Method for identifying sweet potato plants exhibiting low enlargement of seed potatoes

By crossing Koganegenkan with Kyushu 199 and using DNA markers on chromosome 11, the method efficiently identifies and produces sweet potato plants with low tuber hypertrophy, addressing the challenges of direct seeding cultivation and enhancing tuber quality.

JP2025109209APending Publication Date: 2025-07-25NAT AGRI & FOOD RES ORG
View PDF 0 Cites 2 Cited by

Patent Information

Application Number
JP2024002896
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-01-12
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

Current sweet potato cultivation methods face challenges in achieving direct seeding cultivation due to seed potato enlargement, leading to decreased quality and yield, and existing technologies lack efficient methods to identify and produce plants with low tuber hypertrophy.

Method used

The method involves crossing the Koganegenkan variety with the Kyushu 199 line to create an F1 population, using next-generation sequencing to identify polymorphic sites on chromosome 11, and employing DNA markers 1 to 4 to detect Kyushu 199-type mutant alleles, enabling rapid identification of plants with low tuber hypertrophy through PCR testing.

Benefits of technology

This approach allows for efficient production of sweet potato plants with low tuber hypertrophy, reducing labor and time required for cultivation, and ensuring high-quality tuber production without the need for lengthy confirmation cultivation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025109209000001_ABST
    Figure 2025109209000001_ABST
Patent Text Reader

Abstract

To provide a technique that enables direct seeding cultivation of seed potatoes in the field of production of sweet potato tuberous roots (sweet potato cultivation), which offers significant labor-saving benefits, wherein the technique enables efficient development of sweet potato plants having desired traits and exhibiting low enlargement of seed potatoes.SOLUTION: A method for identifying a sweet potato plant exhibiting low enlargement of seed potatoes, includes the steps of: detecting a nucleotide site indicating the "Kyushu 199-type variant allele" associated with a DNA marker from a genomic DNA of the sweet potato plant to be identified, with respect to "the DNA marker that shows relevance to the phenotype of low enlargement of seed potatoes" in the genomic DNA of sweet potato plants; and determining that the sweet potato plant to be identified is a sweet potato plant exhibiting low enlargement of seed potatoes if a nucleotide site indicating the "Kyushu 199-type variant allele" associated with the DNA marker is detected in the detection step.SELECTED DRAWING: Figure 2
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a technique that enables direct seeding cultivation of seed potatoes, which has labor-saving advantages at the site of sweet potato tuber production (sweet potato cultivation), and relates to a technique that enables efficient production of sweet potato plants showing low tuber growth of seed potatoes.

Background Art

[0002] In the cultivation field of kansho (sweet potato tuber) production, "seedling transplanting cultivation" is customarily carried out, in which "seedlings" cultivated indoors in a beer house, greenhouse, etc. are transplanted to the field and then cultivated. If "direct seeding cultivation" in which "seed potatoes" are directly planted in the field becomes possible as compared with this conventional seedling transplanting cultivation, it is expected that the labor at the site during the transplantation of seedlings in the current sweet potato cultivation will be significantly reduced, and the efficiency of kansho production will be improved. However, currently, the sweet potato variety lines generally used in the cultivation field of kansho (sweet potato tuber) production, when "direct seeding cultivation" is carried out, the planted parent seed potatoes become enlarged during the cultivation process, resulting in a decrease in the quality and yield of the daughter seed potatoes (the characteristic of seed potato enlargement is manifested), and there is a problem that commercially valuable tubers cannot be sufficiently produced. Therefore, in kansho cultivation using the current general sweet potato plant variety lines, there is a situation where direct seeding cultivation, which has great advantages in on-site cultivation, cannot be carried out.

[0003] The applicant of the present application, the National Agriculture and Food Research Organization, has found a sweet potato line showing the characteristic of suppressing the enlargement of seed potatoes (planted parent seed potatoes) when direct seeding cultivation of seed potatoes is carried out (Non-Patent Document 1), and by crossing this with a sweet potato plant having useful traits (for example, another sweet potato plant having desired traits related to growth and tuber quality) using this as an intermediate female parent (breeding material), it is expected to be possible to produce a sweet potato plant showing low tuber growth of seed potatoes and showing desired traits. However, in order to determine whether sweet potato plants belonging to the progeny population obtained by cross-breeding exhibit tuberous root hypertrophy or low hypertrophy, it is necessary to cultivate the seeds obtained by crossing once in the following year to obtain tuberous roots (daughter tubers), and then directly plant these tuberous roots as mother tubers in the following year to actually carry out direct seeding cultivation. In principle, it takes at least three years for crossing and selection. (Furthermore, in large-scale selection in the actual field, from the perspective of growth cultivation to ensure the number of mother tubers and multiple cultivation tests to ensure the reliability of the selection test for desired traits, it takes a total of four to five years.)

[0004] In view of the above, in creating sweet potato plants that are capable of direct seeding cultivation and exhibit desired traits, there is a need for technological development that enables efficient creation of sweet potato plants showing low mother tuber hypertrophy.

Prior Art Documents

Non-Patent Documents

[0005]

Non-Patent Document 1

Summary of the Invention

Problems to be Solved by the Invention

[0006] The present invention relates to a technology that enables direct seeding cultivation of mother tubers, which has a great advantage in reducing labor at the site of sweet potato tuber production (sweet potato cultivation). The problem to be solved is to provide a technology that can efficiently create sweet potato plants having desired traits and showing low mother tuber hypertrophy.

Means for Solving the Problems

[0007] In order to solve the above problems, the present inventors have conducted intensive research. First, the inventors crossed the variety Koganegenkan, which exhibits normal sweet potato hypertrophy, with the Kyushu 199 line (FERM P-22485), which exhibits low sweet potato hypertrophy and is held by the National Agriculture and Food Research Organization, to obtain seeds of the F1 population. In the following year, the obtained F1 population seeds were sown and grown under normal transplanting cultivation to obtain tuberous roots of each individual (line) in the F1 population. Since this cultivation was carried out in the absence of sweet potato seeds, it was not possible to determine the characteristics related to sweet potato hypertrophy / low hypertrophy. Therefore, in the following year, the obtained tuberous roots were used as sweet potato seeds (parent sweet potatoes) to perform "direct seeding cultivation" to form new tuberous roots (offspring sweet potatoes), and the "parent sweet potato weight ratio", which indicates the ratio of the weight of the parent sweet potato to the total weight of the sweet potatoes after cultivation, was measured. As a result of the test, it was found that about 50% (about half) of the individuals in the F1 population exhibited low sweet potato hypertrophy (parent sweet potato weight ratio of 0.2 or less).

[0008] In order to investigate the cause, the present inventors determined the sequences of almost all individuals (lines) in the F1 population using next-generation sequencer technology, and determined the haplotypes related to polymorphic sites on a genome-wide scale between the variety Koganegenkan, which exhibits sweet potato hypertrophy, and the Kyushu 199 line, which exhibits low sweet potato hypertrophy. Then, using genome-wide association analysis (GWAS), a statistical estimation of polymorphic mutations related to the association with the phenotype (the phenotype showing a parent sweet potato weight ratio of 0.2 or less) considered to exhibit low sweet potato hypertrophy was performed and shown in a Manhattan plot. As a result, it was estimated that polymorphic base sites (single-base sites or continuous base sites) in the region from "chr11:5719438" to "chr11:11357942" on chromosome 11 could be used as DNA markers showing the association with sweet potato hypertrophy / low hypertrophy when shown by the genomic information (Itr_r2.2) of the sweet potato wild relative species (Ipomoea trifida Mx23Hm line). Based on this result, polymorphic mutations 1 to 4 with a high possibility of showing the association with low sweet potato hypertrophy were selected, and after verification tests, these were designated as DNA markers 1 to 4.

[0009] Regarding the DNA markers 1 to 4, the following findings were obtained based on the experimental results (see the following experimental examples). (1) As a result of histogram analysis and genotyping analysis of the F1 population obtained by crossing the cultivar Koganegenkan, which exhibits normal sweet potato hypertrophy, and the Kyushu 199 line (FERM P-22485), which exhibits low sweet potato hypertrophy, there was a clear correlation between the "genotype having the Kyushu 199-type mutant alleles regarding DNA markers 1 to 4" and the "phenotype of low sweet potato fatness (parent sweet potato weight ratio of 0.2 or less)". In this regard, it was recognized that any of the four DNA markers 1 to 4 is a DNA marker capable of identifying sweet potato plants exhibiting low sweet potato hypertrophy.

[0010] (2) The DNA markers 1 to 4 (the four polymorphic sites described above) were recognized as linked DNA markers that are grouped in a "specific genomic region (5.64 Mb) on chromosome 11" of the sweet potato plant genome and the mutant alleles of these Kyushu 199 types exist in a "linked relationship" on the same chromosome. In this regard, it was recognized that there is a locus of a causative gene involved in sweet potato hypertrophy / low hypertrophy in the region containing the base sites of these four DNA markers or its peripheral region, and the mutant alleles of these Kyushu 199 types (mutant alleles regarding each DNA marker) exist in a "linked relationship" on the same chromosome as the mutant gene of the causative gene (allele of the mutant gene mutated to exhibit low hypertrophy). Here, the genome of the sweet potato plant is composed of autotetraploids. As for the combination of alleles (genotype) of the sweet potato hypertrophy / low hypertrophy gene, if it is a heterozygous genotype having one mutant gene showing low sweet potato hypertrophy in the genome, it was recognized that the phenotype showing low sweet potato hypertrophy is expressed as a "dominant trait". Regarding the genomic DNA of the sweet potato plant to be identified as described above, it was recognized that it is possible to identify a sweet potato plant showing low sweet potato hypertrophy by detecting a base site showing a "Kyushu 199-type mutant allele" regarding any one or more of the polymorphic sites 1 to 4 (DNA markers 1 to 4).

[0011] Furthermore, based on the above findings and judging from the positional relationship of the four DNA markers 1 to 4 and the high degree of association with the phenotype of low tuber swelling in sweet potato, from the base site of "DNA marker 1" existing on the most upstream side of the four DNA markers on chromosome 11 (the base site corresponding to chr11:5719438) to the most downstream base site of "DNA marker 4" existing on the most downstream side (the base site corresponding to chr11:11357942), regarding the genomic region of 5.64 Mb composed of the base sequence, for other Kyushu 199 type mutant alleles existing in the region that are in "linkage relationship" with the Kyushu 199 type mutant alleles related to DNA markers 1 to 4 (Kyushu 199 type mutant alleles showing polymorphic mutations with respect to the normal type alleles in the Koganesengan genome other than DNA markers 1 to 4), in principle, it was recognized that they are polymorphic mutations that can be used as DNA markers showing an association with low tuber swelling in sweet potato in the same manner as DNA markers 1 to 4.

[0012] Based on the above findings, the present inventors have completed the present invention. Specifically, the present invention relates to the inventions described below. [Item 1] Regarding a method for identifying characteristics related to low tuber swelling in sweet potato plants to be identified, (Detection step) Regarding the "DNA marker showing an association with the phenotype of low tuber swelling in sweet potato" shown below in the genomic DNA of a sweet potato plant (Ipomoea batatas), a step of detecting a base site showing the "Kyushu 199 type mutant allele" related to the DNA marker from the genomic DNA of the sweet potato plant to be identified, and, (Determination step) In the above detection step, when a base site showing the "Kyushu 199 type mutant allele" related to the DNA marker is detected, a step of determining that the sweet potato plant to be identified is a sweet potato plant showing low tuber swelling. A method for identifying a sweet potato plant showing low tuber swelling, characterized by including: ; (DNA marker showing an association with the phenotype of low tuber swelling in sweet potato) The "DNA marker showing an association with the phenotype of low tuber swelling in sweet potato" is Regarding the base sites of the base sequence constituting the region from "chr11:5719438" to "chr11:11357942" on chromosome 11 when shown by the genomic information (Itr_r2.2) of the diploid related wild species of sweet potato (Ipomoea trifida Mx23Hm strain), A DNA marker regarding the base site showing the "Kyushu 199 type mutant allele" with respect to the corresponding base site (normal allele) in the genomic DNA of the variety Koganesengan showing tuberous root hypertrophy, wherein the "Kyushu 199 type mutant allele" is a mutant allele showing a polymorphism occurring at the corresponding base site on one chromosome in the hexaploid genome of the Kyushu 199 strain (FERM P-22485) showing low tuberous root hypertrophy with respect to the corresponding base site (normal allele) in the genomic DNA of the variety Koganesengan showing tuberous root hypertrophy, ; The "DNA marker showing the relevance to the phenotype of low tuberous root hypertrophy" is i) one or more DNA markers among the DNA markers shown by the following DNA markers 1 to 4, or ii) a DNA marker in which the base site showing the "Kyushu 199 type mutant allele" related to the DNA marker is in a linkage relationship with any of the base sites showing the "Kyushu 199 type mutant allele" related to the following DNA markers 1 to 4, ; (DNA markers 1 to 4) The "DNA marker 1" is a DNA marker regarding the base site of the sweet potato plant (Ipomoea batatas) corresponding to "chr11:5719438" on the above chromosome 11, and regarding the corresponding base site "G" (normal allele) in the genomic DNA of the variety Koganesengan showing tuberous root hypertrophy, it is a DNA marker regarding the base site showing "T" in the "Kyushu 199 type allele", The "DNA marker 2" is a DNA marker related to the base site of the sweet potato plant (Ipomoea batatas) corresponding to "chr11:6183279" on the 11th chromosome. Regarding the corresponding base site "T" (normal allele) in the genomic DNA of the variety Koganesengan, which exhibits tuberous root hypertrophy, the "Kyushu 199-type allele" shows "C" at this base site. The "DNA marker 3" is a DNA marker related to the consecutive base sites of the sweet potato plant (Ipomoea batatas) corresponding to "chr11:8693418~chr11:8693419" on the 11th chromosome. Regarding the corresponding base site "TA" (normal allele) in the genomic DNA of the variety Koganesengan, which exhibits tuberous root hypertrophy, the "Kyushu 199-type allele" shows "TTA" with "T" inserted between the two bases at this base site. The "DNA marker 4" is a DNA marker related to the consecutive base sites of the sweet potato plant (Ipomoea batatas) corresponding to "chr11:11357940~chr11:11357942" on the 11th chromosome. Regarding the corresponding base site "AGT" (normal allele) in the genomic DNA of the variety Koganesengan, which exhibits tuberous root hypertrophy, the "Kyushu 199-type allele" shows "CGC" at this base site. ; The method for identifying a sweet potato plant that exhibits low tuberous root hypertrophy. [Item 2] Regarding the "DNA marker 1", the "chr11:5719438" on the 11th chromosome of the genomic information (Itr_r2.2) of the diploid related wild species (Ipomoea trifida Mx23Hm strain) of sweet potato corresponding to the position information in the sweet potato plant genomic DNA is specified as the 2000th base site in the base sequence shown by SEQ ID NO: 1. Regarding the above-mentioned "DNA Marker 2", "chr11:6183279" on chromosome 11 of the genomic information (Itr_r2.2) of the diploid related wild species of sweet potato (Ipomoea trifida Mx23Hm strain) corresponding to the position information in the sweet potato plant genomic DNA is specified as the 2002nd base site in the base sequence shown in SEQ ID NO: 4. Regarding the above-mentioned "DNA Marker 3", "chr11:8693418" to "chr11:8693419" on chromosome 11 of the genomic information (Itr_r2.2) of the diploid related wild species of sweet potato (Ipomoea trifida Mx23Hm strain) corresponding to the position information in the sweet potato plant genomic DNA are specified as the 2001st to 2002nd base sites in the base sequence shown in SEQ ID NO: 7. Regarding the above-mentioned "DNA Marker 4", "chr11:11357940" to "chr11:11357942" on chromosome 11 of the genomic information (Itr_r2.2) of the diploid related wild species of sweet potato (Ipomoea trifida Mx23Hm strain) corresponding to the position information in the sweet potato plant genomic DNA are specified as the 2001st to 2003rd base sites in the base sequence shown in SEQ ID NO: 10. The method for identifying a sweet potato plant showing low growth and hypertrophy of the tuberous roots according to item 1. [Item 3] The above-mentioned "DNA marker showing the relevance to the phenotype of low growth and hypertrophy of the tuberous roots" refers to one or more DNA markers among the DNA markers shown by the above-mentioned DNA Markers 1 to 4. The method for identifying a sweet potato plant showing low growth and hypertrophy of the tuberous roots according to item 1. [Item 4] The above-mentioned "DNA marker showing the relevance to the phenotype of low growth and hypertrophy of the tuberous roots" refers to the above-mentioned DNA Marker 3. The method for identifying a sweet potato plant showing low growth and hypertrophy of the tuberous roots according to item 1. [Item 5] The method for identifying sweet potato plants showing low tuberous root growth of the species according to claim 1, wherein the detection step is performed using a sweet potato plant belonging to a progeny population of the Kyushu 199 strain (FERM P-22485) as the sweet potato plant to be identified. [Claim 6] A method for producing a sweet potato plant showing low tuberous root growth of the species, comprising using the identification method according to any one of claims 1 to 5. [Claim 7] A method for producing a sweet potato strain showing low tuberous root growth of the species, comprising using the identification method according to any one of claims 1 to 5. [Claim 8] A method for producing a plant body of a sweet potato plant showing low tuberous root growth of the species, comprising using the identification method according to any one of claims 1 to 5. [Advantages of the Invention]

