAAGACGTTCTTGAGTGTAATGTGAAAACTACCGAAGTTGTAGGAGACATTATACT TAAACCAGCAAATAATAGTTTAAAAATTACAGAAGAGGTTGGCCACACAGATCTAATGGCTGCTTATGTA GACAATTCTAGTCTTACTATTAAGAAACCTAATGAATTATCTAGAGTATTAGGTTTGAAAACCCTTGCTA CTCATGGTTTAGCTGCTGTTAATAGTGTCCCTTGGGATACTATAGCTAATTATGCTAAGCCTTTTCTTAA CAAAGTTGTTAGTACAACTACTAACATAGTTACACGGTGTTTAAACCGTGTTTGTACTAATTATATGCCT TATTTCTTTACTTTATTGCTACAATTGTGTACTTTTACTAGAAGTACAAATTCTAGAATTAAAGCATCTA TGCCGACTACTATAGCAAAGAATACTGTTAAGAGTGTCGGTAAATTTTGTCTAGAGGCTTCATTTAATTA TTTGAAGTCACCTAATTTTTCTAAACTGATAAATATTATAATTTGGTTTTTACTATTAAGTGTTTGCCTA GGTTCTTTAATCTACTCAACCGCTGCTTTAGGTGTTTTAATGTCTAATTTAGGCATGCCTTCTTACTGTA CTGGTTACAGAGAAGGCTATTTGAACTCTACTAATGTCACTATTGCAACCTACTGTACTGGTTCTATACC TTGTAGTGTTTGTCTTAGTGGTTTAGATTCTTTAGACACCTATCCTTCTTTAGAAACTATACAAATTACC 26 01 26 ATTTCATCTTTTAAATGGGATTTAACTGCTTTTGGCTTAGTTGCAGAGTGGTTTTTGGCATATATTCTTT TCACTAGGTTTTTCTATGTACTTGGATTGGCTGCAATCATGCAATTGTTTTTCAGCTATTTTGCAGTACA TTTTATTAGTAATTCTTGGCTTATGTGGTTAATAATTAATCTTGTACAAATGGCCCCGATTTCAGCTATG GTTAGAATGTACATCTTCTTTGCATCATTTTATTATGTATGGAAAAGTTATGTGCATGTTGTAGACGGTT GTAATTCATCAACTTGTATGATGTGTTACAAACGTAATAGAGCAACAAGAGTCGAATGTACAACTATTGT TAATGGTGTTAGAAGGTCCTTTTATGTCTATGCTAATGGAGGTAAAGGCTTTTGCAAACTACACAATTGG AATTGTGTTAATTGTGATACATTCTGTGCTGGTAGTACATTTATTAGTGATGAAGTTGCGAGAGACTTGT CACTACAGTTTAAAAGACCAATAAATCCTACTGACCAGTCTTCTTACATCGTTGATAGTGTTACAGTGAA GAATGGTTCCATCCATCTTTACTTTGATAAAGCTGGTCAAAAGACTTATGAAAGACATTCTCTCTCTCAT TTTGTTAACTTAGACAACCTGAGAGCTAATAACACTAAAGGTTCATTGCCTATTAATGTTATAGTTTTTG ATGGTAAATCAAAATGTGAAGAATCATCTGCAAAATCAGCGTCTGTTTACTACAGTCAGCTTATGTGTCA ACCTATACTGTTACTAGATCAGGCATTAGTGTCTGATGTTGGTGATAGTGCGGAAGTTGCAGTTAAAATG TTTGATGCTTACGTTAATACGTTTTCATCAACTTTTAACGTACCAATGGAAAAACTCAAAACACTAGTTG CAACTGCAGAAGCTGAACTTGCAAAGAATGTGTCCTTAGACAATGTCTTATCTACTTTTATTTCAGCAGC TCGGCAAGGGTTTGTTGATTCAGATGTAGAAACTAAAGATGTTGTTGAATGTCTTAAATTGTCACATCAA TCTGACATAGAAGTTACTGGCGATAGTTGTAATAACTATATGCTCACCTATAACAAAGTTGAAAACATGA CACCCCGTGACCTTGGTGCTTGTATTGACTGTAGTGCGCGTCATATTAATGCGCAGGTAGCAAAAAGTCA CAACATTGCTTTGATATGGAACGTTAAAGATTTCATGTCATTGTCTGAACAACTACGAAAACAAATACGT AGTGCTGCTAAAAAGAATAACTTACCTTTTAAGTTGACATGTGCAACTACTAGACAAGTTGTTAATGTTG TAAC AACAAAGAT AGC AC T TAAGGGT GGTAAAAT T GT TAATAAT T GGT T GAAGCAGT TAAT TAAAGT TAC ACTTGTGTTCCTTTTTGTTGCTGCTATTTTCTATTTAATAACACCTGTTCATGTCATGTCTAAACATACT GACTTTTCAAGTGAAATCATAGGATACAAGGCTATTGATGGTGGTGTCACTCGTGACATAGCATCTACAG ATACTTGTTTTGCTAACAAACATGCTGATTTTGACACATGGTTTAGCCAGCGTGGTGGTAGTTATACTAA TGACAAAGCTTGCCCATTGATTGCTGCAGTCATAACAAGAGAAGTGGGTTTTGTCGTGCCTGGTTTGCCT GGCACGATATTACGCACAACTAATGGTGACTTTTTGCATTTCTTACCTAGAGTTTTTAGTGCAGTTGGTA ACATCTGTTACACACCATCAAAACTTATAGAGTACACTGACTTTGCAACATCAGCTTGTGTTTTGGCTGC TGAATGTACAATTTTTAAAGATGCTTCTGGTAAGCCAGTACCATATTGTTATGATACCAATGTACTAGAA GGTTCTGTTGCTTATGAAAGTTTACGCCCTGACACACGTTATGTGCTCATGGATGGCTCTATTATTCAAT TTCCTAACACCTACCTTGAAGGTTCTGTTAGAGTGGTAACAACTTTTGATTCTGAGTACTGTAGGCACGG CACTTGTGAAAGATCAGAAGCTGGTGTTTGTGTATCTACTAGTGGTAGATGGGTACTTAACAATGATTAT TACAGATCTTTACCAGGAGTTTTCTGTGGTGTAGATGCTGTAAATTTACTTACTAATATGTTTACACCAC TAATTCAACCTATTGGTGCTTTGGACATATCAGCATCTATAGTAGCTGGTGGTATTGTAGCTATCGTAGT AACATGCCTTGCCTACTATTTTATGAGGTTTAGAAGAGCTTTTGGTGAATACAGTCATGTAGTTGCCTTT AATACTTTACTATTCCTTATGTCATTCACTGTACTCTGTTTAACACCAGTTTACTCATTCTTACCTGGTG TTTATTCTGTTATTTACTTGTACTTGACATTTTATCTTACTAATGATGTTTCTTTTTTAGCACATATTCA GTGGATGGTTATGTTCACACCTTTAGTACCTTTCTGGATAACAATTGCTTATATCATTTGTATTTCCACA AAGCATTTCTATTGGTTCTTTAGTAATTACCTAAAGAGACGTGTAGTCTTTAATGGTGTTTCCTTTAGTA CTTTTGAAGAAGCTGCGCTGTGCACCTTTTTGTTAAATAAAGAAATGTATCTAAAGTTGCGTAGTGATGT GCTATTACCTCTTACGCAATATAATAGATACTTAGCTCTTTATAATAAGTACAAGTATTTTAGTGGAGCA ATGGATACAACTAGCTACAGAGAAGCTGCTTGTTGTCATCTCGCAAAGGCTCTCAATGACTTCAGTAACT CAGGTTCTGATGTTCTTTACCAACCACCACAAACCTCTATCACCTCAGCTGTTTTGCAGAGTGGTTTTAG AAAAATGGCATTCCCATCTGGTAAAGTTGAGGGTTGTATGGTACAAGTAACTTGTGGTACAACTACACTT AACGGTCTTTGGCTTGATGACGTAGTTTACTGTCCAAGACATGTGATCTGCACCTCTGAAGACATGCTTA ACCCTAATTATGAAGATTTACTCATTCGTAAGTCTAATCATAATTTCTTGGTACAGGCTGGTAATGTTCA ACTCAGGGTTATTGGACATTCTATGCAAAATTGTGTACTTAAGCTTAAGGTTGATACAGCCAATCCTAAG ACACCTAAGTATAAGTTTGTTCGCATTCAACCAGGACAGACTTTTTCAGTGTTAGCTTGTTACAATGGTT CACCATCTGGTGTTTACCAATGTGCTATGAGGCCCAATTTCACTATTAAGGGTTCATTCCTTAATGGTTC ATGTGGTAGTGTTGGTTTTAACATAGATTATGACTGTGTCTCTTTTTGTTACATGCACCATATGGAATTA CCAACTGGAGTTCATGCTGGCACAGACTTAGAAGGTAACTTTTATGGACCTTTTGTTGACAGGCAAACAG CACAAGCAGCTGGTACGGACACAACTATTACAGTTAATGTTTTAGCTTGGTTGTACGCTGCTGTTATAAA TGGAGACAGGTGGTTTCTCAATCGATTTACCACAACTCTTAATGACTTTAACCTTGTGGCTATGAAGTAC AATTATGAACCTCTAACACAAGACCATGTTGACATACTAGGACCTCTTTCTGCTCAAACTGGAATTGCCG TTTTAGATATGTGTGCTTCATTAAAAGAATTACTGCAAAATGGTATGAATGGACGTACCATATTGGGTAG TGCTTTATTAGAAGATGAATTTACACCTTTTGATGTTGTTAGACAATGCTCAGGTGTTACTTTCCAAAGT GCAGTGAAAAGAACAATCAAGGGTACACACCACTGGTTGTTACTCACAATTTTGACTTCACTTTTAGTTT TAGTCCAGAGTACTCAATGGTCTTTGTTCTTTTTTTTGTATGAAAATGCCTTTTTACCTTTTGCTATGGG TATTATTGCTATGTCTGCTTTTGCAATGATGTTTGTCAAACATAAGCATGCATTTCTCTGTTTGTTTTTG TTACCTTCTCTTGCCACTGTAGCTTATTTTAATATGGTCTATATGCCTGCTAGTTGGGTGATGCGTATTA TGACATGGTTGGATATGGTTGATACTAGTTTGTCTGGTTTTAAGCTAAAAGACTGTGTTATGTATGCATC AGCTGTAGTGTTACTAATCCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACA CTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGT GGGCTCTTATAATCTCTGTTACTTCTAACTACTCAGGTGTAGTTACAACTGTCATGTTTTTGGCCAGAGG TATTGTTTTTATGTGTGTTGAGTATTGCCCTATTTTCTTCATAACTGGTAATACACTTCAGTGTATAATG CTAGTTTATTGTTTCTTAGGCTATTTTTGTACTTGTTACTTTGGCCTCTTTTGTTTACTCAACCGCTACT TTAGACTGACTCTTGGTGTTTATGATTACTTAGTTTCTACACAGGAGTTTAGATATATGAATTCACAGGG ACTACTCCCACCCAAGAATAGCATAGATGCCTTCAAACTCAACATTAAATTGTTGGGTGTTGGTGGCAAA CCTTGTATCAAAGTAGCCACTGTACAGTCTAAAATGTCAGATGTAAAGTGCACATCAGTAGTCTTACTCT CAGTTTTGCAACAACTCAGAGTAGAATCATCATCTAAATTGTGGGCTCAATGTGTCCAGTTACACAATGA CATTCTCTTAGCTAAAGATACTACTGAAGCCTTTGAAAAAATGGTTTCACTACTTTCTGTTTTGCTTTCC 26 01 26 ATGCAGGGTGCTGTAGACATAAACAAGCTTTGTGAAGAAATGCTGGACAACAGGGCAACCTTACAAGCTA TAGCCTCAGAGTTTAGTTCCCTTCCATCATATGCAGCTTTTGCTACTGCTCAAGAAGCTTATGAGCAGGC TGTTGCTAATGGTGATTCTGAAGTTGTTCTTAAAAAGTTGAAGAAGTCTTTGAATGTGGCTAAATCTGAA TTTGACCGTGATGCAGCCATGCAACGTAAGTTGGAAAAGATGGCTGATCAAGCTATGACCCAAATGTATA AACAGGCTAGATCTGAGGACAAGAGGGCAAAAGTTACTAGTGCTATGCAGACAATGCTTTTCACTATGCT TAGAAAGTTGGATAATGATGCACTCAACAACATTATCAACAATGCAAGAGATGGTTGTGTTCCCTTGAAC ATAATACCTCTTACAACAGCAGCCAAACTAATGGTTGTCATACCAGACTATAACACATATAAAAATACGT GTGATGGTACAACATTTACTTATGCATCAGCATTGTGGGAAATCCAACAGGTTGTAGATGCAGATAGTAA AATTGTTCAACTTAGTGAAATTAGTATGGACAATTCACCTAATTTAGCATGGCCTCTTATTGTAACAGCT TTAAGGGCCAATTCTGCTGTCAAATTACAGAATAATGAGCTTAGTCCTGTTGCACTACGACAGATGTCTT GTGCTGCCGGTACTACACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACTACAACACAACAAAGGG AGGTAGGTTTGTACTTGCACTGTTATCCGATTTACAGGATTTGAAATGGGCTAGATTCCCTAAGAGTGAT GGAACTGGTACTATCTATACAGAACTGGAACCACCTTGTAGGTTTGTTACAGACACACCTAAAGGTCCTA AAGTGAAGTATTTATACTTTATTAAAGGATTAAACAACCTAAATAGAGGTATGGTACTTGGTAGTTTAGC TGCCACAGTACGTCTACAAGCTGGTAATGCAACAGAAGTGCCTGCCAATTCAACTGTATTATCTTTCTGT GCTTTTGCTGTAGATGCTGCTAAAGCTTACAAAGATTATCTAGCTAGTGGGGGACAACCAATCACTAATT GTGTTAAGATGTTGTGTACACACACTGGTACTGGTCAGGCAATAACAGTTACACCGGAAGCCAATATGGA TCAAGAATCCTTTGGTGGTGCATCGTGTTGTCTGTACTGCCGTTGCCACATAGATCATCCAAATCCTAAA GGATTTTGTGACTTAAAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTA CACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCG CGAACCCATGCTTCAGTCAGCTGATGCACAATCGTTTTTAAACCGGGTTTGCGGTGTAAGTGCAGCCCGT CTTACACCGTGCGGCACAGGCACTAGTACTGATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAG TAGCTGGTTTTGCTAAATTCCTAAAAACTAATTGTTGTCGCTTCCAAGAAAAGGACGAAGATGACAATTT AATTGATTCTTACTTTGTAGTTAAGAGACACACTTTCTCTAACTACCAACATGAAGAAACAATTTATAAT TTACTTAAGGATTGTCCAGCTGTTGCTAAACATGACTTCTTTAAGTTTAGAATAGACGGTGACATGGTAC CACATATATCACGTCAACGTCTTACTAAATACACAATGGCAGACCTCGTCTATGCTTTAAGGCATTTTGA TGAAGGTAATTGTGACACATTAAAAGAAATACTTGTCACATACAATTGTTGTGATGATGATTATTTCAAT AAAAAGGACTGGTATGATTTTGTAGAAAACCCAGATATATTACGCGTATACGCCAACTTAGGTGAACGTG TACGCCAAGCTTTGTTAAAAACAGTACAATTCTGTGATGCCATGCGAAATGCTGGTATTGTTGGTGTACT GACATTAGATAATCAAGATCTCAATGGTAACTGGTATGATTTCGGTGATTTCATACAAACCACGCCAGGT AGTGGAGTTCCTGTTGTAGATTCTTATTATTCATTGTTAATGCCTATATTAACCTTGACCAGGGCTTTAA CTGCAGAGTCACATGTTGACACTGACTTAACAAAGCCTTACATTAAGTGGGATTTGTTAAAATATGACTT CACGGAAGAGAGGTTAAAACTCTTTGACCGTTATTTTAAATATTGGGATCAGACATACCACCCAAATTGT GTTAACTGTTTGGATGACAGATGCATTCTGCATTGTGCAAACTTTAATGTTTTATTCTCTACAGTGTTCC CACTTACAAGTTTTGGACCACTAGTGAGAAAAATATTTGTTGATGGTGTTCCATTTGTAGTTTCAACTGG ATACCACTTCAGAGAGCTAGGTGTTGTACATAATCAGGATGTAAACTTACATAGCTCTAGACTTAGTTTT AAGGAATTACTTGTGTATGCTGCTGACCCTGCTATGCACGCTGCTTCTGGTAATCTATTACTAGATAAAC GCACTACGTGCTTTTCAGTAGCTGCACTTACTAACAATGTTGCTTTTCAAACTGTCAAACCCGGTAATTT TAACAAAGACTTCTATGACTTTGCTGTGTCTAAGGGTTTCTTTAAGGAAGGAAGTTCTGTTGAATTAAAA CACTTCTTCTTTGCTCAGGATGGTAATGCTGCTATCAGCGATTATGACTACTATCGTTATAATCTACCAA CAATGTGTGATATCAGACAACTACTATTTGTAGTTGAAGTTGTTGATAAGTACTTTGATTGTTACGATGG TGGCTGTATTAATGCTAACCAAGTCATCGTCAACAACCTAGACAAATCAGCTGGTTTTCCATTTAATAAA TGGGGTAAGGCTAGACTTTATTATGATTCAATGAGTTATGAGGATCAAGATGCACTTTTCGCATATACAA AACGTAATGTCATCCCTACTATAACTCAAATGAATCTTAAGTATGCCATTAGTGCAAAGAATAGAGCTCG CACCGTAGCTGGTGTCTCTATCTGTAGTACTATGACCAATAGACAGTTTCATCAAAAATTATTGAAATCA ATAGCCGCCACTAGAGGAGCTACTGTAGTAATTGGAACAAGCAAATTCTATGGTGGTTGGCACAACATGT TAAAAACTGTTTATAGTGATGTAGAAAACCCTCACCTTATGGGTTGGGATTATCCTAAATGTGATAGAGC CATGCCTAACATGCTTAGAATTATGGCCTCACTTGTTCTTGCTCGCAAACATACAACGTGTTGTAGCTTG TCACACCGTTTCTATAGATTAGCTAATGAGTGTGCTCAAGTATTGAGTGAAATGGTCATGTGTGGCGGTT CACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTTTTAA CATTTGTCAAGCTGTCACGGCCAATGTTAATGCACTTTTATCTACTGATGGTAACAAAATTGCCGATAAG TATGTCCGCAATTTACAACACAGACTTTATGAGTGTCTCTATAGAAATAGAGATGTTGACACAGACTTTG TGAATGAGTTTTACGCATATTTGCGTAAACATTTCTCAATGATGATACTCTCTGACGATGCTGTTGTGTG TTTCAATAGCACTTATGCATCTCAAGGTCTAGTGGCTAGCATAAAGAACTTTAAGTCAGTTCTTTATTAT CAAAACAATGTTTTTATGTCTGAAGCAAAATGTTGGACTGAGACTGACCTTACTAAAGGACCTCATGAAT TTTGCTCTCAACATACAATGCTAGTTAAACAGGGTGATGATTATGTGTACCTTCCTTACCCAGATCCATC AAGAATCCTAGGGGCCGGCTGTTTTGTAGATGATATCGTAAAAACAGATGGTACACTTATGATTGAACGG TTCGTGTCTTTAGCTATAGATGCTTACCCACTTACTAAACATCCTAATCAGGAGTATGCTGATGTCTTTC ATTTGTACTTACAATACATAAGAAAGCTACATGATGAGTTAACAGGACACATGTTAGACATGTATTCTGT TATGCTTACTAATGATAACACTTCAAGGTATTGGGAACCTGAGTTTTATGAGGCTATGTACACACCGCAT ACAGTCTTACAGGCTGTTGGGGCTTGTGTTCTTTGCAATTCACAGACTTCATTAAGATGTGGTGCTTGCA TACGTAGACCATTCTTATGTTGTAAATGCTGTTACGACCATGTCATATCAACATCACATAAATTAGTCTT GTCTGTTAATCCGTATGTTTGCAATGCTCCAGGTTGTGATGTCACAGATGTGACTCAACTTTACTTAGGA GGTATGAGCTATTATTGTAAATCACATAAACCACCCATTAGTTTTCCATTGTGTGCTAATGGACAAGTTT TTGGTTTATATAAAAATACATGTGTTGGTAGCGATAATGTTACTGACTTTAATGCAATTGCAACATGTGA CTGGACAAATGCTGGTGATTACATTTTAGCTAACACCTGTACTGAAAGACTCAAGCTTTTTGCAGCAGAA ACGCTCAAAGCTACTGAGGAGACATTTAAACTGTCTTATGGTATTGCTACTGTACGTGAAGTGCTGTCTG ACAGAGAATTACATCTTTCATGGGAAGTTGGTAAACCTAGACCACCACTTAACCGAAATTATGTCTTTAC TGGTTATCGTGTAACTAAAAACAGTAAAGTACAAATAGGAGAGTACACCTTTGAAAAAGGTGACTATGGT 26 01 26 GATGCTGTTGTTTACCGAGGTACAACAACTTACAAATTAAATGTTGGTGATTATTTTGTGCTGACATCAC ATACAGTAATGCCATTAAGTGCACCTACACTAGTGCCACAAGAGCACTATGTTAGAATTACTGGCTTATA CCCAACACTCAATATCTCAGATGAGTTTTCTAGCAATGTTGCAAATTATCAAAAGGTTGGTATGCAAAAG TATTCTACACTCCAGGGACCACCTGGTACTGGTAAGAGTCATTTTGCTATTGGCCTAGCTCTCTACTACC CTTCTGCTCGCATAGTGTATACAGCTTGCTCTCATGCCGCTGTTGATGCACTATGTGAGAAGGCATTAAA ATATTTGCCTATAGATAAATGTAGTAGAATTATACCTGCACGTGCTCGTGTAGAGTGTTTTGATAAATTC AAAGTGAATTCAACATTAGAACAGTATGTCTTTTGTACTGTAAATGCATTGCCTGAGACGACAGCAGATA TAGTTGTCTTTGATGAAATTTCAATGGCCACAAATTATGATTTGAGTGTTGTCAATGCCAGATTACGTGC TAAGCACTATGTGTACATTGGCGACCCTGCTCAATTACCTGCACCACGCACATTGCTAACTAAGGGCACA CTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAA CTTGTCGGCGTTGTCCTGCTGAAATTGTTGACACTGTGAGTGCTTTGGTTTATGATAATAAGCTTAAAGC ACATAAAGACAAATCAGCTCAATGCTTTAAAATGTTTTATAAGGGTGTTATCACGCATGATGTTTCATCT GCAATTAACAGGCCACAAATAGGCGTGGTAAGAGAATTCCTTACACGTAACCCTGCTTGGAGAAAAGCTG TCTTTATTTCACCTTATAATTCACAGAATGCTGTAGCCTCAAAGATTTTGGGACTACCAACTCAAACTGT TGATTCATCACAGGGCTCAGAATATGACTATGTCATATTCACTCAAACCACTGAAACAGCTCACTCTTGT AATGTAAACAGATTTAATGTTGCTATTACCAGAGCAAAAGTAGGCATACTTTGCATAATGTCTGATAGAG ACCTTTATGACAAGTTGCAATTTACAAGTCTTGAAATTCCACGTAGGAATGTGGCAACTTTACAAGCTGA AAATGTAACAGGACTCTTTAAAGATTGTAGTAAGGTAATCACTGGGTTACATCCTACACAGGCACCTACA CACCTCAGTGTTGACACTAAATTCAAAACTGAAGGTTTATGTGTTGACATACCTGGCATACCTAAGGACA TGACCTATAGAAGACTCATCTCTATGATGGGTTTTAAAATGAATTATCAAGTTAATGGTTACCCTAACAT GTTTATCACCCGCGAAGAAGCTATAAGACATGTACGTGCATGGATTGGCTTCGATGTCGAGGGGTGTCAT GCTACTAGAGAAGCTGTTGGTACCAATTTACCTTTACAGCTAGGTTTTTCTACAGGTGTTAACCTAGTTG CTGTACCTACAGGTTATGTTGATACACCTAATAATACAGATTTTTCCAGAGTTAGTGCTAAACCACCGCC TGGAGATCAATTTAAACACCTCATACCACTTATGTACAAAGGACTTCCTTGGAATGTAGTGCGTATAAAG ATTGTACAAATGTTAAGTGACACACTTAAAAATCTCTCTGACAGAGTCGTATTTGTCTTATGGGCACATG GCTTTGAGTTGACATCTATGAAGTATTTTGTGAAAATAGGACCTGAGCGCACCTGTTGTCTATGTGATAG ACGTGCCACATGCTTTTCCACTGCTTCAGACACTTATGCCTGTTGGCATCATTCTATTGGATTTGATTAC GTCTATAATCCGTTTATGATTGATGTTCAACAATGGGGTTTTACAGGTAACCTACAAAGCAACCATGATC TGTATTGTCAAGTCCATGGTAATGCACATGTAGCTAGTTGTGATGCAATCATGACTAGGTGTCTAGCTGT CCACGAGTGCTTTGTTAAGCGTGTTGACTGGACTATTGAATATCCTATAATTGGTGATGAACTGAAGATT AATGCGGCTTGTAGAAAGGTTCAACACATGGTTGTTAAAGCTGCATTATTAGCAGACAAATTCCCAGTTC TTCACGACATTGGTAACCCTAAAGCTATTAAGTGTGTACCTCAAGCTGATGTAGAATGGAAGTTCTATGA TGCACAGCCTTGTAGTGACAAAGCTTATAAAATAGAAGAATTATTCTATTCTTATGCCACACATTCTGAC AAATTCACAGATGGTGTATGCCTATTTTGGAATTGCAATGTCGATAGATATCCTGCTAATTCCATTGTTT GTAGATTTGACACTAGAGTGCTATCTAACCTTAACTTGCCTGGTTGTGATGGTGGCAGTTTGTATGTAAA TAAACATGCATTCCACACACCAGCTTTTGATAAAAGTGCTTTTGTTAATTTAAAACAATTACCATTTTTC TATTACTCTGACAGTCCATGTGAGTCTCATGGAAAACAAGTAGTGTCAGATATAGATTATGTACCACTAA AGTCTGCTACGTGTATAACACGTTGCAATTTAGGTGGTGCTGTCTGTAGACATCATGCTAATGAGTACAG ATTGTATCTCGATGCTTATAACATGATGATCTCAGCTGGCTTTAGCTTGTGGGTTTACAAACAATTTGAT ACTTATAACCTCTGGAACACTTTTACAAGACTTCAGAGTTTAGAAAATGTGGCTTTTAATGTTGTAAATA AGGGACACTTTGATGGACAACAGGGTGAAGTACCAGTTTCTATCATTAATAACACTGTTTACACAAAAGT TGATGGTGTTGATGTAGAATTGTTTGAAAATAAAACAACATTACCTGTTAATGTAGCATTTGAGCTTTGG GCTAAGCGCAACATTAAACCAGTACCAGAGGTGAAAATACTCAATAATTTGGGTGTGGACATTGCTGCTA ATACTGTGATCTGGGACTACAAAAGAGATGCTCCAGCACATATATCTACTATTGGTGTTTGTTCTATGAC TGACATAGCCAAGAAACCAACTGAAACGATTTGTGCACCACTCACTGTCTTTTTTGATGGTAGAGTTGAT GGTCAAGTAGACTTATTTAGAAATGCCCGTAATGGTGTTCTTATTACAGAAGGTAGTGTTAAAGGTTTAC AACCATCTGTAGGTCCCAAACAAGCTAGTCTTAATGGAGTCACATTAATTGGAGAAGCCGTAAAAACACA GTTCAATTATTATAAGAAAGTTGATGGTGTTGTCCAACAATTACCTGAAACTTACTTTACTCAGAGTAGA AATTTACAAGAATTTAAACCCAGGAGTCAAATGGAAATTGATTTCTTAGAATTAGCTATGGATGAATTCA TTGAACGGTATAAATTAGAAGGCTATGCCTTCGAACATATCGTTTATGGAGATTTTAGTCATAGTCAGTT AGGTGGTTTACATCTACTGATTGGACTAGCTAAACGTTTTAAGGAATCACCTTTTGAATTAGAAGATTTT ATTCCTATGGACAGTACAGTTAAAAACTATTTCATAACAGATGCGCAAACAGGTTCATCTAAGTGTGTGT GTTCTGTTATTGATTTATTACTTGATGATTTTGTTGAAATAATAAAATCCCAAGATTTATCTGTAGTTTC TAAGGTTGTCAAAGTGACTATTGACTATACAGAAATTTCATTTATGCTTTGGTGTAAAGATGGCCATGTA GAAACATTTTACCCAAAATTACAATCTAGTCAAGCGTGGCAACCGGGTGTTGCTATGCCTAATCTTTACA AAATGCAAAGAATGCTATTAGAAAAGTGTGACCTTCAAAATTATGGTGATAGTGCAACATTACCTAAAGG CATAATGATGAATGTCGCAAAATATACTCAACTGTGTCAATATTTAAACACATTAACATTAGCTGTACCC TATAATATGAGAGTTATACATTTTGGTGCTGGTTCTGATAAAGGAGTTGCACCAGGTACAGCTGTTTTAA GACAGTGGTTGCCTACGGGTACGCTGCTTGTCGATTCAGATCTTAATGACTTTGTCTCTGATGCAGATTC AACTTTGATTGGTGATTGTGCAACTGTACATACAGCTAATAAATGGGATCTCATTATTAGTGATATGTAC GACCCTAAGACTAAAAATGTTACAAAAGAAAATGACTCTAAAGAGGGTTTTTTCACTTACATTTGTGGGT TTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGA TCTTTATAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCT GAAGCATTTTTAATTGGATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATG CAAATTACATATTTTGGAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAA ATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTA TCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTG TTAACAACTAA 26 01 26

