Kit and method for visual identification of RHDV type 1 and type 2 by means of LAMP-CRISPR / Cas12a
The LAMP-CRISPR/Cas12a kit and method provide rapid, sensitive, and specific visual identification of RHDV1 and RHDV2, addressing the limitations of existing detection methods by enabling efficient on-site diagnosis with high accuracy and low equipment requirements.
Patent Information
- Application Number
- GB2025009596
- Authority / Receiving Office
- GB · GB
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-01-19
- Filing Date
- 2024-03-21
- Publication Date
- 2025-11-19
AI Technical Summary
Current methods for detecting rabbit hemorrhagic disease viruses RHDV1 and RHDV2 are inaccurate, require professional equipment, and cannot be conducted quickly on site, especially during the window period, and there is a lack of rapid visual identification techniques using LAMP and CRISPR/Cas12a.
A kit and method utilizing LAMP-CRISPR/Cas12a for visual identification of RHDV1 and RHDV2, incorporating specific primer pairs and gRNAs, with optional lateral flow strips or blue light analyzers for rapid detection.
The method achieves rapid, sensitive, and specific detection of RHDV1 and RHDV2 with visible results within 1.5 hours, suitable for resource-limited regions, with high consistency rates compared to fluorescence quantitative PCR.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[0002] The present disclosure belongs to the technical field of pathogenic microorganism detection, and specifically relates to a kit and a method for visual identification of a rabbit hemorrhagic disease virus type 1 (RHDV1) and a rabbit hemorrhagic disease virus type 2 (RHDV2) by loop-mediated isothermal amplification (LAMP)-clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated protein 12a (Casl2a). BACKGROUND
[0003] Rabbit hemorrhagic disease (RHD) is an acute, severe, and highly contagious disease caused by rabbit hemorrhagic disease virus (RHDV), and shows an extremely high mortality rate and seriously threatens the development of rabbit industry. Compared with a classic RHDV, called rabbit hemorrhagic disease virus type 1 (RHDV1), a strain rabbit hemorrhagic disease virus type 2 (RHDV2) has a wider host range, multiple transmission routes, and strong resistance in the natural environment, and causes huge economic losses to the breeding industry. Therefore, efficient and accurate diagnostic tools that can identify the two strains are particularly important for the control of RHD epidemics.
[0004] Currently, there are detection methods such as PCR, fluorescence quantitative PCR, hemagglutination test, and enzyme-linked immunosorbent assay (ELISA). Immunological detection methods such as the hemagglutination test and ELISA have poor accuracy and are difficult to detect during the window period. Pathogenic detection methods such as the RT-PCR and fluorescence quantitative PCR require professional instruments, and are generally laboratory tests that cannot be conducted quickly on site, thus failing to meet the detection demands of grassroots farms. At present, there are no reports on the rapid visual identification of RHDV based on two techniques LAMP and CRISPR-Casl2a. Moreover, there are no reports on use of the two techniques in rapid identification of RHDV 1 and RHDV2. SUMMARY
[0005] The present disclosure provides a kit and a method for visual identification of an RHDV1 and an RHDV2 by LAMP-CRISPR / Casl2a. In the present disclosure, the kit and the method can accurately identify the two strains RHDV1 and RHDV2 with rapidity, high sensitivity, excellent specificity, visualization, and low equipment requirements.
[0006] To solve the above technical problems, the present disclosure provides the following technical solutions:
[0007] The present disclosure provides a kit for visual identification of an RHDV1 and an RHDV2 by LAMP-CRISPR / Casl2a, including a LAMP amplification system and a CRISPR / Casl2a detection system; where the LAMP amplification system includes outer primer pairs of F3 and B3 and two inner primer pairs of FIP and BIP; the outer primer pair of F3 and B3 has nucleotide sequences shown in SEQ ID NO: 13 and SEQ ID NO: 14 and the inner primer pair of FIP and BIP has nucleotide sequences shown in SEQ ID NO: 15 and SEQ ID NO: 16 in the LAMP amplification system for the RHDV1; and the outer primer pair of F3 and B3 has nucleotide sequences shown in SEQ ID NO: 24 and SEQ ID NO: 25 and the inner primer pair of FIP and BIP has nucleotide sequences shown in SEQ ID NO: 26 and SEQ ID NO: 27 in the LAMP amplification system for the RHDV2; and the CRISPR / Casl 2a detection system includes gRNAs; the gRNA in the CRISPR / Casl2a detection system for the RHDV1 has a nucleotide sequence shown in SEQ ID NO: 37; and the gRNA in the CRISPR / Casl2a detection system for the RHDV2 has a nucleotide sequence shown in SEQ ID NO: 39.
[0008] Preferably, the LAMP amplification system further includes a loop primer LF and loop primers LB; the loop primer LB in the LAMP amplification system for the RHDV1 has a nucleotide sequence shown in SEQ ID NO: 17; and the loop primer LF and the loop primer LB in the LAMP amplification system for the RHDV2 have nucleotide sequences shown in SEQ ID NO: 28 and SEQ ID NO: 29.
[0009] Preferably, the LAMP amplification system further includes a LAMP / RT-LAMP 2X premix, a nucleic acid to be tested, and nuclease-free water.
[0010] Preferably, the CRISPR / Casl2a detection system further includes a LAMP amplification product, an RNase inhibitor, NEBuffer 2.1, a Casl2a protein, an ssDNA reporter molecule, and nuclease-free water.
[0011] Preferably, the kit further includes a lateral flow strip (LFS) or a blue light analyzer.
[0012] Preferably, when the kit includes the LFS, an ssDNA reporter molecule is a biotin ssDNA reporter molecule; and when the kit includes the blue light analyzer, the ssDNA reporter molecule is a fluorescence quenching ssDNA reporter molecule.
[0013] The present disclosure further provides use of the kit in preparation of a product for identifying an RHDVI and an RHDV2. The present disclosure further provides a method for visual identification of an RHDVI and an RHDV2 by LAMP-CRISPR / Casl2a in a non-diagnostic purpose, including the following steps: (1) extracting an RNA of a sample to be tested; (2) conducting LAMP amplification in a LAMP amplification system using the RNA extracted in step (1) as a template; and (3) digesting a LAMP amplification product obtained in step (2) in a CR1SPR / Casl2a detection system and then conducting fluorescence detection; alternatively, digesting the LAMP amplification product in the CRISPR / Casl2a detection system and then conducting LFS detection.
[0014] Preferably, the LAMP amplification system has a total volume of 25 pL and includes 12.5 pL of a LAMP / RT-LAMP 2X premix, 2.5 pL of a primer mixture, 2 pL of the extracted RNA, and 8 pL of nuclease-free water.
[0015] Preferably, in the LAMP amplification system for the RHDVI, the outer primer pair of F3 and B3 has independently a final concentration of 200 nM, the inner primer pair of FIP and BIP has independently a final concentration of 1,200 nM, and the loop primer LB has a final concentration of 600 nM in the primer mixture; and in the LAMP amplification system for the RHDV2, the outer primer pair of F3 and B3 has independently a final concentration of 200 nM, the inner primer pair of FIP and BIP has independently a final concentration of 800 nM, and the loop primer LF and the loop primer LB have independently a final concentration of 600 nM in the primer mixture.
[0016] Preferably, when the fluorescence detection is conducted, the CRISPR / Casl2a detection system has a total volume of 20 pL and includes 2 pL of the LAMP amplification product, 1 pL of an RNase inhibitor with a final concentration of 0.5 U / pL, 2 pL of a gRNA with a final concentration of 500 nM, 2 pL of NEBuffer 2.1, 1 pL of a Casl2a protein with a final concentration of 125 nM, 1 pL of a fluorescence quenching ssDNA reporter molecule with a final concentration of 250 nM, and 11 pL of nuclease-free water.