[0013] By using the identification technique of the present invention, regarding the identification of traits related to tuberous root growth / low tuberous root growth of sweet potato plants belonging to a progeny population obtained by cross-breeding for variety improvement, it is possible to easily identify only by using a DNA identification technique such as a PCR test using a part of the germinated plant body or a grown leaf as a sample, without actually performing confirmation cultivation in direct seeding cultivation over several years to identify the trait. Accordingly, the present invention relates to a technique that enables direct seeding cultivation of a species of sweet potato having a great advantage in terms of labor reduction at the site of sweet potato tuberous root production (sweet potato cultivation), and it is possible to provide a technique that can efficiently produce a sweet potato plant having a desired trait and showing low tuberous root growth of the species. [Brief Description of the Drawings]

[0014]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Mode for Carrying Out the Invention

[0015] Hereinafter, embodiments of the present invention will be described in detail. However, the technical scope of the present invention is not limited to an aspect including all of the following configurations. Further, the technical scope of the present invention does not exclude an aspect including other configurations than the configurations described below as long as the functions and effects exhibited by the technical features of the present invention are not substantially hindered.

[0016] 1. Term Explanation In this specification, the "sweet potato plant (sweet potato)" refers to a plant belonging to Ipomoea batatas (L.) Lam. Since the sweet potato plant has a homologous hexaploid genome, it exhibits a characteristic that the traits of recessive genes are extremely difficult to express. In this specification, the "tuberous root" refers to the tuber (yam) which is an underground storage organ in which the roots of the sweet potato plant are enlarged. In this specification, "low growth of seed yams" means that in the case of performing "direct seeding cultivation" in which tuberous roots are directly planted in the soil as seed yams and the whole plant is cultivated until harvest in the cultivation of sweet potato plants, the growth of the seed yams (parent yams) accompanying the growth of the plants is suppressed and the growth of the newly formed daughter yams becomes good. This characteristic includes characteristics such as the growth of the parent yam being slower or the parent yam growing only slightly compared to the growth of the daughter yam, the daughter yam growing but the parent yam not growing at all or the parent yam decomposing (withering), and the like. As an objective index value regarding this characteristic, as long as the following parent yam weight ratio shows a value lower than a certain level, it can be evaluated as having low growth of seed yams. In this specification, "parent tuber hypertrophy" refers to the characteristic that when the above-mentioned "direct seeding cultivation" is carried out, the growth of the daughter tubers newly formed without the suppression of the hypertrophy of the seed tubers (parent tubers) accompanying the growth of the plant body becomes poor. This characteristic includes the characteristic that the growth of the daughter tubers is slower or the daughter tubers grow only slightly compared to the growth of the parent tubers, the characteristic that the parent tubers grow but the daughter tubers are not formed or are formed only slightly, and the like. As an objective index value regarding this characteristic, if the following parent tuber weight ratio shows a value higher than a certain level, it can be evaluated as seed tuber hypertrophy.

[0017] In this specification, the "parent tuber weight ratio" refers to the value calculated by the following "Formula (1)" by measuring the weights of the parent tubers (seed tubers planted at the start of cultivation) and all the daughter tubers (tubers newly formed by the growth of the plant body) after growing and cultivating the plant body by direct seeding cultivation and then digging out the underground part. [Formula (1)] Parent tuber weight ratio = Weight of parent tubers (g) / Total weight of all tubers (g) ··· Formula (1) Here, the total weight of all tubers (g) indicates the sum of the weight of the parent tubers (g) and the weights of all the formed daughter tubers (g). The lower this value, the more the hypertrophy of the seed tubers (parent tubers) planted at the start of cultivation is suppressed. As a reference value regarding the relationship between the value of the parent tuber weight ratio and the low seed tuber hypertrophy property, when judging from the state of the tuberous roots after harvest, if the value (parent tuber weight ratio) is 0.2 or less, it can be evaluated that the property of low seed tuber hypertrophy is clearly shown. For example, in the Kyushu 199 line showing low seed tuber hypertrophy, the value shows a relatively low value of about 0.1 to 0.2. In addition, in sweet potato plants showing normal general seed tuber hypertrophy, the value shows a high value such as 0.3 or more. For example, in Koganesengan, a normal variety showing seed tuber hypertrophy, the value shows a high value of about 0.5 to 0.9.

[0018] In this specification, the term "line" refers to a sub-classification of "species" and is used as a term to refer to a population that has morphological and / or physiological characteristics (phenotype) that can be distinguished as a group from other varieties or lines (populations). Among the "lines", a population that has sufficient similarity in characteristics within the same generation and has the stability to maintain the characteristics across generations is called a "variety", and a variety is also included as part of a line. In this specification, "vegetative propagation" refers to a mode of reproduction in which the whole plant is regenerated from a part, organ, or tissue of the plant without going through pollination. As an example of vegetative propagation of sweet potato plants, examples of propagation modes include planting of tuberous roots, cuttings or buds of the above-ground part, division of plants, tissue culture, etc., but are not particularly limited thereto. Here, a sweet potato plant obtained by vegetative propagation is a clone having the same genetic characteristics as the original sweet potato plant, and as long as the same genetic characteristics (such as genotype, phenotype, etc.) are maintained, it corresponds to the same sweet potato plant as the original sweet potato plant. The same applies even if vegetative propagation is repeated. In this specification, "self-propagation" means a mode of reproduction by self-crossing (self-pollination) by the same individual. In this specification, "cross-propagation" means a mode of reproduction by mating between different individuals.

[0019] In this specification, the term "descendant population" refers to a sub-population (mating population) obtained by using a predetermined sweet potato plant as one or both of the mating parents and the progeny population thereof. Here, the mating using a predetermined sweet potato plant as "both" of the mating parents includes self-crossing (self-propagation) and a mode of reproduction by mating between separate individuals corresponding to the predetermined sweet potato plant. In addition, the mating using a predetermined sweet potato plant as "one" of the mating parents includes the mating of the predetermined sweet potato plant with other sweet potato plants. That is, it includes the mating with a sweet potato plant belonging to another sweet potato line as the other mating parent. In this regard, as the descendant population, a sub-population (mating population) generated by mating between different variety lines and the progeny population thereof are included herein. In this specification, the term "descendants" is used to mean children and their descendants. In this regard, the expression "the population of its descendants (the population of descendants of a subpopulation)" refers to a population of a generation later than the population to which "its" refers. Examples of the "population of its descendants" include a population obtained by self-propagation, isogenic cross-propagation, or repeated passage of these (a population from the second generation onward by self-propagation and / or isogenic cross-propagation), but crossing with other strains (outcrossing) is also permitted.

[0020] In this specification, the "mutant population (mutant strain, mutant line)" refers to a population in which mutant traits of mutants (mutant individuals) created by mutation, gene introduction, genome editing, etc. are fixed. The progeny population having the mutant trait is also included herein.

[0021] In this specification, the expression "the nucleotide sequence from the Y-th to the Z-th position of SEQ ID NO: X" (where X, Y, and Z in this paragraph are natural numbers) means the nucleotide sequence composed of the Y-th nucleotide site to the Z-th nucleotide site in the nucleotide sequence described in SEQ ID NO: X shown in the Sequence Listing. It is also possible to express it as the nucleotide sequence composed of the nucleotides from the Y-th to the Z-th in the nucleotide sequence shown by SEQ ID NO: X, the nucleotide sequence composed of the nucleotides from the Y-th position to the Z-th position in the nucleotide sequence shown by SEQ ID NO: X, the nucleotide sequence composed of the nucleotides from the Y-th to the Z-th in the nucleotide sequence shown by SEQ ID NO: X, etc.

[0022] In this specification, the term "PCR reaction (PCR)" is used as a term meaning polymerase chain reaction. In this specification, the term "sense strand" is used to refer to a single-stranded DNA strand that indicates the 5' to 3' direction with respect to a continuous genomic region, where the numerical value indicating the base site on the chromosome increases from a smaller value to a larger value. A forward primer refers to a primer designed in the sense strand direction. On the other hand, the term "complementary strand" is used to refer to a single-stranded DNA strand that indicates the 5' to 3' direction (the direction of the base sequence complementary to the base sequence of the above-mentioned sense strand) with respect to the base site on the chromosome, where the numerical value indicating the base site decreases from a larger value to a smaller value. A reverse primer refers to a primer designed in the complementary strand direction.

[0023] In this specification, "PCR primer" refers to a primer used in a PCR reaction that is composed of or contains an oligonucleotide (or polynucleotide). It can also be expressed as an oligonucleotide primer. A PCR primer is a short single-stranded DNA that binds to a specific sequence in a PCR reaction and functions as a starting point for the extension of a heat-resistant DNA polymerase. In this specification, the description "PCR primer containing the base sequence of **" can be explained as a PCR primer that contains a single-stranded DNA containing the base sequence of ** as an oligonucleotide (or polynucleotide). This description can also be expressed as a PCR primer containing the base sequence of **, a PCR primer containing a single-stranded DNA containing the base sequence of **, etc. Regarding the main body part (the part not including molecular modifications, etc.) of the oligonucleotide (or polynucleotide) of the PCR primer, it can also be expressed as a PCR primer composed of a single-stranded DNA containing the base sequence of **, a PCR primer consisting of a single-stranded DNA containing the base sequence of **, etc. In addition, the description of "PCR primer containing the base sequence of **" in this specification can be described in a limiting expression such as a PCR primer composed of the base sequence of **, a PCR primer consisting of the base sequence of **, etc. when performing the limitation of the scope. More specifically, it is also possible to describe it in a limiting expression such as a PCR primer comprising a single-stranded DNA showing the base sequence of **, a PCR primer composed of a single-stranded DNA showing the base sequence of **, a PCR primer consisting of a DNA showing the base sequence of **, etc.

[0024] 2. Method for Identifying Sweet Potato Plants Exhibiting Low Hypertrophy of Sweet Potato The present invention relates to a method for identifying characteristics related to the low tuber bulking property of the sweet potato plant species to be identified. Specifically, the method according to the present invention relates to a method for identifying a sweet potato plant showing low tuber bulking property, which includes performing the following "detection step" and "determination step".

[0025] (2-1) Object to be identified The "sweet potato plant" that is the object to be identified in the technology according to the present invention refers to a plant belonging to the sweet potato species (Ipomoea batatas (L.) Lam.) of the genus Ipomoea in the Convolvulaceae family. Plants belonging to the sweet potato species (sweet potato) (sweet potato plants) have the characteristic of forming new tuberous roots (seed tubers) during the growth of the plant body and storing carbohydrates such as starch, and may also contain various functional components such as dietary fiber, anthocyanins, minerals, vitamins, etc. Its tuberous roots are also called sweet potatoes and are often important agricultural product resources used as food and ingredients. As described above, in general sweet potato variety lines currently used as crops, most variety lines show the seed tuber bulking property when directly sown, and no variety line showing low seed tuber bulking property has been confirmed in general major sweet potato variety lines. That is, no variety line showing low seed tuber bulking property with suppressed bulking of the parent tuber has been confirmed in general major sweet potato variety lines. Here, sweet potato (Ipomoea batatas) is widely cultivated around the world including Japan as an important crop, and there are many cultivar lines due to breeding improvement. As a result, in the current major sweet potato cultivar lines, which have hexaploid genomic DNA with a doubled chromosome set, there is also a corresponding diploid chromosome set in the related wild species (Ipomoea trifida) that serves as the prototype. Therefore, it is recognized that the corresponding regions on chromosome 11 (the locus where the genes involved in tuberous swelling / non-swelling of sweet potato were found to exist in the following experimental examples) commonly exist throughout the taxonomic group of sweet potato (Ipomoea batatas).

[0026] In view of the above, it is recognized that any sweet potato plant belonging to the genus sweet potato (Ipomoea batatas) can be the object of identification of the present invention. In this regard, it is recognized that the sweet potato plants belonging to each line (including cultivars) or population belonging to sweet potato (Ipomoea batatas) can be the object of identification of the present invention. In addition, the objects of identification of the present invention include plants belonging to the mating population (F1 population) or its progeny population generated by mating sweet potato plants belonging to each line (including cultivars) or population belonging to sweet potato (Ipomoea batatas). That is, the objects of identification of the present invention include sweet potato plants belonging to the progeny population generated by mating sweet potato plants belonging to each line (including cultivars) or population belonging to sweet potato (Ipomoea batatas). Regarding the above points, the method of identification according to the present invention can efficiently identify the characteristics related to tuberous swelling / non-swelling of sweet potato in sweet potato plants for which such characteristics have not been determined. That is, regarding sweet potato plants belonging to each cultivar line or various populations of sweet potato (Ipomoea batatas), it is possible to easily identify such characteristics only by performing identification using DNA markers without performing confirmation in direct seeding cultivation.