[0060] In some embodiments, such pathogens are a vims from a plant, an animal, a bacterium, or an archaeon. Additional viruses contemplated herein include, but are not limited to, viruses comprising nucleic acid components of vegetable mosaic viruses (tomato mosaic vims, tobacco mosaic vims, cucumber mosaic vims), and vimses related to common animal diseases, including rabies vims. Similarly contemplated as nucleic acids within the current disclosure are viroids and subviral pathogens such as hepatitis delta RNA, citms exocortis viroid, columnea latent viroid, pepper chat fruit viroid, potato spindle tuber viroid, tomato chlorotic dwarf viroid, coconut cadang-cadang viroid, and tomato apical stunt viroid, and the like.

[0061] In some embodiments, such pathogens are a vims comprising an RNA vims or a DNA vims. In some embodiments, such RNA or DNA vims is single-stranded or double-stranded. In some embodiments, such RNA or DNA vims is a negative-sense or a positive-sense vims.

[0062] In some embodiments, such pathogens are a vims comprising single-stranded DNA (ssDNA). Such vims comprising single-stranded DNA is from the family of Anelloviridae, Bacillariodnaviridae, Bidnaviridae, Circoviridae, Geminiviridae, Inoviridae, Microviridae, Nanoviridae, Parvoviridae, and Spiraviridae.

[0063] In some embodiments, such pathogens are a vims comprising double-stranded DNA (dsDNA). Such vims comprising double-stranded DNA is from the family of Adenoviridae, Alloherpesviridae, Ampullaviridae, Ascoviridae, Asfaviridae, Baculoviridae, Bicaudaviridae, Clavaviridae, Corticoviridae, Fuselloviridae, Globuloviridae, Guttaviridae, Herpesviridae, Hytrosaviridae, Iridoviridae, Lipothrixviridae, Malacoherpesviridae, Marseilleviridae, Mimiviridae, Myoviridae, Nimaviridae, Pandoraviridae, Papillomaviridae, Phycodnaviridae, Plasmaviridae, Podoviridae, Polydnavimses, Polyomaviridae, Poxviridae, Rudiviridae, Siphoviridae, Tectiviridae, Sphaerolipoviridae, and the like.

[0064] In some embodiments, such pathogens are a vims comprising both ssDNA and dsDNA regions. Such vims comprising both ssDNA and ds DNA regions is from the family of Pleolipovimses comprising Haloarcula hispanica pleomorphic vims 1, Halogeometricum pleomorphic vims 1, Halombmm pleomorphic vims 1, Halombmm pleomorphic vims 2, Halombmm pleomorphic vims 3, Halombmm pleomorphic vims 6, and the like.

[0065] In some embodiments, such pathogens are a vims comprising double-stranded RNA (dsRNA). Such vims comprising double-stranded RNA is from the family comprising Bimaviridae, Chrysoviridae, Cystoviridae, Endomaviridae, Hypoviridae, Megavimaviridae, Partitiviridae, Picobimaviridae, Reoviridae, Rotavims, Totiviridae, and the like.

[0066] In some embodiments, such pathogens are a vims comprising the negative-sense RNA. Such vims comprising negative-sense RNA vims is from the family of Arenaviridae, Bomaviridae, 26 01 26 Bunyaviridae, Filoviridae, Nyamiviridae, Ophioviridae, Orthomyxoviridae, Paramyxoviridae, Rhabdoviridae, and the like.

[0067] In some embodiments, such pathogens are a vims comprising the positive-sense RNA. Such vims comprising the positive-sense RNA is from the family of Alphaflexiviridae, Alphatetraviridae, Alvemaviridae, Arteriviridae, Astroviridae, Bamaviridae, Betaflexiviridae, Bromoviridae, Caliciviridae, Carmotetraviridae, Closteroviridae, Coronaviridae, Dicistroviridae, Flaviviridae, Gammaflexiviridae, Iflaviridae, Leviviridae, Luteoviridae, Mamaviridae, Mesoniviridae, Namaviridae, Nodaviridae, Permutotetraviridae, Picomaviridae, Potyviridae, Roniviridae, Secoviridae, Togaviridae, Tombusviridae, Tymoviridae, Virgaviridae, and the like. Target nucleic acid molecules

[0068] The disclosed methods and systems may be used to detect any of a variety of target nucleic acid molecules (sometimes referred to as "analytes"). Examples include, but are not limited to, DNA molecules or fragments thereof, genomic DNA or fragments thereof, mitochondrial DNA or fragments thereof, chromosomal DNA or fragments thereof, plasmid DNA or fragments thereof, gene sequences or fragments thereof, exon sequences or fragments thereof, intron sequences or fragments thereof, bacterial DNA or fragments thereof, viral DNA or fragments thereof, RNA molecules or fragments thereof, mRNA molecules or fragments thereof, tRNA molecules or fragments thereof, rRNA molecules or fragments thereof, bacterial RNA or fragments thereof, viral RNA or fragments thereof, and the like, or any combination thereof. Samples

[0069] The disclosed methods and systems may be used to detect target nucleic acid molecules in any of a variety of samples. Non-limiting examples of a sample include, but are not limited to, tissue samples, cell suspension samples, surgical resection samples, biopsy samples, nasopharyngeal swab samples, sputum samples, bronchoalveolar lavage fluid samples, blood samples, urine samples, feces samples, or any combination thereof. In some embodiments, the sample is obtained from soil, sewage, biological tissue, food, a surface of an object in contact with one or more of the preceding samples, or any combination thereof. In some embodiments, multiple samples are obtained at different time points, or at different locations, or both. In such an embodiment, a presence of the target nucleic acid (e.g., derived from a pathogen disclosed herein) is indicative of a spread of infection by the pathogen. In some embodiments, processing of samples may be required for extraction and purification of the target nucleic acid molecules of interest. Bar coding assay workflow

[0070] Padlock (or molecular inversion) probes comprising target nucleic acid-specific recognition sequences, e.g., COVID-19 locus specific sequences, are designed and synthesized. 26 01 26 Each padlock probe includes a locus-specific probe barcode positioned in the non-targeting region of the probe molecule. Upon recognition of the target sequence, the padlock probe will hybridize to the target, generating a circularizable intermediate that can then be fully circularized through ligation. Optionally, any remaining unreacted probe molecules or linear sample nucleic acid molecules, e.g., DNA, can be then digested by an exonuclease, leaving a number of circularized probes proportional to the number of target nucleic acid molecules, e.g., viral RNA molecules, where each species of circularized probe in a multiplexed assay is identifiable by the probe barcode inserted therein. Sample-indexed rolling circle amplification (RCA) is then performed (e.g., using amplification primers comprising a unique sample barcode sequence) to generate concatemer molecules comprising multiple copies of the circularized probe sequences.

[0071] Fig. 5 illustrates an example of a workflow for the disclosed barcoded padlock probe or molecular inversion probe assays. The use of several different probe pools, each identified by a unique probe barcode, allows one to perform multiplexed testing for detection of multiple targets or diseases. An isothermal padlock assay followed by indexed RCA may be executed in less than, for example, 1 hour. The resulting concatemer molecules are then be condensed into nanoballs and loaded into a sequencing flow cell. The barcodes and indexes may then be sequenced using, e.g., 15 sequencing cycles, thereby providing for rapid sequencing data readout (in, e.g., approximately 75 min). Sample index demultiplexing and probe barcode counting provides a yes / no answer for the presence of the target nucleic acid in a given sample with high precision due to the large number of probe barcodes counted for each sample. Viral titer data is also accessible since the number of probe barcodes counted will be proportional to the number of viral copies that were present in the sample.

[0072] The proposed barcoding methods can be implemented for introducing both sample indexes for multiplexed sample processing or unique probe barcodes to identify the specific locus targeted by a given probe, thereby enabling assay multiplexing. Besides sample multiplexing, the disclosed methods enable assays that can target multiple sites within the genome of an infectious disease agent (e.g., the CO VID-19 genome), thereby increasing the specificity of the assay (e.g., a COVID-19 assay) and allowing for the identification of multiple strains. Sample processing and DNA extraction

[0073] In some instances, samples may require processing to extract the target nucleic acid molecules of interest. Any of a variety of existing sample processing and nucleic acid extraction techniques may be utilized.

[0074] In some embodiments, DNA extraction comprises: (i) collection of the sample (e.g., a swab sample, a cell sample, a blood sample, or tissue sample) from which the DNA is to be extracted; (ii) 26 01 26 disruption of cell membranes (e.g., cell lysis) to release DNA and other cytoplasmic components in the presence of a lysis buffer; (iii) treatment of the lysed sample with a concentrated salt solution to precipitate proteins, lipids, and RNA followed by centrifugation to separate out the precipitated proteins, lipids, and RNA; and (iv) purification of DNA from the supernatant to remove detergents, proteins, salts, or other reagents used during the cell membrane lysis step.

[0075] Disruption of cell membranes for DNA (or RNA) extraction may be performed using a variety of mechanical shear (e.g., by passing through a French press or fine needle), bead-based disruption, or ultrasonic disruption techniques. The cell lysis step often comprises the use of detergents and surfactants to solubilize lipids the cellular and nuclear membranes. In some instances, the lysis step may further comprise use of proteases to break down protein, or the use of an RNase for digestion of RNA in the sample.

[0076] Examples of existing techniques for DNA purification include, but are not limited, to (i) precipitation in ice-cold ethanol or isopropanol followed by centrifugation (precipitation of DNA may be enhanced by increasing ionic strength, e.g., by addition of sodium acetate); (ii) phenolchloroform extraction followed by centrifugation to separate the aqueous phase containing the nucleic acid from the organic phase containing denatured protein; and (iii) solid phase chromatography where the nucleic acids adsorb to the solid phase (e.g., silica or other) depending on the pH and salt concentration of the buffer.

[0077] In some instances, cellular and histone proteins bound to the DNA may be removed either by adding a protease or by having precipitated the proteins with sodium or ammonium acetate or through extraction with a phenol-chloroform mixture prior to a DNA precipitation step.