[0017] Preferably, when the LFS detection is conducted, the CRISPR / Casl2a detection system has a total volume of 20 pL and includes 2 pL of the LAMP amplification product, 1 pL of an RNase inhibitor with a final concentration of 0.5 U / pL, 2 pL of a gRNA with a final concentration of 500 nM, 2 pL of NEBuffer 2.1, 1 pL of a Casl2a protein with a final concentration of 125 nM, 1 pL of a biotin ssDNA reporter molecule with a final concentration of 100 nM, and 11 pL of nuclease-free water.
[0018] Preferably, the LAMP amplification is conducted at 65°C to 69°C for 25 min to 35 min.
[0019] Preferably, the digesting in the CRISPR / Casl2a detection system is conducted by incubation at 35°C to 38°C for 25 min to 35 min.
[0020] Compared with the prior art, the present disclosure has the following beneficial effects:
[0021] In order to quickly, conveniently, and specifically detect RHDV1 and RHDV2 strains, the kit and the method for rapid detection of the RHDV1 and the RHDV2 based on the LAMP-CRISPR / Casl2a are established as a platform. The platform shows a high sensitivity, is capable of detecting 10 copies / pL of a nucleic acid sample, and has a desirable specificity. The method and the kit are able to specifically identify strains of the RHDV1 and the RHDV2, and have no cross-reaction with other common pathogens in rabbits.
[0022] In the present disclosure, LFS detection and visual fluorescence detection are further conducted to obtain visible results within 1.5 h. In addition, 74 clinical samples are tested using the detection systems for RHDV1 and RHDV2, and consistency rates with fluorescence quantitative PCR are 97.30% and 97.30%, which are higher in sensitivity than those of the fluorescence quantitative PCR. The prepared kit and the constructed method have rapidity, high sensitivity, excellent specificity, visualization, and low equipment requirements during detection, and can be used clinically in remote rural regions and resource-limited regions. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] FIG. 1 shows a schematic diagram of a LAMP-CRISPR / Casl2a-based method combined with LFS and a blue light analyzer;
[0024] FIG. 2 shows three primer sets for detecting and screening RHDV1 and RHDV2 using fluorescent LAMP; where A is the RHDV1 primer set of Set 1, Set 2, and Set 3; B is the RHDV2 primer set of Set 1, Set 2, and Set 3;
[0025] FIG. 3 shows the results of a cross-validation experiment using LAMP to amplify RHDV1 and RHDV2; where A is the result of a cross-validation experiment using nucleic acid gel electrophoresis; B is the end point fluorescence value of the cross-validation experiment using fluorescent LAMP; n=3, ****P<0.0001;
[0026] FIG. 4 shows the screening results of a detection reaction temperature of RHDV 1 and RHDV2 using fluorescent LAMP; where A is the screening result of RHDV1; B is the screening result of RHDV2;
[0027] FIG. 5 shows the screening results of an inner primer-to-outer primer ratio of RHDV1 and RHDV2 using fluorescent LAMP; where A is the screening result of RHDV1; B is the screening result of RHDV2;
[0028] FIG. 6 shows the screening results of a loop primer concentration of RHDV1 and RHDV2 using fluorescent LAMP; where A is the screening result of RHDV1, B is the screening result of RHDV2;
[0029] FIG. 7 shows the detection results of RHDV1 and RHDV2 by visible LAMP;
[0030] FIG. 8 shows the detection results of a method by LAMP combined with CRISPR / Casl2a; where A is the fluorescence value change curve of the orthogonal experiment of gRNA screening in the CRISPR stage of the RHDV1 detection system and the optimization of Casl2a protein concentration; B is the fluorescence value change curve of the orthogonal experiment of gRNA screening in the CRISPR stage of the RHDV2 detection system and the optimization of Casl2a protein concentration; C is a comparison of the fluorescence values at the end point of the orthogonal experiment (three replicates); D is the trans-cleavage activity verification of Casl2a protein and the cross-experiment of the RHDV1 / RHDV2 detection method in the CRISPR stage; E is the result of the trans-cleavage activity verification and the cross-experiment under blue light;
[0031] FIG. 9 shows the evaluation results of a specificity of the LAMP-CRISPR / Casl2a-based method; where A and B are the specificity of the LAMP-CRISPR / Casl 2a fluorescence detection platform evaluated by the end point fluorescence value (n=3, ****P<0.0001); C and D are the specificity of the LAMP-CRISPR / Casl2a fluorescence detection platform evaluated by the imaging results under blue light; E and F are the specificity of the LFS detection platform based on LAMP-CRISPR / Casl2a; A, C, and E correspond to the detection system of RHDV1, while B, D, and F correspond to the detection system of RHDV2;
[0032] FIG. 10 shows the evaluation results of a sensitivity of the LAMP-CRISPR / Casl2a-based method; where A and B are the sensitivity of the LAMP-CRISPR / Casl2a fluorescence detection platform evaluated by the end point fluorescence value (n=3, ****P<0.0001); C and D are the sensitivity of the LAMP-CRISPR / Casl2a fluorescence detection platform evaluated by the imaging results under blue light; E and F are the sensitivity of the LFS detection platform based on LAMP-CRISPR / Casl2a; A, C, and E correspond to the detection system of RHDV1, while B, D, and F correspond to the detection system of RHDV2;
[0033] FIG. 11 shows the evaluation results of a clinical practicality of the LAMP-CRISPR / Casl2a-based method; where A and B are the end point fluorescence values of 74 clinical samples detected by the LAMP-CRISPR / Casl2a fluorescence detection method (the critical values are 55,482 and 57,905, respectively); C and D are the blue light irradiation results of 74 clinical samples detected by the LAMP-CRISPR / Casl2a fluorescence detection method; E and F are the results of 74 clinical samples detected by the LFS detection method based on LAMP-CRISPR / Casl2a; G and H are the results of 74 clinical samples detected by the qPCR method, herein circled numbers indicate that a detection result of the sample is inconsistent with that by the method established in this experiment; A, C, and E correspond to the detection system of RHDV1, while B, D, and F correspond to the detection system of RHDV2. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0034] The present disclosure provides a kit for visual identification of an RHDV1 and an RHDV2 by LAMP-CRISPR / Casl2a, including a LAMP amplification system and a CRISPR / Casl2a detection system; where the LAMP amplification system includes outer primer pairs of F3 and B3 and two inner primer pairs of FIP and BIP; the outer primer pair of F3 and B3 has nucleotide sequences shown in SEQ ID NO: 13 and SEQ ID NO: 14 and the inner primer pair of FIP and BIP has nucleotide sequences shown in SEQ ID NO: 15 and SEQ ID NO: 16 for the RHDV1; and the outer primer pair of F3 and B3 has nucleotide sequences shown in SEQ ID NO: 24 and SEQ ID NO: 25 and the inner primer pair of FIP and BIP has nucleotide sequences shown in SEQ ID NO: 26 and SEQ ID NO: 27 for the RHDV2; and the CRISPR / Casl2a detection system includes gRNAs; the gRNA for the RHDV1 has a nucleotide sequence shown in SEQ ID NO: 37; and the gRNA for the RHDV2 has a nucleotide sequence shown in SEQ ID NO: 39. In the kit, the LAMP amplification system further includes a loop primer LF and loop primers LB; the loop primer LB for the RHDV1 has a nucleotide sequence shown in SEQ ID NO: 17; and the loop primer LF and the loop primer LB for the RHDV2 have nucleotide sequences shown in SEQ ID NO: 28 and SEQ ID NO: 29.
