Recombinant Bacillus subtilis, and construction method therefor and use thereof

GB2644149APending Publication Date: 2026-03-18NANJING TECH UNIV
View PDF 9 Cites 0 Cited by

Patent Information

Application Number
GB2025017963
Authority / Receiving Office
GB · GB
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-04-27
Filing Date
2024-04-11
Publication Date
2026-03-18

AI Technical Summary

Technical Problem

The existing Bacillus subtilis B. subtilis 168 is easily degraded by its own proteases when expressing heterologous proteins, resulting in low yield, low transformation efficiency, and resistance gene problems, which limits its application as an industrial microbial cell factory.

Method used

By constructing the recombinant strain B.S168△2 with the protease gene knocked out, and overexpressing the pullulanase gene amyX on the basis of it, the recombinant B. subtilis B.S168△9amyX is formed, which eliminates the hydrolysis of the target protein by extracellular protease. Improve conversion efficiency and enzyme activity.

Benefits of technology

The activity and production of pullulanase were significantly improved. The modified strain B.S168△9amyX increased the pullulanase activity by 89 times under the same fermentation conditions, solving the problem of low protease degradation and conversion efficiency and providing a highly efficient Chassis cells are used for industrial enzyme and drug precursor production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000001_0000
    Figure 00000001_0000
  • Figure 00000001_0001
    Figure 00000001_0001
  • Figure 00000002_0000
    Figure 00000002_0000
Patent Text Reader

Abstract

Provided are a recombinant Bacillus subtilis, and a construction method therefor and a use thereof. By means of CRISPR / cas9 technology, a starting strain B.S168Δ2 with a sporulation membrane serine protease htrC and an alkaline serine protease aprX knocked out is constructed first; then on the basis of the starting strain B.S168Δ2, eight chassis cells with extracellular protease genes knocked out are constructed, namely, B.S168Δ3, B.S168Δ4, B.S168Δ5, B.S168Δ6, B.S168Δ7, B.S168Δ8, B.S168Δ9 and B.S168Δ10; chassis cells B.S168Δ8, B.S168Δ9 and B.S168Δ10, which have high transformation efficiency, no residual resistance, and almost no extracellular proteases and do not affect accumulation of extracellular target proteins, are selected; then, on this basis, the chassis strain B.S168Δ9 which is most suitable for secreting and expressing pullulanase is selected. Compared with the original strain B.S168, the enzyme activity of the constructed recombinant strain B.S168Δ9amyX is remarkably improved.
Need to check novelty before this filing date? Find Prior Art

Description

A recombinant Bacillus subtilis and its construction method and application Technical Field

[0001] The present invention belongs to the field of bioengineering technology, and in particular relates to a recombinant Bacillus subtilis and a construction method and application thereof. Background Art

[0002] In recent years, microbial chassis cells constructed using metabolic engineering techniques and synthetic biology methods have been widely used to produce a variety of natural, high-value-added chemicals, high-quality clean energy, and biomaterials. Synthetic biology aims to create pathways or production hosts that do not exist in nature, or to modify existing biological systems to meet synthesis and production needs, targeting a single target or product. Synthetic biology primarily combines knowledge from multiple disciplines, including biology, chemistry, and thermodynamics, to analyze, assemble, and coordinate discovered biological components to create production hosts.

[0003] Bacillus subtilis, a typical Gram-positive bacterium and model industrial microorganism, is often used as a model strain for bacterial genetics and cell metabolism research. Bacillus subtilis has the advantages of being non-pathogenic, having a strong ability to secrete proteins outside the cell, and having no obvious codon preference. It is also a GRAS (generally recognized as safe) food safety host bacteria with clear physiological and biochemical characteristics, relatively simple genetic manipulation, strong secretion and expression capabilities, and convenient cultivation and fermentation. It is widely used in the production of functional nutrients, fine chemicals, and enzyme preparations. As an important industrial production strain, B. subtilis has been developed through metabolic engineering to produce different types of chassis cells, which have been transformed into microbial cell factories for the production of target products such as industrial enzymes, vitamins, functional sugars, health products, and drug precursors, demonstrating strong industrial production application capabilities.

[0004] However, since heterologous proteins expressed by B. subtilis 168 are easily degraded by endogenous proteases secreted by the bacterium, the ability to express heterologous proteins using the B. subtilis 168 cell system is limited, and only low yields of target proteins can be produced. Therefore, most researchers choose the protease-deficient strain B. subtilis WB800N as the starting strain. However, B. subtilis WB800N also has certain problems, such as extremely low transformation efficiency and the presence of a neomycin resistance gene. Compared with Escherichia coli, the development of B. subtilis chassis cells is still significantly behind. Therefore, using synthetic biology methods to construct a B. subtilis chassis cell with extracellular proteases knocked out to optimize production has important scientific significance and application value.

[0005] Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide a recombinant Bacillus subtilis which is safe, has a simpler operation process and can efficiently secrete and express pullulanase in response to the deficiencies of the existing technology.

[0007] The technical problem that the present invention also aims to solve is to provide a method for constructing the above-mentioned recombinant Bacillus subtilis.

[0008] The final technical problem to be solved by the present invention is to provide the use of the recombinant Bacillus subtilis in fermentation to produce pullulanase and its use as a chassis strain in constructing genetically engineered bacteria for fermentation to produce pullulanase.