[0078] In some instances, DNA may be extracted using any of a variety of commercial DNA extraction and purification kits. Examples include, but are not limited to, the QIAamp (for isolation of genomic DNA from human samples) and DNAeasy kits (for isolation of genomic DNA from animal or plant samples) from Qiagen (Germantown, MD) or the Maxwell® and ReliaPrepTM series of kits from Promega (Madison, WI).

[0079] After isolation, the DNA is dissolved in a slightly alkaline buffer, e.g., Tris-EDTA (TE) buffer, or in ultra-pure water. Additional DNA fragmentation, if necessary, may be performed using mechanical fragmentation (e.g., using sonication, needle shear, nebulization, point-sink shearing, or passage through a pressure cell) or enzymatic digestion techniques (e.g., with the use of restriction enzymes or endonucleases). Sample processing and RNA extraction

[0080] An existing RNA extraction procedure comprises: (i) collection of a sample (e.g., a swab sample, a cell sample, a blood sample, or tissue sample) from which the RNA is to be extracted; 26 01 26 (ii) optionally, protection and freezing of the sample for later processing, where an RNA stabilization reagent, such as the Invitrogen™ RNAlater™ and Invitrogen™ RNAlater™-ICE RNA stabilization solutions, may be used to stabilize the RNA in the sample for later purification; (iii) RNA extraction using, e.g., organic extraction methods, spin basket formats, magnetic particle methods, and direct lysis methods.

[0081] Organic extraction methods are widely used for RNA preparation. The sample is homogenized in, e.g., a phenol-containing solution and then centrifuged to yield three separate phases: a lower organic phase, a middle phase that contains denatured proteins and genomic DNA, and an upper aqueous phase that contains the RNA. The upper aqueous phase is recovered, and RNA is collected by alcohol precipitation and rehydration. Although the organic extraction methods provide for rapid denaturation of nucleases and stabilization of RNA in a scalable format, these methods, comprising the use of chlorinated organic reagents, may be labor-intensive and can be difficult to automate.

[0082] Filter-based, spin basket RNA preparation techniques utilize glass fiber, derivatized silica, or ion exchange membranes seated at the bottom of a small plastic basket. Samples are lysed in a buffer that contains RNase inhibitors (e.g., guanidine salts), and nucleic acids are bound to the membrane by passing the lysate through the membrane using centrifugal force or applied vacuum followed by several wash steps. An elution solution is then applied, and the extracted RNA is collected into a tube by centrifugation. Some methods combine the use of organic extraction with the sample collection, washing, and elution steps of a spin basket format. Spin-basket techniques for RNA extraction are convenient and easy to use, amenable to processing of sample in both single-sample and 96-well formats, and relatively easy to automate. Drawbacks include a propensity of the fdter material to clog with particulates, the retention of large nucleic acid molecules such as genomic DNA, and fixed binding capacity within a manufactured format.

[0083] Magnetic particle extraction methods utilize small (0.5-1 pm diameter) particles that contain a paramagnetic core and surrounding shell that has been modified to bind to molecules of interest. Paramagnetic particles migrate in an applied magnetic field, but they retain minimal magnetic memory once the field is removed. This phenomenon allows the magnetic particles to interact with the molecules of interest in solution based on their surface modification, to be collected rapidly using an external magnetic field, and then to be easily resuspended once the field is removed. Samples are lysed in a solution comprising RNase inhibitors and allowed to bind to the magnetic particles. The magnetic particles and associated RNA may be collected by applying a magnetic field and subjected to several rounds of release, resuspension in wash solutions, and recapture, following which the RNA is released into an elution buffer, and the magnetic particles 26 01 26 are removed. One of the advantages of magnetic particle extraction techniques is that the solutionbased binding kinetics increase the efficiency of target capture. The magnetic bead format also allows for rapid collection / concentration of sample RNA (or other biomolecules depending on the bead surface; there are a wide variety of surface chemistries available) and is amenable to automation. Potential drawbacks include carry-through of magnetic particles into eluted samples, slow migration of magnetic particles in viscous solutions, and laborious capture / release steps when performed manually.

[0084] Direct lysis methods perform sample preparation (not purification) by utilizing lysis buffer formulations that disrupt samples, stabilize nucleic acids, and are compatible with downstream analysis. A sample is mixed with a lysis agent and incubated for a specified time under specified conditions. In some instances, the lysate may be used directly for downstream analysis. In many instances, the samples, e.g., RNA samples, may be purified from stabilized lysates, e.g., using magnetic beads, spin filter baskets, or other existing techniques. By eliminating the need to bind and elute from solid surfaces, direct lysis methods may avoid sample bias and recovery efficiency effects that may occur when using other extraction / purification methods. Directly lysis methods are fast, compatible with small samples, amenable to automation, and provide the highest potential for accurate representation of the distribution of RNA species within the sample. Potential drawbacks of direct lysis methods may include significant dilution of the sample, incompatibility with existing analytical methods such as spectrophotometric measurements of yield, and sample degradation due to residual RNase activity if lysates are not handled properly, and the like. Fragmenting nucleic acid molecules

[0085] Provided here, in some embodiments, are methods for fragmenting a nucleic acid that has been obtained. In some embodiments, fragmenting comprises at least one of shearing, sonicating, restriction digesting, sequence specific endonuclease treatment, sequence-independent endonuclease treatment and chemical digesting, as well as other shearing approaches. Various shearing options include acoustic shearing, point-sink shearing, and needle shearing. In some steps, the restriction digesting is the intentional sequence specific breaking of nucleic acid molecules. One type of the restriction digesting is an enzyme-based treatment to fragment the double-stranded nucleic acid molecules either by the simultaneous cleavage of both strands, or by generation of nicks on each strand of the double-stranded nucleic acid molecules to produce double-stranded nucleic acid molecules breaks. One type of sonication subject nucleic acid molecules to acoustic cavitation and hydrodynamic shearing by exposure to brief periods of sonication. As one type of shearing, the acoustic shearing transmits high-frequency acoustic energy waves to nucleic acid molecules. As another type of shearing, the point-sink 44 26 01 26 shearing uses a syringe pump to create hydrodynamic shear forces by pushing a nucleic acid library through a small abrupt contraction. As yet another type of shearing, the needle shearing creates shearing forces by passing DNA libraries through small gauge needle. After the fragmenting, some of the double-stranded nucleic acid fragments contain a region of a nucleic acid sequence with at least about 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 300, 350, 400, 450, 500, 550, 600 bp or more. In some cases, after the fragmenting, some of the doublestranded nucleic acid fragments contain a region of a nucleic acid sequence with less than about 20.

[0086] In some embodiments, the fragmenting further comprises end repair, sticky end generation, and overhang generation. One type of the overhang generation comprises 5’ end generation. One type of the overhang generation comprises 3’ end generation. Some of the steps, such as end repair, sticky end generation, or overhang generation are performed in a tube. Some of the steps, such as end repair, sticky end generation, or overhang generation are performed with a solution containing the doublestranded nucleic acid fragments, end repair buffer, and end repair enzyme.

[0087] In some embodiments, the fragmenting further comprises end repair, sticky end generation, and overhang generation. One type of the overhang generation comprises 5’ end generation. One type of the overhang generation comprises 3’ end generation. Some of the steps, such as end repair, sticky end generation, or overhang generation are performed in a tube. Some of the steps, such as end repair, sticky end generation, or overhang generation are performed with a solution containing the doublestranded nucleic acid fragments, end repair buffer, and end repair enzyme. Immobilizing fragmented nucleic acid molecules to surface

[0088] Provided herein, in some embodiments, are methods of immobilizing the fragmented nucleic acid molecules to a surface described herein. In some embodiments, the surface is a low non-specific binding surface, such as a hydrophilic surface. In some embodiments, the immobilizing comprises hybridizing a surface-bound capture nucleic acid molecule with at least a portion of the fragmented nucleic acid molecules (serving as a template for the sequencing reaction). Capture nucleic acid molecule

[0089] In general, at least one layer of one or more layers of low non-specific binding material may comprise functional groups for covalently or non-covalently attaching nucleic acid molecules, e.g., adapter or primer sequences, or the at least one layer may already comprise covalently or non-covalently attached nucleic acid adapter or primer sequences at the time that it is deposited on the support surface. In some instances, the nucleic acid adaptor or primer sequences tethered to the polymer molecules of at least one third layer may be distributed at a plurality of depths throughout the layer. 26 01 26

[0090] In some instances, the nucleic acid adapter or primer molecules are covalently coupled to the polymer in solution, that is, prior to coupling or depositing the polymer on the surface. In some instances, the nucleic acid adapter or primer molecules are covalently coupled to the polymer after it has been coupled to or deposited on the surface. In some instances, at least one hydrophilic polymer layer comprises a plurality of covalently attached oligonucleotide adapter or primer molecules. In some instances, at least two, at least three, at least four, or at least five layers of hydrophilic polymer comprise a plurality of covalently attached adapter or primer molecules.

[0091] In some instances, the nucleic acid adapter or primer molecules may be coupled to the one or more layers of hydrophilic polymer using any of a variety of conjugation chemistries. For example, the oligonucleotide adapter or primer sequences may comprise moieties that are reactive with amine groups, carboxyl groups, thiol groups, and the like. Examples of amine-reactive conjugation chemistries that may be used include, but are not limited to, reactions involving isothiocyanate, isocyanate, acyl azide, NHS ester, sulfonyl chloride, aldehyde, glyoxal, epoxide, oxirane, carbonate, aryl halide, imidoester, carbodiimide, anhydride, and fluorophenyl ester groups. Examples of carboxylreactive conjugation chemistries include, but are not limited to, reactions involving carbodiimide compounds, e.g., water soluble EDC (l-ethyl-3-(3-dimethylaminopropyl)carbodiimideHCL). Examples of sulfydryl-reactive conjugation chemistries include maleimides, haloacetyls and pyridyl disulfides.

[0092] One or more types of nucleic acid molecules may be attached or tethered to the support surface. In some instances, the one or more types of oligonucleotide adapters or primers may comprise spacer sequences, adapter sequences for hybridization to adapter-ligated template library nucleic acid sequences, forward amplification primers, reverse amplification primers, sequencing primers, molecular barcoding sequences, or any combination thereof. In some instances, 1 primer or adapter sequence may be tethered to at least one layer of the surface. In some instances, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 different primer or adapter sequences may be tethered to at least one layer of the surface.

[0093] In some instances, the tethered nucleic acid adapter or primer sequences may range in length from about 10 nucleotides to about 100 nucleotides. In some instances, the tethered oligonucleotide adapter or primer sequences may be at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 nucleotides in length. In some instances, the tethered oligonucleotide adapter or primer sequences may be at most 100, at most 90, at most 80, at most 70, at most 60, at most 50, at most 40, at most 30, at most 20, or at most 10 nucleotides in length. Any of the lower and upper values described in this paragraph may be combined to form a range included within the present disclosure, for example, in some instances the length of the tethered oligonucleotide adapter or primer sequences may range from about 20 nucleotides to about 80 26 01 26 nucleotides. In an example, the length of the tethered oligonucleotide adapter or primer sequences may have any value within this range, e.g., about 24 nucleotides.

[0094] In some instances, the resultant surface density of primers on the low binding support surfaces of the present disclosure may range from about 100 primer molecules per pm2 to about 100,000 primer molecules per pm2. In some instances, the resultant surface density of primers on the low binding support surfaces of the present disclosure may range from about 1,000 primer molecules per pm2 to about 1,000,000 primer molecules per pm2. In some instances, the surface density of primers may be at least 1,000, at least 10,000, at least 100,000, or at least 1,000,000 molecules per pm2. In some instances, the surface density of primers may be at most 1,000,000, at most 100,000, at most 10,000, or at most 1,000 molecules per pm2. Any of the lower and upper values described in this paragraph may be combined to form a range included within the present disclosure, for example, in some instances the surface density of primers may range from about 10,000 molecules per pm2 to about 100,000 molecules per pm2. In some instances, the surface density of primer molecules may have any value within this range, e.g., about 455,000 molecules per pm2. In some instances, the surface density of target library nucleic acid sequences initially hybridized to adapter or primer sequences on the support surface may be less than or equal to that indicated for the surface density of tethered primers. In some instances, the surface density of clonally amplified target library nucleic acid sequences hybridized to adapter or primer sequences on the support surface may span the same range as that indicated for the surface density of tethered primers. In some instances, the surface properties of the capillary or channel lumen coating, including the surface density of tethered oligonucleotide primers, may be adjusted so as to optimize, e.g., solid-phase nucleic acid hybridization specificity and efficiency or solid-phase nucleic acid amplification rate, specificity, and efficiency.

[0095] Local densities as listed above do not preclude variation in density across a surface, such that a surface may comprise a region having an oligo density of, for example, 500,000 / pm2, while also comprising at least a second region having a substantially different local density.

[0096] In some instances, the tethered adapter or primer sequences may comprise modifications designed to facilitate the specificity and efficiency of nucleic acid amplification as performed on the low-binding supports. For example, in some instances the primer may comprise polymerase stop points such that the stretch of primer sequence between the surface conjugation point and the modification site is always in single-stranded form and functions as a loading site for 5’ to 3’ helicases in some helicasedependent isothermal amplification methods. Other examples of primer modifications that may be used to create polymerase stop points include, but are not limited to, an insertion of a PEG chain into the backbone of the primer between two nucleotides towards the 5 ’ end, insertion of an abasic nucleotide 26 01 26 (that is, a nucleotide that has neither a purine nor a pyrimidine base), or a lesion site which can be bypassed by the helicase.

[0097] As will be discussed further in the examples below, it may be desirable to vary the surface density of tethered oligonucleotide adapters or primers on the support surface or the spacing of the tethered adapter or primers away from the support surface (e.g., by varying the length of a linker molecule used to tether the adapter or primers to the surface) in order to “tune” the support for optimal performance when using a given amplification method. As noted below, adjusting the surface density of tethered oligonucleotide adapters or primers may impact the level of specific or non-specific amplification observed on the support in a manner that varies according to the amplification method selected. In some instances, the surface density of tethered nucleic acid adapters or primers may be varied by adjusting the ratio of molecular components used to create the support surface. For example, in the case that an nucleic acid primer - PEG conjugate is used to create the outer layer of a low-binding support, the ratio of the oligonucleotide primer - PEG conjugate to a non-conjugated PEG molecule may be varied. The resulting surface density of tethered primer molecules may then be estimated or measured using any of a variety of techniques. Examples include, but are not limited to, the use of radioisotope labeling and counting methods, covalent coupling of a cleavable molecule that comprises an optically-detectable tag (e.g., a fluorescent tag) that may be cleaved from a support surface of defined area, collected in a fixed volume of an appropriate solvent, and then quantified by comparison of fluorescence signals to that for a calibration solution of known optical tag concentration, or using fluorescence imaging techniques provided that care has been taken with the labeling reaction conditions and image acquisition settings to ensure that the fluorescence signals are linearly related to the number of fluorophores on the surface (e.g., that there is no significant self-quenching of the fluorophores on the surface).

[0098] In some instances, the resultant surface density of nucleic acid adapters or primers on the low binding support surfaces of the present disclosure may range from about 100 primer molecules per pm2 to about 1,000,000 primer molecules per pm2. In some instances, the surface density of oligonucleotide adapters or primers may be at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1,000, at least 1,500, at least 2,000, at least 2,500, at least 3,000, at least 3,500, at least 4,000, at least 4,500, at least 5,000, at least 5,500, at least 6,000, at least 6,500, at least 7,000, at least 7,500, at least 8,000, at least 8,500, at least 9,000, at least 9,500, at least 10,000, at least 15,000, at least 20,000, at least 25,000, at least 30,000, at least 35,000, at least 40,000, at least 45,000, at least 50,000, at least 55,000, at least 60,000, at least 65,000, at least 70,000, at least 75,000, at least 80,000, at least 85,000, at least 90,000, at least 95,000, at least 100,000, at least 150,000, at least 200,000, at least 250,000, at least 300,000, at least 350,000, at least 400,000, at least 26 01 26 450,000, at least 500,000, at least 550,000, at least 600,000, at least 650,000, at least 700,000, at least 750,000, at least 800,000, at least 850,000, at least 900,000, at least 950,000, or at least 1,000,000 molecules per pm2. In some instances, the surface density of oligonucleotide adapters or primers may be at most 1,000,000, at most 950,000, at most 900,000, at most 850,000, at most 800,000, at most 750,000, at most 700,000, at most 650,000, at most 600,000, at most 550,000, at most 500,000, at most 450,000, at most 400,000, at most 350,000, at most 300,000, at most 250,000, at most 200,000, at most 150,000, at most 100,000, at most 95,000, at most 90,000, at most 85,000, at most 80,000, at most 75,000, at most 70,000, at most 65,000, at most 60,000, at most 55,000, at most 50,000, at most 45,000, at most 40,000, at most 35,000, at most 30,000, at most 25,000, at most 20,000, at most 15,000, at most 10,000, at most 9,500, at most 9,000, at most 8,500, at most 8,000, at most 7,500, at most 7,000, at most 6,500, at most 6,000, at most 5,500, at most 5,000, at most 4,500, at most 4,000, at most 3,500, at most 3,000, at most 2,500, at most 2,000, at most 1,500, at most 1,000, at most 900, at most 800, at most 700, at most 600, at most 500, at most 400, at most 300, at most 200, or at most 100 molecules per pm2. Any of the lower and upper values described in this paragraph may be combined to form a range included within the present disclosure, for example, in some instances the surface density of adapters or primers may range from about 10,000 molecules per pm2 to about 100,000 molecules per pm2. The surface density of adapter or primer molecules may have any value within this range, e.g., about 3,800 molecules per pm2 in some instances, or about 455,000 molecules per pm2 in other instances. In some instances, as will be discussed further below, the surface density of template library nucleic acid sequences (e.g., sample DNA molecules) initially hybridized to adapter or primer sequences on the support surface may be less than or equal to that indicated for the surface density of tethered nucleic acid primers. In some instances, as will also be discussed further below, the surface density of clonally-amplified template library nucleic acid sequences hybridized to adapter or primer sequences on the support surface may span the same range or a different range as that indicated for the surface density of tethered oligonucleotide adapters or primers.

[0099] In some embodiments, nucleic acids in a library are coupled to a surface (e.g., low non-specific binding surface). In some embodiments, the coupling is performed by way of hybridization between a region of the nucleic acid molecule and a region of a capture molecule coupled to the surface. Unless noted otherwise, hybridization may occur between nucleic acids of any length and the hybridized nucleic acid may take on one or a combination of many structural forms, including, but not limited to: the B-form, the A-form, Z-form, stem loop, pseudoknot, or other hybridization structures formed by base-pairing interactions between two or more single-stranded nucleic acids. In some embodiments, hybridization occurs between two single-stranded nucleic acids of any length. In some embodiments, hybridization occurs between a single-stranded linear nucleic acid and a single-stranded linear nucleic 26 01 26 acid. In some embodiments, hybridization occurs between a single-stranded linear nucleic acid and a single-stranded circularized nucleic acid. In some embodiments, hybridization occurs between a singlestranded circularized nucleic acid and a single-stranded circularized nucleic acid. In some embodiments, hybridization occurs between a DNA molecule and a DNA molecule. In some embodiments, hybridization occurs between a DNA molecule and an RNA molecule. In some embodiments, hybridization occurs between an RNA molecule and an RNA molecule. In some embodiments, hybridization occurs between a DNA molecule and a DNA / RNA hybrid molecule. In some embodiments, hybridization occurs between an RNA molecule and a DNA / RNA hybrid molecule. In some embodiments, hybridization occurs between a DNA / RNA hybrid molecule and a DNA / RNA hybrid molecule.

[00100] In some embodiments, a nucleic acid molecule of the library is coupled to the surface by hybridization between a nucleic acid sequence of the nucleic acid molecule and one or more capture nucleic acid molecules coupled the surface. In some embodiments, the one or more capture nucleic acid molecules is a splint nucleic acid molecule described herein and facilitates circularization of the nucleic acid molecule on the surface in the presence of a ligating enzyme or catalytically active portion thereof described herein.