[0035] In the present disclosure, multiple sets of primers for a conserved fragment VP60 are designed for RHDV1 (isolate WF2007, GenBank accession number: FJ794180) and RHDV2 (isolate SC2020 / 04, GenBank accession number: MT383749). Primers are selected to obtain the most efficient primer set, and it is ensured that there is no cross-reaction between the RHDV1 and RHDV2 systems. The loop primers are designed based on the outer and inner primers.
[0036] In the present disclosure, the LAMP amplification system has a total volume of 25 uL and includes 12.5 pL of a LAMP / RT-LAMP 2X premix, 2.5 pL of a primer mixture, 2 pL of the extracted RNA, and 8 pL of nuclease-free water. The primer mixture includes the outer primer pairs F3 and B3 and the inner primer pairs FIP and BIP, and further includes the loop primers LF and / or LB.
[0037] In the present disclosure, a preparation process of the primer mixture for RHDV1 includes the following steps: diluting each primer to 100 pM; adding 12 pL each of FIP / BIP, 2 pL each of F3 / B3, 6 pL of LB, and then adding nuclease-free water to a total volume of 100 pL to obtain the primer mixture for RHDV1.
[0038] In the present disclosure, a preparation process of the primer mixture for RHDV2 includes the following steps: diluting each primer to 100 pM; adding 8 pL each of FIP / BIP, 2 pL each of F3 / B3, 6 pL each of LF / LB, and then adding nuclease-free water to a total volume of 100 pL to obtain the primer mixture for RHDV2.
[0039] In the present disclosure, in the LAMP amplification system for the RHDV1, the outer primer pair of F3 and B3 has independently a final concentration of 200 nM, the inner primer pair of FIP and BIP has independently a final concentration of 1,200 nM, and the loop primer LB has a final concentration of 600 nM; and in the LAMP amplification system for the RHDV2, the outer primer pair of F3 and B3 has independently a final concentration of 200 nM, the inner primer pair of FIP and BIP has independently a final concentration of 800 nM, and the loop primer LF and the loop primer LB have independently a final concentration of 600 nM.
[0040] In the present disclosure, the CRISPR / Casl2a detection system further includes a LAMP amplification product, an RNase inhibitor, NEBuffer 2.1, a Casl2a protein, an ssDNA reporter molecule. The LAMP amplification product is a product amplified from RNA extracted from a sample in the LAMP amplification system, and the LAMP amplification product has a dosage of (1-3) uL. The RNase inhibitor has a concentration of (0.2-0.8) U / pL and a dosage of (0.5-1.5) uL. The gRNA has a concentration of (450-550) nM and a dosage of (1.5-2.5) uL The NEBuffer 2.1 has a dosage of (1-3) pL. The Casl2a protein has a dosage of (0.5-1.5) pL and a concentration of (50-250) nM. The ssDNA reporter molecule has a dosage of (0.5-1.5) pL and a concentration of (50-300) nM. The gRNA (consisting of a spacer sequence and a repeat sequence, the spacer sequence is generally 20 to 21 bases after a PAM sequence) and an ssDNA probe (5'FAM-TTATT-BHQl 3' or 5'6-FAM-TTATT-Biotin 3') are designed according to a fragment amplified by LAMP. The fluorescence produced by CRISPR / Casl2a cleavage experiments is used to screen gRNA and optimize the concentration of Cas 12a protein.
[0041] In the present disclosure, the kit further includes an LFS. The LFS is a test strip suitable for RHDV detection. The test strip is preferably a CRISPR Casl2 / 13 HybriDetect test strip (purchased from Warbio Biotech (Nanjing, China), JY0301), where a colloidal gold-labeled mouse anti-FAM antibody is added to a sample pad, streptavidin is labeled on a control line (C line), and an anti-mouse IgG antibody is labeled on a test line (T line). When the test strip is included in the kit, the ssDNA probe is a biotin ssDNA probe (5'6-FAM-TTATT-Biotin 3'). The results determined using the test strip are based on: when the ssDNA reporter molecule is not cut, the streptavidin of the C line binds and captures the biotin on the ssDNA, and the C line is colored. When the ssDNA reporter molecule is cut due to the activated trans-cleavage ability of Casl2a, the disconnected FAM end continues to surge upward, and the anti-mouse IgG antibody on the T line binds to the colloidal gold-labeled mouse antibody bound to FAM, capturing the FAM end with colloidal gold, and the T line is colored. The result is negative when only the C line is colored, and is positive when only the T line is colored.
[0042] The present disclosure further provides a method for visual identification of an RHDV1 and an RHDV2 by LAMP-CRISPR / Casl2a in a non-diagnostic purpose, including the following steps: (1) extracting an RNA of a sample to be tested; (2) conducting LAMP amplification in a LAMP amplification system using the RNA extracted in step (1) as a template; and (3) digesting a LAMP amplification product obtained in step (2) in a CRISPR / Casl2a detection system and then conducting fluorescence detection. The LAMP-CRISPR / Casl2a is combined with LFS to achieve visualization and construct a portable detection platform. The CRISPR / Casl2a detection system after digestion can also be detected by a blue light analyzer to achieve fluorescence visualization, as shown in FIG. 1. RHDV1 and RHDV2 are tested in two different detection systems, namely, the detection system for RHDV1 and the detection system for RHDV2.
[0043] In the present disclosure, the LAMP amplification system has a total volume of 25 pL and includes 12.5 pL of a LAMP / RT-LAMP 2X premix, 2.5 pL of a primer mixture, 2 pL of the extracted RNA, and 8 pL of nuclease-free water. The primer mixture includes outer primer pairs, inner primer pairs, and / or loop primers. For RHDV1, the outer primer pair, the inner primer pair, and the loop primer pair are at a volume ratio of 1:6:1.5 or 1:6:3; for RHDV2. the outer primer pair and the inner primer pair are at a volume ratio of 1:4:3. For the RHDV1, the outer primer pair of F3 and B3 has independently a final concentration of 200 nM, the inner primer pair of FIP and BIP has independently a final concentration of 1,200 nM, and the loop primer LB has a final concentration of 600 nM; and for the RHDV2, the outer primer pair of F3 and B3 has independently a final concentration of 200 nM, the inner primer pair of FIP and BIP has independently a final concentration of 800 nM, and the loop primer LF and the loop primer LB have independently a final concentration of 600 nM.
[0044] In the present disclosure, the LAMP amplification is reaction conducted at 65°C to 69°C for 25 min to 35 min, preferably at 67°C for 30 min.
[0045] In the present disclosure, the CRISPR / Casl2a detection system has a total volume of 20 pL and includes 2 pL of the LAMP amplification product, 1 pL of an RNase inhibitor with a final concentration of 0.5 U / pL, 2 pL of a gRNA with a final concentration of 500 nM, 2 pL of NEBuffer 2.1, 1 pL of a Casl2a protein with a final concentration of 125 nM, and 1 pL of an ssDNA reporter molecule (250 nM fluorescence quenching probe / 100 nM biotin probe).
[0046] In the present disclosure, the digesting in the CRISPR / Casl2a detection system is conducted by incubation at 35°C to 38°C for 25 min to 35 min.
[0047] In the present disclosure, the LAMP is the most widely used isothermal amplification technology. Amplification can be completed in a short time using a water bath, with an amplification efficiency 2 to 5 times higher than that of ordinary PCR. The combination of LAMP with dyes can visualize the test results. The CRISPR / Casl2a can be used for gene editing and pathogen detection, and is the most common detection method coupled with isothermal amplification technology to increase specificity. After binding to gRNA, the Casl2a protein further binds to a target sequence to activate the cleavage activity, and can not only specifically cleave the target nucleic acid, but also cleave the nearby ssDNA probe indiscriminately. If fluorescein and quencher are added to both ends of the ssDNA, the fluorophore emits light after cleaving ssDNA, thus pointing to a positive result. Combining LAMP with CRISPR / Casl2a and LFS can achieve more intuitive detection results.