[0009] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows:

[0010] A recombinant Bacillus subtilis is a chassis strain, which is obtained by overexpressing the pullulanase gene amyX based on the construction of a strain with a knockout extracellular protease gene, using Bacillus subtilis B.S168△2 as the starting strain.

[0011] The Bacillus subtilis B.S168Δ2 is a modified strain of Bacillus subtilis 168, that is, two protease genes htrC and aprX are knocked out based on the original strain.

[0012] Specifically, the nucleotide sequences of the protease genes htrC and aprX are shown in SEQ ID NOs. 17 and 19, and the corresponding amino acid sequences are shown in SEQ ID NOs. 18 and 20.

[0013] Wherein, the extracellular protease gene is any one or a combination of several of aprE, epr, bpr, mpr, nprE, nprB, vpr and wprA.

[0014] Preferably, the extracellular protease gene is a combination of aprE, epr, bpr, mpr, nprE and nprB, or a combination of aprE, epr, bpr, mpr, nprE, nprB and vpr, or a combination of aprE, epr, bpr, mpr, nprE, nprB, vpr and wprA.

[0015] Most preferably, the extracellular protease gene is a combination of aprE, epr, bpr, mpr, nprE, nprB and vpr.

[0016] Specifically, the nucleotide sequences of the extracellular protease genes aprE, epr, bpr, mpr, nprE, nprB, vpr and wprA are shown in SEQ ID NOs. 1, 3, 5, 7, 9, 11, 13 and 15, and the corresponding amino acid sequences are shown in SEQ ID NOs. 2, 4, 6, 8, 10, 12, 14 and 16.

[0017] The pullulanase gene amyX is derived from Bacillus subtilis 168, and its nucleotide sequence is shown in SEQ ID NO.21, and the corresponding amino acid sequence is shown in SEQ ID NO.22.

[0018] The method for constructing the recombinant Bacillus subtilis comprises the following steps:

[0019] (1) Construction of the starting strain B.S168△2: The starting strain B.S168△2 was obtained by knocking out the protease genes htrC and aprX of B. subtilis 168;

[0020] (2) Construction of extracellular protease gene knockout strain: The extracellular protease gene of the starting strain B.S168△2 was iteratively knocked out to obtain an extracellular protease gene knockout strain;

[0021] (3) Overexpressing the pullulanase gene amyX: overexpressing the pullulanase gene amyX in the extracellular protease gene knockout strain obtained in step (1) to construct a Bacillus subtilis pullulanase chassis strain, i.e., a recombinant Bacillus subtilis.

[0022] Wherein, in step (2) and step (3), the extracellular protease gene knockout strain is any one of B.S168△3, B.S168△4, B.S168△5, B.S168△6, B.S168△7, B.S168△8, B.S168△9 and B.S168△10.

[0023] Preferably, the extracellular protease gene knockout strain is any one of B.S168△8, B.S168△9 and B.S168△10.

[0024] More preferably, the extracellular protease gene knockout strain is B.S168△9.

[0025] Specifically, the genes knocked out of the knockout strain B.S168△8 are: htrC, aprX, aprE, epr, bpr, mpr, nprE and nprB; the genes knocked out of the knockout strain B.S168△9 are: htrC, aprX, aprE, epr, bpr, mpr, nprE, nprB and vpr; the genes knocked out of the knockout strain B.S168△10 are: htrC, aprX, aprE, epr, bpr, mpr, nprE, nprB, vpr and wprA.

[0026] Wherein, in step (2), the Bacillus subtilis strain expressing pullulanase chassis is any one of B.S168△8amyX, B.S168△9amyX, and B.S168△10amyX.

[0027] Preferably, the Bacillus subtilis chassis strain expressing pullulanase is B.S168Δ9amyX.

[0028] The use of the above-mentioned recombinant Bacillus subtilis in the fermentation production of pullulanase is also within the scope of protection of the present invention.

[0029] Wherein, the fermentation medium is any one of Terrific broth medium (TB medium), Super Broth medium (SB medium), jar fermentation medium (G medium) and Luria-Bertani medium (LB medium).

[0030] Preferably, the fermentation medium is a jar fermentation medium (G medium), and its formula is: glutinous rice starch 2g / L, peptone 3g / L, KH2PO40.05 g / L, MgSO4·7H2O 0.01g / L, MnSO4·7H2O 0.01g / L, pH 6.0.

[0031] The fermentation conditions are as follows: 35° C., 160 rpm, and culture for 2-5 days.

[0032] The pullulanase activity was verified and tested. The results showed that the modified strain B.S168Δ9amyX reached a maximum enzyme activity of 18 U / mL after fermentation in G medium. This is an 89-fold increase compared to the original B.S168 strain under the same fermentation conditions, and 1.2 times the enzyme activity of the B.S168amyX strain after fermentation. The modified strain B.S168Δ9amyX significantly increased the yield of the original pullulanase.

[0033] The use of the above-mentioned recombinant Bacillus subtilis as a chassis strain in constructing a genetically engineered bacterium for producing pullulanase through fermentation is also within the scope of protection of the present invention. Beneficial effects:

[0034] 1. This invention utilizes CRISPR / Cas9 gene knockout technology without residual resistance. Based on the knockout of two proteases in the original strain B.S168, eight chassis cells with iterative knockout of eight extracellular protease genes were constructed. This allows for rapid selection of chassis cells optimal for pullulanase expression and eliminates the problem of Bacillus subtilis extracellular proteases hydrolyzing secreted target proteins. The modified chassis cells have the advantages of high transformation efficiency, no residual resistance genes, almost no extracellular proteases, and no impact on the accumulation of extracellular target proteins. They have important scientific significance and application value for later optimized production.