[00101] In some embodiments, the one or more capture nucleic acid molecules (as referred to here as surface-bound primer) hybridizes to one or more adaptors of the nucleic acid molecule, such as an adaptor containing an index sequence disclosed herein. In some embodiments, the index sequence is any unique sequence of 8 to 10 nucleotides, usable as unique index sequence pairs. Hybridization of barcoded probe molecules to target

[00102] In some instances, hybridization of the disclosed barcoded padlock probe or molecular inversion probe molecules to target nucleic acid sequences may be performed in samples comprising, e.g., purified, partially purified, or non-purified target nucleic acid molecules. Hybridization may be performed using any of a variety of existing hybridization protocols.

[00103] In some instances, the hybridization reaction may comprise the use of a hybridization buffer formulation comprising a pH buffer, an organic solvent, a molecular crowding agent, an additive for controlling melting temperature of double-stranded nucleic acids, an additive that impacts nucleic acid hydration, or any combination thereof.

[00104] In some aspects of the present disclosure, hybridization buffer formulations are described which, in combination with the disclosed low non-specific binding supports, provide for improved hybridization rates, hybridization specificity (or stringency), and hybridization efficiency (or yield). As used herein, hybridization specificity is a measure of the ability of tethered adapter sequences, primer sequences, or oligonucleotide sequences in general to correctly hybridize to completely complementary 50 26 01 26 sequences, while hybridization efficiency is a measure of the percentage of total available tethered adapter sequences, primer sequences, or oligonucleotide sequences in general that are hybridized to complementary sequences.

[00105] Improved hybridization specificity or efficiency may be achieved through optimization of the hybridization buffer formulation used with the disclosed low-binding surfaces and will be discussed in more detail in the examples below. Examples of hybridization buffer components that may be adjusted to achieve improved performance include, but are not limited to, buffer type, organic solvent mixtures, buffer pH, buffer viscosity, detergents and zwitterionic components, ionic strength (including adjustment of both monovalent and divalent ion concentrations), antioxidants and reducing agents, carbohydrates, BSA, poly(ethylene glycol), dextran sulfate, betaine, other additives, and the like.

[00106] In some instances, the hybridization buffer formulation may comprise a pH buffer selected from the group comprising Tris, HEPES, TAPS, Tricine, Bicine, Bis-Tris, NaOH, KOH, TES, EPFS, and MOPS. In some instances, the pH of the hybridization buffer formulation may range from about 3 to about 10. In some instances, the pH may be at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10. In some instances, the pH may be at most 10, at most 9, at most 8, at most 7, at most 6, at most 5, at most 4, or at most 3. Any of the lower and upper values described in this paragraph may be combined to form a range included within the present disclosure, for example, the pH of the hybridization buffer may range from about 4 to about 8. It is possible that the pH of the hybridization buffer may have any value within this range, e.g., about pH 7.8.

[00107] Examples of detergents for use in hybridization buffer formulation include, but are not limited to, zitterionic detergents (e.g., l-dodecanoyl-sn-glycero-3-phosphocholine, 3-(4-tert-butyl-l-pyridinio)-I-propanesulfonate, 3-(A,A-dimethylmyristylammonio)propanesulfonate, 3-(N,N-dimethylmyristylammonio) propanesulfonate, ASB-C80, C7BzO, CHAPS, CHAPS hydrate, CHAPSO, DDMAB, dimethylethylammoniumpropane sulfonate, A.A-dimcthyldodccylaminc A-oxide, A-dodccyl-A. A-dimcthy I-3 -ammonio-1 -propanesulfonate, or A-dodecyl-A,A-dimethyl-3 -ammonio-1 -propanesulfonate) and anionic, cationic, and non-ionic detergents. Examples of nonionic detergents include poly(oxyethylene) ethers and related polymers (e.g. Brij®, TWEEN®, TRITON®, TRITON X-100 and IGEPAL® CA-630), bile salts, and glycosidic detergents.

[00108] The use of the disclosed low non-specific binding supports either alone or in combination with optimized buffer formulations may yield relative hybridization rates that range from about 2x to about 20x faster than that for an existing hybridization protocol. In some instances, the relative hybridization rate may be at least 2x, at least 3x, at least 4x, at least 5x, at least 6x, at least 7x, at least 8x, at least 9x, 26 01 26 at least lOx, at least 12x, at least 14x, at least 16x, at least 18x, at least 20x, at least 25x, at least 3 Ox, or at least 40x that for an existing hybridization protocol.

[00109] In some instances, the use of the disclosed low-binding supports alone or in combination with optimized buffer formulations may yield total hybridization reaction times (that is, the time required to reach 90%, 95%, 98%, or 99% completion of the hybridization reaction) of less than 60 minutes, 50 minutes, 40 minutes, 30 minutes, 20 minutes, 15 minutes, 10 minutes, or 5 minutes for any of these completion metrics.

[00110] In some instances, the use of the disclosed low non-specific binding supports alone or in combination with optimized buffer formulations may yield improved hybridization specificity compared to that for an existing hybridization protocol. In some instances, the hybridization specificity that may be achieved is better than 1 base mismatch in 10 hybridization events, 1 base mismatch in20 hybridization events, 1 base mismatch in 30 hybridization events, 1 base mismatch in 40 hybridization events, 1 base mismatch in 50 hybridization events, 1 base mismatch in 75 hybridization events, 1 base mismatch in 100 hybridization events, 1 base mismatch in 200 hybridization events, 1 base mismatch in 300 hybridization events, 1 base mismatch in 400 hybridization events, 1 base mismatch in 500 hybridization events, 1 base mismatch in 600 hybridization events, 1 base mismatch in 700 hybridization events, 1 base mismatch in 800 hybridization events, 1 base mismatch in 900 hybridization events, 1 base mismatch in 1,000 hybridization events, 1 base mismatch in 2,000 hybridization events, 1 base mismatch in 3,000 hybridization events, 1 base mismatch in 4,000 hybridization events, 1 base mismatch in 5,000 hybridization events, 1 base mismatch in 6,000 hybridization events, 1 base mismatch in 7,000 hybridization events, 1 base mismatch in 8,000 hybridization events, 1 base mismatch in 9,000 hybridization events, or 1 base mismatch in 10,000 hybridization events.

[00111] In some instances, the use of the disclosed low-binding supports alone or in combination with optimized buffer formulations may yield improved hybridization efficiency (e.g., the fraction of available oligonucleotide primers on the support surface that are successfully hybridized with target oligonucleotide sequences) compared to that for an existing hybridization protocol. In some instances, the hybridization efficiency that may be achieved is better than 50%, 60%, 70%, 80%, 85%, 90%, 95%, 98%, or 99% for any of the input target oligonucleotide concentrations specified below and in any of the hybridization reaction times specified above. In some instances, e.g, wherein the hybridization efficiency is less than 100%, the resulting surface density of target nucleic acid sequences hybridized to the support surface may be less than the surface density of oligonucleotide adapter or primer sequences on the surface. 26 01 26

[00112] In some instances, the hybridization buffer formulation may comprise an organic solvent. Examples of solvents include, but are not limited to, acetonitrile, ethanol, DMF, and methanol, or any combination thereof at varying percentages (>5%). In some instances, the percentage of organic solvent (by volume) included in the hybridization buffer may range from about 1% to about 20%. In some instances, the percentage by volume of organic solvent may be at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 15%, or at least 20%. In some instances, the percentage by volume of organic solvent may be at most 20%, at most 15%, at most 10%, at most 9%, at most 8%, at most 7%, at most 6%, at most 5%, at most 4%, at most 3%, at most 2%, or at most 1%. Any of the lower and upper values described in this paragraph may be combined to form a range included within the present disclosure, for example, the percentage by volume of organic solvent may range from about 4% to about 15%. It is possible that the percentage by volume of organic solvent may have any value within this range, e.g., about 7.5%.

[00113] In some instances, the hybridization buffer formulation may comprise a molecular crowding agent selected from the group comprising poly(ethylene glycol) (PEG), dextran, hydroxypropyl methyl cellulose (HPMC), hydroxyethyl methyl cellulose (HEMC), hydroxybutyl methyl cellulose, hydroxypropyl cellulose, methyl cellulose, and hydroxyl methyl cellulose, ovalbumin, hemoglobin, Ficoll, or any combination thereof. In some instances, the percentage of molecular crowding agent included in the hybridization buffer formulation may range from about 1% to about 60%. In some instances, the percentage of molecular crowding agent in the hybridization buffer may be at least 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, or higher, by volume based on the total volume of the formulation. In some instances, the percentage of molecular crowding agent in the hybridization buffer may be at most 60%, 50%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, 1%, or lower, by volume based on the total volume of the formulation. Any of the lower and upper values described in this paragraph may be combined to form a range included within the present disclosure, for example, in some instances the percentage by volume of molecular crowding agent may range from about 5% to about 25%. It is possible that the percentage by volume of molecular crowding agent may have any value within this range, e.g., about 8.5%.

[00114] In some instances, the hybridization buffer formulation may comprise an additive for controlling melting temperature. Examples include, but are not limited to, formamide, tetramethyl ammonium chloride (TMAC), or any combination thereof. The amount of the additive for controlling melting temperature of nucleic acid can vary depending on other agents used in the hybridization buffer formulation. In some instances, the percentage of melting temperature additive 26 01 26 included in the hybridization buffer formulation may range from about 1% to about 60%. In some instances, the percentage of melting temperature additive in the hybridization buffer may be at least 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, or higher, by volume based on the total volume of the formulation. In some instances, the percentage of melting temperature additive in the hybridization buffer may be at most 60%, 50%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, 1%, or lower, by volume based on the total volume of the formulation. Any of the lower and upper values described in this paragraph may be combined to form a range included within the present disclosure, for example, in some instances the percentage by volume of melting temperature additive may range from about 4% to about 35%. It is possible that the percentage by volume of melting temperature additive may have any value within this range, e.g., about 6.5%.

[00115] In some instances, the hybridization buffer formulation may comprise an additive that impacts nucleic acid hydration. Examples include, but are not limited to, betaine, urea, glycine betaine, or any combination thereof. In some instances, the percentage by volume of a hydration additive included in the hybridization buffer formulation may range from about 1% to about 50%. In some instances, the percentage by volume of a hydration additive may be at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%), or at least 50%. In some instances, the percentage by volume of a hydration additive may be at most 50%, at most 45%, at most 40%, at most 35%, at most 30%, at most 25%, at most 20%, at most 15%, at most 10%, at most 5%, or at most 1%. Any of the lower and upper values described in this paragraph may be combined to form a range included within the present disclosure, for example, the percentage by volume of a hydration additive may range from about 1% to about 30%. It is possible that the percentage by volume of a melting temperature additive may have any value within this range, e.g., about 6.5%. Ligation

[00116] In addition to DNA ligase, the ligation of the disclosed barcoded padlock probe or molecular inversion probe molecules to create circularized probe molecule may comprise the use of an optimized ligation buffer. The two adjacent ends of the barcoded padlock probe (after hybridization to the target sequence) or of the molecule inversion probe (after hybridization to the target sequence and gap-filling) are joined together by DNA ligase which catalyzes the formation of a phosphodiester bond between the 3'-OH at one end of the probe and the 5'-phosphate group of the other end. Factors that affect the rate and yield of the ligation reaction include the nucleic acid concentration, the ligase concentration, the reaction temperature (the optimum temperature for DNA ligase activity is 37 °C, but the optimal reaction temperature will also depend on the melting 26 01 26 temperature (Tm) of the hybridized probe-target sequences), and ligation buffer composition (e.g., the ionic strength and species of cations present). In some instances, the ligation buffer composition may be the same as the hybridization buffer formulations described above or may comprise any of the hybridization buffer components, or combinations thereof, described above. Nucleic acid amplification

[00117] In some instances, the disclosed methods may comprise one or more nucleic acid amplification steps. In some embodiments, such amplification is performed in solution. In some embodiments, such application is performed on the surface. In some embodiments, amplification is performed prior to sequencing the nucleic acid molecules or derivatives thereof. Examples of nucleic acid amplification techniques include, but are not limited to, polymerase chain reaction (PCR), multiple displacement amplification (MDA), transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), strand displacement amplification (SDA), real-time SDA, rolling circle amplification, or circle-to-circle amplification.

[00118] As used herein, the phrase “nucleic acid surface amplification” (NASA) is used interchangeably with the phrase “solid-phase nucleic acid amplification” (or simply “solid-phase amplification”). In some aspects of the present disclosure, nucleic acid amplification formulations are described which, in combination with the disclosed low non-specific binding supports, provide for improved amplification rates, amplification specificity, and amplification efficiency. As used herein, specific amplification refers to amplification of template library oligonucleotide strands that have been tethered to the solid support either covalently or non-covalently. As used herein, non-specific amplification refers to amplification of primer-dimers or other non-template nucleic acids. As used herein, amplification efficiency is a measure of the percentage of tethered oligonucleotides on the support surface that are successfully amplified during a given amplification cycle or amplification reaction. Nucleic acid amplification performed on surfaces disclosed herein may obtain amplification efficiencies of at least 50%, 60%, 70%, 80%, 90%, 95%, or greater than 95%, such as 98% or 99%.

[00119] In some instances, an indexed amplification primer may be used to add a sample barcode to each amplified nucleic acid molecule during amplification of circularized padlock probe or molecular inversion probe molecules for a given sample, thereby allowing pooling of the amplicons from multiple samples prior to performing sequencing. In some instances, the amplification primer may also be used to add an adapter sequence, sequencing primer binding site, an additional primer binding site, or any combination thereof, to amplified product for a given sample.

[00120] Any of a variety of thermal cycling or isothermal nucleic acid amplification schemes may be used with the disclosed low non-specific binding supports. Examples of nucleic acid amplification methods that may be utilized with the disclosed low-binding supports include, but are not limited to, 26 01 26 polymerase chain reaction (PCR), multiple displacement amplification (MDA), transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), strand displacement amplification (SDA), real-time SDA, bridge amplification, isothermal bridge amplification, rolling circle amplification, circle-to-circle amplification, helicase-dependent amplification, recombinasedependent amplification, or single-stranded binding (SSB) protein-dependent amplification.

[00121] Often, improvements in amplification rate, amplification specificity, and amplification efficiency may be achieved using the disclosed low non-specific binding supports alone or in combination with formulations of the amplification reaction components. In addition to inclusion of nucleotides, one or more polymerases, helicases, single-stranded binding proteins, etc. (or any combination thereof), the amplification reaction mixture may be adjusted in a variety of ways to achieve improved performance including, but are not limited to, choice of buffer type, buffer pH, organic solvent mixtures, buffer viscosity, detergents and zwitterionic components, ionic strength (including adjustment of both monovalent and divalent ion concentrations), antioxidants and reducing agents, carbohydrates, BSA, poly(ethylene glycol), dextran sulfate, betaine, other additives, and the like.

[00122] In some instances, solid-phase amplification may be performed after tethering an amplicon comprising the circularized probe molecules (or re-linearized copies thereof) to a sequencing surface, thereby generating clonal colonies or clusters of the barcode sequences on the surface. Isothermal rolling circle amplification (RCA)

[00123] In some embodiments, the disclosed methods may comprise the use of rolling circle amplification (RCA) to generate concatemer molecules comprising multiple copies of the circularized probe molecules. RCA is an isothermal nucleic acid amplification technique where the polymerase continuously adds single nucleotides to a primer annealed to a circular template, thereby generating a concatemer molecule comprising single-stranded DNA that contains tens to hundreds of tandem repeats of the nucleic acid sequence (complementary to the circular template). The components required for performing RCA include a DNA polymerase, a polymerase-compatible buffer, a short DNA or RNA primer, a circular DNA template, and deoxynucleotide triphosphates (dNTPs). The polymerases used in RCA are Phi29, Bst, and Vent exo-DNA polymerase for DNA amplification, and T7 RNA polymerase for RNA amplification. Phi29 DNA polymerase is frequently used as it has the best processivity and strand displacement ability. RCA is conducted at constant temperature (e.g., ranging from room temperature to about 37 °C) in both free solution and for solid phase amplification.

[00124] There are three steps involved in a DNA RCA reaction: (i) circular template ligation, which can be conducted via template-mediated enzymatic ligation (e.g., T4 DNA ligase) or 26 01 26 template-free ligation using special DNA ligases (e.g., CircLigase); (ii) primer-induced singlestrand DNA elongation; multiple primers can be hybridized to the same circular template ("multiprimed RCA"), resulting in the initiation of multiple amplification events and producing multiple RCA products (optionally, the conversion of linear RCA product into multiple circles using restriction enzyme digestion followed by template-mediated enzymatic ligation); and (iii) amplification product detection and visualization, e.g., by method of fluorescent detection using a fluorophore-conjugated dNTP, a fluorophore-labeled complementary sequence, or fluorescently-labeled molecular beacons.

[00125] In some instances, an indexed amplification primer may be used during RCA to add a sample barcode to each amplified nucleic acid molecule during amplification of circularized padlock probe or molecular inversion probe molecules for a given sample, thereby allowing pooling of the amplicons from multiple samples prior to performing sequencing. In some instances, the amplification primer may also be used to add an adapter sequence, sequencing primer binding site, an additional primer binding site, or any combination thereof, to amplified product for a given sample. Identifying a nucleic acid sequence

[00126] Disclosed herein, in some embodiments, are methods of identifying a nucleic acid sequence of a pathogen disclosed herein. In some embodiments, the pathogen is a severe respiratory syndrome 2 (SARS-CoV-2). In some embodiments, identifying a nucleic acid sequence comprises sequencing. In some embodiments, identifying a nucleic acid sequence comprises targeted enrichment of a region of a pathogen genome, such as using a panel of nucleic acid probes specific to regions within the pathogen genome. In some embodiments, the entire genome of the pathogen is identified. In some embodiments, in the case of a coronavirus, a region of the genome is identified. In some embodiments, the region encodes a structural protein of the coronavirus comprises the spike glycoprotein, nucleocapsid protein, envelope glycoprotein, or membrane glycoprotein, or a combination thereof. Nucleic acid sequencing

[00127] The disclosed compositions and methods enable extremely high degrees of assay or sample multiplexing due to the large number of unique labels that may be generated using relatively short DNA sequences as barcodes. Furthermore, the relatively short sequencing reads required for implementing the disclosed barcoded padlock probe or molecular inversion probe assays leads to fast turn-round times and lower assay costs. Existing approaches to DNA barcoding rely on a standard sequencing run to identify the barcodes and then map them to a known manifest, such as in spatial transcriptomics applications, synthetic long reads, or Swab Seq. While effective, these approaches can be lengthy since 26 01 26 an entire sequencing run, including clustering, has to be completed. They can also be cost-prohibitive unless a very large number of samples is multiplexed to amortize the cost of a sequencing kit.

[00128] Although any of a variety of commercial nucleic acid sequencing methods and platforms may be used for sequencing the barcoded RCA amplification product to demultiplex assay and sample data, in some embodiments, "nanoball" sequencing may be employed. Nanoball sequencing is a high throughput sequencing methodology that uses rolling circle replication to amplify short template nucleic acid sequences and generate concatemers which are then condensed to form nanoballs. The nanoballs may subsequently be tethered to a sequencing surface, e.g., an interior surface of a sequencing flow cell and subjected to an iterative series of, e.g., sequencing-by-synthesis reactions to determine the sequence of the short template nucleic acid sequences. Large numbers of nanoballs may be hybridized to adapters on, or otherwise tethered to, a sequencing surface to enable massively parallel sequencing to be performed at lower reagent costs compared to other next generation sequencing techniques.