[0027] [A sweet potato plant belonging to a progeny population obtained using a sweet potato plant showing low tuberous root hypertrophy as a mating parent] As a detection step of the discrimination method according to the present invention, a mode of performing the discrimination on a sweet potato plant belonging to a progeny population (obtained mating population or its progeny population) of "a sweet potato plant showing low tuberous root hypertrophy" can be preferably cited. Here, as the "sweet potato plant showing low tuberous root hypertrophy", sweet potato plants belonging to strains (including varieties) belonging to sweet potato (Ipomoea batatas) that have been found to show low tuberous root hypertrophy, such as "Kyushu 199 strain", "Tamaakane", and "Resisto" can be cited (see the following experimental examples). Further, as the "sweet potato plant showing low tuberous root hypertrophy", sweet potato plants belonging to "a population showing a parent sweet potato weight ratio of 0.2 or less in the progeny population of the Kyushu 199 strain, Tamaakane, or Resisto" can also be cited. In this regard, as the detection step according to the present invention, a mode of performing the discrimination on a sweet potato plant belonging to a progeny population (obtained mating population or its progeny population) of the "Kyushu 199 strain", "Tamaakane", or "Resisto" can be preferably cited. Further, a mode of performing the discrimination on a sweet potato plant belonging to a progeny population (obtained mating population or its progeny population) of "a population showing a parent sweet potato weight ratio of 0.2 or less in the said progeny population" can also be cited. In particular, for the purpose of improving the varieties of ordinary sweet potato varieties (in order to introduce the trait of low tuberous root hypertrophy), a mode of performing the discrimination on a sweet potato plant belonging to a progeny population (obtained mating population or its progeny population) of the "Kyushu 199 strain" created as an intermediate female parent strain can be preferably cited. Further, a mode of performing the discrimination on a sweet potato plant belonging to a progeny population (obtained mating population or its progeny population) of "a population showing a parent sweet potato weight ratio of 0.2 or less in the said progeny population" can also be cited.

[0028] As mating for obtaining a progeny population of the "sweet potato plant showing low hypocotyl swelling of the seed potato" regarding the object to be identified of the present invention, although an aspect of obtaining a progeny population by mating the above-mentioned "sweet potato plants showing low hypocotyl swelling of the seed potato" with each other is also allowed, as an aspect particularly assumed as the application object of the identification method according to the present invention, when mating with "other sweet potato plants" using the "sweet potato plant showing low hypocotyl swelling of the seed potato" as a trait donor parent, regarding the sweet potato plants belonging to the obtained progeny population (the obtained mating population or its progeny population), an aspect of efficiently identifying the trait can be mentioned. Here, regarding the mating for obtaining a progeny population of the "sweet potato plant showing low hypocotyl swelling of the seed potato", as the "sweet potato plant showing low hypocotyl swelling of the seed potato" used as a trait donor parent for the trait of low hypocotyl swelling of the seed potato, the sweet potato plants belonging to the above-mentioned Kyushu 199 line, Tamaakane, Resisto, or their progeny populations (populations showing a parent potato weight ratio of 0.2 or less) can be mentioned. In this regard, as the application object of the identification method according to the present invention, sweet potato plants belonging to the Kyushu 199 line, Tamaakane, Resisto, or their progeny populations (populations showing a parent potato weight ratio of 0.2 or less) are used as one of the mating parents and mated with other sweet potato plants (for example, plants of a normal sweet potato cultivar line having desired traits), and regarding the obtained progeny population (the obtained mating population or its progeny population), it becomes possible to efficiently identify the traits related to low hypocotyl swelling of the seed potato.

[0029] As a practical aspect particularly assumed by the present invention, as the "other sweet potato plants" that are mating partners of the above-mentioned sweet potato plants showing low hypocotyl swelling of the seed potato (trait donor parents for traits related to low hypocotyl swelling of the seed potato), sweet potato plants belonging to normal cultivar lines belonging to Ipomoea batatas can be mentioned. Here, as the "other sweet potato plants", it is mainly assumed a normal sweet potato plant showing seed potato swelling that wants to introduce the trait related to low hypocotyl swelling of the seed potato, and it is possible to use sweet potato plants having desired traits (for example, traits excellent in characteristics related to the growth of the plant body, quality and yield of tuberous roots, disease resistance, environmental characteristics, etc.). As the "other sweet potato plants", particularly preferred embodiments include sweet potato plants belonging to the following 17 major cultivar lines (see the following experimental examples). Examples of sweet potato plants belonging to the "17 cultivar lines" include sweet potato plants belonging to Koganegen, Shiroyutaka, Konaisin, Shirosatsuma, Churakoikou, Murasaki Masari, Tamayutaka, Daichinoyume, Quick Sweet, Beniharuka, Beniazuma, Takase 14, Silk Sweet, Benimasari, Anna Kou, Ayamurasaki (Ayamurasaki), or Anna Kogane. The 17 cultivar lines are sweet potato cultivar lines that had a top share in the kansho production in Japan at the time of filing the present application, and are major cultivar lines that account for 88% of the sweet potato cultivation area in Japan. In addition, examples of the "other sweet potato plants" include sweet potato plants belonging to the "progeny population" of these 17 cultivar lines. Particularly, from the viewpoint of eliminating false positives related to DNA markers, sweet potato plants belonging to a progeny population in which mating with the above-described sweet potato plants showing low growth and fattening of the seed potato and cultivar lines other than these major cultivar lines has not been performed can be particularly preferably cited.

[0030] (2-2) Detection step The identification method according to the present invention is a method including a step of detecting a Kyushu 199-type allele related to the following DNA marker from the genomic DNA of a sweet potato plant to be identified. Specifically, the identification method according to the present invention (Detection step) Regarding the "DNA marker showing the relationship with the phenotype of low growth and fattening of the seed potato" shown below in the genomic DNA of a sweet potato plant (Ipomoea batatas), a step of detecting a base site showing the "Kyushu 199-type mutant allele" related to the DNA marker from the genomic DNA of the sweet potato plant to be identified.

[0031] In the detection step, it is possible to perform the detection of a predetermined polymorphism (mutant allele) related to the following DNA marker from the genomic DNA of sweet potato plants by using existing nucleic acid detection techniques. For example, techniques using the PCR method, techniques using the hybridization method, etc. can be used. It is also possible to use polymorphism detection techniques such as microchips and real-time PCR methods.

[0032] As the detection step according to the present invention, from the viewpoints of ease and rapidity, a technique using the PCR method with a primer capable of specifically amplifying a base sequence showing a mutant allele with respect to the base sequence containing the locus related to the following DNA marker is preferably used. Here, the methods such as reaction reagents and reaction conditions used in the PCR method are not particularly limited as long as they are methods such as reaction reagents and reaction conditions that can obtain a primer-specific PCR amplification fragment, and can be carried out by known methods. In addition, as the detection means for the PCR amplification fragment, it is possible to carry out by a conventional method or a novel method. As an example of the detection principle, there are modes such as a method of intercalating a labeling substance into the PCR amplification fragment, a method of obtaining a PCR amplification fragment using a primer bound with a labeling substance, a method of hybridizing a probe bound with a labeling substance to the PCR amplification fragment, etc. Also, depending on the method, it is possible to perform size fractionation of the amplified DNA fragment using a gel, a capillary, etc., but it is also possible to directly detect and quantify the amplified fragment incorporating a labeling substance such as the real-time PCR method. As an example of the labeling substance, it is possible to detect the PCR amplification fragment by using a fluorescent substance (for example, ethidium bromide, SYBR Green, etc.), a chromogenic substance, a luminescent substance, a radioisotope, etc., but it is not particularly limited to these.

[0033] The detection of mutant alleles in the detection step can be performed using a sample containing the sweet potato plant itself or its genomic DNA. For example, in the detection step, detection can be performed using the sweet potato plant, a processed product of the plant, or DNA extracted from the plant or the processed product, etc. Here, as a sample of the target sweet potato plant used in the detection operation in the detection step, it suffices that the sample contains genomic DNA to such an extent that a detection reaction is possible, but it is preferably used in the state of a biological sample (DNA extract or DNA extraction solution) purified to a state with few contaminants other than DNA. As an example, it is possible to use a part of the plant body or a processed product (ground product, cut product, powder product, paste product, puree product, ground product, dried product, squeezed juice product, extract, etc.) as the sample. In addition, there is no particular limitation on the part of the sweet potato plant body to be the target sample, and it is possible to use all parts or some parts of the plant body, and any growth stage. For example, stems, petioles, leaf blades, tuberous roots, leaves, vines, roots, apical buds, axillary buds, flower buds, flower organs, fruits, seeds, seedlings, etc. can be mentioned.

[0034] [DNA Marker Indicating Association with the Phenotype of Low Hypertrophy of Sweet Potato] The detection step in the identification method according to the present invention includes a step of detecting the "Kyushu 199 type mutant allele" related to the "DNA marker indicating the association with the phenotype of low hypertrophy of sweet potato".

[0035] Here, as described in the above paragraph, the cultivar lines belonging to sweet potato (Ipomoea batatas), which is cultivated as a major crop in Japan, have a hexaploid genomic DNA with a doubled chromosomal set of the genome during the process of variety improvement, while its wild relative (Ipomoea trifida) has a genomic DNA of the corresponding diploid chromosomal set as its prototype. Therefore, it is recognized that the corresponding regions on chromosome 11 exist commonly in the entire taxonomic group of sweet potato (Ipomoea batatas). In this regard, as the "DNA marker showing the association with the phenotype of low tuberous growth of sweet potato" according to the present invention, it can be described as follows by using the genomic information of the diploid related wild species (Ipomoea trifida) of sweet potato as the position information on the chromosomal genome of sweet potato plants. In this regard, as the "DNA marker showing the association with the phenotype of low tuberous growth of sweet potato" according to the present invention, when shown by the genomic information (Itr_r2.2) of the diploid related wild species (Ipomoea trifida Mx23Hm line) of sweet potato, for the base sites of the base sequence constituting the region from "chr11:5719438" to "chr11:11357942" on chromosome 11, regarding the corresponding base sites of sweet potato plants (Ipomoea batatas), a DNA marker regarding the base site showing the "Kyushu 199 type mutant allele" with respect to the corresponding base site (normal type allele) in the genomic DNA of the cultivar Koganesengan showing tuberous growth of sweet potato can be described.

[0036] In this specification, the position information on the chromosome described as "chr11:********" indicates the position information on the chromosome specified by the public genomic information (Itr_r2.2) of the Ipomoea trifida Mx23Hm line, which is a diploid related wild species of sweet potato. For example, in the case of the notation "chr11:********", it is specified by the position information of the ********-th base site on chromosome 11 of the Ipomoea trifida Mx23Hm line. Here, the "Itr_r2.2", which is the public genomic information of the Ipomoea trifida Mx23Hm line, can be referred to from "https: / / plantgarden.jp / ja / list / t35884 / genome / t35884.G002" in "Plant GARDEN" operated by the Kazusa DNA Research Institute, a public interest incorporated foundation. In this specification, the "Kyushu 199-type mutant allele" refers to a mutant allele showing a polymorphism occurring at a corresponding base site (single base site, continuous base site) on one chromosome in the hexaploid genome of the Kyushu 199 line (FERM P-22485) showing low tuber hypertrophy, with respect to the corresponding base site (normal allele) in the genomic DNA of the cultivar Koganegenkan showing tuber hypertrophy. Here, as the mode of the mutation showing polymorphism, not only the mutation regarding the base site of a single base but also the mode of the mutation regarding the continuous base site of 2 to 3 bases is included. Further, not only the substitution mutation but also the mode of the insertion / deletion mutation is included. In this specification, the "normal allele" refers to an allele showing the original base regarding the base site in an allelic relationship (capable of existing at the same locus) with the above mutant allele.

[0037] As the "DNA marker showing the relevance to the phenotype of low tuber hypertrophy" according to the present invention, specifically, it can be described as the following modes. That is, regarding the base site of the sweet potato plant (Ipomoea batatas) corresponding to the base site of the base sequence constituting the region from "chr11:5719438" to "chr11:11357942" on the 11th chromosome described above, a DNA marker regarding the base site showing the "Kyushu 199-type mutant allele" with respect to the corresponding base site (normal allele) in the genomic DNA of the cultivar Koganegenkan showing tuber hypertrophy, i) One or more DNA markers among the DNA markers shown by the following DNA markers 1 to 4, or ii) a DNA marker in which the base site showing the "Kyushu 199-type mutant allele" related to the DNA marker is in a linkage relationship with any of the base sites showing the "Kyushu 199-type mutant allele" related to the following DNA markers 1 to 4.

[0038] [DNA Markers 1 to 4] As the "DNA markers showing the association with the phenotype of low bulbousness of sweet potato", "DNA markers 1 to 4" can be specifically mentioned from the verification results in the following experimental examples. DNA markers 1 to 4 are polymorphic mutations found in the Kyushu 199 line, in which the association with the phenotype showing a parent sweet potato weight ratio of 0.2 or less (a phenotype clearly showing low bulbousness of sweet potato when directly sown) was estimated by genome-wide association analysis (GWAS) according to the following experimental example, and among them, DNA markers in which a clear association with sweet potato bulbousness was confirmed by subsequent genotyping analysis.

[0039] · DNA marker 1 As a suitable DNA marker that can be used in the identification method according to the present invention, DNA marker 1 can be mentioned. Specifically, "DNA marker 1" is a DNA marker regarding the base site corresponding to "chr11:5719438" on the 11th chromosome above in the sweet potato plant (Ipomoea batatas), and regarding the corresponding base site "G" (wild-type allele) in the genomic DNA of the cultivar Koganesengan showing sweet potato bulbousness, the "Kyushu 199 type allele" shows "T". The DNA marker 1 is a DNA marker regarding the base site where a substitution mutation (SNP type mutation) occurred in the corresponding sequence found from the Kyushu 199 line with respect to the base site of the wild-type sequence in the genome of Koganesengan, resulting in a mutant allele. "chr11:5719438" on the 11th chromosome above (the position information in the genome of the diploid related wild species of sweet potato corresponding to the position information in the sweet potato plant genomic DNA: the position information in the reference genome) is the base site specified as the 2000th base site in the base sequence shown by SEQ ID NO: 1. Specific sequence information and the like regarding the mutant allele and wild-type allele of DNA marker 1 can be shown by referring to or quoting the description content described as "polymorphic site 1" in the following experimental example 1(4).