[0035] 2. The recombinant strain B.S168△9amyX is used as the chassis cell for producing pullulanase. The pullulanase activity of the recombinant strain B.S168△9amyX is much higher than that of the original strain under the same fermentation conditions. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, and the above and / or other advantages of the present invention will become more apparent.

[0037] Figure 1: Electrophoretic analysis of 10 iterative knockouts of protease genes. a) Verification of the htrC protease gene knockout in the original strain. After successful knockout, the fragment size should be 2065 bp as verified by PCR. The strain was named B.S168△1. b) Verification of the aprX protease gene knockout. After successful knockout, the fragment size should be 2078 bp as verified by PCR. The strain was named B.S168△2. c) Verification of the aprE extracellular protease gene knockout. After successful knockout, the fragment size should be 2066 bp as verified by PCR. The strain was named B.S168△3. d) Verification of the epr extracellular protease gene knockout. After successful knockout, the fragment size should be 2081 bp as verified by PCR. The strain was named B.S168△4. e) Verification of the bpr extracellular protease gene knockout. After successful knockout, the fragment size should be 2074 bp as verified by PCR. The strain was named B.S168△5. f) Verification image for knockout of the mpr extracellular protease gene. After successful knockout, the fragment size should be 2076 bp as verified by PCR. The strain was named B.S168△6. g) Verification image for knockout of the nprE extracellular protease gene. After successful knockout, the fragment size should be 2072 bp as verified by PCR. The strain was named B.S168△7. h) Verification image for knockout of the nprB extracellular protease gene. After successful knockout, the fragment size should be 2064 bp as verified by PCR. The strain was named B.S168△8. r) Verification image for knockout of the vpr extracellular protease gene. After successful knockout, the fragment size should be 2159 bp as verified by PCR. The strain was named B.S168△9. j) Verification image for knockout of the wprA extracellular protease gene. After successful knockout, the fragment size should be 2070 bp as verified by PCR. The strain was named B.S168△10.

[0038] Figure 2: 12% gelatin plate liquefaction experiment of the starting strain 168△2 and 8 modified strains B.S168△3, B.S168△4, B.S168△5, B.S168△6, B.S168△7, B.S168△8, B.S168△9, and B.S168△10.

[0039] Figure 3: Validation of pullulanase activity on a 1% pullulan plate.

[0040] Figure 4: Reducing sugar standard curve using the DNS-Ghose method.

[0041] Figure 5: Enzyme activities of strains B.S168, B.S168amyX, and B.S168Δ9amyX. DETAILED DESCRIPTION

[0042] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials are commercially available unless otherwise specified.

[0043] In the following examples, the Bacillus subtilis 168 was purchased from Wuhan Miaoling Biotechnology Co., Ltd., the Terrific broth medium (TB medium), Super Broth medium (SB medium) and Luria-Bertani medium (LB medium) were purchased from Beijing Solebold Technology Co., Ltd., and the plasmids pJOE8999 and pBE2R were purchased from Wuhan Miaoling Biotechnology Co., Ltd.

[0044] Example 1: Construction of 10 protease CRISPR / cas9 knockout plasmids

[0045] Using the Bacillus subtilis 168 genome as a template, upper and lower homology arm fragments were amplified by PCR using primers X up-F and X up-R to obtain upper homology arm fragments of 10 proteases, all 1040 bp in length. Lower homology arm fragments of 10 proteases were amplified by PCR using primers X down-F and X down-R, respectively. Using the pJOE8999 plasmid as a template, N20 fragments of 10 proteases were amplified by PCR using primers X N20-F and X N20-R, respectively. N20 fragments of 269 bp in length were obtained for each of the 10 proteases.

[0046] The above PCR products were gel-recovered using a Takara gel recovery kit (Code No. 9762) to obtain three fragment products. These three fragments were used as templates and primers X N20-F2 and X down-R were used to obtain the connection products of the above three fragments by cross-over PCR, namely htrC knockout fragment, aprX knockout fragment, aprE knockout fragment, epr knockout fragment, nprE knockout fragment, bpr knockout fragment, mpr knockout fragment, nprB knockout fragment, vpr knockout fragment, and wprA knockout fragment, each with a length of 2289 bp. The 5' end of the knockout fragment has the homologous sequence actgttgggaagggcgatcg at the restriction site PvuⅠ in plasmid pJOE8999, and the 3' end of the knockout fragment has the homologous sequence Tctagattaagaaataatct at the restriction site and XbaⅠ in plasmid pJOE8999, ensuring that the plasmid pJOE8999 can be cloned in one step using the Novozymes kit (C112) and the knockout fragment after double digestion with PvuⅠ and XbaⅠ.

[0047] Among them, the primers required for the construction of CRISPR / cas9 knockout plasmids for the two proteases htrC and aprX and the eight extracellular proteases aprE, epr, nprE, bpr, mpr, nprB, vpr, and wprA are shown in Table 1 below, where X represents any one of the 10 proteases.

[0048] Among them, the nucleotide sequences of the extracellular protease genes aprE, epr, bpr, mpr, nprE, nprB, vpr and wprA are shown in SEQ ID NOs. 1, 3, 5, 7, 9, 11, 13 and 15, and the corresponding amino acid sequences are shown in SEQ ID NOs. 2, 4, 6, 8, 10, 12, 14 and 16; the nucleotide sequences of the protease genes htrC and aprX are shown in SEQ ID NOs. 17 and 19, and the corresponding amino acid sequences are shown in SEQ ID NOs. 18 and 20.