[00129] In some instances, the sequencing of concatemer sequences, or concatemer sequences which have been condensed to form nanoballs, generated using the disclosed compositions and methods may comprise the use of existing sequencing by incorporation (sequencing-by-synthesis™) chemistries and commercially-available platforms such as those available from Illumina (San Diego, CA). In some instances, the sequencing may comprise the use of single molecule sequencing chemistries and commercially available instruments such as those available from Pacific Biosciences (Menlo Park, CA). In some instances, the sequencing may comprise the use of nanopore sequencing techniques and commercially available instruments such as those available from Oxford Nanopore (Oxford, United Kingdom). In some instances, the disclosed compositions and methods may comprise the use of sequencing by binding techniques and commercially available instruments such as those available from Omniome (Omniome™, San Diego, CA). In some instances, the disclosed sequencing comprises bisulfite-free sequencing, bisulfite sequencing, TET-assisted bisulfite (TAB) sequencing, ACE-sequencing, high-throughput sequencing, Maxam-Gilbert sequencing, massively parallel signature sequencing, Polony sequencing, 454 pyrosequencing, Sanger sequencing, Illumina sequencing, SOLiD sequencing, Ion Torrent semiconductor sequencing, DNA nanoball sequencing, Heliscope single molecule sequencing, single molecule real time (SMRT) sequencing, nanopore DNA sequencing, shot gun sequencing, RNA sequencing, Enigma sequencing, or any combination thereof.

[00130] In some instances, the sequencing of concatemer sequences, or concatemer sequences which have been condensed to form nanoballs, generated using the disclosed compositions and methods may comprise the use of novel polymer-nucleotide conjugates (and related compositions) that enable “sequencing-by-trapping” methods as described in co-pending U.S. Patent Application 26 01 26 Serial No. 16 / 579,794 and International Patent Application Serial No. PCT / US2020 / 034409, both of which applications are incorporated herein in their entirety. Briefly, these methods comprise the use of polymer-nucleotide conjugates (or more generally, multivalent binding compositions) comprising a core structure to which a plurality of known nucleotide moieties, nucleotide analog moieties, or other binding elements are attached, and which optionally include a plurality of fluorophores or other detectable tags, are contacted with primed target nucleic acid molecules in the presence of a polymerase under conditions which promote hybridization between two or more nucleotide moieties of the polymer-nucleotide conjugate and two or more copies of the target sequence (e.g., two or more copies within a clonal cluster of replicate target nucleic acid molecules tethered to a surface, or two or more copies of the target nucleic acid sequence in a concatemer tethered to a surface) to form multivalent binding complexes which may be detected, e.g., using fluorescent labels as detectable tags and fluorescence imaging as the read-out for detection of the complex, to determine the identify of a nucleotide in the target nucleic acid sequence. Fig. 6 provides a schematic illustration of a multivalent binding complex formed between a polymer nucleotide conjugate comprising a plurality of nucleotide moieties and fluorophores and a plurality of target nucleic acid sequences tethered to a sequencing flow cell surface. In some instances, the nucleotide moieties attached to the polymer-nucleotide conjugate are not incorporated into the primed target nucleic acid strand. Instead, the multivalent binding complex is disrupted, and a single nucleotide extension reaction is performed prior to repeating the cycle of contacting with another polymer-nucleotide conjugate (or mixture thereof) comprising another or different known nucleotide moieties.

[00131] In some instances, multivalent binding compositions may comprise a plurality of nucleotides conjugated to a particle (e.g., a polymer, branched polymer, dendrimer, or equivalent structure) or other core structure. Contacting the multivalent binding composition with a polymerase and multiple copies of a primed target nucleic acid may result in the formation of a ternary complex which may be detected and in turn achieve a more accurate determination of the bases of the target nucleic acid.

[00132] Disclosed herein are methods of preparing multivalent binding or incorporation compositions comprising: a) a polymer core; and b) two or more nucleotide, nucleotide analog, nucleoside, or nucleoside analog moieties attached to the polymer core; wherein the length of the linker is dependent on the nucleotide, nucleotide analog, nucleoside, or nucleoside analog moiety that is attached to the polymer core. Also disclosed herein are methods of preparing multivalent binding compositions comprising: a) a mixture of polymer-nucleotide conjugates, wherein each polymer-nucleotide conjugate comprises: i) a polymer core; and ii) two or more nucleotide, nucleotide analog, nucleoside, or 26 01 26 nucleoside analog moieties attached to the polymer core, wherein the length of the linker is dependent on the nucleotide, nucleotide analog, nucleoside, or nucleoside analog moiety that is attached to the polymer core; and wherein the mixture comprises polymer-nucleotide conjugates having at least two different types of attached nucleotide, nucleotide analog, nucleoside, or nucleoside analog moiety. In some embodiments, the polymer core comprises a polymer having a plurality of branches and the two or more nucleotide, nucleotide analog, nucleoside, or nucleoside analog moieties are attached to said branches. In some embodiments, polymer has a star, comb, cross-linked, bottle brush, or dendrimer configuration. In some embodiments, the polymer-nucleotide conjugate comprises one or more binding groups selected from the group comprising an avidin, a biotin, an affinity tag, and combinations thereof. In some embodiments, the polymer core comprises a branched polyethylene glycol (PEG) molecule. In some embodiments, the polymer-nucleotide conjugate comprises a blocked nucleotide moiety. In some embodiments, the blocked nucleotide is a 3 '-0-azidomethyl nucleotide, a 3 '-0-methyl nucleotide, or a 3'-0-alkyl hydroxylamine nucleotide. In some embodiments, the polymer-nucleotide conjugate further comprises one or more fluorescent labels.

[00133] Disclosed herein are methods of preparing multivalent binding compositions and analyzing nucleic acid molecules, including in sequencing or other bioassay applications. An increase in binding or incorporation of a nucleotide to an enzyme (e.g., polymerase) or an enzyme complex can be affected by increasing the effective concentration of the nucleotide. The increase can be achieved by increasing the concentration of the nucleotide in free solution, or by increasing the amount of the nucleotide in proximity to the relevant binding or incorporation site. The increase can also be achieved by physically restricting a number of nucleotides into a limited volume thus resulting in a local increase in concentration, and such as structure may thus bind or incorporate to the binding or incorporation site with a higher apparent avidity than can be observed with unconjugated, untethered, or otherwise unrestricted individual nucleotide. One non-limiting mechanism of effecting such restriction is by providing a multivalent binding or incorporation composition in which multiple nucleotides are bound to a particle such as a polymer, a branched polymer, a dendrimer, a micelle, a liposome, a microparticle, a nanoparticle, a quantum dot, or other types of particles.

[00134] When the multivalent binding composition is used in sequencing reactions (instead of single unconjugated or untethered nucleotides) to form a multivalent binding complex with the polymerase and two or more copies of the target nucleic acid sequence, the effective local concentration of the nucleotide as well as the binding avidity of the complex are increased many-fold, which in turn enhances the persistence time of the complex (as illustrated in Fig. 7), increases signal-to-noise ratios and the differential signal intensity (e.g., the signal intensity for correct basepairing versus mismatch), enables the use of shorter imaging steps, and improves base-calling 26 01 26 accuracy. The multivalent binding composition described herein can include at least one particle-nucleotide conjugate (each particle-nucleotide conjugate comprising multiple copies of a single nucleotide moiety) for interacting with the target nucleic acid. The multivalent composition can also include two, three, or four different particle-nucleotide conjugates, each having a different nucleotide conjugated to the particle.

[00135] The present disclosure provides a method of using composition comprising a particle (e.g., a nanoparticle or polymer core), said particle comprising a plurality of enzyme or protein binding or incorporation substrates, wherein the enzyme or protein binding or incorporation substrates bind with one or more enzymes or proteins to form one or more binding or incorporation complexes (e.g.. a multivalent binding or incorporation complex), and wherein said binding or incorporation may be monitored or identified by observation of the location, presence, or persistence of the one or more binding or incorporation complexes. In some embodiments, said particle may comprise a polymer, branched polymer, dendrimer, liposome, micelle, nanoparticle, or quantum dot. In some embodiments, said substrate may comprise a nucleotide, a nucleoside, a nucleotide analog, or a nucleoside analog. In some embodiments, the enzyme or protein binding or incorporation substrate may comprise an agent that can bind with a polymerase. In some embodiments, the enzyme or protein may comprise a polymerase. In some embodiments, said observation of the location, presence, or persistence of one or more binding or incorporation complexes may comprise fluorescence detection.

[00136] The multivalent binding or incorporation composition can comprise 1, 2, 3, 4, or more types of particle-nucleotide conjugates, wherein each particle-nucleotide conjugate comprises a different type of nucleotide. A first type of the particle-nucleotide conjugate can comprise a nucleotide selected from the group comprising ATP, ADP, AMP, dATP, dADP, and dAMP. A second type of the particle-nucleotide conjugate can comprise a nucleotide selected from the group comprising TTP, TDP, T1MP, dTTP, dTDP, dTNIP, UTP, UDP, UNIP, dUTP, dUDP, and dUMP. A third type of the particle-nucleotide conjugate can comprise a nucleotide selected from the group comprising CTP, CDP, C1\1P, dCTP, dCDP, and dCMP. A fourth type of the particle-nucleotide conjugate can comprise a nucleotide selected from the group comprising GTP, GDP, GIMP, dGTP, dGDP, and dGMP. In some embodiments, each particle-nucleotide conjugate comprises a single type of nucleotide respectively corresponding to one or more nucleotide selected from the group comprising ATP, ADP, AMP, dATP, dADP, dAMP TTP, TDP, TMP, dTTP, dTDP, dTMP, UTP, UDP, UMP, dUTP, dUDP, dUMP, CTP, CDP, CMP, dCTP, dCDP, dCMP, GTP, GDP, GMP, dGTP, dGDP, and dGMP.

[00137] Each multivalent binding or incorporation composition may further comprise one or more labels corresponding to the particular nucleotide conjugated to each respective conjugate. Non-limiting 61 26 01 26 examples of labels include fluorescent labels (e.g., cyanine dye 3 (Cy3), cyanine dye 3.5 (Cy3.5), cyanine dye 5 (Cy5), and cyanine dye 5.5. (Cy5.5)), colorimetric labels, electrochemical labels (for example, glucose or other reducing sugars, or thiols or other redox active moieties), luminescent labels, chemiluminescent labels, spin labels, radioactive labels, steric labels, affinity tags, or the like.

[00138] In some embodiments, the present disclosure provides methods of preparing and using said composition wherein one or more labels comprise a fluorescent label, a FRET donor, or a FRET acceptor. In some embodiments, the present disclosure provides methods of preparing and using said composition wherein the substrate (e.g., nucleotide, nucleotide analog, nucleoside, or nucleoside analog) is attached to the particle through a linker. In some embodiments, the present disclosure provides methods of preparing and using said composition wherein at least one nucleotide or nucleotide analog is a nucleotide that has been modified to inhibit elongation during a polymerase reaction or a sequencing reaction, for example, a nucleotide that lacks a 3’ hydroxyl group; a nucleotide that has been modified to contain a blocking group at the 3 ’ position; a nucleotide that has been modified with a 3’-O-azido group, a 3’-O-azidomethyl group,, a 3’-O-alkyl hydroxylamino group, a 3’-phosphorothioate group, a 3’-O-malonyl group, or a 3’-O-benzyl group; or a nucleotide that has not been modified at the 3’ position.

[00139] One non-limiting example of the particle-nucleotide conjugate is a polymer-nucleotide conjugate comprising a polymer core to which a plurality of nucleotide moieties, nucleotide analog moieties, other binding elements, linkers, or detectable labels may be tethered. In some instances, the polymer core may comprise linear or branched polymers. Examples of linear or branched polymers include linear or branched poly(ethylene glycol) (PEG), linear or branched poly(propylene glycol), linear or branched poly(vinyl alcohol), linear or branched polylactic acid, linear or branched poly(glycolic acid), linear or branched polyglycine, linear or branched poly(vinyl acetate), a dextran, or other such polymers, or copolymers incorporating any two or more of the foregoing or incorporating other polymers. In one embodiment, the polymer is a PEG. In another embodiment, the polymer can have PEG branches.

[00140] Polymers may be characterized by a repeating unit incorporating a functional group for derivatization such as an amine, a hydroxyl, a carbonyl, or an allyl group. The polymer can also have one or more pre-derivatized substituents such that one or more particular subunits will incorporate a site of derivatization or a branch site, whether or not other subunits incorporate the same site, substituent, or moiety. A pre-derivatized substituent may comprise or may further comprise, for example, a nucleotide, a nucleoside, a nucleotide analog, a label such as a fluorescent label, radioactive label, or spin label, an interaction moiety, an additional polymer moiety, or the like, or any combination of the foregoing. 26 01 26

[00141] In the polymer-nucleotide conjugate, the polymer can have a plurality of branches. The branched polymer can have various configurations, including but are not limited to, stellate ("starburst") forms, aggregated stellate ("helter skelter") forms, bottle brush, or dendrimer. The branched polymer can radiate from a central attachment point or central moiety or may incorporate multiple branch points, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more branch points. In some embodiments, each subunit of a polymer may optionally constitute a separate branch point.

[00142] The length and size of the branch can differ based on the type of polymer. In some branched polymers, the branch may have a length of between 1 and 1,000 nm, between 1 and 100 nm, between 1 and 200 nm, between 1 and 300 nm, between 1 and 400 nm, between 1 and 500 nm, between 1 and 600 nm, between 1 and 700 nm, between 1 and 800 nm, or between 1 and 900 nm, or more, or having a length falling within or between any of the values disclosed herein.

[00143] In some polymer-nucleotide conjugates, the polymer core may have a size corresponding to an apparent molecular weight of 1 kDa, 2 kDa, 3 kDa, 4 kDa, 5kDa, 10 kDa, 15 kDa, 20 kDa, 30 kDa, 50 kDa, 80 kDa, 100 kDa, or any value within a range defined by any two of the foregoing. The apparent molecular weight of a polymer may be calculated from the known molecular weight of a representative number of subunits, as determined by size exclusion chromatography, as determined by mass spectrometry, or as determined by any other existing methods.

[00144] In some branched polymers, the branch may have a size corresponding to an apparent molecular weight ofl kDa, 2 kDa, 3 kDa, 4 kDa, 5 kDa, 10 kDa, 15 kDa, 20 kDa, 30 kDa, 50 kDa, 80 kDa, 100 kDa, or any value within a range defined by any two of the foregoing. The apparent molecular weight of a polymer may be calculated from the known molecular weight of a representative number of subunits, as determined by size exclusion chromatography, as determined by mass spectrometry, or as determined by any other method as is known in the art. The polymer can have multiple branches. The number of branches in the polymer can be 2, 3, 4, 5, 6, 7, 8, 12, 16, 24, 32, 64, 128 or more, or a number falling within a range defined by any two of these values.

[00145] For polymer-nucleotide conjugates comprising a branched polymer of, for example, a branched PEG comprising 4, 8, 16, 32, or 64 branches, the polymer nucleotide conjugate can have nucleotides attached to the ends of the PEG branches, such that each end has attached thereto 0, 1,2, 3, 4, 5, 6 or more nucleotides. In one non-limiting example, a branched PEG polymer of between 3 and 128 PEG arms may have attached to the ends of the polymer branches one or more nucleotides, such that each end has attached thereto 0, 1, 2, 3, 4, 5, 6 or more nucleotides or nucleotide analogs. In some embodiments, a branched polymer or dendrimer has an even number of arms. In some embodiments, a branched polymer or dendrimer has an odd number of arms. 26 01 26

[00146] In some instances, the length of the linker (e.g., a PEG linker) may range from about 1 nm to about 1,000 nm. In some instances, the length of the linker may be at least 1 nm, at least 10 nm, at least 25 nm, at least 50 nm, at least 75 nm, at least 100 nm, at least 200 nm, at least 300 nm, at least 400 nm, at least 500 nm, at least 600 nm, at least 700 nm, at least 800 nm, at least 900 nm, or at least 1,000 nm. In some instances, the length of the linker may range between any two of the values in this paragraph. For example, in some instances, the length of the linker may range from about 75 nm to about 400 nm. It is possible that in some instances, the length of the linker may have any value within the range of values in this paragraph, e.g., 834 nm.

[00147] In some instances, the length of the linker is different for different nucleotides (including deoxyribonucleotides and ribonucleotides), nucleotide analogs (including deoxyribonucleotide analogs and ribonucleotide analogs), nucleosides (including deoxyribonucleosides or ribonucleosides), or nucleoside analogs (including deoxyribonucleoside analogs or ribonucleoside analogs). In some instances, one of the nucleotides, nucleotide analogs, nucleosides, or nucleoside analogs comprises, for example, deoxyadenosine, and the length of the linker is between 1 nm and 1,000 nm. In some instances, one of the nucleotides, nucleotide analogs, nucleosides, or nucleoside analogs comprises, for example, deoxyguanosine, and the length of the linker is between 1 nm and 1,000 nm. In some instances, one of the nucleotides, nucleotide analogs, nucleosides, or nucleoside analogs comprises, for example, thymidine, and the length of the linker is between 1 nm and 1,000 nm. In some instances, one of the nucleotides, nucleotide analogs, nucleosides, or nucleoside analogs comprises, for example, deoxyuridine, and the length of the linker is between 1 nm and 1,000 nm. In some instances, one of the nucleotides, nucleotide analogs, nucleosides, or nucleoside analogs comprises, for example, deoxycytidine, and the length of the linker is between 1 nm and 1,000 nm. In some instances, one of the nucleotides, nucleotide analogs, nucleosides, or nucleoside analogs comprises, for example, adenosine, and the length of the linker is between 1 nm and 1,000 nm. In some instances, one of the nucleotides, nucleotide analogs, nucleosides, or nucleoside analogs comprises, for example, guanosine, and the length of the linker is between 1 and 1,000 nm. In some instances, one of the nucleotides, nucleotide analogs, nucleosides, or nucleoside analogs comprises, for example, 5-methyl-uridine, and the length of the linker is between 1 nm and 1,000 nm. In some instances, one of the nucleotides, nucleotide analogs, nucleosides, or nucleoside analogs comprises, for example, uridine, and the length of the linker is between 1 nm and 1,000 nm. In some instances, one of the nucleotides, nucleotide analogs, nucleosides, or nucleoside analogs comprises, for example, cytidine, and the length of the linker is between 1 nm and 1,000 nm.

[00148] In the polymer-nucleotide conjugate, each branch or a subset of branches of the polymer may have attached thereto a moiety comprising a nucleotide (e.g., an adenine, a thymine, a uracil, a 64 26 01 26 cytosine, or a guanine residue or a derivative or mimetic thereof), and the moiety is capable of binding or incorporation to a polymerase, reverse transcriptase, or other nucleotide binding or incorporation domain. Optionally, the moiety may be capable of being incorporated into an elongating nucleic acid chain during a polymerase reaction. In some instances, said moiety may be blocked such that it is not capable of being incorporated into an elongating nucleic acid chain during a polymerase reaction. In some other instances, said moiety may be reversibly blocked such that it is not capable of being incorporated into an elongating nucleic acid chain during a polymerase reaction until such block is removed, after which said moiety is then capable of being incorporated into an elongating nucleic acid chain during a polymerase reaction.

[00149] The nucleotide can be conjugated to the polymer branch through the 5' end of the nucleotide. In some instances, the nucleotide may be modified to inhibit or prevent incorporation of the nucleotide into an elongating nucleic acid chain during a polymerase reaction. By way of example, the nucleotide may include a 3' deoxyribonucleotide, a 3' azidonucleotide, a 3'-methyl azido nucleotide, or another such nucleotide as is or may be known in the art, to be incapable of being incorporated into an elongating nucleic acid chain during a polymerase reaction. In some embodiments, the nucleotide can include a 3'-O-azido group, a 3'-O-azidomethyl group, a 3' phosphorothioate group, a 3'-O-malonyl group, a 3'-O-alkyl hydroxylamino group, or a 3'- O -benzyl group. In some embodiments, the nucleotide lacks a 3' hydroxyl group.