[0040] · DNA marker 2 As a suitable DNA marker that can be used in the identification method according to the present invention, DNA marker 2 can be mentioned. Specifically, "DNA marker 2" is a DNA marker related to the base site corresponding to "chr11:6183279" on the 11th chromosome in the sweet potato plant (Ipomoea batatas). Regarding the corresponding base site "T" (normal allele) in the genomic DNA of the variety Koganeginsenkan, which exhibits sweet potato hypertrophy, the "Kyushu 199 type allele" shows "C". The DNA marker 2 is a DNA marker related to the base site where a substitution mutation (SNP type mutation) has occurred in the corresponding sequence found from the Kyushu 199 line, resulting in a mutant allele, with respect to the base site of the normal type sequence (normal allele) in the genome of Koganeginsenkan. "chr11:6183279" on the 11th chromosome (the position information in the genome of the diploid related wild species of sweet potato corresponding to the position information in the sweet potato plant genomic DNA: the position information in the reference genome) is the base site specified as the 2002nd base site in the base sequence shown by SEQ ID NO: 4. Specific sequence information and the like regarding the mutant allele and normal allele of DNA marker 2 can be shown by referring to or quoting the description content described as "polymorphic site 2" in Experimental Example 1(4) below.

[0041] ·DNA marker 3 As a suitable DNA marker that can be used in the identification method according to the present invention, DNA marker 3 can be mentioned. Specifically, "DNA marker 3" relates to a continuous nucleotide site of the sweet potato plant (Ipomoea batatas) corresponding to "chr11:8693418~chr11:8693419" on the above-mentioned 11th chromosome. Regarding the corresponding nucleotide site "TA" (normal allele) in the genomic DNA of the cultivar Koganegenkan, which exhibits tuberous swelling of the common potato, the "Kyushu 199-type allele" shows a nucleotide site of "TTA" with a "T" inserted between the two nucleotides. The DNA marker 3 is a DNA marker related to a nucleotide site where an insertion mutation (InDel mutation) occurred between two consecutive nucleotide sites in the normal sequence of Koganegenkan, resulting in a mutant allele of three consecutive nucleotides in the sequence found in the Kyushu 199 line. "chr11:8693418~chr11:8693419" on the above-mentioned 11th chromosome (the position information in the genomic information of the diploid related wild species of sweet potato corresponding to the position information in the sweet potato plant genomic DNA: the position information in the reference genome) is a nucleotide site specified as the 2001st to 2002nd nucleotide sites in the nucleotide sequence shown in SEQ ID NO: 7. Specific sequence information and the like regarding the mutant allele and normal allele of DNA marker 3 can be shown by referring to or quoting the description content described as "Polymorphic site 3" in the following Experimental Example 1(4).

[0042] ·DNA marker 4 A suitable DNA marker that can be used in the identification method according to the present invention includes DNA marker 4. Specifically, "DNA marker 4" corresponds to the continuous base site of the sweet potato plant (Ipomoea batatas) at "chr11:11357940~chr11:11357942" on the above-mentioned 11th chromosome. Regarding the corresponding base site "AGT" (normal allele) in the genomic DNA of the variety Koganegenkan, which exhibits sweet potato hypertrophy, the "Kyushu 199 type allele" shows "CGC". It is a DNA marker related to the base site. The DNA marker 4 is related to the continuous 3-base site in the normal sequence in Koganegenkan. In the sequence found in the Kyushu 199 line, substitution mutations (2 SNP-type mutations) occurred in 2 bases, namely the most upstream base and the most downstream base, among the continuous 3-base sites, resulting in a mutated allele. It is a DNA marker related to the base site that has become a mutated allele. The "chr11:11357940~chr11:11357942" on the above-mentioned 11th chromosome (the position information in the genomic information of the diploid related wild species of sweet potato corresponding to the position information in the sweet potato plant genomic DNA: the position information in the reference genome) is the base site specified as the 2001st to 2003rd base sites in the base sequence shown by SEQ ID NO: 10. Specific sequence information and the like regarding the mutant allele and normal allele of DNA marker 4 can be shown by referring to or quoting the description content described as "polymorphic site 4" in the following Experimental Example 1(4).

[0043] [DNA markers linked to DNA markers 1 to 4] Regarding the above-mentioned DNA markers 1 to 4, it is recognized that all of these four Kyushu 199 type mutant alleles are mutant alleles that exist on the "same chromosome" as the mutant gene related to the causative gene of sweet potato hypertrophy / low hypertrophy (a gene mutated to express sweet potato low hypertrophy) and are in "linkage relationship" with each other. In view of this point, as the "DNA marker showing the association with the phenotype of low tuber swelling of sweet potato" according to the present invention, with respect to the base site of the sweet potato plant (Ipomoea batatas) corresponding to the base site of the nucleotide sequence constituting the region from "chr11:5719438" to "chr11:11357942" on chromosome 11 described above, it is a DNA marker regarding the base site showing the "Kyushu 199 type mutant allele", and also regarding DNA markers other than DNA markers 1 to 4 that are present on the same chromosome as the Kyushu 199 type mutant alleles of the above DNA markers 1 to 4 and are in a linkage relationship, in principle, it can be used as a DNA marker used in the discrimination method of the present invention. That is, as a DNA marker that can be used in the discrimination method according to the present invention, regarding a DNA marker (linkage marker of DNA markers 1 to 4) in which the base site showing the "Kyushu 199 type mutant allele" related to the DNA marker is present on the same chromosome as and in a linkage relationship with any of the base sites showing the "Kyushu 199 type mutant allele" related to the above DNA markers 1 to 4, it is recognized that it can be used as a DNA marker according to the present invention.

[0044] (2-3) Judgment step The discrimination method according to the present invention is a method including determining the characteristics regarding the tuber swelling / low tuber swelling of the sweet potato plant to be discriminated based on the presence or absence of detection of the Kyushu 199 type allele related to the above DNA marker. Specifically, in the discrimination method according to the present invention, when the Kyushu 199 type mutant allele related to the above DNA marker is detected in the detection step, it becomes possible to determine that the sweet potato plant to be discriminated is a sweet potato plant showing low tuber swelling. On the other hand, when the Kyushu 199 type mutant allele related to the above DNA marker is not detected in the detection step, it becomes possible to determine that the sweet potato plant to be discriminated is not a sweet potato plant showing low tuber swelling (that is, it is a sweet potato plant showing normal tuber swelling). In this regard, the discrimination method according to the present invention, as an aspect of discriminating a sweet potato plant showing low tuber swelling, (Determination step) In the detection step, when a base site indicating the "Kyushu 199 type mutant allele" related to the DNA marker is detected, it is determined that the sweet potato plant to be identified is a sweet potato plant showing low growth and swelling of the seed potato. This step is included.

[0045] The DNA markers (DNA markers 1 to 4 and their linked markers, etc.) according to the present invention are collectively present in a specific genomic region (5.64 Mb) on chromosome 11 of the sweet potato plant genome, and these "Kyushu 199 type mutant alleles" are considered to exist in a "linked relationship" on the same chromosome. In this regard, it is considered that a locus of a causative gene involved in seed potato growth / swelling or low growth exists within or in the vicinity of the specific genomic region (5.64 Mb) where the DNA marker group according to the present invention exists. Further, the mutant gene of the causative gene (a gene mutated to express low growth and swelling of the seed potato) is considered to exist in a "linked relationship" on the same chromosome as the Kyushu 199 type mutant allele of the DNA marker group according to the present invention. Here, in the genome of the variety Koganegasengan showing general seed potato growth and swelling, the base sites related to the DNA markers according to the present invention show normal type alleles in all chromosomes in the hexaploid genome (see Figure 8). On the other hand, in the genome of the Kyushu 199 line showing low growth and swelling of the seed potato, the base sites related to the DNA markers according to the present invention show the above mutant alleles in one chromosome in the hexaploid genome, while showing normal type alleles in the remaining five chromosomes (see Figure 8). In this regard, as the combination (genotype) of alleles of the seed potato growth / swelling or low growth gene, if it is a heterozygous genotype having one gene sequence (mutant gene) showing low growth and swelling of the seed potato in the genome, it is considered that a phenotype showing low growth and swelling of the seed potato is expressed as a "dominant trait". Regarding the above points, in the identification method according to the present invention, regarding the genomic DNA of the sweet potato plant to be identified, by detecting the base site indicating the "Kyushu 199 type mutation allele" for any one or more of the DNA markers according to the present invention (DNA markers 1 to 4 and their linked markers, etc.), it becomes possible to perform the step of determining that the sweet potato plant to be identified is a sweet potato plant showing low growth and fattening of the wild potato.

[0046] As an aspect of the determination step, when PCR using DNA marker polymorphism detection primers is used in the above detection step, the determination can be performed as follows. Specifically, when a PCR amplification fragment is detected (that is, when the PCR detection is positive (+)), since a base sequence containing the Kyushu 199 type mutation allele related to the DNA marker used as an index for PCR detection exists in the genomic DNA of the sweet potato plant to be identified, it becomes possible to determine that the sweet potato plant to be identified is a sweet potato plant showing "low growth and fattening of the wild potato". On the other hand, when a PCR amplification fragment is not detected (that is, when the PCR detection is negative (-)), since a base sequence containing the Kyushu 199 type mutation allele related to the DNA marker used as an index for PCR detection does not exist in the genomic DNA of the sweet potato plant to be identified, it becomes possible to determine that the sweet potato plant to be identified does not show "low growth and fattening of the wild potato" (or shows "growth and fattening of the wild potato").

[0047] (2-4) Various aspects and considerations In the identification method according to the present invention, as the "DNA marker showing the association with the phenotype of low hypertrophy of sweet potato", by using one or more of the DNA markers described above, it is possible to identify the characteristics related to low hypertrophy of sweet potato. As a specific embodiment, an embodiment of using any one or more of DNA markers 1 to 4 can be preferably cited. Further, an embodiment of using a DNA marker containing any one or more of DNA markers 1 to 4 can be preferably cited. Further, as a specific embodiment, an embodiment of using any one of DNA markers 1 to 4 can be cited. Further, an embodiment of using DNA marker 1, an embodiment of using DNA marker 2, an embodiment of using DNA marker 3, and an embodiment of using DNA marker 4 can be cited. Further, as a more preferred embodiment, an embodiment of using DNA marker 3 or 4 that can cover 70 to 80% of the main sweet potato varieties in Japan (including their descendants) can be preferably cited. Further, an embodiment of using a DNA marker containing any one or more of DNA markers 3 and 4 can be preferably cited. Further, as a particularly preferred embodiment, an embodiment of using DNA marker 3 that can cover all of the 17 main sweet potato varieties in Japan (including their descendants) can be preferably cited. Further, an embodiment of using a DNA marker containing DNA marker 3 can be preferably cited.

[0048] Further, as the identification method according to the present invention, it can be carried out in an embodiment of using a plurality (two or more, three or more, or four or more) of the DNA markers among the DNA markers described above. As a specific embodiment, an embodiment of using any two or more of DNA markers 1 to 4 can be cited. Further, an embodiment of using a DNA marker containing any two or more of DNA markers 1 to 4 can be cited. As a more preferred embodiment, for the same reason as in the above paragraph, an embodiment of using two or more DNA markers containing DNA marker 3 or 4 can be cited. As a particularly preferred embodiment, for the same reason as in the above paragraph, an embodiment of using two or more DNA markers containing DNA marker 3 can be cited. In addition, the expression "two or more" in the said paragraph can be read by replacing it with "three or more" or "four or more" as an aspect.

[0049] In the aspect of performing the identification method according to the present invention using a plurality (two or more, three or more, or four or more) of DNA markers, in the said detection step, a base site showing the Kyushu 199 type mutant allele related to the plurality of DNA markers is detected from the genomic DNA of the sweet potato plant to be identified. And in the determination step in the said aspect, regarding all of the plurality (two or more, three or more, or four or more) of DNA markers used in the said detection step, when all of the base sites showing the Kyushu 199 type mutant allele related to the DNA marker are detected, it is determined that the sweet potato plant to be identified is a sweet potato plant showing low growth and low yield of the wild potato. To explain this aspect by way of example, in the aspect of using two DNA markers, for example, when the Kyushu 199 type mutant allele is detected at both of the two DNA markers in the said detection step, it is determined that the sweet potato plant to be identified is a sweet potato plant showing low growth and low yield of the wild potato.

[0050] 3. Invention Regarding Primers In the present invention, the present invention relates to "primers for polymorphism detection related to DNA markers related to low growth and low yield of wild potato" that enable specifically detecting a sequence (Kyushu 199 type sequence) containing the base site showing the Kyushu 199 type mutant allele of the said DNA marker, and various inventions related thereto are included.

[0051] (3-1) Primers for polymorphism detection related to DNA markers related to low growth and low yield of wild potato The present invention includes the invention related to primers for polymorphism detection related to DNA markers related to low growth and low yield of wild potato. Here, as the said "primers for polymorphism detection", it refers to a PCR primer containing a part or all of the base sites constituting the Kyushu 199 type mutant allele related to the said DNA marker (the base sites showing polymorphism mutation in the Kyushu 199 type sequence) on the 3'-terminal side of the primer constituent bases. In addition, the present invention includes an invention related to a "primer set" containing the primer for polymorphism detection. The invention related to the primer set includes an invention comprising (or consisting of) a "primer for polymorphism detection" and a "common primer" corresponding to each DNA marker. The primer set can specifically detect a sequence containing the Kyushu 199 type mutant allele for each DNA marker due to the sequence characteristics conforming to the Kyushu 199 type mutant allele that the primer for polymorphism detection has on the 3'-terminal side.

[0052] Regarding the primer set related to the present invention, when the "primer for polymorphism detection" is a primer showing the nucleotide sequence in the forward strand direction (forward sequence) with respect to the genomic DNA of chromosome 11 of sweet potato plants (i.e., a forward primer), the "common primer" forming a primer pair with this is a primer showing the nucleotide sequence in the complementary strand direction (complementary sequence) (i.e., a reverse primer). On the other hand, when the "primer for polymorphism detection" is a primer showing the nucleotide sequence in the complementary strand direction (complementary sequence) with respect to the genomic DNA of chromosome 11 of sweet potato plants (i.e., a reverse primer), the "common primer" forming a primer pair with this is a primer showing the nucleotide sequence in the forward strand direction (forward sequence) (i.e., a forward primer). In addition, as the primer set, an embodiment including a plurality of types of "primers for polymorphism detection" and / or "common primers" is allowed.

[0053] Here, as the position for designing the "common primer", it is preferable to design the primer at a position where the length of the amplified DNA fragment excluding the primer (the base length of the region constituted between the polymorphism detection primer and the common primer) is within the following range on the base sequence showing the genomic DNA of the sweet potato plant for which primer design is performed. As an example, the length of the amplified DNA fragment excluding the primer obtained by the PCR reaction (the base length of the region constituted between the polymorphism detection primer and the common primer) can be mentioned as a position where it is 1000 bp or less, 500 bp or less, 300 bp or less. More preferably, a position where it is 200 bp or less, 150 bp or less, or 140 bp or less can be mentioned. As the lower limit of the value, there is no particular limitation as long as the length allowing the PCR reaction is ensured, but as an example, the value can be 20 bp or more, 50 bp or more, or 60 bp or more.