[0049] Table 1 Primers required for the construction of 10 protease CRISPR / cas9 knockout plasmids

[0050] Among them, the system of upper and lower homology arm PCR is as follows:

[0051] (1) PCR amplification reaction system: Buffer 25 μl, dNTPs 10 μl, Primer F 1.5 μl, Primer R 1.5 μl, Template 1 μl, ddH20 19 μl, total system 50 μl.

[0052] (2) The PCR amplification procedure was as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 sec, annealing at 54°C for 30 sec, extension at 60°C for 1.5 min, 30 cycles; extension at 72°C for 10 min, and storage at 4°C.

[0053] Among them, the cross-over PCR system is as follows:

[0054] (1) The PCR amplification reaction system was as follows: Buffer 25 μl, dNTPs 10 μl, primer X N20-F2 1.5 μl, primer X down-R 1.5 μl, 1 μl each of the three fragments, ddH20 17 μl, and the total system was 50 μl.

[0055] (2) The PCR amplification procedure was as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 sec, annealing at 54°C for 30 sec, extension at 60°C for 3 min, 30 cycles; extension at 72°C for 10 min, and storage at 4°C.

[0056] The cross-over PCR product and the plasmid pJOE8999 double-digested with PvuⅠ and XbaⅠ were cloned in one step using the Novozymes kit (C112). Finally, 10 protease knockout plasmids pJOE8999+htrC, pJOE8999+aprX, pJOE8999+aprE, pJOE8999+epr, pJOE8999+nprE, pJOE8999+bpr, pJOE8999+mpr, pJOE8999+nprB, pJOE8999+vpr, and pJOE8999+wprA were successfully constructed.

[0057] Example 2: Construction of Bacillus subtilis chassis strain

[0058] 1. Construction of initial cells of Bacillus subtilis 168△2

[0059] (1) Preparation of competent Bacillus subtilis 168

[0060] a. Inorganic salt stock solution: 40 g / L anhydrous dipotassium hydrogen phosphate, 20 g / L anhydrous potassium dihydrogen phosphate, 10 g / L ammonium sulfate, 20 g / L trisodium citrate dihydrate, and 1 g / L magnesium sulfate heptahydrate. Sterilize at 121°C for 15 min.

[0061] b. GMI solution: 10 mL of inorganic salt stock solution, 4 mL of 20% glucose, 1 mL of 5% casein hydrolyzate, 3 mL of 10% yeast extract, and distilled water to 100 mL. Sterilize at 115°C for 20 min, sterilizing each component separately.

[0062] c. GMII solution: 10 mL of inorganic salt stock solution, 4 mL of 20% glucose, 0.5 mL of 5% casein, 2 mL of 10% yeast extract, 1 mL of 1M magnesium chloride, 1 mL of 1M calcium chloride, and distilled water to 100 mL. Sterilize each component separately.

[0063] d. The activated Bacillus subtilis 168 single colony was inoculated into a 5 mL GMI solution shake tube and cultured overnight at 30°C and 125 rpm for 16 h.

[0064] e. Inoculate 2 mL of GMI solution into 18 mL of fresh GMI solution and incubate for 3.5 hours (37°C, 200 rpm). Inoculate 10 mL of seed solution into 90 mL of GMII culture medium and incubate for 90 minutes at 37°C, 200 rpm.

[0065] f. Centrifuge at 4°C for 10 minutes to collect the cells. Reserve 10 mL of the solution for resuspending the cells. Aliquot 500 μL into tubes and store in a -80°C freezer.

[0066] (2) Two protease knockout plasmids were introduced into Bacillus subtilis 168

[0067] a. Use AxyPrep Plasmid DNA Mini Kit to extract the two constructed protease knockout plasmids.

[0068] b. Remove the competent Bacillus subtilis 168 and incubate in a water bath at 45°C for 3-5 minutes. Add 1 μg of htrC protease knockout plasmid DNA and incubate at 37°C for 90 minutes. Spread the plate on an LB plate containing 5 μg / mL Kan and incubate at 30°C for 18 hours.

[0069] c. Pick a single spot on the plate, streak it on an LB plate, incubate it in a 48°C incubator for 12 hours, and perform colony PCR verification using verification primers.

[0070] d. Pick out the correct transformants by colony PCR, culture them in a shaker at 48°C, 200 rpm for 12 h, streak them on an LB plate with an inoculating loop, and culture them in a 37°C incubator for 12 h.

[0071] e. Pick out a single spot and streak it on an LB plate, incubate it in a 37°C incubator for 12 h, and perform colony PCR verification using verification primers (Table 2).

[0072] f. The correct transformants from the above colony PCR were cultured at 37°C overnight, and 800 μl of bacterial solution was added with 800 μl of 40% glycerol and stored in a bacterial tube to obtain the transformed strain B.S168△1 (knockout gene htrC).

[0073] g. The transformed strain B.S168△1 was prepared into a competent state and the aprX gene knockout plasmid was introduced. The knockout process was the same as above to obtain the transformed strain B.S168△2 (knockout genes htrC, aprX).