[00150] The polymer can further have a binding or incorporation moiety in each branch or a subset of branches. Some examples of the binding or incorporation moiety include, but are not limited to biotin, avidin, strepavidin or the like, polyhistidine domains, complementary paired nucleic acid domains, G-quartet forming nucleic acid domains, calmodulin, maltose-binding protein, cellulase, maltose, sucrose, glutathione-S-transferase, glutathione, O-6-methylguanine-DNA methyltransferase, benzylguanine and derivatives thereof, benzylcysteine and derivatives thereof, an antibody, an epitope, a protein A, a protein G. The binding or incorporation moiety can be any interactive molecules or fragment thereof known in the art to bind to or facilitate interactions between proteins, between proteins and ligands, between proteins and nucleic acids, between nucleic acids, or between small molecule interaction domains or moieties.

[00151] Without intending to be bound by any particular theory, it has been observed that multivalent binding compositions disclosed herein associate with polymerase nucleotide complexes in order to form a ternary binding complexes with a rate that is time-dependent, though substantially slower than the rate of association is obtainable by nucleotides in free solution. Thus, the on-rate (Kon) is substantially and surprisingly slower than the on rate for single nucleotides or nucleotides not attached to multivalent ligand complexes. Importantly, however, the off rate (Koff) of the multivalent ligand complex is 26 01 26 substantially slower than that observed for nucleotides in free solution. Therefore, the multivalent ligand complexes of the present disclosure provide a surprising and beneficial improvement of the persistence of ternary polymerase-polynucleotide-nucleotide complexes (especially over such complexes that are formed with free nucleotides) allowing, for example, significant improvements in imaging quality for nucleic acid sequencing applications over currently available methods and reagents. Importantly, this property of the multivalent binding compositions disclosed herein renders the formation of visible ternary complexes controllable, such that subsequent visualization, modification, or processing operations may be undertaken essentially without regard to the dissociation of the complex, that is, the complex can be formed, imaged, modified, or used in other ways, and will remain stable until a user carries out an affirmative dissociation operation, such as exposing the complexes to a dissociation buffer.

[00152] In some instances, the multivalent binding complexes formed between a multivalent binding composition (at low effective nucleotide concentration) such as a polymer-nucleotide conjugate, a polymerase, and two or more copies of a target nucleic acid sequence may have a persistence time ranging from about 0.1 second to about 600 second under non-destabilizing conditions. In some instances, the persistence time may be at least 0.1 second, at least 1 second, at least 2 seconds, at least 3 second, at least 4 second, at least 5 seconds, at least 6 seconds, at least 7 seconds, at least 8 seconds, at least 9 seconds, at least 10 seconds, at least 20 seconds, at least 30 second, at least 40 second, at least 50 seconds, at least 60 seconds, at least 120 seconds, at least 180 seconds, at least 240 seconds, at least 300 seconds, at least 360 seconds, at least 420 seconds, at least 480 seconds, at least 540 seconds, or at least 600 seconds. In some instances, the persistence time may range between any two of the values specified in this paragraph. For example, in some instances, the persistence time may range from about 10 seconds to about 360 seconds. It is possible that, in some instances, the persistence time may have any value within the range of values specified in this paragraph, e.g., 78 seconds.

[00153] In some instances, the aforementioned persistence times may be achieved when using the multivalent binding composition, e.g., a polymer-nucleotide conjugate, for performing sequencing-by-trapping reactions using effective nucleotide concentrations of less than 1,000 nM, less than 500 nM, less than 400 nM, less than 300 nM, less than 200 nM, less than 150 nM, less than 100 nM, less than 90 nM, less than 80 nM, less than 70 nM, less than 60 nM, less than 50 nM, less than 40 nM, less than 30 nM, less than 20 nM, less than 15 nM, less than 10 nM, less than 9 nM, less than 8 nM, less than 7 nM, less than 6 nM, less than 5 nM, less than 4 nM, less than 3 nM, less than 2 nM, or less than 1 nM. Polymerase for the multivalent binding complexes 26 01 26

[00154] In various embodiments, polymerases for the binding or incorporation interaction describe herein may include any polymerase as is or may be known in the art. Examples of polymerases may include but are not limited to: Klenow DNA polymerase, Thermus aquaticus DNA polymerase I (Taq polymerase), KlenTaq polymerase,and bacteriophage T7 DNA polymerase; human alpha, delta and epsilon DNA polymerases; bacteriophage polymerases such as T4, RB69 and phi29 bacteriophage DNA polymerases, Pyrococcus furiosus DNA polymerase (Pfu polymerase); Bacillus subtilis DNA polymerase III, and E. coli DNA polymerase III alpha and epsilon; 9 degree N polymerase, reverse transcriptases such as HIV type M or O reverse transcriptases, avian myeloblastosis virus reverse transcriptase, or Moloney Murine Leukemia Virus (MMLV) reverse transcriptase, or telomerase. Further non-limiting examples of DNA polymerases can include those from various Archaea genera, such as, Aeropyrum, Archaeglobus, De sulfurococcus, Pyrobaculum, Pyrococcus, Pyrolobus, Pyrodictium, Staphylothermus, Stetteria, Sulfolobus, Thermococcus, and Vulcanisaeta and the like or variants thereof, including polymerases such as Vent ™, Deep Vent ™, Pfu, KOD, Pfx, Therminator™, and Tgo polymerases. In some embodiments, the polymerase is a klenow polymerase.

[00155] The ternary complex has longer persistence time when the nucleotide on the polymernucleotide conjugate is complementary to the target nucleic acid than when a non-complementary nucleotide. The ternary complex also has longer persistence time when the nucleotide on the polymernucleotide conjugate is complementary to the target nucleic acid than a complementary nucleotide that is not conjugated or tethered. For example, in some embodiments, said ternary complexes may have a persistence time of less than Is, greater than Is, greater than 2s, greaterthan 3s, greaterthan 5s, greater than 10s, greaterthan 15s, greaterthan 20s, greaterthan 30s, greaterthan 60s, greaterthan 120s, greater than 360s, greater than 3600s, or more, or for a time lying within a range defined by any two or more of these values.

[00156] The persistence time can be measured, for example, by observing the onset or duration of a binding complex, such as by observing a signal from a labeled component of the binding complex. For example, a labeled nucleotide or a labeled reagent comprising one or more nucleotides may be present in a binding complex, thus allowing the signal from the label to be detected during the persistence time of the binding complex.

[00157] It has been observed that different ranges of persistence times are achievable with different salts or ions, showing, for example, that complexes formed in the presence of, for example, magnesium ions (Mg2+) form more quickly than complexes formed with other ions. It has also been observed that complexes formed in the presence of, for example, strontium ions (Sr24), form readily and dissociate completely or with substantial completeness upon withdrawal of the ion or upon washing with buffer lacking one or more components of the present compositions, such as, e.g., a polymer or one or more 26 01 26 nucleotides, or one or more interaction moieties, or a buffer containing, for example, a chelating agent which may cause or accelerate the removal of a divalent cation from the multivalent reagent containing complex. Thus, in some embodiments, a composition of the present disclosure comprises Mg2+. In some embodiments, a composition of the present disclosure comprises Ca2+. In some embodiments, a composition of the present disclosure comprises Sr24. In some embodiments, a composition of the present disclosure comprises cobalt ions (Co2+). In some embodiments, a composition of the present disclosure comprises MgCE. In some embodiments, a composition of the present disclosure comprises CaCk. In some embodiments, a composition of the present disclosure comprises SrCE. In some embodiments, a composition of the present disclosure comprises CoCT. In some embodiments, the composition comprises no, or substantially no magnesium. In some embodiments, the composition comprises no, or substantially no calcium. In some embodiments, the methods of the present disclosure provide for the contacting of one or more nucleic acids with one or more of the compositions disclosed herein wherein said composition lacks either one of calcium or magnesium or lacks both calcium and magnesium.

[00158] The dissociation of ternary complexes can be controlled by changing the buffer conditions. After the imaging operation, a buffer with increased salt content is used to cause dissociation of the ternary complexes such that labeled polymer-nucleotide conjugates can be washed out, providing a mechanism by which signals can be attenuated or terminated, such as in the transition between one sequencing cycle and the next. This dissociation may be affected, in some embodiments, by washing the complexes with a buffer lacking a metal or cofactor. In some embodiments, a wash buffer may comprise one or more compositions for the purpose of maintaining pH control. In some embodiments, a wash buffer may comprise one or more monovalent cations, such as sodium. In some embodiments, a wash buffer lacks or substantially lacks a divalent cation, for example, having no or substantially no strontium, calcium, magnesium, or manganese. In some embodiments, a wash buffer further comprises a chelating agent, for example, EDTA, EGTA, nitrilotriacetic acid, polyhistidine, imidazole, or the like. In some embodiments, a wash buffer may maintain the pH of the environment at the same level as for the bound complex. In some embodiments, a wash buffer may raise or lower the pH of the environment relative to the level seen for the bound complex. In some embodiments, the pH may be within a range from 2-4, 2-7, 5-8, 7-9, 7-10, or lower than 2, or higher than 10, or a range defined by any two of the values provided herein.

[00159] Addition of a particular ion may affect the binding of the polymerase to a primed target nucleic acid, the formation of a ternary complex, the dissociation of a ternary complex, or the incorporation of one or more nucleotides into an elongating nucleic acid such as during a polymerase reaction. In some embodiments, relevant anions may comprise chloride, acetate, gluconate, sulfate, phosphate, or the like. 26 01 26 In some embodiments, an ion may be incorporated into the compositions of the present disclosure by the addition of one or more acids, bases, or salts, such as NiCE, C0CI2, MgCE. MnCE, SrCE. CaCT. CaSO4, SrCOs, BaCEor the like. Representative salts, ions, solutions and conditions may be found in Remington: The Science and Practice of Pharmacy, 20th. Edition, Gennaro, A.R., Ed. (2000), and especially with respect to Chapter 17 and related disclosure of salts, ions, salt solutions, and ionic solutions.

[00160] The present disclosure contemplates contacting the multivalent binding or incorporation composition comprising at least one particle-nucleotide conjugate with one or more polymerases. The contacting can be optionally done in the presence of one or more target nucleic acids. In some embodiments, said target nucleic acids are single stranded nucleic acids. In some embodiments, said target nucleic acids are primed single stranded nucleic acids. In some embodiments, said target nucleic acids are double stranded nucleic acids. In some embodiments, said contacting comprises contacting the multivalent binding or incorporation composition with one polymerase. In some embodiments, said contacting comprises the contacting of said composition comprising one or more nucleotides with multiple polymerases. The polymerase can be bound to a single nucleic acid molecule.

[00161] The target nucleic acid can refer to a target nucleic acid sample having one or more nucleic acid molecules. In some embodiments, the target nucleic acid can include a plurality of nucleic acid molecules. In some embodiments, the target nucleic acid can include two or more nucleic acid molecules. In some embodiments, the target nucleic acid can include two or more nucleic acid molecules having the same sequences.

[00162] The binding between target nucleic acid and multivalent binding composition may be provided in the presence of a polymerase that has been rendered catalytically inactive. In one embodiment, the polymerase may have been rendered catalytically inactive by mutation. In one embodiment, the polymerase may have been rendered catalytically inactive by chemical modification. In some embodiments, the polymerase may have been rendered catalytically inactive by the absence of a substrate, ion, or cofactor. In some embodiments, the polymerase enzyme may have been rendered catalytically inactive by the absence of magnesium ions.

[00163] The binding between target nucleic acid and multivalent binding composition occur in the presence of a polymerase wherein the binding solution, reaction solution, or buffer lacks magnesium or manganese. Alternatively, the binding between target nucleic acid and multivalent binding composition occur in the presence of a polymerase wherein the binding solution, reaction solution, or buffer comprises calcium or strontium.

[00164] When the catalytically inactive polymerases are used to help a nucleic acid interact with a multivalent binding composition, the interaction between said composition and said polymerase 26 01 26 stabilizes a ternary complex so as to render the complex detectable by fluorescence or by other methods as disclosed herein or otherwise known in the art. Unbound polymer-nucleotide conjugates may optionally be washed away prior to detection of the ternary binding complex.

[00165] Contacting of one or more nucleic acids with the polymer-nucleotide conjugates disclosed herein in a solution containing either one of calcium or magnesium or containing both calcium and magnesium. Alternatively, the contacting of one or more nucleic acids with the polymer-nucleotide conjugates disclosed herein in a solution lacking either one of calcium or magnesium, or lacking both calcium or magnesium, and in a separate operation, without regard to the order of the operations, adding to the solution one of calcium or magnesium, or both calcium and magnesium. In some embodiments, the contacting of one or more nucleic acids with the polymer-nucleotide conjugates disclosed herein in a solution lacking strontium, and comprises in a separate operation, without regard to the order of the operations, adding to the solution strontium. Sequencing systems

[00166] Also disclosed herein are sequencing systems configured to perform the disclosed barcoded padlock probe and molecular inversion probe assays. The disclosed sequencing systems may comprise novel sequencing chemistries, sequencing flow cells, imaging modules, fluid flow controllers or fluid dispensing systems, processors or computer systems, or any combination thereof. Applicant is developing proprietary sequencing chemistries (e.g., "sequencing-bytrapping" chemistries), sequencing flow cells, and sequencing systems that provide high quality nucleic acid sequence data at high throughput and low cost in a compact, modular format. The sequencing platform (and associated consumable kit) will be configured as a highly multiplexed barcode reader that minimizes reagent consumption and assay cost while affording a barcode reading efficiency that is unprecedented in the context of conventional molecular diagnostic testing. The implementation of the disclosed padlock probe or molecular inversion probe assays followed by RCA amplification generates a huge number of data points, where each concatemer generated corresponds to a unique assay replicate. The disclosed sequencing platform and sequencing consumables allow one to discriminate between 100s of millions of these concatemers. The large number of replicates involved will thus yield very accurate assays and will also provide information on viral load since the number of concatemers generated will be proportional to the viral copies initially present in the sample. Sequencing flow cells

[00167] In some instances, one or more interior surfaces of the sequencing flow cells of the disclosed systems may comprise novel low non-specific binding surface chemistries that have been optimized for low background / high foreground fluorescence signals that yield high contrast-to-noise ratio images of 26 01 26 fluorescently tagged molecules tethered to a flow cell surface. In some instances, one or more sequencing flow cells may be fixed components of the sequencing system. In some instances, one or more sequencing flow cells may be removable or disposable components of the sequencing system.

[00168] In some instances, the sequencing flow cell may be fabricated from off-the-shelf components such as glass capillaries, fused-silica capillaries, or polymer capillaries. Examples of materials include, but are not limited to, glass, fused-silica, silicon, a polymer (e.g., polystyrene (PS), microporous polystyrene (MPPS), poly(methyl methacrylate) (PMMA), polycarbonate (PC), polypropylene (PP), polyethylene (PE), high-density polyethylene (HDPE), cyclic olefin polymers (COP), cyclic olefin copolymers (COC), poly(ethylene terephthalate) (PET)), or any combination thereof. Various flow cell designs constructed of both glass and polymer components are contemplated.

[00169] In some instances, the one or more interior surfaces of the sequencing flow cell may comprise one or more layers of a covalently or non-covalently attached low-binding, chemical modification layers, e.g., silane layers, polymer films, and one or more covalently or non-covalently attached primer sequences that may be used for tethering single-stranded target nucleic acid(s) to the support surface. In some instances, the formulation of the surface, e.g., the chemical composition of one or more layers, the coupling chemistry used to cross-link the one or more layers to the support surface or to each other, and the total number of layers, may be varied such that non-specific binding of proteins, nucleic acid molecules, and other hybridization and amplification reaction components to the support surface is minimized or reduced relative to a comparable monolayer. Often, the formulation of the surface may be varied such that non-specific hybridization on the support surface is minimized or reduced relative to a comparable monolayer. The formulation of the surface may be varied such that non-specific amplification on the support surface is minimized or reduced relative to a comparable monolayer or unmodified surface. The formulation of the surface may be varied such that specific amplification rates or yields on the support surface are maximized in those instances where a solid-phase amplification step is incorporated into the assay.

[00170] In some instances, the low non-specific binding surfaces may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 layers of a hydrophilic polymer coating. Examples of polymers include, but are not limited to, poly(ethylene glycol) (PEG), poly(vinyl alcohol) (PVA), poly(vinyl pyridine), poly(vinyl pyrrolidone) (PVP), poly(acrylic acid) (PAA), polyacrylamide, poly(A-isopropylacrylamide) (PNIPAM), poly(methyl methacrylate) (PMA), poly(hydroxyethyl methacrylate) (PHEMA), poly(oligo(ethylene glycol) methyl ether methacrylate) (POEGMA), polyglutamic acid (PGA), poly-lysine, poly-glucoside, streptavidin, and dextran. 26 01 26

[00171] In some instances, one or more polymer coating layers may comprise a branched or multibranched polymer. Examples of branched polymers include, but are not limited to, branched PEG, branched poly(vinyl alcohol) (branched PVA), branched poly(vinyl pyridine), branched poly(vinyl pyrrolidone) (branched PVP), branched ), poly(acrylic acid) (branched PAA), branched polyacrylamide, branched poly(JV-isopropylacrylamide) (branched PNIPAM), branched poly(methyl methacrylate) (branched PMA), branched poly(hydroxylethyl methacrylate) (branched PHEMA), branched poly(oligo(ethylene glycol) methyl ether methacrylate) (branched POEGMA), branched poly(glutamic acid) (branched PGA), branched polylysine, branched polyglucoside, and dextran.

[00172] In some instances, the branched polymers used to create one or more layers of any of the multi-layered surfaces disclosed herein may comprise at least 4 branches, at least 5 branches, at least 6 branches, at least 7 branches, at least 8 branches, at least 9 branches, at least 10 branches, at least 12 branches, at least 14 branches, at least 16 branches, at least 18 branches, at least 20 branches, at least 22 branches, at least 24 branches, at least 26 branches, at least 28 branches, at least 30 branches, at least 32 branches, at least 34 branches, at least 36 branches, at least 38 branches, or at least 40 branches. Molecules often exhibit a 'power of 2' number of branches, such as 2, 4, 8, 16, 32, 64, or 128 branches.

[00173] In some instances, the linear, branched, or multi-branched polymers used to create one or more layers of any of the low non-specific binding surfaces disclosed herein may have a molecular weight of at least 500, at least 1,000, at least 2,000, at least 3,000, at least 4,000, at least 5,000, at least 10,000, at least 15,000, at least 20,000, at least 25,000, at least 30,000, at least 35,000, at least 40,000, at least 45,000, or at least 50,000 Da.

[00174] In some instances, 1, 2, 3, 4, or more than 4 polymer coating layers of the low non-specific binding surfaces may comprise a plurality of tethered oligonucleotide primer or adapter sequences attached or tethered thereto. One or more types of oligonucleotide primer or adapter sequences may be attached one or more polymer coating layers on the surface. In some instances, the one or more types of oligonucleotide adapters or primers may comprise spacer sequences, adapter sequences for hybridization to adapter-ligated template library nucleic acid sequences, forward amplification primers, reverse amplification primers, sequencing primers, or molecular barcoding sequences, or any combination thereof In some instances, 1 primer or adapter sequence may be tethered to at least one layer of the surface. In some instances, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 different primer or adapter sequences may be tethered to at least one layer of the surface.

[00175] In some instances, the tethered oligonucleotide adapter or primer sequences may range in length from about 10 nucleotides to about 100 nucleotides. In some instances, the tethered 26 01 26 oligonucleotide adapter or primer sequences may be at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 nucleotides in length. In some instances, the tethered oligonucleotide adapter or primer sequences may be at most 100, at most 90, at most 80, at most 70, at most 60, at most 50, at most 40, at most 30, at most 20, or at most 10 nucleotides in length. Any of the lower and upper values described in this paragraph may be combined to form a range included within the present disclosure, for example, in some instances the length of the tethered oligonucleotide adapter or primer sequences may range from about 20 nucleotides to about 80 nucleotides. It is possible that the length of the tethered oligonucleotide adapter or primer sequences may have any value within this range, e.g., about 24 nucleotides.