[0048] The present disclosure further provides use of the kit in identifying an RHDV1 and an RHDV2.
[0049] In the present disclosure, all components or reagents are commercially available products well known to those skilled in the art unless otherwise specified.
[0050] The technical solutions of the present disclosure will be clearly and completely described below with reference to the examples of the present disclosure. All other examples obtained by a person of ordinary skill in the art based on the examples of the present disclosure without creative efforts shall fall within the protection scope of the present disclosure.
[0051] Example 1
[0052] 1. Design of LAMP primers
[0053] The LAMP primers included two outer primers F3 and B3, two inner primers FIP and B1P, and possibly loop primers LF and LB. Multiple sets of primers for the conserved fragment VP60 were designed for RHDV1 (isolate WF2007, GenBank accession number: FJ794180) and RHDV2 (isolate SC2020 / 04, GenBank accession number: MT383749), respectively. Primer set 1 (Set 1), primer set 2 (Set 2), and primer set 3 (Set 3) were designed for RHDV1 and RHDV2, respectively, as shown in Table 1. Primer sequences were synthesized from GenScript Biotech (Nanjing, China).
[0054] Table 1 Primer sequences of LAMP
[0055] Virus primer Sequence RHDV1 (Set 1)F3 TCCCTGACATGTCATTCGTG (SEQ ID NO: 1) RHDV1 (Set 1) B3 GGTTTGTGCCGGTTACCAC (SEQ ID NO: 2) RHDV1 (Set 1) FIP CGGGGGCACCGTTGTTACTGTTAACAGCCCCAACATTCCG (SEQ ID NO: 3) RHDV 1 (Set 1) BIP A GTTAGGTTTTGCC A CTGGGGCC AGTr'TGTGC A CGTG A AGTG (SEQ ID NO: 4) RHDV1 (Set 1) LF ACCACCAAACCCGACCCAC (SEQ ID NO: 5) RHDV1 (Set 1) LB AACAGCCTCCAGCCCACCA (SEQ ID NO: 6) RHDV1 (Set 2) F3 GCATGCAGTTCCGCTTCA(SEQ ID NO: 7) RHDV1 (Set 2) B3 ACTAGTGTGGGGACAAGGC (SEQ ID NO: 8) RHDV1 (Set 2) FIP CTCCAACCCTGGCCCAATCTCGTGTGTTTGGTGGGCGAC (SEQ ID NO: 9) RHDV1 (Set 2) BIP CGCCCGTTCACTCGAACCTGCAGGGTCACCAGTTGGATG (SEQ ID NO: 10) RHDV1 (Set 2) LF CCTGGTGGTATCACAGCCGC (SEQ ID NO: 11) RHDV1 (Set 2) LB TCACCATGCCAGACTTGCGT (SEQ ID NO: 12) RHDV1 (Set 3) F3 AACGGCAGCACATATGGC (SEQ ID NO: 13) RHDV1 (Set 3) B3 GCTGTTAAAGGGCACGAATG (SEQ ID NO: 14) RHDV1 (Set 3) FIP ACGTTGGTGGAGTTGTTCCCAGTTTGCCGACATTGACCATCG (SEQ ID NO: 15) RHDV 1 (Set 3) BIP dTTACf^r'TA ATGCTGGGTCTGC ATHTC AGGGA Af^CCGTCT fQFO £*—B £^J £ 2 £.£*_^ £^J £.-^- £ 2 £*2 £ £ £»_j £.-^ £ £_J £_J £_J £ £*_^ £ £_J £~^ 2 £. £. £^£ £ £--^ 2 £..£_J £_J £_J 2 £.2 £. £^J £^-^- £^-^- £»_J £ £^-^ £. B ki? B.....> £^*_ ID NO: 16) RHDV1 (Set 3) LB GATTGACAACCCTATCTCCCAGGTT (SEQ ID NO: 17) RHDV2 (Set 1) F3 ACCACCGGGCATTGAGAT (SEQ ID NO: 18) RHDV2 (Set 1)B3 TCGTGGATCCACCAAATGG (SEQ ID NO: 19) RHDV2 (Set 1) FIP TGACTGGTTCGAGTGAACGAGCTGGGCCAGGTTTGGAAGT (SEQ ID NO: 20) RHDV2 (Set 1) BIP GCGCCCCAACATGTACCACCAACGCTCAGGACCAACGT (SEQ ID NO: 21) RHDV2 (Set 1) LF TGACAACATGAGGGAATTGTCTG (SEQ ID NO: 22) RHDV2 (Set 1) LB CAACAGGCAACCCTGGC (SEQ ID NO: 23) RHDV2 (Set 2) F3 ATGCTAGTGCCGGGTCTG (SEQ ID NO: 24) RHDV2 (Set 2) B3 GTTGCTCGGTACTCCAGTG (SEQ ID NO: 25) RHDV2 (Set 2) FIP GGTAGGGATGGTGATACCGCTGAACCCCATCTCCCAAATTGC (SEQ ID NO: 26) RHDV2 (Set 2) BIP GGTCGGGTTCGGTGGGATCTTAAGCCTGCATGGTCGTGA (SEQ ID NO: 27) RHDV2 (Set 2) LF TGACATGTCAGGGAAACCATCTGG (SEQ ID NO: 28) RHDV2 (Set 2) LB AACAGCAGTAATGGTGCCCCC (SEQ ID NO: 29) RHDV2 (Set 3) F3 CATGTACCACCCAACAGGC (SEQ ID NO: 30) RHDV2 (Set 3) B3 GTGAGAACTGGGGTTGTGAG (SEQ ID NO: 31) RHDV2 (Set 3) FIP CTCGTGGATCCACCAAATGGGTGTTCCCACGTTGGTCCTG (SEQ ID NO: 32) RHDV2 (Set 3) BIP AGTTTGTGATGATCCGTGCCCCGAGATCTGCGGGCGAGAT (SEQ ID NO: 33) RHDV2 (Set 3) LF TGATGAGGTTGTTGTAAACGCT (SEQ ID NO: 34) RHDV2 (Set 3) LB TCCAGTAAGACCGTTGACTCG (SEQ ID NO: 35)
[0056] 2. RNA template extraction
[0057] RNA was extracted from RHDV1 and RHDV2 strains (stored in laboratory) using RNA extraction kits (purchased from Vazyme Biotech Co., Ltd., Nanjing, China). The concentration of RNA extracted from the RHDV1 strain was 218.6 ng / pL, while the concentration of RNA extracted from the RHDV2 strain was 158.8 ng / pL, which were used in subsequent experiments.
[0058] 3. Establishment of LAMP amplification method for RHDV1 and RHDV2 and optimization of primers and reaction conditions
[0059] (1) LAMP amplification step: using the RNA extracted in step 2 as a template, the designed primers were added according to the reaction system in Table 2, mixed well, and reacted in a constant-temperature oscillating box at 67°C for 30 min. A preparation process of the primer mixture for RHDV1 included the following steps: each primer was diluted to 100 pM; 12 pL each of FIP / BIP, 2 pL each of F3 / B3, 6 pL each of LB / LF or 6 pL of LB were added, and then nuclease-free water was added to a total volume of 100 pL to obtain the primer mixture for RHDV1. A preparation process of the primer mixture for RHDV2 included the following steps: each primer was diluted to 100 pM; 8 pL each of FIP / BIP, 2 pL each of F3 / B3, 6 pL each of LF / LB were added, and then nuclease-free water was added to a total volume of 100 pL to obtain the primer mixture for RHDV2. The LAMP amplification system for RHDV1 and RHDV2 as well as the volume and final concentration of each primer were shown in Tables 2 to 4.