[0074] 2. Preparation of competent cells of Bacillus subtilis 168△2

[0075] (1) Inorganic salt mother solution: anhydrous dipotassium hydrogen phosphate 40 g / L, anhydrous potassium dihydrogen phosphate 20 g / L, ammonium sulfate 10 g / L, trisodium citrate dihydrate 20 g / L, magnesium sulfate heptahydrate 1 g / L. Sterilize at 121°C for 15 min.

[0076] (2) GMI solution: 10 mL of inorganic salt stock solution, 4 mL of 20% glucose, 1 mL of 5% casein hydrolyzate, 3 mL of 10% yeast extract, and distilled water to 100 mL. Sterilize at 115°C for 20 min, sterilizing each component separately.

[0077] (3) GMII solution: 10 mL of inorganic salt stock solution, 4 mL of 20% glucose, 0.5 mL of 5% casein, 2 mL of 10% yeast extract, 1 mL of 1M magnesium chloride, 1 mL of 1M calcium chloride, and distilled water to 100 mL. Sterilize each component separately.

[0078] (4) A single colony of activated Bacillus subtilis 168Δ2 was inoculated into a shake tube containing 5 mL of GMI solution and cultured overnight at 30°C and 125 rpm for 16 h.

[0079] (5) Take 2 mL of GMI solution and inoculate it into 18 mL of fresh GMI solution and culture it for 3.5 hours (37°C, 200 rpm). Take 10 mL of seed solution and inoculate it into 90 mL of GMII culture medium and culture it at 37°C, 200 rpm for 90 minutes.

[0080] (6) Centrifuge at 4°C for 10 min to collect the cells. Reserve 10 mL of the liquid for resuspending the cells. Aliquot 500 μL into tubes and store in a -80°C freezer.

[0081] 2. 8 extracellular protease knockout plasmids were introduced into Bacillus subtilis 168△2

[0082] (1) Use AxyPrep plasmid DNA mini kit to extract the constructed 8 extracellular protease knockout plasmids.

[0083] (2) Take out the competent cell of Bacillus subtilis 168△2 and incubate it in a water bath at 45℃ for 3-5min, add 1μg of the first extracellular protease knockout plasmid DNA, incubate at 37℃ for 90min, spread it on an LB plate containing 5μg / mL Kan, and incubate it at 30℃ for 18h.

[0084] (3) Pick a single spot on the plate, streak it on an LB plate, incubate it in a 48°C incubator for 12 h, and perform colony PCR verification using verification primers.

[0085] (4) Select the correct transformants by colony PCR, culture them in a shaker at 48°C, 200 rpm for 12 h, streak them on an LB plate with an inoculation loop, and culture them in a 37°C incubator for 12 h.

[0086] (5) Pick out a single spot and streak it on an LB plate, incubate it in a 37°C incubator for 12 h, and perform colony PCR verification using verification primers (Table 2).

[0087] (6) The correct transformants obtained by colony PCR were cultured at 37°C overnight, and 800 μl of bacterial solution was added with 800 μl of 40% glycerol and stored in a bacterial tube to obtain the transformed bacterium B.S168△3 (knockout genes htrC, aprX, aprE).

[0088] (7) The B.S168△3 modified bacteria were prepared into competent state, and the second to eighth extracellular protease knockout plasmids were introduced in sequence, and the above operation was repeated to finally obtain the modified strains B.S168△4 (knockout genes htrC, aprX, aprE, epr), B.S168△5 (knockout genes htrC, aprX, aprE, epr, nprE), B.S168△6 (knockout genes htrC, aprX, aprE, epr, nprE, bpr), B.S168△7 (knockout genes htrC, aprX, aprE, epr, nprE, bpr, mpr), B.S168△8 (knockout genes htrC, aprX, aprE, epr, nprE, bpr, mpr, nprB), B.S168△9 (knockout genes htrC, aprX, aprE, epr, nprE, bpr, mpr, nprB, vpr), B.S168△10 (knockout genes htrC, aprX, aprE, epr, nprE, bpr, mpr, nprB, vpr, wprA) (Figure 1).

[0089] Table 2 Validation primers required for the construction of 10 protease knockout strains

[0090] Example 3: Gelatin plate liquefaction experiment of starting strain Bacillus subtilis 168Δ2 and 8 modified strains

[0091] The starting strain Bacillus subtilis 168△2 (B.S168△2) and 8 modified strains (B.S168△3, B.S168△4, B.S168△5, B.S168△6B.S168△7, B.S168△8, B.S168△9, B.S168△10) were cultured in LB liquid culture medium at 37°C and 200rpm overnight; 50 μl of each bacterial liquid was spread on a 12% gelatin LB solid culture medium plate, the plate was sealed with a sealing film and placed upright in an incubator and cultured at 25°C for 36 hours.

[0092] Remove the incubated plates and place them in a 4°C refrigerator for 30 minutes before taking them out for observation. In the presence of extracellular proteases, 12% gelatin LB solid medium plates will liquefy. As shown in Figure 2, the 12% gelatin LB solid medium plates grown with the starting strain B.S168Δ2 exhibited the most pronounced liquefaction, while plates grown with B.S168Δ8, B.S168Δ9, and B.S168Δ10 exhibited the weakest liquefaction, with almost no liquefaction observed. This indicates that the extracellular proteases in the modified strains B.S168Δ8, B.S168Δ9, and B.S168Δ10 are extremely low and incapable of hydrolyzing the secreted target protein. Therefore, these three modified strains were used as the base strains for screening in the following examples.