[00176] In some instances, the effective surface density of oligonucleotide adapter or primer sequences on the low non-specific binding surfaces may range from about 100 molecules per pm2 to about 100,000 molecules per pm2. In some instances, the effective surface density of oligonucleotide adapter or primer sequences may range from about 1,000 molecules per pm2 to about 1,000,000 molecules per pm2. In some instances, the effective surface density of oligonucleotide adapter or primer sequences may be at least 100, at least 1,000, at least 10,000, at least 100,000, or at least 1,000,000 molecules per pm2. In some instances, the effective surface density of oligonucleotide adapter or primer sequences may be at most 1,000,000, at most 100,000, at most 10,000, at most 1,000 molecules, or at most 100 molecules per pm2. Any of the lower and upper values described in this paragraph may be combined to form a range included within the present disclosure, for example, in some instances the effective surface density of oligonucleotide adapter or primer sequences may range from about 10,000 molecules per pm2 to about 100,000 molecules per pm2. It is possible that the surface density of primer molecules may have any value within this range, e.g., about 455,000 molecules per pm2. In some instances, the effective surface density of target nucleic acid sequences (e.g., concatemer or nanoball sequences) initially hybridized to the primer or adapter on the surface may be less than or equal to that indicated for the effective surface density of oligonucleotide primer or adapters. In some instances, the surface density of hybridized concatemer or nanoball sequences, or of clonally-amplified target nucleic acid sequences hybridized to primer or adapter sequences on the surface may span the same range as that indicated for the effective surface density of the oligonucleotide primer or adapter sequences. The local surface densities as listed above do not preclude variation in surface density across a surface, such that a surface may comprise a region having an oligonucleotide primer or adapter sequence surface density of, for example, 50,000 molecules per pm2, while also comprising at least a second region having a substantially different local surface density. 26 01 26

[00177] In some instances, the degree of hydrophilicity (or "wettability" with aqueous solutions) of the disclosed support surfaces may be assessed, for example, through the measurement of water contact angles in which a small droplet of water is placed on the surface and its angle of contact with the surface is measured using, e.g., an optical tensiometer. In some instances, a static contact angle may be determined. In some instances, an advancing or receding contact angle may be determined. In some instances, the water contact angle for the hydrophilic, low-binding support surfaced disclosed herein may range from about 0 degrees to about 50 degrees. In some instances, the water contact angle for the hydrophilic, low-binding support surfaced disclosed herein may be less than 50 degrees, less than 40 degrees, less than 30 degrees, less than 25 degrees, less than 20 degrees, less than 18 degrees, less than 16 degrees, less than 14 degrees, less than 12 degrees, less than 10 degrees, less than 8 degrees, less than 6 degrees, less than 4 degrees, less than 2 degrees, or less than 1 degree. In some cases, the contact angle is no more than 40 degrees. It is possible that a given hydrophilic, low-binding support surface of the present disclosure may exhibit a water contact angle having a value of anywhere within the range of 0 degrees to 50 degrees. Fluorescence imaging of support surfaces

[00178] The disclosed solid-phase nucleic acid amplification reaction formulations and low-binding supports may be used in any of a variety of nucleic acid analysis applications, e.g., nucleic acid base discrimination, nucleic acid base classification, nucleic acid base calling, nucleic acid detection applications, nucleic acid sequencing applications, and nucleic acid-based (genetic and genomic) diagnostic applications. In many of these applications, fluorescence imaging techniques may be used to monitor hybridization, amplification, or sequencing reactions performed on the low non-specific binding supports.

[00179] Fluorescence imaging may be performed using any of a variety of fluorophores, fluorescence imaging techniques, and fluorescence imaging instruments. Examples of fluorescence dyes that may be used (e.g., by conjugation to nucleotides, oligonucleotides, or proteins) include, but are not limited to, fluorescein, rhodamine, coumarin, cyanine, and derivatives thereof, including the cyanine derivatives Cyanine dye-3 (Cy3), Cyanine dye-5 (Cy5), Cyanine dye-7 (Cy7), etc. Examples of fluorescence imaging techniques that may be used include, but are not limited to, wide-field fluorescence microscopy fluorescence microscopy imaging, fluorescence confocal imaging, two-photon fluorescence, and the like. Examples of fluorescence imaging instruments that may be used include, but are not limited to, fluorescence microscopes equipped with an image sensor or camera, wide-field fluorescence microscopy, confocal fluorescence microscopes, two-photon fluorescence microscopes, or custom instruments that comprise a selection of light sources, lenses, mirrors, prisms, dichroic reflectors, apertures, and image sensors or cameras, etc. A non-limiting example of a fluorescence 26 01 26 microscope equipped for acquiring images of the disclosed low-binding support surfaces and clonally-amplified colonies (or clusters) of target nucleic acid sequences hybridized thereon is the Olympus 1X83 inverted fluorescence microscope equipped with ) 20x, 0.75 NA, a 532 nm light source, a bandpass and dichroic mirror filter set optimized for 532 nm long-pass excitation and Cy3 fluorescence emission filter, a Semrock 532 nm dichroic reflector, and a camera (Andor sCMOS, Zyla 4.2) where the excitation light intensity is adjusted to avoid signal saturation. Often, the support surface may be immersed in a buffer (e.g., 25 mM ACES, pH 7.4 buffer) while the image is acquired.

[00180] In some instances, the low non-specific binding surfaces exhibit reduced non-specific binding of proteins, nucleic acids, and other components of the hybridization or amplification formulations used for tethering target nucleic acid sequences (e.g., concatemer or nanoball sequences) to the surface or for performing solid-phase nucleic acid amplification. The degree of non-specific binding exhibited by a given support surface may be assessed either qualitatively or quantitatively. For example, in some instances, exposure of the surface to fluorescent dyes (e.g., Cy3, Cy5, etc.), fluorescently-labeled nucleotides, fluorescently-labeled oligonucleotides, or fluorescently-labeled proteins (e.g. polymerases) under a standardized set of conditions followed by a specified rinse protocol and fluorescence imaging may be used as a qualitative or quantitative tool for comparison of non-specific binding on surfaces comprising different surface formulations -provided that care has been taken to ensure that the fluorescence imaging is performed under conditions where fluorescence signal is linearly related (or related in a predictable manner) to the number of fluorophores on the support surface (e.g., under conditions where signal saturation or self-quenching of the fluorophore is not an issue) and calibration standards are used. In some instances, other existing techniques, for example, radioisotope labeling and counting methods may be used for quantitative assessment of the degree to which non-specific binding is exhibited by different surface formulations. In some instances, the low non-specific-binding surfaces of the present disclosure may exhibit non-specific protein binding (or non-specific binding of other specified molecules, e.g., Cy3 dye) of less than 0.001 molecule per pm2, less than 0.01 molecule per pm2, less than 0.1 molecule per pm2, less than 0.25 molecule per pm2, less than 0.5 molecule per pm2, less than 1 molecule per pm2, less than 10 molecules per pm2, less than 100 molecules per pm2, or less than 1,000 molecules per pm2. It is possible that a given surface may exhibit non-specific binding falling anywhere within this range, for example, of less than 86 molecules per pm2.

[00181] In some instances, the performance of nucleic acid hybridization or amplification reactions using the disclosed low non-specific binding surfaces may be assessed using fluorescence imaging techniques, where the contrast-to-noise ratio (CNR) of the images provides a key metric in assessing, e.g., amplification specificity or non-specific binding on the support. CNR is commonly 75 26 01 26 defined as: CNR = (Signal - Background) / Noise. The background term is commonly taken to be the signal measured for the interstitial regions surrounding a particular feature (e.g., a diffraction limited spot, DLS) in a specified region of interest (ROI). While signal-to-noise ratio (SNR) is often considered to be a benchmark of overall signal quality, it can be shown that improved CNR can provide a significant advantage over SNR as a benchmark for signal quality in applications that require rapid image capture (e.g., sequencing applications for which cycle times may be minimized). At high CNR the imaging time required to reach accurate discrimination (and thus accurate base-calling in the case of sequencing applications) can be drastically reduced even with moderate improvements in CNR.

[00182] In most ensemble-based sequencing approaches, the background term is measured as the signal associated with 'interstitial' regions. In addition to "interstitial" background (Binter),"intrastitial" background (Bintra) exists within the region occupied by, e.g., an amplified DNA colony. The combination of these two background signals dictates the achievable CNR, and subsequently directly impacts the optical instrument requirements, architecture costs, reagent costs, run- times, cost / genome, and ultimately the accuracy and data quality for cyclic array-based sequencing applications. The Bmter background signal arises from a variety of sources; a few examples include auto-fluorescence from consumable flow cells, non-specific adsorption of detection molecules that yield spurious fluorescence signals that may obscure the signal from the ROI, the presence of non-specific DNA amplification products (e.g., those arising from primer dimers). In next generation sequencing (NGS) applications, this background signal in the current field-of-view (FOV) is averaged overtime and subtracted. The signal arising from individual DNA colonies (e.g., (S) - Bmter in the FOV) yields a discernable feature that can be classified. In some instances, the Bintra can contribute a confounding fluorescence signal that is not specific to the target of interest but is present in the same ROI thus making it far more difficult to average and subtract. A more accurate calculation of CNR is thus provided by the formula CNR = (Signal -Background) / Noise, where Background = Bmter + Bintra.

[00183] In some instances, as a result of the extremely low non-specific binding (low background signal) and dense, tightly packed nanoball sequences (or clonally-amplified target nucleic acid clusters) that are achievable on the disclosed surfaces, fluorescence images of said surfaces may exhibit improvements in CNR by a factor of 2, 5, 10, 100, or 1000-fold over those achieved using conventional support surfaces. In some instances, fluorescence images of one or more interior surfaces of the sequencing flow cells disclosed herein, when used in nucleic acid hybridization or amplification applications to create clusters of hybridized or clonally-amplified nucleic acid molecules (e.g., that have been directly or indirectly labeled with a fluorophore), or when used to 26 01 26 perform sequencing of the disclosed barcoded padlock probe and molecular inversion probe assays) may exhibit contrast-to-noise ratios (CNRs) of at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20,210, 220, 230, 240, 250, or greater than 250 when the image is acquired under a defined set of conditions, e.g., when the nucleic acid molecules or complementary sequences thereof are labeled with a Cy3 fluorophore, and when the fluorescence image is acquired using an Olympus 1X83 inverted fluorescence microscope equipped with a total internal reflectance fluorescence (TIRF) lOOx, 1.5 NA objective, a 100W Hg lamp, a 532 nm long-pass excitation filter, a Semrock 532 nm dichroic reflector, and an Olympus EM-CCD camera under non-signal saturating conditions while the surface is immersed in a 25 mM ACES, pH 7.4 buffer.

[00184] In some embodiments, sequencing methods utilizing the compositions and methods disclosed herein may incorporate a detection method enabling base calling to reveal the sequence of the target nucleic acid. In some embodiments, these detection methods may include any method for nucleic acid detection or nucleic acid sequencing. In some embodiments, the systems described herein are used to perform the base calling procedure. In some embodiments, said detection methods may include, for example, one or more of fluorescence detection, colorimetric detection, luminescence (such as chemiluminescence of bioluminescence) detection, interferometric detection, resonance-based detection such as Raman detection, spin resonance-based detection, NMR-based detection, and the like, and other methods such as electrical detection, for example, capacitance-based detection, impedance based detection, or electrochemical detection, such as detection of electrons generated by or within a chemical reaction, or combinations of electrical, such as, e.g., impedance measurements, with other, e.g., optical measurements.

[00185] It may be advantageous to provide the multivalent binding compositions in combination with other elements such as to provide optimized signals, for example to provide identification of a nucleotide at a particular position in a nucleic acid sequence. In some embodiments, the compositions disclosed herein are provided in combination with a surface providing low background binding or low levels of protein binding, especially a hydrophilic or polymer coated surface. Representative surfaces may be found, for example, in U.S. Patent Application No. 16 / 363,842. Imaging modules

[00186] In some instances, the disclosed systems may comprise one or more imaging modules, where an imaging module comprises, e.g., one or more light sources (e.g., lasers, laser diodes, arc lamps, tungsten-halogen lamps, etc.), one or more optical components (e.g., lenses, mirrors, prisms, optical fdters, colored glass fdters, narrowband interference fdters, broadband interference filters, dichroic reflectors, diffraction gratings, apertures, optical fibers, or optical waveguides and the like), and one or more image sensors (e.g., charge-coupled device (CCD) sensors or cameras, 26 01 26 complementary metal-oxide-semiconductor (CMOS) image sensors or cameras, or negative-channel metal-oxide semiconductor (NMOS) image sensors or cameras) configured for imaging one or more interior surfaces of a sequencing flow cell or detection of binding of the disclosed multivalent binding compositions to target (or template) nucleic acid sequences tethered to a surface on the interior of a sequencing flow cell. Fluid flow controllers or fluid dispensing systems

[00187] In some instances, the system may further comprise one or more fluid flow controllers or fluid dispensing modules configured to sequentially and iteratively contact template nucleic acid sequences hybridized to adapter or primer sequences on the interior surface(s) of the flow cell (or otherwise tethered thereto) with the disclosed multivalent binding compositions or reagents. In some instances, said contacting may be performed within one or more flow cells. In some instances, said one or more flow cells may be fixed components of the system. In some instances, said one or more flow cells may be removable or disposable components of the system. Computer Control Systems.

[00188] The present disclosure provides computer systems that are programmed or otherwise configured to implement methods provided herein, for example, methods for nucleic sequencing, storing reference nucleic acid sequences, conducting sequence analysis or comparing sample and reference nucleic acid sequences as described herein. An example of such a computer system is shown in Fig. 10. The computer system 1001 includes a central processing unit (CPU, also “processor” and “computer processor” herein) 1005, which can be a single core or multi core processor, or a plurality of processors for parallel processing. The computer system 1001 also includes memory or memory location 1010 (e.g., random-access memory, read-only memory, flash memory), electronic storage unit 1015 (e.g., hard disk), communication interface 1020 (e.g., network adapter) for communicating with one or more other systems, and peripheral devices 1025, such as cache, other memory, data storage or electronic display adapters. The memory 1010, storage unit 1015, interface 1020 and peripheral devices 1025 are in communication with the CPU 1005 through a communication bus (solid lines), such as a motherboard. The storage unit 1015 can be a data storage unit (or data repository) for storing data. The computer system 1001 can be operatively coupled to a computer network (“network”) 1030 with the aid of the communication interface 1020. The network 1030 can be the Internet, an internet or extranet, or an intranet or extranet that is in communication with the Internet. The network 1030 in some cases is a telecommunication or data network. The network 1030 can include one or more computer servers, which can enable distributed computing, such as cloud computing. The network 1030, in some cases with the aid of the computer system 1001, can implement a peer-to-peer network, which may enable devices coupled to the computer system 1001 to behave as a client or a server. 26 01 26

[00189] The CPU 1005 can execute a sequence of machine-readable instructions, which can be embodied in a program or software. The instructions may be stored in a memory location, such as the memory 1010. Examples of operations performed by the CPU 1005 can include fetch, decode, execute, and writeback.

[00190] The storage unit 1015 can store files, such as drivers, libraries and saved programs. The storage unit 1015 can store user data, e.g., user preferences and user programs. The computer system 1001 in some cases can include one or more additional data storage units that are external to the computer system 1001, such as located on a remote server that is in communication with the computer system 1001 through an intranet or the Internet.

[00191] The computer system 1001 can communicate with one or more remote computer systems through the network 1030. For instance, the computer system 1001 can communicate with a remote computer system of a user (e.g., operator). Examples of remote computer systems include personal computers (e.g., portable PC), slate or tablet PC’s (e.g., Apple® iPad, Samsung® Galaxy Tab), telephones, Smart phones (e.g., Apple® iPhone, Android-enabled device, Blackberry®), or personal digital assistants. The user can access the computer system 1001 via the network 1030.

[00192] Methods as described herein can be implemented by way of machine (e.g., computer processor) executable code stored on an electronic storage location of the computer system 1001, for example, on the memory 1010 or electronic storage unit 1015. The machine executable or machine readable code can be provided in the form of software. During use, the code can be executed by the processor 1005. In some cases, the code can be retrieved from the storage unit 1015 and stored on the memory 1010 for ready access by the processor 1005. In some situations, the electronic storage unit 1015 can be precluded, and machine-executable instructions are stored on memory 1010.

[00193] The code can be pre-compiled and configured for use with a machine have a processer adapted to execute the code or can be compiled during runtime. The code can be supplied in a programming language that can be selected to enable the code to execute in a pre-compiled or as-compiled fashion.

[00194] Aspects of the systems provided herein, such as the computer system 1001, can be embodied in programming. Various aspects of the technology may be thought of as “products” or “articles of manufacture” in the form of machine (or processor) executable code or associated data that is carried on or embodied in a type of machine readable medium. Machine-executable code can be stored on an electronic storage unit, such memory (e.g., read-only memory, random-access memory, flash memory) or a hard disk. “Storage” type media can include any or all of the tangible memory of the computers, processors or the like, or associated modules thereof, such as various semiconductor memories, tape drives, disk drives and the like, which may provide non-transitory storage at any time for the software programming. All or portions of the software may at times be communicated through the Internet or 26 01 26 various other telecommunication networks. Such communications, for example, may enable loading of the software from one computer or processor into another, for example, from a management server or host computer into the computer platform of an application server. Thus, another type of media that may bear the software elements includes optical, electrical and electromagnetic waves, such as used across physical interfaces between local devices, through wired and optical landline networks and over various air-links. The physical elements that carry such waves, such as wired or wireless links, optical links or the like, also may be considered as media bearing the software. As used herein, unless restricted to non-transitory, tangible “storage” media, terms such as computer or machine “readable medium” refer to any medium that participates in providing instructions to a processor for execution.

[00195] Hence, a machine readable medium, such as computer-executable code, may take many forms, including but not limited to, a tangible storage medium, a carrier wave medium or physical transmission medium. Non-volatile storage media include, for example, optical or magnetic disks, such as any of the storage devices in any computer(s) or the like, such as may be used to implement the databases, etc. shown in the drawings. Volatile storage media include dynamic memory, such as main memory of such a computer platform. Tangible transmission media include coaxial cables; copper wire and fiber optics, including the wires that comprise a bus within a computer system. Carrier-wave transmission media may take the form of electric or electromagnetic signals, or acoustic or light waves such as those generated during radio frequency (RF) and infrared (IR) data communications. Common forms of computer-readable media therefore include for example: a floppy disk, a flexible disk, hard disk, magnetic tape, any other magnetic medium, a CD-ROM, DVD or DVD-ROM, any other optical medium, punch cards paper tape, any other physical storage medium with patterns of holes, a RAM, a ROM, a PROM and EPROM, a FLASH-EPROM, any other memory chip or cartridge, a carrier wave transporting data or instructions, cables or links transporting such a carrier wave, or any other medium from which a computer may read programming code or data. Many of these forms of computer readable media may be involved in carrying one or more sequences of one or more instructions to a processor for execution. The computer system 1001 can include or be in communication with an electronic display 1035 that comprises a user interface (UI) for providing, for example, an output or readout of a nucleic acid sequencing instrument coupled to the computer system 1001. Such readout can include a nucleic acid sequencing readout, such as a sequence of nucleic acid bases that comprise a given nucleic acid sample. The UI may also be used to display the results of an analysis making use of such readout. Examples of Ui’s include, without limitation, a graphical user interface (GUI) and web-based user interface. The electronic display 1035 can be a computer monitor, or a capacitive or resistive touchscreen. Processors and computer systems 26 01 26

[00196] One or more processors may be employed to implement the systems for nucleic acid sequencing or other nucleic acid detection and analysis methods disclosed herein. The one or more processors may comprise a hardware processor such as a central processing unit (CPU), a graphic processing unit (GPU), a general-purpose processing unit, or computing platform. The one or more processors may be comprised of any of a variety of integrated circuits (e.g., application specific integrated circuits (ASICs) designed specifically for implementing deep learning network architectures, or field-programmable gate arrays (FPGAs) to accelerate compute time, etc., or to facilitate deployment), microprocessors, emerging next-generation microprocessor designs (e.g., memristor-based processors), logic devices and the like. Although the disclosure is described with reference to a processor, other types of integrated circuits and logic devices may also be applicable. The processor may have any data operation capability. For example, the processor may perform 512 bit, 256 bit, 128 bit, 64 bit, 32 bit, or 16 bit data operations. The one or more processors may be single core or multi core processors, or a plurality of processors configured for parallel processing.