[0060] Table 2 LAMP amplification system
[0061] Component Volume Initial concentration LAMP / RT-LAMP 2X Premix 12.5 pL / Primer mixture 2.5 pL / Extracted RNA 2 pL RHDV1 218.6 ng / pL or RHDV2 158 8 ng / pL Nuclease-free water 8 pL /
[0062] Table 3 Primer volumes and final concentrations in LAMP amplification system for RHDV1
[0063] Primer Initial concentration Volume Final concentration FIP 100 pM 0.3 pL 1.2 pM BIP 100 pM 0.3 pL 1.2 pM F3 100 pM 0.05 pL 0.2 pM B3 100 pM 0.05 pL 0.2 pM LB / LF or LB WOpM / lOOpMor 100 pM 0.15 pL / 0.15 pL or 0.15 pL 0.6 pM / 0.6 pM or 0.6
[0064] Table 4 Primer volumes and fma concentrations in LAMP amplification system for RHDV2
[0065] Primer Initial concentration Volume Final concentration FIP 100 pM 0.2 pL 0.8 pM BIP 100 pM 0.2 pL 0.8 pM F3 100 pM 0.05 pL 0.2 pM B3 100 pM 0.05 pL 0.2 pM LF 100 pM 0.15 pL 0.6 pM LB 100 pM 0.15 pL 0.6 pM
[0066] (2) Primer screening: based on the primers designed in step 1 and the LAMP amplification in step 3 (1), a nucleic acid dye SYTO9 (final concentration 250 nM) was added into the LAMP system. The most efficient primer set was selected by the change in fluorescence value under the monitoring of the Quant Studio 1 system, and it was ensured that there was no cross-reaction between the RHDV1 and RHDV2 systems. Water was used as a negative control during the experiment. The results were shown in FIG. 2.
[0067] As shown in FIG. 2, the primers with the highest amplification efficiency were primer set 3 for RHDV1 and primer set 2 for RHDV2.
[0068] The selected primer set 3 for RHDV1 and primer set 2 for RHDV2 were used to amplify the nucleic acids of RHDV1 and RHDV2, respectively, and a crossover experiment was conducted. The amplified results were subjected to gel electrophoresis analysis and fluorescence value analysis. Results were shown in FIG. 3.
[0069] As shown in FIG. 3, the crossover experiment was tested by gel electrophoresis. When RHDV1 was amplified with the selected primer set 3 for RHDV1, a typical ladder-shaped LAMP band was obtained, and no band was obtained when RHDV2 was amplified. The selected primer set 2 for RHDV2 was used to amplify the nucleic acids of RHDV1 and RHDV2, respectively. No band was obtained when RHDV I was amplified, and a typical ladder-shaped LAMP band was obtained when RHDV2 was amplified. The crossover experiment was conducted using fluorescent LAMP. The results showed that the fluorescence value increased significantly only when the RHDV1 nucleic acid was amplified with the primer set for RHDV1 and the RHDV2 nucleic acid was amplified with the primer set for RHDV2. The above results indicated that the two selected primer sets had desirable specificity.
[0070] (3) Screening of reaction temperature, ratio of inner and outer primer concentrations, and loop primer concentration
[0071] Based on the screened primer sets and the above-mentioned amplification steps and LAMP amplification system, the optimal reaction temperature, ratio of outer and inner primer concentrations, and loop primer concentration were selected according to a change trend of the fluorescence value. The reaction temperatures for screening were set to: 61 °C, 63°C, 65°C, 67°C, 69°C; the concentration ratios of the outer and inner primers for screening were set to: 200 nM: 400 nM, 200 nM: 800 nM, 200 nM: 1,200 nM, 200 nM: 1,600 nM, 200 nM: 2,000 nM; the concentrations of the loop primers for screening were set to: 200 nM, 400 nM, 600 nM, 800 nM, 1,000 nM. Water was used as a negative control during the experiment. The results were shown in FIG. 4 to FIG. 7.
[0072] As shown in FIG. 4 to FIG. 7, the optimal reaction conditions for RHDV1 included 67°C, outer primer: inner primer = 1:6 (200 nM: 1,200 nM), and loop primer concentration 600 nM; the optimal reaction conditions for RHDV2 included 67°C, outer primer: inner primer = 1:4 (200 nM: 800 nM), and loop primer concentration 600 nM. The neutral red dye added to the LAMP system allowed visualization of the results, and there was a clear color difference between positive and negative results.
[0073] 4. Establishment of CRISPR / Casl2a detection method for RHDV1 and RHDV2 and optimization of reaction system
[0074] (1) Design of gRNA and ssDNA probes
[0075] gRNAs were designed based on the target fragments of RHDV1 and RHDV2 amplified in the preferred LAMP stage, gRNAs (gRNAl and gRNA2) were designed (each being composed of a spacer sequence and a repeat sequence, where the spacer sequence was generally 20 to 21 bases after the PAM sequence), and an ssDNA probe (5'FAM-TTATT-BHQ1 3') was designed. The gRNA and ssDNA probe sequences were synthesized from GenScript Biotech (Nanjing, China) and then listed in Table 5.
[0076] Table 5 gRNA sequences
[0077] Viruses PAM Sequence gRNAl for RHDV1 TTTG UAAUUUCUACUAAGUGUAGAUCCGACAUUGACCAUCGAAGA (SEQ ID NO: 36) gRNA2 for RHDV1 TTTG it A AI I I 'CL ACIIA AGLGL AGAI 'GI JACGCI 'A ALGCITGGGTTCI TG x_J x_J x_J x_J x^ xJ J Vx_z xJ ZA.Zi.vJ xJ xJ xJ zjlxJ zi. x_J xJ xJ 2 x V xJ x_J xJ xJ x~> x_J kJ kJ xi xJ x^ xJ xJ (SEQ ID NO: 37) gRNAl for RHDV2 TTTG UAAUUUCUACUAAGUGUAGAUUACCCUUCAGCGGUAUCACCA (SEQ ID NO: 38) gRNA2 for RHDV2 TTTC UAAUUUCUACUAAGUGUAGAUCCUGACAUGUCAUUUGUACCC (SEQ ID NO: 39)
[0078] (2) CRISPR / Casl2a detection steps: using the fragment amplified by the selected optimal LAMP amplification system and amplification conditions as a template, the samples were added according to the reaction system in Table 6, mixed well, and incubated at 37°C for 30 min to obtain a reactant solution.
[0079] Table 6 CRISPR / Casl2a detection system
[0080] Component Volume Final concentration LAMP amplification product 2 pL / RNase inhibitor 1 pL 0.5 U / pL gRNA 2 pL 500 nM NEBuflfer2.1 2 pL / Cas 12a protein 1 pL 125 nM ssDNA reporter molecule 1 pL 250 nM Nuclease-free water 11 pL /
[0081] (3) Screening gRNA and optimizing Casl2a protein concentration by generating fluorescence through CRISPR / Casl2a cleavage experiment: based on the primer gRNA in step 4 (1) and the detection process in step 4 (2), changes in fluorescence values and blue light analyzer irradiation were recorded by Quant Studio 1. The results were determined by the fluorescence curve and whether fluorescence was emitted, and it was ensured that there was no cross-reaction between the RHDV1 and RHDV2 systems. The fluorescence generated was verified to be caused by gRNA guiding the Casl2a protein to bind to the target fragment, activating its trans-cleavage activity and non-specifically cleaving the surrounding ssDNA. Water was used as a negative control during the experiment, and the product amplified using water as a template in the LAMP stage was called LAMP-NC.