[0093] Example 4: Construction and screening of Bacillus subtilis strains expressing pullulanase chassis

[0094] 1. Construction of Bacillus subtilis strain expressing pullulanase chassis

[0095] (1) The pullulanase gene amyX from Bacillus subtilis 168 was used to construct the expression plasmid pBE2RB+amyX. Plasmid pBE2RB was constructed in our laboratory based on the purchased pBE2R plasmid. The Apr sp portion of the original plasmid, totaling 432 bp, was removed and replaced with a BamHI restriction site. The primers used are shown in Table 3. The nucleotide sequence of the pullulanase gene amyX is shown in SEQ ID NO. 21, and the corresponding amino acid sequence is shown in SEQ ID NO. 22.

[0096] Table 3 Primers used to construct expression plasmid pBE2RB+amyX

[0097] (2) Using the genome of Bacillus subtilis 168 as a template and pBE2RB+amyX-F and pBE2RB+amyX-R as upper and lower primers for PCR, a pullulanase gene amyX fragment of 2214 bp was obtained. The upstream and downstream of the fragment contained homologous sequences of the BamHI-cleaved plasmid pBE2RB, namely AGAGGAATGTACACGGATCC and GGATCCGGTTATGTATTAAT, respectively. This ensured that the plasmid pBE2RB could be cloned in one step using the Novozymes kit (C112) and the PCR fragment after BamHI-cleavage, and the expression plasmid pBE2RB+amyX was successfully constructed.

[0098] (3) Use AxyPrep plasmid DNA mini kit to extract the constructed pBE2RB+amyX expression plasmid.

[0099] (4) The competent cells of the original strain B.S168 and the modified strains B.S168△8, B.S168△9, and B.S168△10 were taken out and incubated in a water bath at 45°C for 3-5 min. 1 μg of pBE2RB+amyX expression plasmid DNA was added to each of them, and the cells were cultured at 37°C for 90 min. The cells were spread on LB plates containing 5 μg / mL Kan and cultured at 37°C for 12 h.

[0100] (5) Pick a single spot on the plate, streak it on an LB plate containing 5 μg / mL Kan, culture it in a 37°C incubator for 12 h, and perform colony PCR verification using verification primers (Table 4).

[0101] (6) Select the correct transformant by colony PCR, culture at 37°C, 200 rpm shaker for 12 h, streak the plate on an LB plate containing 5 μg / mL Kan with an inoculating loop, and culture in a 37°C incubator for 12 h.

[0102] (7) A single spot was picked and streaked on an LB plate containing 5 μg / mL Kan, cultured in a 37°C incubator for 12 h, and colony PCR verification was performed using verification primers (Table 4).

[0103] (8) The correct transformants identified by colony PCR were cultured at 37°C overnight. 800 μl of bacterial solution was added with 800 μl of 40% glycerol and stored in a bacterial tube.

[0104] Table 4 Verification primers for expression plasmid pBE2RB+amyX introduced into Bacillus subtilis

[0105] 2. Screening of Bacillus subtilis strains expressing pullulanase chassis

[0106] (1) Strain culture: Five modified strains, B.S168amyX, B.S168△8amyX, B.S168△9amyX, B.S168△10amyX and E. coli (BL21)amyX (laboratory-preserved strains), were cultured in LB liquid medium containing 5 μg / mL Kan resistance, and the original strain B.S168 was cultured in LB medium without resistance. The culture conditions were 37°C, 200 rpm, and cultured overnight. 10 μl of each bacterial solution was spotted on a 1% pullulan plate without resistance, air-dried in a clean bench, sealed with sealing film, and placed upside down in an incubator for culture at 37°C for 36 h.

[0107] (2) Verification of the optimal base plate cells: After the culture is completed, 10 mL of 100% ethanol is poured onto the surface of the plate with the colonies. After standing for 30 minutes, an obvious transparent zone can be seen. The transparent zone of the B.S168△9amyX strain is the largest, as shown in Figure 3(a). After scraping off the bacterial sludge and observing again, the remaining amount of pullulan under the bacterial sludge can be seen. The white precipitate of the B.S168amyX strain is the least, followed by the B.S168△9amyX strain, as shown in Figure 3(b). Pullulan can be specifically hydrolyzed by pullulanase, and pullulan can combine with ethanol to form a white precipitate. As can be seen from Figure 3(a), the transparent zone of the B.S168△9amyX strain is the largest, that is, the pullulan is hydrolyzed in large quantities around the colonies. It can be considered that the B.S168△9amyX strain secretes the largest amount of pullulanase and has the highest enzyme activity. After scraping off the bacterial sludge, Figure 3(b) shows that the modified strain B.S168amyX has the least white precipitate beneath its colonies, followed by the B.S168Δ9amyX strain. This is likely because the extracellular protease in strain B.S168amyX has not been knocked out, allowing it to better penetrate the plate, resulting in a large amount of pullulan hydrolysis beneath the colonies by pullulanase. While strain B.S168amyX can express sufficient pullulanase, the expressed pullulanase is not effectively secreted outside the cells, contradicting the present invention. Combined with the results of the clear zone characterization experiment, the modified strain B.S168Δ9amyX was ultimately selected as the optimal strain for secreting and expressing pullulanase.

[0108] (3) Culture medium for fermentation verification of optimal chassis cells:

[0109] The seed culture medium formula is as follows: peptone 3 g / L, KH2PO4 0.5 g / L, MgSO4·7H2O 0.02 g / L, MnSO4·7H2O 0.01 g / L, and the initial pH of the culture medium is 6.0.