[0054] As an aspect of the primer according to the present invention, regarding the primer constituent bases of the "polymorphism detection primer" and / or the "common primer", the description of the number of bases (base length) of "16 bases or more" regarding the length of the base sequence (or its complementary strand sequence) corresponding to the following base sequence of the genomic DNA (including exact match or one mismatch) is preferably more preferably an aspect where it is 17 bases or more, 18 bases or more, 19 bases or more, or 20 bases or more. Note that the upper limit of the number of bases is not limited as long as the primer function is ensured, and for example, 50 bases or less, 40 bases or less, or 30 bases or less can be mentioned.

[0055] As an aspect of the primer according to the present invention, regarding the "polymorphism detection primer" and / or "common primer", for the base sequence (or its complementary strand sequence) of the genomic DNA described below, with respect to the length of the base sequence (exactly matching or including one mismatch) corresponding to it, for the base sequence on the 5'-terminal side compared to the number of bases of "** bases or more (16 bases or more in the specific embodiments described below)", it is also allowed to include "any base sequence". For example, regarding the base sequence of this part (the base sequence upstream of the primer design region in the forward primer, the complementary strand sequence of the base sequence downstream of the primer design region in the reverse primer), it is also allowed to be a base sequence including a mutation with respect to the Kyushu 199 type sequence. Also, with respect to the base sequence on the 5'-terminal side compared to the number of bases of "** bases or more (16 bases or more in the specific embodiments described below)", it may be a sequence including the base sequence in the 5'-terminal direction from the primer design region (the base sequence upstream of the primer design region in the forward primer, the complementary strand sequence of the base sequence downstream of the primer design region in the reverse primer). Also, with respect to the base sequence on the 5'-terminal side compared to the number of bases of "** bases or more (16 bases or more in the specific embodiments described below)", it may be one to which other base sequences are added. For example, it may be one to which a restriction enzyme site for use in vector insertion or the like or a modified base sequence for introducing various vectors is added. Also, as the primer, an embodiment in which a labeling substance (such as a fluorescent substance, a luminescent substance, etc.) is bound to an oligonucleotide (or polynucleotide) molecule is also allowed.

[0056] As an aspect of the primer according to the present invention, as a "primer for polymorphism detection", a "primer for polymorphism detection (A1)" containing a base sequence that is completely identical to the base sequence in the forward strand direction (forward strand sequence) of the Kyushu 199 type sequence by a certain number of bases or more, a "primer for polymorphism detection (A2)" containing a base sequence that is completely identical to the base sequence in the complementary strand direction (complementary strand sequence) of the Kyushu 199 type sequence by a certain number of bases or more, or a "primer for polymorphism detection (B)" containing a base sequence with a single base difference from these base sequences (forward strand sequence or complementary strand sequence) can be mentioned. In this regard, as a primer set according to the present invention, one or more of these can be used as a "primer for polymorphism detection". Further, as an aspect of the primer according to the present invention, as a "common primer", a "common primer (A)" containing a base sequence that is completely identical to the base sequence in the complementary strand direction (complementary strand sequence) or the forward strand direction (forward strand sequence) of the genomic DNA base sequence by a certain number of bases or more, or a "common primer (B)" containing a base sequence with a single base difference from these base sequences (forward strand sequence or complementary strand sequence) can be mentioned. In this regard, as a primer set according to the present invention, with respect to these primers indicating an array direction capable of forming a primer pair with the primer for polymorphism detection, one or more of these can be used as a "common primer".

[0057] Here, as an aspect of the primer according to the present invention, with respect to other primer constituent bases excluding the base at the 3'-end of the primer constituent base and the base on the upstream side of that base by one base (i.e., the two bases on the 3'-end side), a mode is allowed in which the sequence contains a single base difference from the target base sequence (forward strand sequence) or complementary strand sequence. In the primer of this aspect, particularly regarding the polymorphic detection primer (B), for the normal type sequence (the sequence indicating the normal type allele which is the origin of the Kyushu 199 type mutation allele), it becomes a primer showing a difference of 2 bases or more, while for the Kyushu 199 type sequence (the sequence containing the Kyushu 199 type mutation allele), it becomes a primer showing a base sequence that matches one more base than the normal type sequence. In this regard, when performing a PCR reaction, compared with a 100% perfect match primer, the amplification sensitivity in terms of PCR amplification efficiency may decrease. However, from the viewpoint of reducing non-specific amplification of the normal type sequence, it is a preferable primer aspect. Here, as the position of the base site with a single base difference, it may be any position of the primer constituent bases excluding the 2 bases on the 3'-terminal side of the primer constituent bases. However, from the viewpoint of reducing non-specific amplification of the normal type sequence, when counting the base at the 3'-terminal of the primer constituent bases as the first base, any of the 3rd to 10th bases toward the 5'-terminal side (the upstream side of the primer constituent bases) is preferably the base site with the single base difference. More preferably, when counting the base at the 3'-terminal of the primer constituent bases as the first base, any of the 3rd to 5th bases (particularly the 3rd base) toward the 5'-terminal side (the upstream side of the primer constituent bases) is preferably the base site with the single base difference.

[0058] [Primer for polymorphic detection related to DNA marker 3] In the present invention, regarding the PCR primer capable of specifically detecting the Kyushu 199 type mutation allele related to DNA marker 3, the invention regarding the "primer for DNA marker 3 polymorphic detection" in the following aspect is included. Specifically, as the "primer for detecting polymorphism of DNA marker 3", when the consecutive base sites "TTA" from the 31st to the 33rd of the base sequence described in SEQ ID NO: 8 (the base site indicating the Kyushu 199 type mutation allele related to DNA marker 3 and the base sequence in its peripheral region) are the base sites indicating the Kyushu 199 type mutation allele related to DNA marker 3, and the middle one, the 32nd "T" of SEQ ID NO: 8 is the base site indicating the insertion base site, it can be described as the following primers. (Primer A1 for polymorphism detection) A PCR primer containing, as the primer constituent base sequence, a continuous base sequence of 16 or more bases contained in the base sequence described in SEQ ID NO: 8 such that the base at the 3'-end of the primer constituent base sequence is the 32nd base "T" or the 33rd base "A" of SEQ ID NO: 8, or (Primer A2 for polymorphism detection) A PCR primer containing, as the primer constituent base sequence, a continuous base sequence of 16 or more bases contained in the complementary strand sequence of the base sequence described in SEQ ID NO: 8 such that the base at the 3'-end of the primer constituent base sequence is the complementary base "A" of the 32nd base or the complementary base "A" of the 31st base of SEQ ID NO: 8, or (Primer B for polymorphism detection) A PCR primer containing, as the primer constituent base sequence, a base sequence having one substitution mutation other than the base at the 3'-end of the primer constituent base sequence and the base one base upstream thereof among the 16 or more base sequences on the 3'-end side of the primer constituent base sequence of the above-mentioned primer A1 or A2 for detecting polymorphism of DNA marker 3.

[0059] In the present invention, the invention related to a primer set containing the above-described primer for detecting polymorphism of DNA marker 3 is included. That is, the present invention includes the invention related to a primer set containing the above-described "primer for detecting polymorphism of DNA marker 3" and the following "common primer for DNA marker 3". As the primer design position of the "common primer" related to DNA marker 3, primer design can be performed without particular limitation as long as it is a position on genomic DNA where a primer pair can be formed with the "primer for polymorphism detection" and DNA fragments can be amplified by PCR reaction. However, as the primer set according to the present invention, an embodiment is preferable in which a sample containing a plant grinding liquid or the like is assumed to be used, and the primer set enables easy PCR testing even under conditions where contaminants are present in the sample. In this regard, as the "common primer" according to the present invention, with respect to the nucleotide sequence showing the peripheral region containing the Kyushu 199 type mutant allele related to DNA marker 3 (the nucleotide sequence shown in SEQ ID NO: 8), it is preferable to design the "common primer" at a position and in an arrangement direction capable of forming a primer pair with the above-mentioned "primer for polymorphism detection" so that a DNA amplification fragment of a size that is easy to amplify by PCR can be obtained. In addition, as the "common primer", with respect to the nucleotide sequence showing the peripheral region containing "chr11:8693418~chr11:8693419" (the nucleotide site corresponding to DNA marker 3 on the reference genome) on chromosome 11 of the diploid wild relative of sweet potato corresponding to DNA marker 3 (the nucleotide sequence shown in SEQ ID NO: 7), it is also possible to design the "common primer" at a position and in an arrangement direction capable of forming a primer pair with the above-mentioned "primer for polymorphism detection".

[0060] The "DNA marker 3 common primer" can be specifically described as the following primers. (Common primer A) A continuous nucleotide sequence of 16 or more nucleotides contained in the nucleotide sequence described in SEQ ID NO: 7 or 8 or its complementary strand sequence, and the nucleotide sequence at a position and in an arrangement direction capable of forming a primer pair with the "DNA marker 3 polymorphism detection primer" is included as the primer constituent nucleotide sequence on the 3'-terminal side, or, (Common primer B) Among the base sequences of 16 bases or more on the 3'-terminal side of the primer constituent base sequence described in the common primer A, a base sequence having one substitution mutation other than the base at the 3'-terminal of the primer constituent base sequence and the base one base upstream thereof, as a primer constituent base sequence, a PCR primer containing it on the 3'-terminal side.

[0061] [Primer for polymorphism detection related to DNA marker 4] In the present invention, regarding a PCR primer capable of specifically detecting the Kyushu 199 type mutant allele related to DNA marker 4, the invention regarding the "primer for DNA marker 4 polymorphism detection" in the following aspect is included. Specifically, as the "primer for DNA marker 4 polymorphism detection", when the continuous base site "CGC" from the 85th to the 87th bases of the base sequence described in SEQ ID NO: 11 (the base site showing the Kyushu 199 type mutant allele related to DNA marker 4 and the base sequence showing the surrounding region) is the base site showing the Kyushu 199 type mutant allele related to DNA marker 4, it can be described as the following primer. (Primer A1 for polymorphism detection) A PCR primer containing, as a primer constituent base sequence, a continuous base sequence of 16 bases or more contained in the base sequence described in SEQ ID NO: 11 such that the base at the 3'-terminal of the primer constituent base sequence is the 85th base "C", the 86th base "G", or the 87th base "C" of SEQ ID NO: 11, or (Primer A2 for polymorphism detection) A PCR primer containing, as a primer constituent base sequence, a continuous base sequence of 16 bases or more contained in the complementary strand sequence of the base sequence described in SEQ ID NO: 11 such that the base at the 3'-terminal of the primer constituent base sequence is the complementary base "G" of the 87th base, the complementary base "C" of the 86th base, or the complementary base "G" of the 85th base of SEQ ID NO: 11, or (Primer B for polymorphism detection) Among the base sequences of 16 bases or more on the 3'-terminal side of the primer-constituting base sequence of the above-described primer A1 or A2 for polymorphism detection, a base sequence having one substitution mutation other than the base at the 3'-terminal of the primer-constituting base sequence and the base one base upstream thereof, is included on the 3'-terminal side as the primer-constituting base sequence in a PCR primer.

[0062] In the present invention, an invention related to a primer set containing the above-described primer for detecting DNA marker 4 polymorphism is included. That is, as the present invention, an invention related to a primer set containing the above-described "primer for detecting DNA marker 4 polymorphism" and the following-described "common primer for DNA marker 4" is included. As the primer design position of the "common primer" related to DNA marker 4, primer design can be performed without particular limitation as long as it is a position on genomic DNA where amplification of a DNA fragment by PCR reaction is possible by forming a primer pair with the "primer for polymorphism detection". However, as the primer set according to the present invention, an embodiment which assumes using a sample containing a ground solution of a plant body or the like and enables easy PCR testing even under conditions where contaminants are present in the sample is preferable. In this regard, as the "common primer" according to the present invention, with respect to the base sequence showing the peripheral region containing the Kyushu 199 type mutant allele related to DNA marker 4 (the base sequence shown in SEQ ID NO: 11) so that a DNA amplification fragment of an easily PCR-amplified size can be obtained, it is preferable to design the "common primer" at a position and in a sequence direction capable of forming a primer pair with the above-described "primer for polymorphism detection". Also, as the "common primer", with respect to the base sequence showing the peripheral region containing "chr11:11357940~chr11:11357942" (the base site corresponding to DNA marker 4 on the reference genome) on chromosome 11 of the diploid wild relative of sweet potato corresponding to DNA marker 4, it is also possible to design the "common primer" at a position and in a sequence direction capable of forming a primer pair with the above-described "primer for polymorphism detection".

[0063] As the "DNA marker 4 common primer", specifically, it can be described as the following primers. (Common primer A) It is a continuous base sequence of 16 bases or more included in the base sequence described in SEQ ID NO: 10 or 11 or its complementary strand sequence, and the base sequence at the position and sequence direction that can form a primer pair with the "primer for detecting polymorphism of DNA marker 4" is included on the 3'-end side as the primer constituent base sequence in a PCR primer, or (Common primer B) Among the base sequences of 16 bases or more on the 3'-end side of the primer constituent base sequence described in the common primer A, a base sequence having one substitution mutation other than the base at the 3'-end of the primer constituent base sequence and the base one base upstream thereof, is included on the 3'-end side as the primer constituent base sequence in a PCR primer.

[0064] [Specific embodiments regarding primers 1 to 4 for detecting DNA marker polymorphism] As the "primer for detecting polymorphism related to the DNA marker related to low hypertrophy of taro" according to the present invention, the invention regarding the primers for detecting polymorphism related to DNA markers 1 to 4 specifically described in the following Experimental Example 2 is included.

[0065] As a specific embodiment of the "primer for detecting polymorphism of DNA marker 1" according to the present invention, a PCR primer including the base sequence shown in SEQ ID NO: 13 as the primer constituent base sequence on the 3'-end side can be mentioned. Further, in the present invention, the invention regarding a primer set including the primer for detecting polymorphism of DNA marker 1 is included. In this regard, as the present invention, the invention regarding a primer set including the "primer for detecting polymorphism of DNA marker 1" and the "common primer for DNA marker 1" described below is included. Here, as a specific embodiment of the "common primer for DNA marker 1", a PCR primer including the base sequence shown in SEQ ID NO: 14 as the primer constituent base sequence on the 3'-end side can be mentioned.

[0066] As a specific embodiment of the "primer for detecting DNA marker 2 polymorphism" according to the present invention, a PCR primer containing the nucleotide sequence shown in SEQ ID NO: 15 as a primer-constituting nucleotide sequence on the 3'-terminal side can be mentioned. In the present invention, an invention related to a primer set containing the primer for detecting DNA marker 2 polymorphism is also included. In this regard, the present invention includes an invention related to a primer set containing the "primer for detecting DNA marker 2 polymorphism" and the following "common primer for DNA marker 2". Here, as a specific embodiment of the "common primer for DNA marker 2", a PCR primer containing the nucleotide sequence shown in SEQ ID NO: 16 as a primer-constituting nucleotide sequence on the 3'-terminal side can be mentioned.