[0082] The gRNAl and gRNA2 of RHDV1 and RHDV2 were optimized and screened, respectively, 3 Casl2a protein concentrations (50 nM, 125 nM, and 250 nM) were set for orthogonal experiments, and the results were shown in FIG. 8. As shown in FIG. 8, at three different Cas 12a concentrations, among the gRNAs designed for RHDV1, the gRNA2 showed a higher efficiency of cleavage to produce fluorescence; among the gRNAs designed for RHDV2, the gRNA2 showed a higher efficiency of cleavage to produce fluorescence. When the Cas 12a concentration increased from 50 nM to 125 nM, the fluorescence value produced increased significantly (P<0.05); when the Casl2a concentration was further increased to 250 nM, the fluorescence value produced was not significantly different from that at 125 nM (P>0.05). Therefore, the reaction concentration of Cas 12a protein was set at 125 nM.
[0083] The selected gRNA was used to verify the trans-cleavage activity of Cas 12a protein and to allow cross-experiments between the RHDV1 reaction system and the RHDV2 reaction system. The product amplified using the selected optimal LAMP amplification system and amplification conditions was used as a template for CRISPR / Cas 12a cleavage experiments in the RHDV1 and RHDV2 systems. Nuclease-free water was used as a template and a negative control, and the generated fluorescence was detected using the Quant Studio 1 system. The results were shown in FIG. 8. The results showed that only when the templates were products of RHDV1 primer amplifying RHDV1 nucleic acid and RHDV2 primer amplifying RHDV2 nucleic acid, there was an obvious increase in fluorescence value in the system, and the same result was observed under blue light. This suggested that the fluorescence generated by the RHDV1 and RHDV2 systems in the CRISPR / Cas 12a cleavage experiment was generated through the trans-cutting activity stimulated by the binding of Casl2a protein to the target fragment under the guidance of the corresponding gRNA, and there was no cross-reaction between the RHDV1 and RHDV2 systems at this stage.
[0084] Example 2 Kit 1 for visual identification of RHDV1 and RHDV2 by LAMP-CRISPR / Casl2a
[0085] The kit included a LAMP amplification system and a CRISPR / Cas 12a detection system.
[0086] The LAMP amplification system had a total volume of 25 pL and included 12.5 pL of a LAMP / RT-LAMP 2X premix, 2.5 pL of a primer mixture, 2 pL of the extracted RNA, and 8 pL of nuclease-free water. In the LAMP amplification system for the RHDV1, a primer set used was the primer set 3 for RHE)VI in Table 1; the outer primer pair of F3 and B3 had independently a final concentration of 200 nM, the inner primer pair of FIP and BIP had independently a final concentration of 1,200 nM, and the loop primer LB had a final concentration of 600 nM. In the LAMP amplification system for the RHDV2, a primer set used was the primer set 2 for RHDV1 in Table 1; the outer primer pair of F3 and B3 had independently a final concentration of 200 nM, the inner primer pair of FIP and BIP had independently a final concentration of 800 nM, and the loop primer LF and the loop primer LB had independently a final concentration of 600 nM.
[0087] The CRISPR / Casl2a detection system had a total volume of 20 pL and included 2 pL of the LAMP amplification product, 1 pL of an RNase inhibitor with a final concentration of 0.5 U / pL, 2 pL of a gRNA with a final concentration of 500 nM, 2 pL of NEBuffer 2.1, 1 pL of a Casl2a protein with a final concentration of 125 nM, and 1 pL of an ssDNA reporter molecule (250 nM fluorescence quenching probe by final concentration). For RHDV1, the gRNA used was shown in RHDV1 gRNA2 in Table 5; for RHDV2, the gRNA used was shown in RHDV2 gRNA2 in Table 5.
[0088] Example 3 Kit 2 for visual identification of RHDV1 and RHDV2 by LAMP-CRISPR / Casl2a
[0089] The kit included LFS in addition to the system in Example 2. The LFS was CRISPR Casl2 / 13 HybriDetect strip (purchased from Warbio Biotech (Nanjing, China), JY0301). A LAMP amplification system and a CRISPR / Casl2a detection system were the same as those in Example 2, where the fluorescence quenching ssDNA probe was replaced with a biotin ssDNA probe (5'6-FAM-TTATT-Biotin3'), which had a final concentration of 100 nM in the reaction system.
[0090] Example 4
[0091] A method for visual identification of an RHDV1 and an RHDV2 by LAMP-CRISPR / Casl2a included the following steps:
[0092] (1) an RNA solution was extracted from a sample to be tested using an RNA extraction kit (purchased from Vazyme Biotech Co., Ltd., Nanjing, China);
[0093] (2) the RNA solution was added into the LAMP amplification system in Example 2 or 3, mixed evenly, and reacted in a constant-temperature oscillating box at 67°C for 30 min to obtain a LAMP amplification product;
[0094] (3) the LAMP amplification product was added into the CRISPR / Casl2a detection system in Example 2 or 3, mixed evenly, and incubated at 37°C for 30 min to allow digestion to obtain a digested reactant solution; and
[0095] (4) the digested reactant solution was irradiated with a blue light analyzer (LABGIC, Beijing, China), when the reactant solution had fluorescence, it was positive, and when the reactant solution had no fluorescence, it was negative.
[0096] Alternatively, the LFS in Example 3 was placed in the reactant solution according to the following operations; when only the T line was colored, it was positive, and when only the C line was colored, it was negative. The operations included: 5 pL of the reactant solution was added into 45 pL of nuclease-free water, and the LFS was inserted to allow color development.
[0097] Example 5 Methodological evaluation of the established LAMP-CRISPR / Casl2a detection method
[0098] (1) Specificity experiment: nucleic acids of 7 pathogens (preserved by laboratory), including RHDV1, RHDV2, E. coli, S. typhi, K. pneumoniae, P muhocida, and rotavirus (RV), were extracted using the method in Example 4, and then subjected to LAMP-CRISPR / Casl2a detection to verify the specificity of the established detection method. Water was used as a negative control during the experiment. The results were shown in FIG. 9. When testing with the detection method for RHDV1, only RHDV1 was positive while other pathogens were negative; when testing with the detection method for RHDV2, only RHDV2 was positive while other pathogens were negative; the results seen under blue light were consistent with those shown on the test strip. This indicated that the detection methods established for RHDV1 and RHDV2 had high specificity.
[0099] (2) Sensitivity experiment: a target gene was cloned using the full-length primers of the FP60 gene of RHDV 1 isolate WF2007 and RHDV 2 isolate SC 2020 / 04. The amplified gene sequence was ligated to a pMD18-T vector. After screening and sequencing, the positive pMD18-T-WF2007-VP60 and pMD 18-T-SC2020-VP60 recombinant plasmids were obtained. The recombinant plasmid was measured for concentration and a copy number was calculated using Nano drop, and the recombinant plasmid was diluted to 1 x 1010 copies / pL with ddH2O as a template standard. The VP60 full-length plasmids of RHDV1 and RHDV2 diluted 10 times (lx 106 copies / pL to lx 10° copies / pL) were used as detection templates and detected using the method in Example 4 (replacing the extracted RNA solution with the recombinant plasmid). Nuclease-free water was used as a negative control template during the experiment. The results were shown in FIG. 10. The results showed that the established LAMP-CRISPR / Casl2a detection method for RHDV1 and RHDV2 could detect a minimum of IxfO1 copies / pL of dsDNA template, and the results seen under blue light were consistent with those displayed on the test strip.
[0100] Example 6 Detection of clinical samples
[0101] A total of 74 clinical samples from different regions and farms were tested using the qPCR method and the LAMP-CRISPR / Casl2a detection method, and the consistency and sensitivity of the qPCR method and the established LAMP-CRISPR / Casl2a detection method were compared. Water was used as a negative control (NC), and standard positive plasmid (RHDV1 or RHDV2) at a concentration of lx 105 copies / pL was used as a positive control (PC).
[0102] The LAMP-CRISPR / Casl2a detection method was the same as that in Example 4.