[0110] Fermentation medium is divided into four categories. The first category is Terrific broth medium (TB medium), which consists of: casein hydrolysate 1.2 g / L, yeast powder 2.4 g / L, potassium dihydrogen phosphate 1.254 g / L, potassium dihydrogen phosphate 0.231 g / L, and glycerol 5 mL / L; the second category is Super Broth medium (SB medium), which consists of: casein hydrolysate 1.2 g / L, yeast powder 2.4 g / L, and sodium chloride 0.5 g / L; the third category is self-prepared jar fermentation medium (G medium), which consists of: glutinous rice starch 2 g / L, peptone 3 g / L, KH2PO4 0.05 g / L, MgSO4·7H2O 0.01 g / L, MnSO4·7H2O 0.01 g / L, and the initial pH of the culture medium is 2. 6.0; The fourth type of culture medium is Luria-Bertani medium (LB medium), the components of which are: peptone 1 g / L, yeast powder 0.5 g / L, and sodium chloride 1 g / L.

[0111] (4) Optimal chassis cell fermentation verification: The optimal strain B.S168△9amyX that secretes and expresses pullulanase was used for free fermentation, and the B.S168 and B.S168amyX strains were used as control strains. The strain B.S168 was activated in LB liquid medium, and the B.S168amyX and B.S168△9amyX were activated in LB liquid medium containing 5μg / mL Kan resistance. The culture conditions were 37℃ for 12h. A small amount of bacterial liquid was dipped with an inoculation loop and three lines were drawn on LB solid medium containing 5μg / mL Kan resistance. The culture was placed in a 37℃ incubator for 12h. Single colonies were picked out and activated in LB liquid medium containing 5μg / mL Kan resistance. The culture conditions were 37℃ for 18h. A seed culture was performed in a 250 mL Erlenmeyer flask containing 50 mL of seed culture medium at a 1% v / v inoculum and incubated at 37°C for 12 h. Subsequently, a 2% v / v inoculum was inoculated into 50 mL of four different fermentation media in 250 mL Erlenmeyer flasks for fermentation. The cultures were incubated at 35°C and 160 rpm for 2-5 days. The fermentation broth was centrifuged at 8000 rpm for 10 min at 4°C. The supernatant obtained was the crude enzyme solution. A reducing sugar standard curve was generated using the DNS-Ghose method for enzyme activity verification, as shown in Figure 4. The pullulanase activity of the modified strain B.S168Δ9amyX after fermentation in G medium reached a maximum of 18 U / mL, an 89-fold increase compared to the original B.S168 strain under the same fermentation conditions and 1.2 times the activity of the B.S168amyX strain after fermentation (Figure 5). The modified strain B.S168△9amyX significantly improved the production of original pullulanase.

[0112] The steps for preparing a reducing sugar standard curve using the DNS-Ghose method are as follows:

[0113] Dissolve 50g of sodium hydroxide in an appropriate amount of distilled water. After fully dissolving and cooling to room temperature, transfer the solution into a 500mL volumetric flask and dilute to volume with distilled water to obtain a 10% sodium hydroxide solution. Add 6.9g of sodium sulfite to 15.2mL of the 10% sodium hydroxide solution and dissolve thoroughly to obtain Solution A. Weigh 10g of 3,5-dinitrosalicylic acid and dissolve it in an appropriate amount of distilled water. Transfer the solution into a 1000mL volumetric flask and dilute to volume to obtain a 1% (w / v) 3,5-dinitrosalicylic acid solution. Add 255g of potassium sodium tartrate to 300mL of the prepared 10% sodium hydroxide solution and dissolve thoroughly. Once dissolved, add 880mL of the prepared 1% 3,5-dinitrosalicylic acid solution and mix thoroughly to obtain Solution B. Thoroughly mix Solution A and Solution B and store in a brown bottle for 7-10 days before use.

[0114] Preparation of glucose standard: Weigh 10 mg of anhydrous glucose and dissolve it in 1 mL of pure water to make a 10 mg / mL glucose stock solution. The specific gradient dilution is shown in Table 5 below.

[0115] Table 5 Specific dilution gradients for the preparation of glucose standards

[0116] Prepare three clean 8-tube PCR tubes, take 40μL of the glucose series standard solution numbered 1-5 and add it to the corresponding numbered PCR tube, then add 60μL of DNS reagent and incubate in a PCR instrument at 99.9℃ for 10 minutes; after incubation, quickly cool to 4℃, add 100μL of deionized water to each tube, mix thoroughly, take 100μL and add it to a 96-well plate, and measure its absorbance at 540nm; measure each numbered standard solution in parallel three times and take the average value for drawing the standard curve. Draw a standard curve with the spectrophotometric value of the glucose standard solution as the horizontal axis and the glucose concentration as the vertical axis, as shown in Figure 4. The standard curve formula is y=0.9404x-0.0012, R 2 =1.

[0117] The pullulanase activity is specifically defined as follows: the amount of enzyme that generates 1 μmol of reducing sugar per unit time at the optimum temperature is defined as one enzyme activity unit.