[0067] As a specific embodiment of the "primer for detecting DNA marker 3 polymorphism" according to the present invention, a PCR primer containing the nucleotide sequence shown in SEQ ID NO: 17 as a primer-constituting nucleotide sequence on the 3'-terminal side can be mentioned. In the present invention, an invention related to a primer set containing the primer for detecting DNA marker 3 polymorphism is also included. In this regard, the present invention includes an invention related to a primer set containing the "primer for detecting DNA marker 3 polymorphism" and the following "common primer for DNA marker 3". Here, as a specific embodiment of the "common primer for DNA marker 3", a PCR primer containing the nucleotide sequence shown in SEQ ID NO: 18 as a primer-constituting nucleotide sequence on the 3'-terminal side can be mentioned.

[0068] As a specific embodiment of the "primer for detecting DNA marker 4 polymorphism" according to the present invention, a PCR primer containing the nucleotide sequence shown in SEQ ID NO: 20 as a primer-constituting nucleotide sequence on the 3'-terminal side can be mentioned. In addition, the present invention includes an invention related to a primer set containing the primer for detecting the polymorphism of DNA marker 4. In this regard, the present invention includes an invention related to a primer set containing the "primer for detecting the polymorphism of DNA marker 4" and the "common primer for DNA marker 4" described below. Here, as a specific embodiment of the "common primer for DNA marker 4", a PCR primer containing the base sequence shown in SEQ ID NO: 19 as a primer constituent base sequence on the 3'-terminal side can be mentioned.

[0069] 4. Various Inventions In the present invention, various inventions related to the identification technology of sweet potato plants showing low hypertrophy of the seed yam using the above-described DNA markers are included.

[0070] The present invention includes an invention related to the "method for identifying sweet potato plants showing low hypertrophy of the seed yam" including the above-described detection step and determination step. In addition, the present invention includes inventions related to various methods and production methods related to the identification method. As an example, the present invention includes a method for discriminating sweet potato plants showing low hypertrophy of the seed yam, a method for selecting sweet potato plants showing low hypertrophy of the seed yam, a method for cultivating sweet potato plants showing low hypertrophy of the seed yam, a method for producing sweet potato plants showing low hypertrophy of the seed yam, a method for producing a sweet potato line showing low hypertrophy of the seed yam, a method for producing a plant body of a sweet potato plant showing low hypertrophy of the seed yam, a method for producing a tuberous root of a sweet potato plant showing low hypertrophy of the seed yam, and the like. Here, as the plant body of the sweet potato plant, the whole or a part of the plant body is included. For example, as the plant body of the sweet potato plant, the whole above-ground part, the whole underground part, seedlings, seedlings, tuberous roots, leaves, stems, flowers, seeds, and the like can be mentioned. Regarding the invention of the identification method, various methods, and production methods according to the present invention, embodiments including steps other than the above-described detection step and determination step are allowed. In addition, regarding these, it is possible to refer to or quote the description of the above paragraph for various steps, conditions, methods, means, and the like. In addition, regarding various steps, conditions, methods, means, and the like other than the characteristic part of the present invention, conventional methods and known methods can be adopted.

[0071] The present invention includes the invention related to the "primer for detecting polymorphism related to the DNA marker for low growth and swelling of sweet potato seeds" described above. Further, in the present invention, the invention related to the "primer set including the primer for detecting polymorphism related to the DNA marker for low growth and swelling of sweet potato seeds" described above is included. Further, the present invention includes the invention related to the kit comprising the above-described primer set. That is, the present invention includes inventions related to a "kit for identifying sweet potato plants showing low growth and swelling of sweet potato seeds", a "kit for identifying sweet potato plants showing low growth and swelling of sweet potato seeds", and the like. In addition to the above-described polymorphism detection primer and common primer, the kit can be configured to include various constituent articles. For example, it is also possible to provide a kit including various reagents, enzymes, control, or various primer sets for internal standards.

Example

[0072] Hereinafter, the present invention will be described with reference to examples, but the scope of the present invention is not limited thereto.

[0073] [Experimental Example 1] "Search for DNA markers showing association with low growth and swelling of sweet potato seeds (Genome-wide association study focusing on the parent sweet potato weight ratio)" Focusing on the Kyushu 199 line (FERM P-22485) showing low growth and swelling of sweet potato seeds, which is a breeding material (intermediate maternal line) of sweet potato plants owned by the National Agriculture and Food Research Organization, a search experiment was conducted on polymorphism information (genomic sequence information such as SNPs and indels) showing the association with the low growth and swelling of sweet potato seeds (phenotype) possessed by the line.

[0074] (1) Cultivation test First year of cultivation test: The "Kyushu 199 line" (FERM P-22485) showing low growth and swelling of sweet potato seeds was crossed with "Koganeseengan", which is a major cultivar showing normal growth and swelling of sweet potato seeds, to obtain seeds of the F1 population. In the cross, Koganeseengan was used as the pollen parent and the Kyushu 199 line was used as the seed parent. Second year of cultivation test: 600 seeds belonging to the obtained F1 population were sown in a greenhouse (sowing date: April 1, 2021). After about two months of seedling cultivation in the greenhouse, 420 seedlings with good growth conditions were planted in the field (starting date of transplanting cultivation: June 1, 2021). After about five months of field cultivation, the underground parts of 200 plants with good growth conditions (each plant corresponding to one line) were dug out, and more than three tubers (tuberous roots) per individual (line) of the F1 population were secured (harvest date: November 4, 2021). Note that since the cultivation in the second year is "transplanting cultivation", selection regarding the phenotypic expression of normal tuberous yam hypertrophy / hypo-hypertrophy, which can be expressed by direct seeding cultivation, cannot be performed.

[0075] (2) Acquisition of large-scale sequence data (NGS data) and comprehensive polymorphism information DNA extraction was performed from the leaves of each plant of 186 individuals (lines) of the F1 population grown in the second-year cultivation of (1) above, the leaves of the variety "Koganeseigan" with normal tuberous yam hypertrophy, which is the crossing parent, and the leaves of the "Kyushu 199 line" with tuberous yam hypo-hypertrophy. To obtain comprehensive genomic sequence information using next-generation sequencing technology from the extracted DNA, a sequence library comprehensively containing fragmented whole-genome sequences for each of the 186 lines of the F1 population and the two parental lines (varieties) was created using the GRAS-Di method. Then, using a next-generation sequencer (NovaSeq6000, illumina), the entire nucleotide sequence derived from the samples contained in each library after fragmentation was determined, and sequence information comprehensively containing the whole-genome sequence was obtained for each line. Here, the creation of the sequence library and the determination of the whole-genome sequence by large-scale sequencing were performed using the entrusted service of GRAS-Di analysis commercially provided by Eurofins (https: / / eurofinsgenomics.jp / jp / service / ngs / gras-di / ).

[0076] Using the sequence data containing the whole-genome sequence information for each of the obtained lines, data processing and analysis operations were performed using the bioinformatics methods described in the following i) to iii), comprehensively identifying polymorphic sites (mutation sites) existing between the two parental lines, and obtaining a dataset regarding the haplotypes of each of the 186 individuals (lines) in the F1 population with respect to the polymorphic sites (mutation sites) (comprehensive polymorphic information for each line in the F1 population regarding the polymorphic sites existing between the two parental lines). i) Sequence data QC and trimming: The trimming operation by quality confirmation of sequence accuracy and deletion of low-reliability sites was performed using rabbitQC (v0.0.1). ii) Mapping on the reference genome: The mapping operation of the obtained sequence data onto the reference genome was performed using bwa-mem2 (v2.2.1). Also, the processing operation of the mapping file was performed using samtools (v1.11) sort. Note that the reference genome used as the mapping standard in this study was the publicly available genome information "Itr_r2.2" of "Ipomoea trifida Mx23Hm", which is a fixed line of a diploid wild species closely related to sweet potato. The publicly available genome information can be referred to from "https: / / plantgarden.jp / ja / list / t35884 / genome / t35884.G002" in "Plant GARDEN" operated by the Kazusa DNA Research Institute, Incorporated Administrative Agency. iii) Variant calling and polymorphism filtering: Detection of differences between sequence data was performed using bcftools (v1.11), and determination and filtering of sites recognized as artifacts and having low reliability were performed using vcftools (v0.1.16).

[0077] (3) Cultivation test and measurement of the parent sweet potato weight ratio Third year of cultivation test: Using the tuberous roots of each individual in the F1 population harvested in the second year of the cultivation test in (1) above as the seed potatoes, they were laid in a greenhouse (March 22, 2022: laying). After forcing the seedling cultivation in the greenhouse for about two and a half months, the seedlings were planted in the field (June 13, 2022: start of transplanting cultivation). After forcing the field cultivation for about three months, the underground part of the plant was dug out, and a large number of tuberous roots formed in each individual (line) of the F1 population were secured as the seed potatoes for the next year's planting (September 8, 2022: harvest). Fourth year of cultivation test: The tuberous roots of each individual in the F1 population harvested in the third year of the above cultivation were directly planted in the field to start "direct seeding cultivation" (March 20, 2023: start of direct seeding cultivation). For this planting, for 149 individuals (lines) in the F1 population, 8 tuberous roots (4×2 sections) per line were used for planting. After conducting the field cultivation for about five months, for each individual in the grown F1 population, the underground part of the plant was dug out to measure the weights of the parent potato and the daughter potatoes (August 21 - 22, 2023), and the "parent potato weight ratio" was calculated using these measured values. The weight measurement operation was performed twice. Here, as the parent potato weight ratio, after calculating the parent potato weight ratio for each cultivated strain (plant) using the mathematical formula (1) described above in "1. Explanation of Terms", the measured values of the duplicate individuals were averaged for each line and calculated. Table 1 shows the results of the histogram analysis divided into distribution ranges every 0.05 of the parent potato weight ratio.

[0078] As a result, when the tuberous roots of the F1 population were directly seeded, a cultivation result was shown where lines showing a parent potato weight ratio of 0.2 or less, indicating low parent potato hypertrophy with clearly suppressed hypertrophy of the parent potato (seed potato), appeared at a frequency of 48.3% (breakdown: 72 / 149, about 50%). Here, as reference information, the parent potato weight ratio of the "Kyushu 199 line" showing low parent potato hypertrophy used as the crossing parent line showed an average of 0.15 ± 0.02, and the variety "Koganesengan" showing general parent potato hypertrophy used as the other crossing parent line showed an average of 0.83 ± 0.07. To show the degree of the phenotypic expression regarding the parent potato weight ratio, Figure 1 shows a photographed image of the underground part of the plants after growing the Kyushu 199 line and Koganesengan by direct seeding cultivation.

[0079] [Table 1]

[0080] (4) Genome-wide association analysis Regarding the polymorphic sites included in the haplotype dataset of the polymorphisms shown by each line of the F1 population obtained by the operation in (2) above (genome-wide polymorphic information held by each line of the F1 population regarding the polymorphic sites existing between the two parental lines of the cross), in order to estimate polymorphic sites showing the association with the parent potato weight ratio (phenotypic information regarding seed potato hypertrophy) shown by each line of the F1 population measured in (3) above, genome-wide association analysis (GWAS) was performed. Here, as the criterion for seed potato hypertrophy / low hypertrophy, in order to judge the correlation in the genome-wide association analysis as a clear phenotype, lines showing a parent potato weight ratio of 0.2 or less after direct seeding cultivation in the above-mentioned field were judged as lines showing the phenotype of "seed potato low hypertrophy". As the haplotype dataset used in the analysis, among the haplotype datasets obtained in (2) above, a dataset corresponding to 148 lines (※ one line out of the 149 lines in (3) above was excluded because sequence data could not be obtained) of the F1 population in which the parent potato weight ratio data measured in (3) above existed was used. The genome-wide association analysis was performed using ngsAssocPoly (v1.0.2), and a search for polymorphic mutations showing the association of the above phenotypes was conducted with statistically high reliability. The results of the Manhattan plot of this example are shown in Figure 2.

[0081] As a result, when shown using the genomic information (Itr_r2.2) of the sweet potato-related wild species (Ipomoea trifida Mx23Hm line), which is the above-mentioned reference genome, a polymorphic mutation group in which the relevance with a phenotype showing a parent potato weight ratio of 0.2 or less is shown with statistical reliability of p-value < 0.05 by Bonferroni correction was found to be concentrated and detected in a partial region on chromosome 11. Based on the analysis results, the following polymorphic sites 1 to 4, which are strongly statistically estimated to show relevance with low tuberous growth of the cultivated potato, were found.

[0082] · Polymorphic site 1 (base site corresponding to chr11:5719438) Regarding one of the polymorphic sites found in this example, when shown using the genomic information (Itr_r2.2: reference sequence) of the diploid wild species related to sweet potato (Ipomoea trifida Mx23Hm line), for the base site of the sweet potato plant corresponding to "chr11:5719438", in the cultivar Koganesengan, which shows tuberous growth of the cultivated potato, the corresponding base site is "G" as in the reference sequence, whereas in the corresponding base site found on one of the chromosomes of "Kyushu 199 line", which shows low tuberous growth of the cultivated potato, it shows "T". The polymorphic site (SNP-type polymorphic site corresponding to chr11:5719438) was designated as polymorphic site 1. The polymorphic site 1 was a base site where a substitution mutation (SNP) occurred in the sequence found in the Kyushu 199 line compared to the normal sequence of Koganesengan. Here, the base sequence of "chr11:5719438" and its surrounding region in the reference sequence of the diploid wild species of sweet potato is shown by the base sequence shown in SEQ ID NO: 1. The 2000th base site of SEQ ID NO: 1 indicates the base site corresponding to "chr11:5719438". In this regard, the base sequence having a polymorphic mutation at the corresponding base site found in the genome of the Kyushu 199 line (sequence showing the mutant allele) is shown by the base sequence shown in SEQ ID NO: 2. The base site corresponding to "chr11:5719438" (Kyushu 199 type mutant allele) in the base sequence shown in SEQ ID NO: 2 corresponds to the 11th base site "T" of SEQ ID NO: 2. Regarding the normal-type sequence (sequence indicating the normal-type allele) found in the genome of the variety Koganegenkan, the neighboring sequence of the corresponding base site (partial sequence that matches in the sequences indicating all the normal-type alleles in the hexaploid genome) is represented by the base sequence shown in SEQ ID NO: 3. The corresponding base site (the 10th base site of SEQ ID NO: 3) in the normal-type sequence indicates the same "G" as the reference sequence (normal-type allele: base site indicating the same base as the reference sequence).