[00197] The one or more processors or computers used to implement the disclosed methods may be part of a larger computer system or may be operatively coupled to a computer network (a "network") with the aid of a communication interface to facilitate transmission of and sharing of data. The network may be a local area network, an intranet or extranet, an intranet or extranet that is in communication with the Internet, or the Internet. The network in some cases is a telecommunication or data network. The network may include one or more computer servers, which in some cases enables distributed computing, such as cloud computing. The network, in some cases with the aid of the computer system, may implement a peer-to-peer network, which may enable devices coupled to the computer system to behave as a client or a server.

[00198] The computer system may also include memory or memory locations (e.g., random-access memory, read-only memory, flash memory, Intel® Optane™ technology), electronic storage units (e.g., hard disks), communication interfaces (e.g., network adapters) for communicating with one or more other systems, and peripheral devices, such as cache, other memory, data storage or electronic display adapters. The memory, storage units, interfaces and peripheral devices may be in communication with the one or more processors, e.g., a CPU, through a communication bus, e.g., as is found on a motherboard. The storage unit(s) may be data storage unit(s) (or data repositories) for storing data.

[00199] The one or more processors, e.g., a CPU, execute a sequence of machine-readable instructions, which are embodied in a program (or software). The instructions are stored in a memory location. The instructions are directed to the CPU, which subsequently program or otherwise configure the CPU to implement the methods of the present disclosure. Examples of 26 01 26 operations performed by the CPU include fetch, decode, execute, and write back. The CPU may be part of a circuit, such as an integrated circuit. One or more other components of the system may be included in the circuit. In some cases, the circuit is an application specific integrated circuit (ASIC).

[00200] The storage unit stores files, such as drivers, libraries and saved programs. The storage unit stores user data, e.g., user-specified preferences and user-specified programs. The computer system in some cases may include one or more additional data storage units that are external to the computer system, such as located on a remote server that is in communication with the computer system through an intranet or the Internet.

[00201] Some aspects of the methods and systems provided herein may be implemented by way of machine (e.g., processor) executable code stored in an electronic storage location of the computer system, for example, in the memory or electronic storage unit. The machine-executable or machine-readable code may be provided in the form of software. During use, the code is executed by the one or more processors. In some cases, the code is retrieved from the storage unit and stored in the memory for ready access by the one or more processors. In some situations, the electronic storage unit is precluded, and machine-executable instructions are stored in memory. The code may be precompiled and configured for use with a machine having one or more processors adapted to execute the code or may be compiled at run time. The code may be supplied in a programming language that is selected to enable the code to execute in a pre-compiled or as-compiled fashion.

[00202] Various aspects of the technology may be thought of as "products" or "articles of manufacture", e.g., "computer program or software products", often in the form of machine- (or processor-) executable code or associated data that is stored in a type of machine readable medium, where the executable code comprises a plurality of instructions for controlling a computer or computer system in performing one or more of the methods disclosed herein. Machineexecutable code may be stored in an optical storage unit comprising an optically readable medium such as an optical disc, CD-ROM, DVD, or Blu-Ray disc. Machine-executable code may be stored in an electronic storage unit, such as memory (e.g., read-only memory, random-access memory, flash memory) or on a hard disk. "Storage" type media include any or all of the tangible memory of the computers, processors or the like, or associated modules thereof, such as various semiconductor memory chips, optical drives, tape drives, disk drives and the like, which may provide non-transitory storage at any time for the software that encodes the methods and algorithms disclosed herein.

[00203] All or a portion of the software code may at times be communicated via the Internet or various other telecommunication networks. Such communications, for example, enable loading 26 01 26 of the software from one computer or processor into another, for example, from a management server or host computer into the computer platform of an application server. Thus, other types of media that are used to convey the software encoded instructions include optical, electrical and electromagnetic waves, such as those used across physical interfaces between local devices, through wired and optical landline networks, and over various atmospheric links. The physical elements that carry such waves, such as wired or wireless links, optical links, or the like, are also considered media that convey the software encoded instructions for performing the methods disclosed herein. As used herein, unless restricted to non-transitory, tangible "storage" media, terms such as computer or machine "readable medium" refer to any medium that participates in providing instructions to a processor for execution.

[00204] The computer system often includes, or may be in communication with, an electronic display for providing, for example, images captured by a machine vision system. The display is often also capable of providing a user interface (UI). Examples of Ui's include but are not limited to graphical user interfaces (GUIs), web-based user interfaces, and the like. System control software

[00205] In some instances, the disclosed systems may comprise a computer (or processor) and computer-readable media that includes code for providing a user interface as well as manual, semiautomated, or fully-automated control of all system functions, e.g. control of a fluid flow controller or fluid dispensing system (or sub-system), a temperature control system (or subsystem), an imaging system (or sub-system), etc. In some instances, the system computer or processor may be an integrated component of the instrument system (e.g. a microprocessor or mother board embedded within the instrument). In some instances, the system computer or processor may be a stand-alone module, for example, a personal computer or laptop computer. Examples of fluid flow control functions that may be provided by the instrument control software include, but are not limited to, volumetric fluid flow rates, fluid flow velocities, the timing and duration for sample and reagent additions, rinse steps, and the like. Examples of temperature control functions that may be provided by the instrument control software include, but are not limited to, specifying temperature set point(s) and control of the timing, duration, and ramp rates for temperature changes. Examples of imaging system control functions that may be provided by the instrument control software include, but are not limited to, autofocus capability, control of illumination or excitation light exposure times and intensities, control of image acquisition rate, exposure time, data storage options, and the like. Image processing software 26 01 26

[00206] In some instances of the disclosed systems, the system may further comprise computer-readable media that includes code for providing image processing and analysis capability. Examples of image processing and analysis capability that may be provided by the software include, but are not limited to, manual, semi-automated, or fully-automated image exposure adjustment (e.g. white balance, contrast adjustment, signal-averaging and other noise reduction capability, etc.), manual, semi-automated, or fully-automated edge detection and object identification (e.g., for identifying clusters of amplified template nucleic acid molecules on a substrate surface), manual, semi-automated, or fully-automated signal intensity measurements or thresholding in one or more detection channels (e.g., one or more fluorescence emission channels), manual, semi-automated, or fully-automated statistical analysis (e.g., for comparison of signal intensities to a reference value for base-calling purposes).

[00207] In some instances, the system software may provide integrated real-time image analysis and instrument control, so that sample loading, reagent addition, rinse, or imaging / base-calling steps may be prolonged, modified, or repeated until, e.g., optimal base-calling results are achieved. Any of a variety of existing image processing and analysis algorithms may be used to implement real-time or post-processing image analysis capability. Examples include, but are not limited to, the Canny edge detection method, the Canny-Deriche edge detection method, first-order gradient edge detection methods (e.g. the Sobel operator), second order differential edge detection methods, phase congruency (phase coherence) edge detection methods, other image segmentation algorithms (e.g. intensity thresholding, intensity clustering methods, intensity histogram-based methods, etc.), feature and pattern recognition algorithms (e.g. the generalized Hough transform for detecting arbitrary shapes, the circular Hough transform, etc.), and mathematical analysis algorithms (e.g. Fourier transform, fast Fourier transform, wavelet analysis, auto-correlation, etc.), or combinations thereof.

[00208] In some instances, the system control and image processing / analysis software may be written as separate software modules. In some instances, the system control and image processing / analysis software may be incorporated into an integrated software package. Data analysis software

[00209] In some instances of the disclosed systems, the system may further comprise computer-readable media that includes code for performing data analysis, e.g., software for decoding of probe barcodes, sample demultiplexing, binning of probe barcode sequences detected for a given sample barcode, counting of barcode sequencing, etc. In some instances, the data analysis software may further comprise data analytics (e.g., statistical analysis) and data display capabilities. In some instances, the data analysis software may comprise tools for performing a 26 01 26 preliminary assessment of assay specificity or for determining other assay performance quality metrics. Kits for Detecting Pathogenic Nucleic Acids

[00210] Disclosed herein are kits. In some instances, the kits of the present disclosure may comprise one or more sets of barcoded padlock probes or molecular inversion probes, one or more sets of sample-indexed amplification primers, assay buffers and reagents required to perform sample purification, nucleic acid extraction, hybridization, ligation, and amplification (including RCA), and sequencing (including any combination of the multivalent binding compositions disclosed herein), one or more sequencing flow cells, or any combination thereof.

[00211] Disclosed herein, in some embodiments, are kits for preparing a nucleic acid sequencing library using the compositions, methods, or systems disclosed herein. In some embodiments, the kits comprise compositions described herein, such as reagents and substrates for detecting a presence of a target nucleic acid sequence in one or more samples of a plurality of samples.

[00212] The kit disclosed herein comprise enzymes, nucleic acids, nucleotides, supports with functionalized surfaces, a polymer-nucleotide composition, a buffer system, or instructions. In some embodiments, the kit disclosed herein may comprise a solution comprising nucleic acid molecules extracted from a sample of the plurality of samples with a linear nucleic acid probe molecule under conditions that promote hybridization of complementary sequences. In some embodiments, the linear nucleic acid probe molecule comprises a target-specific 5 ’ region that is complementary to a first region of the target nucleic acid sequence, an amplification primer binding region, a probe barcode sequence, and a target-specific 2’ region that is complementary to a second region of the target nucleic acid sequence. In some embodiments, the linear nucleic acid probe molecule comprises a target-specific 5’ region that is complementary to a first region of the target nucleic acid sequence, an amplification primer binding region, a sample barcode sequence, a probe barcode sequence, and a target-specific 2’ region that is complementary to a second region of the target nucleic acid sequence. In some embodiments, the sample barcode sequence is unique for each sample in the plurality of samples. In some embodiments, the probe barcode sequence is unique for each pair of target-specific 5 ’ and target-specific 3’regions. In some embodiments, the first region of the target nucleic acid sequence and the second region of the target nucleic acid sequence are contiguous sequences in the target nucleic acid molecule. In some embodiments, the amplification primer is complementary to the amplification primer binding region. In some embodiments, the enzymes may be ligating enzymes, proteases, transposases, any one of enzymes described herein and combination thereof. In some embodiments, the nucleic acids may be oligonucleotides, splint oligonucleotides, any oligonucleotides or nucleic acids described herein, or any combinations thereof. In some embodiments, nucleotides may comprise nucleotides with 26 01 26 blocking moieties. In some embodiments, nucleotides may comprise polymer-nucleotide conjugates. In some embodiments, nucleotides may comprise detection moieties. In some embodiments, supports with functionalized surfaces may comprise a plastic, metal, glass, or any combinations thereof for the support. In some embodiments, supports with functionalized surfaces may comprise hydrophilic, hydrophobic, polymeric, primed, or any combinations thereof for the functionalization.

[00213] In some embodiments, the instructions may comprise a description for a method of circularizing single stranded nucleic acid, single stranded DNA, single stranded RNA, double-stranded nucleic acid, double-stranded DNA...

Claims

02 10 251. A method for nucleic acid detection, said method comprising:(a) contacting a nucleic acid sequence obtained from a sample with a nucleic acid probe molecule comprising a distal end and a proximal end under conditions sufficient to couple said distal end of said nucleic acid probe molecule and said proximal end of said nucleic acid probe molecule to said nucleic acid sequence, wherein said nucleic acid probe molecule comprises capture sequences complementary to the nucleic acid sequence, a probe-specific barcode sequence, an amplification primer binding site adjacent to the probe-specific barcode sequence, and a sequence that hybridizes to one or more surface-bound primers;(b) contacting said nucleic acid probe molecule with a ligating enzyme under conditions sufficient to ligate said distal end of said nucleic acid probe molecule to said proximal end of said nucleic acid probe molecule, thereby forming a circular nucleic acid probe molecule;(c) conducting a rolling circle amplification reaction on the circular nucleic acid probe molecule to generate a concatemer molecule that forms a nanoball, wherein the sequence that hybridizes to one or more surface-bound primers binds to a primer on a surface of a flow cell thereby immobilizing the concatemer molecule on the flow cell;(d) contacting a primer nucleic acid sequence to said concatemer molecule to form a primed concatemer molecule;(e) detecting a presence of said nucleic acid sequence comprising performing a nucleotide binding reaction in the presence of a polymerizing enzyme between (i) said primed concatemer molecule and (ii) a nucleotide moiety comprising a detectable label without incorporating said nucleotide moiety into said primer nucleic acid sequence; and (f) identifying said nucleic acid sequence.

2. The method of claim 1, wherein the rolling circle amplification occurs in solution, and wherein immobilization of the concatemer molecule on the flow cell comprises loading the nanoball onto the flow cell.

3. The method of claim 1, wherein the rolling circle amplification is performed on the surface of the flow cell.

4. The method of any one of claims 1-3, wherein said circular nucleic acid probe molecule comprises a gap in a sequence thereof.

5. The method of claim 4, further comprising contacting said nucleic acid probe molecule with a polymerizing enzyme under conditions sufficient to perform an extension reaction, thereby filling said gap with a copy of a portion of said nucleic acid sequence.02 10 256. The method of claim 5, wherein said sequence of said circular nucleic acid probe molecule that is identified in (f) comprises said portion of said nucleic acid sequence.

7. The method of claim 5, further comprising contacting said nucleic acid probe moleculewith a ligating enzyme under conditions sufficient to ligate said distal end of said nucleic acid probe molecule to said proximal end of said nucleic acid probe molecule following said extension reaction.

8. The method of claim 4, wherein said gap comprises between 1 and 200 contiguous nucleotides in length.

9. The method of claim 1, wherein said nucleic acid probe molecule is linear when unhybridized.

10. The method of claim 1, wherein said barcode sequence uniquely identifies said presence of said nucleic acid sequence.

11. The method of claim 1, wherein said sequence of said circular nucleic acid probe molecule that is identified in (f) comprises said barcode sequence.

12. The method of claim 1, further comprising:(g) repeating (a) to (f) to identify a plurality of said nucleic acid sequence in a sample; and (h) counting a number of times each said nucleic acid sequence of said plurality of said nucleic acid sequence is identified in (f).

13. The method of claim 12, further comprising determining a copy number of said nucleic acid sequence in said sample, wherein said copy number of said nucleic acid sequence in said sample is proportional to said number of said times said each said nucleic acid sequence is counted in (h).

14. The method of claim 1, further comprising:(g) repeating (a) to (f) to identify a plurality of nucleic acid sequences comprising said nucleic acid sequence in the sample, wherein a first subset of said plurality of nucleic acid sequences comprises said nucleic acid sequence and is different from a second subset of said plurality of said nucleic acid sequences comprising said nucleic acid sequence; and (h) counting a number of times a first nucleic acid sequence of said first subset and a second nucleic acid sequence of said second subset are identified in (f).

15. The method of claim 14, wherein said first subset of said plurality of said nucleic acid sequences is identified using a first nucleic acid probe molecule that is different from a second nucleic acid probe molecule used to identify said second subset of said nucleic acid sequences in that:(i) said first nucleic acid probe molecule comprises a different barcode sequence from said second nucleic acid probe molecule;(ii) said first nucleic acid probe molecule comprises a different distal end or proximal end from said second nucleic acid probe molecule; or02 10 25(iii) a combination of (i) and (ii).

16. The method of claim 1, further comprising detecting a presence of a second nucleic acid sequence in said sample, comprising:(g) contacting said second nucleic acid sequence in said sample with a second nucleic acid probe molecule under conditions sufficient to couple said second nucleic acid sequence with said second nucleic acid probe molecule, wherein said second nucleic acid probe molecule comprises capture sequences complementary to the second nucleic acid sequence, a second probe-specific barcode sequence, an amplification primer binding site adjacent to the second probe-specific barcode sequence, and a sequence that hybridizes to one or more surface-bound primers;(h) contacting said second nucleic acid probe molecule with a ligating enzyme under conditions sufficient to ligate said distal end of said second nucleic acid probe molecule to said proximal end of said second nucleic acid probe molecule, thereby forming a second circular nucleic acid probe molecule;(i) conducting a rolling circle amplification reaction on the second circular nucleic acid probe molecule to generate a second concatemer molecule that forms a nanoball, wherein the sequence that hybridizes to one or more surface bound primers binds to a primer on a surface of the flow cell thereby immobilizing the concatemer molecule on the flow cell;(j) contacting a primer nucleic acid sequence to said second concatemer molecule to form a second primed concatemer molecule;(k) contacting said second primed concatemer molecule with (i) a second polymerizing enzyme and (ii) a second nucleotide moiety comprising a second detectable label under conditions sufficient to cause a second nucleotide binding reaction to occur between said second primed concatemer molecule and said second nucleotide moiety in the absence of incorporation of said second nucleotide moiety into said second primed concatemer molecule; and(I) identifying said second nucleic acid sequence, wherein said second nucleic acid sequence is different from said nucleic acid sequence identified in (f).

17. The method of claim 1, wherein said nucleotide moiety is coupled to a polymer core in a polymer-nucleotide composition, forming a polymer-nucleotide conjugate.

18. The method of claim 17, wherein said detectable label is coupled to said polymer core of said polymer-nucleotide composition.

19. The method of claim 1, wherein said nucleotide binding reaction comprises two or more binding events between two or more of said nucleotide moiety and two or more copies of said nucleic acid sequence.02 10 2520. The method of claim 1, wherein said detectable label comprises a fluorescent label.

21. The method of claim 1, further comprising detecting a presence of a second nucleic acidsequence derived from a second sample, comprising:(g) contacting said second nucleic acid sequence from said second sample with a second nucleic acid probe molecule under conditions sufficient to couple said second nucleic acid sequence with said second nucleic acid probe molecule, wherein said second nucleic acid probe molecule comprises capture sequences complementary to the second nucleic acid sequence, a second probe-specific barcode sequence, an amplification primer binding site adjacent to the second probe-specific barcode sequence, and a sequence that hybridizes to one or more surface-bound primers;(h) contacting said second nucleic acid probe molecule with a ligating enzyme under conditions sufficient to ligate said distal end of said second nucleic acid probe molecule to said proximal end of said second nucleic acid probe molecule, thereby forming said second circular nucleic acid probe molecule;(i) conducting a rolling circle amplification reaction on the second circular nucleic acid probe molecule to generate a second concatemer molecule that forms a nanoball, wherein the sequence that hybridizes to one or more surface bound primers binds to a primer on a surface of the flow cell thereby immobilizing the concatemer molecule on the flow cell;(j) contacting a primer nucleic acid sequence to said second concatemer molecule to form a second primed concatemer molecule;(k) contacting said second primed concatemer molecule with (i) a second polymerizing enzyme and (ii) a second nucleotide moiety comprising a second detectable label under conditions sufficient to cause a second nucleotide binding reaction to occur between said second primed concatemer molecule and said second nucleotide moiety in the absence of incorporation of said second nucleotide moiety into said second primed concatemer molecule; and(I) identifying said second nucleic acid sequence from said second sample, wherein said second nucleic acid sequence is different from said nucleic acid sequence identified in (f), thereby detecting said presence of said second nucleic acid sequence in said second sample.

22. The method of claim 21, wherein said second sample is obtained from a different source from said sample.

23. The method of claim 21, further comprising tracing a pathogenic infection by a pathogenic source of said nucleic acid sequence and said second nucleic acid sequence, wherein said tracing comprises comparing a first location or a first time of collection of said sample with a second location or a second time of collection of said second sample.

24. The method of claim 1, wherein the nucleic acid probe molecule comprises a samplespecific barcode unique for a given sample within a plurality of samples, and the method comprises identifying the nucleic acid sequence in the plurality of samples.

25. The method of any one of claims 1-24, wherein said sample is obtained from a source comprising:(i) soil;(ii) sewage;(iii) biological tissue;(iv) food;(v) a surface of an object in contact with one or more of (i) to (iv); or(vi) any combination of (i) to (v).02 10 25

Images