[0118] The pullulanase activity is detected as follows: Pullulan is dissolved in acetic acid-sodium acetate buffer at pH 4.5 to prepare a pullulan substrate with a final concentration of 1%. 20 μL of 1% pullulan substrate is added to 20 μL of crude enzyme solution, reacted at 40°C in a PCR instrument for 10 minutes, 60 μL of DNS reagent is quickly added, and the solution is incubated at 99.9°C in a PCR instrument for 10 minutes; after incubation, the temperature is quickly lowered to 4°C, 100 μL of deionized water is added to each tube, 100 μL is taken and added to a 96-well plate after thorough mixing, and the absorbance at 540 nm is measured. A blank control is required for each sample, and three replicates are required for each sample. The difference between the sample and the control is substituted into the standard curve for conversion to obtain the enzyme activity corresponding to each sample.

[0119] In summary, the present invention uses CRISPR / cas9 technology to knock out the genes htrC and aprX on the basis of the original strain B.S168 to construct the starting strain B.S168△2. Subsequently, based on the starting strain B.S168△2, eight chassis cells B.S168△3, B.S168△4, B.S168△5, B.S168△6, B.S168△7, B.S168△8, B.S168△9, and B.S168△10 were constructed with no resistance residues, high transformation efficiency, and almost no extracellular proteases. Through screening, the chassis B.S168△9 that is most suitable for secreting and expressing pullulanase was obtained. The constructed recombinant strain B.S168△9amyX has significantly improved enzyme activity compared to the original strain B.S168.

[0120] The present invention provides a recombinant Bacillus subtilis, its construction method, and its application. There are numerous methods and approaches for implementing this technical solution. The above description is merely a preferred embodiment of the present invention. It should be noted that those skilled in the art may make various improvements and modifications without departing from the principles of the present invention, and such improvements and modifications are also within the scope of protection of the present invention. Any components not specified in this embodiment may be implemented using existing technologies.

Claims

1. A recombinant Bacillus subtilis, characterized in that: The recombinant Bacillus subtilis is obtained by overexpressing the pullulanase gene amyX based on the construction of a knockout strain of the extracellular protease gene using Bacillus subtilis B.S168△2 as the starting strain.

2. The recombinant Bacillus subtilis according to claim 1, characterized in that The Bacillus subtilis B.S168△2 is a modified strain of Bacillus subtilis 168, that is, two protease genes htrC and aprX are knocked out on the basis of the original strain.

3. The recombinant Bacillus subtilis according to claim 1, characterized in that The extracellular protease gene is any one or a combination of aprE, epr, bpr, mpr, nprE, nprB, vpr and wprA; preferably, the extracellular protease gene is a combination of aprE, epr, bpr, mpr, nprE and nprB, or a combination of aprE, epr, bpr, mpr, nprE, nprB and vpr, or a combination of aprE, epr, bpr, mpr, nprE, nprB, vpr and wprA; most preferably, the extracellular protease gene is a combination of aprE, epr, bpr, mpr, nprE, nprB and vpr.

4. The recombinant Bacillus subtilis according to claim 3, characterized in that The extracellular protease genes aprE, epr, bpr, mpr, nprE, nprB, vpr and wprA have nucleotide sequences as shown in SEQ ID NOs. 1, 3, 5, 7, 9, 11, 13 and 15, and corresponding amino acid sequences as shown in SEQ ID NOs. 2, 4, 6, 8, 10, 12, 14 and 16.

5. The recombinant Bacillus subtilis according to claim 1, characterized in that The pullulanase gene amyX is derived from Bacillus subtilis 168, and its nucleotide sequence is shown in SEQ ID NO.21, and the corresponding amino acid sequence is shown in SEQ ID NO.

22.

6. The method for constructing a recombinant Bacillus subtilis according to any one of claims 1 to 5, characterized in that: The steps include: (1) Construction of the starting strain B.S168△2: The starting strain B.S168△2 was obtained by knocking out the protease genes htrC and aprX of B. subtilis 168; (2) Construction of an extracellular protease gene knockout strain: The extracellular protease gene of the starting strain B.S168△2 was iteratively knocked out to obtain an extracellular protease gene knockout strain; (3) Overexpressing the pullulanase gene amyX: The extracellular protease gene knockout strain obtained in step (2) is overexpressed with the pullulanase gene amyX to construct a Bacillus subtilis pullulanase chassis strain, i.e., a recombinant Bacillus subtilis.

7. Use of the recombinant Bacillus subtilis according to any one of claims 1 to 5 in fermentation to produce pullulanase.

8. The use according to claim 7, characterized in that: The fermentation medium is any one of Terrific broth medium, Super Broth medium, jar fermentation medium and Luria-Bertani medium; preferably, the fermentation medium is jar fermentation medium, and its formula is: glutinous rice starch 2g / L, peptone 3g / L, KH2PO40.05g / L, MgSO4·7H2O 0.01g / L, MnSO4·7H2O 0.01g / L, pH 6.

0.

9. The use according to claim 7, characterized in that: The fermentation conditions are as follows: 35°C, 160 rpm, and culture for 2-5 days.

10. Use of the recombinant Bacillus subtilis according to any one of claims 1 to 5 as a chassis strain in constructing a genetically engineered bacterium for producing pullulanase by fermentation.

Citation Information

Patent Citations

  • Bacillus subtilis strain capable of efficiently expressing exogenous secretory proteinase

    CN104073458A

  • Recombinant bacillus subtilis of high-yield pullulanase and construction method thereof

    CN104694452A

  • Bacillus subtilis recombinant strain as well as preparation method and application thereof

    CN106085937A

  • Construction method of recombinant bacillus subtilis of high-yield pullulanase

    CN107058367A

  • Bacillus subtilis used for high-efficiency expression and high-density culture of pullulanase

    CN108102997A