[0083] · Polymorphic site 2 (base site of the sweet potato plant corresponding to chr11:6183279) Also, regarding the base site of the sweet potato plant corresponding to "chr11:6183279" as shown in the genomic information (Itr_r2.2: reference sequence) of the diploid wild relative (Ipomoea trifida Mx23Hm line) of sweet potato, in the variety Koganegenkan showing tuberous swelling of the species sweet potato, the corresponding base site is "T" as in the reference sequence, whereas in the corresponding base site found in one of the chromosomes of the "Kyushu 199 line" showing low tuberous swelling of the species sweet potato, it shows "C". The polymorphic site (SNP-type polymorphic site corresponding to chr11:6183279) was designated as polymorphic site 2. The polymorphic site 2 was a base site where a substitution mutation (SNP) occurred in the sequence found in the Kyushu 199 line with respect to the normal-type sequence of Koganegenkan. Here, the base sequence of "chr11:6183279" and its surrounding region in the reference sequence of the diploid wild relative of sweet potato is represented by the base sequence shown in SEQ ID NO: 4. The 2002nd base site of SEQ ID NO: 4 indicates the base site corresponding to "chr11:6183279". In this regard, the base sequence having a polymorphic mutation (sequence indicating the mutant allele) at the corresponding base site found in the genome of the Kyushu 199 line is represented by the base sequence shown in SEQ ID NO: 5. The base site corresponding to "chr11:6183279" in the base sequence shown in SEQ ID NO: 5 (Kyushu 199 type mutant allele) corresponds to the 52nd base site "C" of SEQ ID NO: 5. Regarding the normal-type sequence (the sequence indicating the normal-type allele) found in the genome of the Koganegen Shogun variety, the neighboring sequence of the corresponding base site (the partial sequence that matches in the sequences indicating all the normal-type alleles in the hexaploid genome) is shown by the base sequence of SEQ ID NO: 6. The corresponding base site (the 16th base site of SEQ ID NO: 6) in the normal-type sequence indicates the same "T" as the reference sequence (the normal-type allele: the base site indicating the same base as the reference sequence).

[0084] · Polymorphic site 3 (base site corresponding to chr11:8693418 to chr11:8693419) Also, regarding the continuous base sites of the sweet potato plant corresponding to "chr11:8693418" to "chr11:8693419" as shown by the genomic information (Itr_r2.2: reference sequence) of the diploid related wild species (Ipomoea trifida Mx23Hm strain) of sweet potato, in the Koganegen Shogun variety showing tuberous root hypertrophy of the species, the corresponding base site is the continuous two bases "TA" similar to the reference sequence, while in the corresponding base site found in one of the chromosomes of the "Kyushu 199 strain" showing low tuberous root hypertrophy of the species, "T" is inserted between the two bases, showing the continuous three bases "TTA". The polymorphic site (the indel-type polymorphic site corresponding to chr11:8693418 to chr11:8693419) was designated as polymorphic site 3. The polymorphic site 3 was the base site where an insertion mutation occurred in the sequence found in the Kyushu 199 strain between the continuous two-base sites in the normal-type sequence of Koganegen Shogun, resulting in continuous three bases. Here, the base sequence of "chr11:8693418" to "chr11:8693419" and its surrounding region in the reference sequence of the diploid related wild species of sweet potato is shown by the base sequence of SEQ ID NO: 7. The 2001st to 2002nd base sites of SEQ ID NO: 7 indicate the base sites corresponding to "chr11:8693418" to "chr11:8693419". In this regard, the nucleotide sequence having a polymorphic mutation at the corresponding nucleotide site found in the genome of the Kyushu 199 line (the sequence indicating the mutant allele) is shown by the nucleotide sequence of SEQ ID NO: 8. The nucleotide site corresponding to "chr11:8693418" to "chr11:8693419" in the nucleotide sequence shown in SEQ ID NO: 8 (Kyushu 199 type mutant allele) corresponds to the consecutive three nucleotides "TTA" at positions 31 to 33 of SEQ ID NO: 8. Here, the nucleotide sites corresponding to "chr11:8693418" and "chr11:8693419" correspond to the 31st nucleotide site "T" and the 33rd nucleotide site "A" of SEQ ID NO: 8, respectively. Also, the nucleotide site indicating the inserted nucleotide between these two nucleotides corresponds to the 32nd nucleotide site "T" of SEQ ID NO: 8. Regarding the normal type sequence (the sequence indicating the normal type allele) found in the genome of the variety Koganeseengan, the adjacent sequence of the corresponding nucleotide site (the partial sequence that matches in the sequences indicating all the normal type alleles in the hexaploid genome) is shown by the nucleotide sequence of SEQ ID NO: 9. The corresponding nucleotide site in the normal type sequence (nucleotide sites 7 to 8 of SEQ ID NO: 9) shows the same "TA" as the reference sequence (normal type allele: the nucleotide site showing the same nucleotide as the reference sequence).

[0085] · Polymorphic site 4 (nucleotide site corresponding to chr11:11357940 to chr11:11357942) Also, regarding the continuous base region of the sweet potato plant corresponding to "chr11:11357940" to "chr11:11357942" as shown by the genomic information (Itr_r2.2: reference sequence) of the diploid related wild species of sweet potato (Ipomoea trifida Mx23Hm line), in the variety Koganegasengan showing tuberous root hypertrophy of the cultivated sweet potato, the corresponding base region is "AGT" as in the reference sequence, while in the corresponding base region found on one of the chromosomes of "Kyushu 199 line" showing low tuberous root hypertrophy of the cultivated sweet potato, it showed "CGC". The polymorphic site (a polymorphic site of multiple SNP types corresponding to chr11:11357940 to chr11:11357942) was designated as polymorphic site 4. Regarding the continuous 3-base region of the normal type sequence in Koganegasengan, the polymorphic site 4 was a base region where substitution mutations occurred in 2 bases, namely the most upstream base and the most downstream base, of the continuous 3-base region in the sequence found in the Kyushu 199 line. Here, the base sequence of "chr11:11357940" to "chr11:11357942" and its surrounding region in the reference sequence of the diploid related wild species of sweet potato is shown by the base sequence shown in SEQ ID NO: 10. The base sites corresponding to "chr11:11357940" to "chr11:11357942" are shown by the 2001st to 2003rd base sites of SEQ ID NO: 10. In this regard, the base sequence having a polymorphic mutation at the corresponding base site found in the genome of the Kyushu 199 line (the sequence showing the mutant allele) is shown by the base sequence shown in SEQ ID NO: 11. The base sites corresponding to "chr11:11357940" to "chr11:11357942" (Kyushu 199 type mutant allele) in the base sequence shown in SEQ ID NO: 11 correspond to the continuous 3 bases "CGC" at the 85th to 87th positions of SEQ ID NO: 11. Here, the base sites corresponding to the two mutation sites "chr11:11357940" and "chr11:11357942" in the mutant allele correspond to the 85th base site "C" and the 87th base site "C" of SEQ ID NO: 11, respectively. Regarding the normal-type sequence (the sequence indicating the normal-type allele) found in the genome of the cultivar Koganegenokan, the neighboring sequence of the corresponding base site (the partial sequence that matches with the sequences indicating all the normal-type alleles in the hexaploid genome) is shown by the base sequence shown in SEQ ID NO: 12. The corresponding base site (the 16th to 18th base sites of SEQ ID NO: 12) in the normal-type sequence indicates the same "AGT" as the reference sequence (the base site indicating the same base as the reference sequence for the normal-type allele).

[0086] (5) Loci of Solanum tuberosum low hypertrophy-related DNA markers 1 to 4 Since the polymorphic sites 1 to 4 found by genome-wide association analysis were strongly suggested to be associated with the phenotype showing a parent potato weight ratio of 0.2 or less, which clearly indicates Solanum tuberosum low hypertrophy, they were presumed to be polymorphic sites showing "association with the characteristic of showing Solanum tuberosum low hypertrophy". The polymorphic sites 1 to 4 were respectively designated as "Solanum tuberosum low hypertrophy-related DNA markers 1 to 4". Here, since the polymorphic sites 1 to 4 on the genome of the sweet potato plant corresponded to the polymorphic sites existing at the base sites on chromosome 11 of the sweet potato wild relative (Ipomoea trifida Mx23Hm line) used as the reference genome, it was shown that they also located on chromosome 11 in the genome of the sweet potato plant (Ipomoea batatas). The above polymorphic sites 1 to 4 (DNA markers 1 to 4) are the polymorphic sites named in the order of the positional relationship of locating from the upstream side on chromosome 11 of the sweet potato plant. Here, the inter-base distances between the polymorphic sites starting from polymorphic site 1 were as shown in the following table when calculated based on the position information in the reference genome. Also, the base distance from the base site of polymorphic site 1 to the most downstream base of polymorphic site 4 was 5.64 Mb.

[0087]

Table 2

[0088] [Experimental Example 2] 'Primers for Polymorphism Detection Regarding Solanum tuberosum Low Hypertrophy-Related DNA Markers' Regarding the polymorphic sites 1 to 4 (DNA markers 1 to 4) whose association with low corm hypertrophy was estimated in the above Experimental Example 1, a primer set capable of specifically detecting a sequence showing the Kyushu 199 type mutant allele was designed. And it was confirmed that when a PCR reaction was carried out using the primer set, a specific PCR amplification reaction was possible in which the "Kyushu 199 type sequence" (a sequence in which the polymorphic site shows the mutant allele of the Kyushu 199 type) was amplified, but the "normal type sequence" (a sequence in which the polymorphic site shows the normal allele) was not amplified. In addition, among the primers designed in this example, from the viewpoint of suppressing non-specific amplification of the DNA fragment of the normal type sequence, a primer containing one substitution base that is deliberately a mismatched base with respect to the base sequences of both the Kyushu 199 type sequence and the normal type sequence (a primer designed so that there are one or more more mismatched bases in the normal type sequence compared to the Kyushu 199 type sequence) is included.

[0089] (1) Design of a primer set containing a primer for detecting the polymorphism of DNA marker 1 As a primer capable of specifically detecting the Kyushu 199 type polymorphism regarding the low corm hypertrophy related DNA marker 1 (single SNP type polymorphic site) of taro, the "primer for detecting the polymorphism of the low corm hypertrophy related DNA marker 1 (F)" (forward primer) consisting of the base sequence described in SEQ ID NO: 13 was designed. The base sequence of the primer for detecting the polymorphism of DNA marker 1 (F) (the base sequence shown in SEQ ID NO: 13) is a continuous 25-base sequence including the base site "G" (the 2000th base site of SEQ ID NO: 1) corresponding to the polymorphic site in the base sequence including the polymorphic site in the reference genome (in the base sequence of SEQ ID NO: 1), with respect to the base "G" corresponding to the polymorphic site being substituted with the base "T" corresponding to the mutant allele of the Kyushu 199 type, and when the base corresponding to the polymorphic site is counted as the first base, the third base (the 1998th base of SEQ ID NO: 1) "T" on the 5'-terminal side is deliberately substituted with the mismatched base "G", and it is a PCR primer having the primer constituent bases. That is, the primer (F) for detecting the polymorphism of the DNA marker 1 contains, as its primer constituent bases, the base site "T" (the 11th base of SEQ ID NO: 2) indicating the Kyushu 199 type mutant allele related to the polymorphic site 1 at the 3' end, and is a PCR primer containing a deliberate mismatched base adjacent to the 2 bases upstream of the 3' end base.

[0090] As the reverse primer (complementary strand direction primer) forming a primer pair with the forward primer (sense strand direction primer), the "common primer (R) for the DNA marker 1 related to low hypertrophy of sweet potato" consisting of the base sequence described in SEQ ID NO: 14 was designed. The base sequence of the common primer (R) for the DNA marker 1 (the base sequence shown by SEQ ID NO: 14) is the complementary strand base sequence of a continuous 20-base sequence (the base sequence from the 2141st to the 2160th bases of SEQ ID NO: 1) existing in the region about 140 to 160 bases downstream of the base site corresponding to the polymorphic site in the corresponding base sequence in the reference genome (the base sequence of SEQ ID NO: 1), and is a PCR primer having the primer constituent bases.

[0091] Using the primer set consisting of the forward primer and the reverse primer, DNA fragments were amplified by PCR reaction under the following conditions for a DNA sample extracted from the leaves of a growing plant of sweet potato (Kyushu 199 strain, Koganesengan). The conditions and procedures for PCR detection were as follows. For the basic reagents for PCR, GoTaq(R) Colorless Master Mix (manufactured by Promega Corporation), an enzyme-containing master mix solution, was used. ·PCR reaction solution GoTaq(R) Colorless Master Mix 5.0 μL Primer solution (each 10 μM) 0.4 μL each Sample DNA (10 ng / μL) 1.0 μL Sterilized ultrapure water 3.2 μL (Total 10.0 μL) ·PCR conditions 94°C for 60 seconds 35 cycles × (94°C for 30 seconds → 54°C for 30 seconds → 72°C for 60 seconds) 72°C for 5 minutes · Detection The DNA amplification fragment was detected as a band using a microchip electrophoresis apparatus (MultiNA, manufactured by Shimadzu Corporation). The results are shown in Fig. 3(A).

[0092] As a result, when a PCR reaction was performed on a DNA sample of the Kyushu 199 line using the said primer set, it was confirmed that a specific PCR amplification fragment was generated at around 185 bp, which is the amplified fragment size predicted from the primer design position. This is a size that matches the base length of 140 bp between the predicted primer sequences (the base length obtained by excluding the primer sequences from the base length of the PCR amplification fragment). On the other hand, when a PCR reaction was performed on a DNA sample of Koganegasane, it was confirmed that no PCR amplification fragment was generated.

[0093] (2) Design of a primer set containing primers for detecting DNA marker 2 polymorphism As a primer capable of specifically detecting the Kyushu 199 type polymorphism related to the potato low-hypertrophy-related DNA marker 2 (single SNP type polymorphism site), the "primer for detecting potato low-hypertrophy-related DNA marker 2 polymorphism (F)" (forward primer), which is a PCR primer consisting of the base sequence described in SEQ ID NO: 15, was designed. The base sequence of the primer for detecting DNA marker 2 polymorphism (F) (the base sequence shown in SEQ ID NO: 15) is, in the base sequence containing the Kyushu 199 type mutant allele related to the polymorphism site (in the base sequence shown in SEQ ID NO: 5), with respect to the continuous 20-base sequence consisting of the base site "C" (the 52nd base site of SEQ ID NO: 5), which is the Kyushu 199 type allele related to the polymorphism site, and including it at the 3' end (the base sequence from the 33rd to the 52nd of SEQ ID NO: 5), when the base site indicating the Kyushu 199 type allele is counted as the first base, the base "A" at the third position (the 50th of SEQ ID NO: 5) towards the 5' end side is deliberately replaced with the mismatched base "T", and it is a PCR primer consisting of the primer constituent bases. That is, the primer (F) for detecting the polymorphism of the DNA marker 2 contains, as its primer constituent bases, the base site "C" (the 52nd base of SEQ ID NO: 5) indicating the Kyushu 199 type mutant allele related to the polymorphism site 2 (SNP) at its 3'-end, and is a PCR primer containing a deliberate mismatched base adjacent to the 2 bases upstream of the 3'-end base.

[0094] As the reverse primer (complementary strand direction primer) forming a primer pair with the forward primer (sense strand direction primer) described above, the "common primer (R) for the sweet potato low hypertrophy-related DNA marker 2" which is a PCR primer consisting of the base sequence described in SEQ ID NO: 16 was designed. The common primer (R) for the DNA marker 2 (the base sequence represented by SEQ ID NO: 16) is a PCR primer having, as its primer constituent bases, the complementary strand base sequence of a continuous 20-base sequence (the base sequence from the 2063rd to the 2082nd bases of SEQ ID NO: 4) existing in the region about 60 to 80 bases downstream of the base site corresponding to the polymorphism site in the corresponding base sequence in the reference genome (the base sequence of SEQ ID NO: 4).