[0103] qPCR detection: RNA was extracted from 74 clinical samples according to the instructions of Vazyme FastPure Cell / Tissue Total RNA Isolation Kit V2, and qPCR amplification was conducted using qPCR primers. An absolute expression level of viral RNA in each tissue sample was detected in the Quant Studio 1 fluorescent quantitative PCR instrument to determine the viral content in different tissue samples. Each sample was tested in triplicate. The positive control Ct value of the TaqMan probe real-time fluorescence quantitative PCR method was <35 and the amplification curve had an obvious logarithmic growth period; at the same time, when the negative control amplification curve had no logarithmic growth period, the Ct value of the test sample was <35.0, and a standard S-shaped amplification curve appeared, it was determined that RHDV1 or / and RHDV2 nucleic acid existed in the sample; if there was no Ct value or Ct value>38, and there was no standard amplification curve, it was determined that RHDV1 or / and RHDV2 nucleic acid showed negative. When the test sample showed 35.0<Ct value<38 and the amplification curve showed a standard S-shaped curve, it was determined as suspicious and a repeated experiment was required; if the above result was still obtained after repetition, it was determined as positive, otherwise it was determined as negative.
[0104] The qPCR primer sequences were upstream primer RHDV-F1: 5'-TGGARMTWGGYTTRAGTGTDGAYG-3' (SEQ ID NO: 40); downstream primer: RHDV-R1: 5'-CAGACATAAGAAAARCCATTGGYTG-3' (SEQ ID NO: 41) of the VP60 gene sequence; RHDV1 probe sequence: 5'-FAM-TGAYTGAACTCATTGAYGTACGCCC-BHQl-3' (5'-FAM-SEQ ID NO: 42-BHQ1-3'); RHDV2 probe sequence: 5'-VIC-TGTCAGAMCTTGTTGACATCCGCC-BHQ2-3' (5'-VIC-SEQ ID NO: 43-BHQ2-3'); where the primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd. In the above sequences, R represented A or G, M represented A or C, W represented A or T, Y represented C or T, and D represented G or A or T.
[0105] The qPCR amplification reaction system included: 10 pL of 2 / Qne Step RT-PCR Buffer III, 0.6 each pL of upstream and downstream primers (10 pmol / L), 0.4 pL of ROX dye II (50*), 0.8 pL each of fluorescent probes (10 pmol / L), 2 pL of RNA product, and 4 pL of ddH2O. The qPCR amplification reaction program included: 42°C for 5 min, 95°C for 10 s; 95°C for 5 s, 60°C for 34 s, 40 cycles.
[0106] The fluorescence of the reactant solution obtained by the two detection methods was monitored by Quant Studio 1; the reactant solution was illuminated by blue light and detected by LFS. The results were shown in FIG. 11. The results showed that when the detection system of RHDV1 was used, the method established by the present disclosure detected 19 RHDV1 positive samples, while the qPCR method detected 17 RHDV1 positive samples, and the consistency rate of the two detection methods was 97.30%. When the detection system of RHDV2 was used, the method established by the present disclosure detected 32 RHDV2 positive samples, while the qPCR method detected 30 RHDV2 positive samples, and the consistency rate of the two detection methods was 97.30%. The results of fluorescence and LFS for the two detection systems under blue light directly observed by the naked eye were consistent, and the two readout strategies were mutually verified. The consistency rate with the qPCR method also verified the stability and reliability of the detection method, indicating that the detection method constructed by the present disclosure could be regarded as a novel diagnostic method for detecting and distinguishing RHDV1 from RHDV2, and was feasible in clinical practice.
[0107] In the present disclosure, all data were statistically analyzed using GraphPad Prism 8.0, and one-way analysis of variance (ANOVA) was conducted between different groups. All experiments were repeated at least 3 times, and the data were expressed as mean ± standard deviation. Differences were considered statistically significant atp<0.05.
[0108] The above descriptions are merely preferred implementations of the present disclosure. It should be noted that a person of ordinary skill in the art may further make several improvements and modifications without departing from the principle of the present disclosure, but such improvements and modifications should be deemed as falling within the protection scope of the present disclosure.
Claims
1. A kit for visual identification of a rabbit hemorrhagic disease virus type 1 (RHDV1) and a rabbit hemorrhagic disease virus type 2 (RHDV2) by loop-mediated isothermal amplification (LAMP)-clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated protein 12a (Casl2a), comprising a LAMP amplification system and a CRISPR / Casl2a detection system; whereinthe LAMP amplification system comprises outer primer pairs of F3 and B3 and two inner primer pairs of FIP and BIP; in the LAMP amplification system for the RHDV1, the outer primer pair of F3 and B3 has nucleotide sequences shown in SEQ ID NO: 13 and SEQ ID NO: 14 and the inner primer pair of FIP and BIP has nucleotide sequences shown in SEQ ID NO: 15 and SEQ ID NO: 16; and in the LAMP amplification system for the RHDV2, the outer primer pair of F3 and B3 has nucleotide sequences shown in SEQ ID NO: 24 and SEQ ID NO: 25 and the inner primer pair of FIP and BIP has nucleotide sequences shown in SEQ ID NO: 26 and SEQ ID NO: 27; andthe CRISPR / Casl2a detection system comprises gRNAs; the gRNA in the CRISPR / Casl2a detection system for the RHDV1 has a nucleotide sequence shown in SEQ ID NO: 37; and the gRNA in the CRISPR / Casl2a detection system for the RHDV2 has a nucleotide sequence shown in SEQ ID NO: 39.
2. The kit according to claim 1, wherein the LAMP amplification system further comprises a loop primer LF and loop primers LB; the loop primer LB in the LAMP amplification system for the RHDV1 has a nucleotide sequence shown in SEQ ID NO: 17; and the loop primer LF and the loop primer LB in the LAMP amplification system for the RHDV2 have nucleotide sequences shown in SEQ ID NO: 28 and SEQ ID NO: 29.
3. The kit according to claim 1, wherein the LAMP amplification system further comprises a LAMP / RT-LAMP 2X premix, a nucleic acid to be tested, and nuclease-free water.
4. The kit according to claim 1, wherein the CRISPR / Casl2a detection system further comprises a LAMP amplification product, an RNase inhibitor, NEBuffer 2.1, a Casl2a protein, an ssDNA reporter molecule, and nuclease-free water.
5. The kit according to claim 1, further comprising a lateral flow strip (LFS) or a blue light analyzer.
6. The kit according to claim 1, wherein when the kit comprises the LFS, an ssDNA reporter molecule is a biotin ssDNA reporter molecule; and when the kit comprises the blue light analyzer, the ssDNA reporter molecule is a fluorescence quenching ssDNA reporter molecule.
7. Use of the kit according to any one of claims 1 to 6 in preparation of a product for identifying an RHDV1 and an RHDV2.
8. A method for visual identification of an RHDV1 and an RHDV2 by LAMP-CRISPR / Casl2a in a non-diagnostic purpose, comprising the following steps:(1) extracting an RNA of a sample to be tested;(2) conducting LAMP amplification in a LAMP amplification system using the RNA extracted in step (1) as a template; and(3) digesting a LAMP amplification product obtained in step (2) in a CRISPR / Casl2a detection system and then conducting fluorescence detection; alternatively,digesting the LAMP amplification product obtained in step (2) in the CRISPR / Casl2a detection system and then conducting LFS detection.
9. The method according to claim 8, wherein the LAMP amplification system has a total volume of 25 pL and comprises 12.5 pL of a LAMP / RT-LAMP 2X premix, 2.5 pL of a primer mixture, 2 pL of the extracted RNA, and 8 pL of nuclease-free water.
10. The method according to claim 9, wherein in the LAMP amplification system for the RHDV1, the outer primer pair of F3 and B3 has independently a final concentration of 200 nM, the inner primer pair of FIP and BIP has independently a final concentration of 1,200 nM, and the loop primer LB has a final concentration of 600 nM in the primer mixture; and in the LAMP amplification system for the RHDV2, the outer primer pair of F3 and B3 has independently a final concentration of 200 nM, the inner primer pair of FIP and BIP has independently a final concentration of 800 nM, and the loop primer LF and the loop primer LB have independently a final concentration of 600 nM in the primer mixture.
11. The method according to claim 8, wherein when the fluorescence detection is conducted, the CRISPR / Casl2a detection system has a total volume of 20 pL and comprises 2 pL of the LAMP amplification product, 1 pL of an RNase inhibitor with a final concentration of 0.5 U / pL, 2 pL of a gRNA with a final concentration of 500 nM, 2 pL of NEBuffer 2.1, 1 pL of a Casl2aprotein with a final concentration of 125 nM, 1 pL of a fluorescence quenching ssDNA reporter molecule with a final concentration of 250 nM, and 11 pL of nuclease-free water.
12. The method according to claim 8, wherein when the LFS detection is conducted, the CRISPR / Casl2a detection system has a total volume of 20 pL and comprises 2 pL of the LAMP amplification product, 1 pL of an RNase inhibitor with a final concentration of 0.5 U / pL, 2 pL of a gRNA with a final concentration of 500 nM, 2 pL of NEBuffer 2.1, 1 pL of a Casl2a protein with a final concentration of 125 nM, 1 pL of a biotin ssDNA reporter molecule with a final concentration of 100 nM, and 11 pL of nuclease-free water.
13. The method according to claim 8, wherein the LAMP amplification is conducted at 65°C to 69°C for 25 min to 35 min.
14. The method according to claim 8, wherein the digesting in the CRISPR / Casl2a detection system is conducted by incubation at 35°C to 38°C for 25 min to 35 min.PCT / CN2024 / 082842A. CLASSIFICATION OF SUBJECT MATTER C12Q l / 70(2006.01)i; C12Q l / 6844(2018.01)i; C12N 15 / ll(2006.01)i; C12R l / 93(2006.01)n According to International Patent Classification (IPC) or to both national classification and IPC B. FIELDS SEARCHED Minimum documentation searched (classification system followed by classification symbols) IPC: C12QC12N Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched Electronic data base consulted during the international search (name of data base and, where practicable, search terms used) CNTXT; CNABS; ENTXTC: WPABSC; VEN; ENTXT: CJFD; CNKI; 7777; WANFANG; TO; DUXIU; ISI_Web of Science; Elsevier Science; SpringerLink; PubMed; NCBI; UNIPROT; EMBL; STNext; China Patents Biological Sequence Search System: STSEQ ID NO.13-17, 24-29, 37, 390^^^^^, sequence search based on SEQ ID NO. 13-17, 24-29, 37, and 39, fttljlfiljEWW, ft tBifilfi, ftlwWttitilfiEffi, , if, Jiangsu Academy of Agricultural Sciences, rabbit hemorrhagic disease virus, rabbit hemorrhagic disease, RHDV, LAMP, loop mediated isothermal amplification, CRIS PR, Cas 12a C. DOCUMENTS CONSIDERED TO BE RELEVANT Category* Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No. PX Y CN 117587168 A (JIANGSU ACADEMY OF AGRICULTURAL SCIENCES) 23 February 2024 (2024-02-23) claims 1-10, and description, paragraphs [0039]-[0043] CN 112280898 A (NINGBO IGENE TECHNOLOGY CO., LTD. et al.) 29 January 2021 (2021-01-29) description, paragraphs [0003]-[0008], and the embodiments 1-14 8-14 Y CN 112359137 A (FUDAN UNIVERSITY) 12 February 2021 (2021-02-12) description, paragraphs [0009]-[0021] 8-14 A CN 112280898 A (NINGBO IGENE TECHNOLOGY CO., LTD. et al.) 29 January 2021 (2021-01-29) description, paragraphs [0003]-[0008], and the embodiments 1-7 | | Further documents are listed in the continuation of Box C. | J | See patent family annex. * Special categories of cited documents: “T” later document published after the international filing date or priority “A” document defining the general state of the art which is not considered date and not in conflict with the application but cited to understand the to be of particular- relevance principle or theory underlying the invention “D” document cited by the applicant in the international application “X” document of particular- relevance; the claimed invention cannot be “E” earlier application orpatent but published on or after the international considered novel or cannot be considered to involve an inventive step filing date when the document is taken alone “L” document which may throw doubts on priority claim(s) or which is “Y” document of particular relevance; the claimed invention cannot be cited to establish the publication date of another citation or other considered to involve an inventive step when the document is special reason (as specified) combined with one or more other such documents, such combination “O” document referring to an oral disclosure, use, exhibition or other being obvious to a person skilled in the art means document member of the same patent family “P” document published prior to the international filing date but later than the priority date claimed Date of the actual completion of the international search 30 September 2024 Date of mailing of the international search report 13 October 2024 Name and mailing address of the ISA / CN China National Intellectual Property Administration (ISA / CN) China No. 6, Xitucheng Road, Jimenqiao, Haidian District, Beijing 100088 Authorized officer Telephone No.INTERNATIONAL SEARCH REPORT International application No. PCT / CN2024 / 082842 C. DOCUMENTS CONSIDERED TO BE RELEVANTCategory* Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No. A CN 112359137 A (FUDAN UNIVERSITY) 12 February 2021 (2021-02-12) description, paragraphs [0009]-[0021] 1-7 A (LIU, Xingxing et al.). "ifettiMffiW^MWtRT-LAMPWJ^SfiWA^^ (Development and Application of RT-LAMP for Visual Detection of Rabbit Hemorrhagic Disease Virus)" (Chinese Veterinary Science), Vol. 47, No. 6, 31 December 2017 (2017-12-31), pages 687-693 abstract, and sections 1.2, 1.3, and 1.5 1-14 A YUAN, Dongwei et al. "Development of a Reverse-Transcription Loop-Mediated Isothermal Amplification Method for Detection of Rabbit Hemorrhagic Disease Virus" Journal ofVirological Methods, Vol. 187, 23 November 2012 (2012-11-23), pages 274-277 abstract, and table 2 1-14PCT / CN2024 / 082842Box No. I Nucleotide and / or amino acid sequence(s) (Continuation of item l.c of the first sheet)1. With regard to any nucleotide and / or amino acid sequence disclosed in the international application, the international search was carried out on the basis of a sequence listing: a. / forming part of the international application as filed. b. __ furnished subsequent to the international filing date for the purposes of international search (Rule 13ter.l(a)),accompanied by a statement to the effect that the sequence listing does not go beyond the disclosure in the international application as filed.
2. | | With regard to any nucleotide and / or amino acid sequence disclosed in the international application, this report has been established to the extent that a meaningful search could be carried out without a WIPO Standard ST.26 compliant sequence listing.
3. Additional comments:INTERNATIONAL SEARCH REPORT Information on patent family membersInternational application No.PCT / CN2024 / 082842Patent document cited in search report Publication date (day / month / year) Patent family member, s) Publication date (day / month / year) CN 117587168 A 23 February 2024 None CN 112280898 A 29 January 2021 None CN 112359137 A 12 February 2021 None
Citation Information
Patent Citations
Primer and kit for efficient duplex detection of rabbit plague and rabbit plague type-2
CN112280898A
RT-LAMP amplification system for visual virus nucleic acid RNA detection and application thereof
CN112359137A
Kit and method for visually identifying RHDV type 1 and RHDV type 2 by LAMP-CRISPR / Cas12a
CN117587168A