[0095] Using the primer set, amplification of a DNA fragment by PCR reaction was performed on a DNA sample extracted from the leaves of a plant body of a sweet potato plant (Kyushu 199 strain, Koganesengan) grown under the following conditions. The conditions and procedures for PCR detection were the same as those described in (1) above, except that the PCR cycle described in (1) above was performed 35 cycles × (94°C for 30 seconds → 58°C for 30 seconds → 72°C for 60 seconds). The results are shown in Fig. 3(B). As a result, when a PCR reaction was performed on the DNA sample of the Kyushu 199 line using the primer set, it was confirmed that a specific PCR amplification fragment was generated at around 100 bp, which is the size of the amplification fragment predicted from the primer design positions. This size is consistent with the base length of 60 bp between the predicted primer sequences (the base length excluding the primer sequences from the base length of the PCR amplification fragment). On the other hand, when a PCR reaction was performed on the DNA sample of Koganegenkan, it was confirmed that no PCR amplification fragment was generated.

[0096] (3) Design of a primer set containing primers for detecting DNA marker 3 polymorphism As a primer capable of specifically detecting the Kyushu 199 type polymorphism related to the potato low-hypertrophy-related DNA marker 3 (insertion / deletion type polymorphic site), the "primer for detecting potato low-hypertrophy-related DNA marker 3 polymorphism (F)" (forward primer), which is a PCR primer consisting of the base sequence set forth in SEQ ID NO: 17, was designed. The base sequence of the primer for detecting DNA marker 3 polymorphism (F) (the base sequence shown in SEQ ID NO: 17) is a base sequence consisting of 26 consecutive bases containing the base site "T" (the 32nd base site of SEQ ID NO: 8) indicating the inserted base contained in the Kyushu 199 type allele related to the polymorphic site in the base sequence containing the Kyushu 199 type mutant allele related to the polymorphic site (in the base sequence shown in SEQ ID NO: 8), with respect to the base sequence from the 7th to the 32nd base of SEQ ID NO: 8, when the inserted base is counted as the first base, the 3rd base "T" (the 30th base of SEQ ID NO: 8) on the 5' end side is deliberately substituted with a mismatched base "G", and it is a PCR primer having this as the primer constituent base. That is, the primer for detecting DNA marker 3 polymorphism (F) is a PCR primer that, as its primer constituent base, contains the inserted base site "T" (the 32nd of SEQ ID NO: 8) existing in the middle of the Kyushu 199 type mutant allele "TTA" related to the polymorphic site 3 (the indel mutation site and the base sites before and after it) at the 3' end, and contains a deliberate mismatched base adjacent to the 2 bases upstream of the 3' end base.

[0097] As the reverse primer (complementary strand direction primer) that forms a primer pair with the forward primer (sense strand direction primer) described above, a PCR primer consisting of the nucleotide sequence set forth in SEQ ID NO: 18, "Common primer for taro low growth-related DNA marker 3 (R)", was designed. The DNA marker 3 common primer (R) (nucleotide sequence shown in SEQ ID NO: 18) is a nucleotide sequence consisting of 20 consecutive nucleotides (nucleotide sequence from positions 2062 to 2081 of SEQ ID NO: 7) in a region approximately 60 to 80 nucleotides downstream of the nucleotide site corresponding to the polymorphic site in the corresponding nucleotide sequence in the reference genome (nucleotide sequence of SEQ ID NO: 7). It is a PCR primer with the complementary strand nucleotide sequence as the primer-constituting nucleotide sequence.

[0098] Using the primer set, DNA samples extracted from the leaves of growing plants of sweet potato plants (Kyushu 199 strain, Koganesengan) were amplified for DNA fragments by PCR reaction under the following conditions. The conditions and procedures for PCR detection were carried out as described in (1) above. The results are shown in Fig. 3(C). As a result, when a PCR reaction was performed on the DNA sample of the Kyushu 199 strain using the primer set, it was confirmed that a specific PCR amplification fragment was generated at around 106 bp, which is the expected amplification fragment size from the primer design position. This size is consistent with the expected base length of 60 bp between the primer sequences (the base length obtained by excluding the primer sequences from the base length of the PCR amplification fragment). On the other hand, when a PCR reaction was performed on the DNA sample of Koganesengan, it was confirmed that no PCR amplification fragment was generated.

[0099] (4) Design of a primer set containing primers for detecting the polymorphism of DNA marker 4 As a primer capable of specifically detecting the Kyushu 199 type polymorphism related to taro low growth-related DNA marker 4 (multiple SNP type polymorphic sites), a PCR primer consisting of the nucleotide sequence set forth in SEQ ID NO: 20, "Primer for detecting the polymorphism of taro low growth-related DNA marker 4 (R)" (reverse primer), was designed. The base sequence of the primer (R) for detecting the polymorphism of the DNA marker 4 (the base sequence shown in SEQ ID NO: 20) is a complementary strand base sequence of a continuous 27-base sequence (the base sequence from the 85th to the 111th bases of SEQ ID NO: 11) containing the three consecutive bases "CGC" (the base site at the 85th to 87th positions of SEQ ID NO: 11), which is the Kyushu 199 type mutant allele related to the polymorphic site, on the 5'-terminal side in the base sequence (the base sequence shown in SEQ ID NO: 11) containing the Kyushu 199 type mutant allele related to the polymorphic site, and is a PCR primer composed of the primer constituent bases. That is, the primer (R) for detecting the polymorphism of the DNA marker 4 is a PCR primer that contains, as its primer constituent bases, the complementary strand sequence "GCG" of the three consecutive bases "CGC" (the base sequence at the 85th to 87th positions of SEQ ID NO: 11) indicating the Kyushu 199 type mutant allele related to the polymorphic site 4 (a polymorphic site containing multiple SNPs) at the 3'-terminal. Note that the base site of the three consecutive bases on the 3'-terminal side of the primer (R) for detecting the polymorphism of the DNA marker 4 differs by two bases from the complementary strand sequence of the corresponding site in the wild type allele.

[0100] As the forward primer (sense strand direction primer) that forms a primer pair with the above reverse primer (complementary strand direction primer), a PCR primer "common primer (F) for the potato low hypertrophy-related DNA marker 4" consisting of the base sequence described in SEQ ID NO: 19 was designed. The common primer (F) for the DNA marker 4 (the base sequence shown in SEQ ID NO: 19) is a PCR primer composed of a continuous 22-base sequence (the base sequence from the 1895th to the 1916th bases of SEQ ID NO: 10) existing in the region about 85 to 105 bases upstream of the polymorphic site in the corresponding base sequence in the reference genome (the base sequence of SEQ ID NO: 10) as the primer constituent bases.

[0101] Using the primer set, a DNA fragment was amplified by PCR reaction under the following conditions for a DNA sample extracted from the leaves of a grown sweet potato plant (Kyushu 199 line, Koganesengan). The PCR detection conditions and procedures were the same as those described in (2) above. The results are shown in Figure 3 (D). As a result, when PCR reactions were performed on DNA samples from Kyushu No. 199 using this primer set, it was confirmed that a specific PCR amplified fragment was generated at approximately 133 bp, which is the amplified fragment size predicted from the primer design positions. This size is consistent with the predicted base length between the primer sequences of 84 bp (the base length of the PCR amplified fragment excluding the primer sequence). On the other hand, when PCR reactions were performed on DNA samples from the Japanese laurel wren, it was confirmed that no PCR amplified fragment was generated.

[0102] (5) Summary of results It was confirmed that by using each of the primer sets designed in (1) to (4) above, it is possible to specifically detect the "Kyushu No. 199 sequence" (a sequence in which the polymorphic site represents a mutant allele of the Kyushu No. 199 sequence) by PCR, distinguishing it from the "normal sequence" (a sequence in which the polymorphic site represents a normal allele), for each of the seed potato hypertrophy-related DNA markers 1 to 4. The primer sets designed in this example and the results of PCR amplification are shown in Table 3 and Figure 3. In addition, the underlined bases in the constituent bases of the polymorphism detection primers shown in the table below indicate mismatch bases that have been intentionally designed to be mismatch bases with both the Kyushu No. 199 sequence and the normal sequence, in order to increase mismatches with the DNA fragment of the normal sequence and suppress non-specific amplification.

[0103] [Table 3]

[0104] [Experimental Example 3] "Verification of the correlation between the above DNA markers 1 to 4 and phenotypes" Regarding DNA markers 1 to 4, for which an association with low growth of sweet potato was estimated in the genome-wide association analysis of Experimental Example 1 above, genotyping analysis was performed on the F1 population by PCR detection using a primer set capable of specifically detecting the Kyushu 199 genotype mutation allele, and the association between the genotypes regarding the above DNA markers 1 to 4 and the phenotypes regarding sweet potato growth / low growth was verified.

[0105] (1) Genotyping analysis in histogram analysis Regarding 149 lines of the F1 population for which the parent sweet potato weight ratio (phenotypic information regarding sweet potato growth) after the cultivation test was calculated in Experimental Example 1(3), a detection test of PCR amplification fragments was performed on DNA samples extracted from the leaves of these plants using a primer set containing the four types of primers for detecting polymorphisms of sweet potato low-growth-related DNA markers designed in Experimental Example 2 above. Specific means such as PCR reaction and detection were performed as described in Experimental Example 2. Then, regarding the sweet potato plants to be discriminated, when PCR amplification was detected, it was determined that the genotype in its genomic DNA was the genotype having the Kyushu 199 genotype mutation allele (heterozygous genotype of Kyushu 199 genotype sequence / normal genotype sequence), while when PCR amplification was not detected, it was determined that the genotype in its genomic DNA was the genotype not having the Kyushu 199 genotype mutation allele (homozygous genotype of normal genotype sequence). Here, the F1 population to be discriminated is a population generated by using Koganesengan (a variety in which the Kyushu 199 genotype sequence was confirmed not to be amplified in Experimental Example 2) as one of the mating parents. Therefore, the F1 population does not include those with the genotype having the Kyushu 199 genotype sequence in homozygous form as its genotype.

[0106] After calculating the parent potato weight ratio (phenotypic information regarding tuber hypertrophy of the seed potato) after the cultivation test conducted in Experimental Example 1(3), in order to examine the distribution of the parent potato weight ratio for 149 lines of the F1 population, a histogram analysis was performed by dividing the difference in the values into ranges of 0.05. Then, the genotypes of each of the tuber low hypertrophy-related DNA markers 1 to 4 obtained above were plotted on the histogram distribution of the parent potato weight ratio, and the frequency of occurrence of the lines having the Kyushu 199 type mutant allele for each DNA marker was calculated. The respective results for DNA markers 1 to 4 are shown in Tables 4 to 7 and Figures 4 to 7.

[0107] (1-1) Analysis results for DNA marker 1 As a result of the analysis of the tuber low hypertrophy-related DNA marker 1, the frequency of occurrence of the lines having the Kyushu 199 type mutant allele for DNA marker 1 was 59.06% (slightly more than half) of all the lines belonging to the F1 population. It was shown that the lines determined to have the genotype with the Kyushu 199 type mutant allele appeared at a high frequency of about 77 to 88% in each distribution range of 0.05 to 0.20 where the parent potato weight ratio showed a low value on the histogram distribution (Table 4, Figure 4). In this regard, among the total number (n = 72) distributed in the range of the parent potato weight ratio of 0.2 or less (below the reference value), which is considered to clearly show tuber low hypertrophy, the ratio of the number of lines (n = 59) having the genotype with the Kyushu 199 type mutant allele was calculated to be a high value of 81.9%.

[0108]

Table 4

[0109] (1-2) Analysis results for DNA marker 2 As a result of the analysis of the potato low hypertrophy-related DNA marker 2, the frequency of occurrence of the line having the Kyushu 199 type mutant allele related to the DNA marker 2 was 61.74% (slightly more than half) of all the lines belonging to the F1 population. However, the lines determined to have the genotype with the Kyushu 199 type mutant allele were shown to appear at a high frequency of about 81 to 100% in each distribution range of 0 to 0.20 showing a low value of the parent potato weight ratio in the histogram distribution (Table 5, Figure 5). In this regard, among the total number (n = 72) distributed in the range of the parent potato weight ratio of 0.2 or less (below the reference value), which is recognized as clearly showing potato low hypertrophy, the ratio of the number of lines (n = 61) having the genotype with the Kyushu 199 type mutant allele was calculated to be a high value of 84.7%.

[0110]

Table 5

[0111] (1-3) Results of the analysis of DNA marker 3 As a result of the analysis of the potato low hypertrophy-related DNA marker 3, the frequency of occurrence of the line having the Kyushu 199 type mutant allele related to the DNA marker 3 was 59.73% (slightly more than half) of all the lines belonging to the F1 population. However, the lines determined to have the genotype with the Kyushu 199 type mutant allele were shown to appear at a high frequency of about 81 to 100% in each distribution range of 0 to 0.20 showing a low value of the parent potato weight ratio in the histogram distribution (Table 6, Figure 6). In this regard, among the total number (n = 72) distributed in the range of the parent potato weight ratio of 0.2 or less (below the reference value), which is recognized as clearly showing potato low hypertrophy, the ratio of the number of lines (n = 63) having the genotype with the Kyushu 199 type mutant allele was calculated to be a high value of 87.5%.

[0112]

Table 6

[0113] (1-4) Results of the analysis of DNA marker 4 As a result of the analysis of the DNA marker 4 related to the low corm weight of the taro variety, the frequency of occurrence of the line having the Kyushu 199 type mutant allele for the DNA marker 4 was 60.40% (slightly more than half) of all the lines belonging to the F1 population. It was shown that the lines determined to have the genotype with the Kyushu 199 type mutant allele appeared at a high frequency of about 81 - 100% in each distribution range of 0 - 0.20 showing a low value of the parent corm weight ratio on the histogram distribution (Table 7, Figure 7). In this regard, among the total number (n = 72) distributed in the range of the parent corm weight ratio of 0.2 or less (below the reference value) which is recognized to clearly show the low corm weight of the taro variety, the ratio of the number of lines (n = 61) having the genotype with the Kyushu 199 type mutant allele was calculated to be a high value of 84.7%.

[0114]

Table 7

[0115] (1 - 5) Arrangement of results In the genome-wide association analysis of the above Experimental Example 1, the four "DNA markers 1 - 4 showing the association with the low corm weight of the taro variety" were found. For any of the DNA markers 1 - 4, the frequency of occurrence of the lines having the Kyushu 199 type mutant allele in the F1 population was about 59 - 62% (almost half). As a result of the histogram analysis and genotyping analysis in this Experimental Example, about 82 - 88% (more than 80%) of the lines in the range of the parent corm weight ratio of 0.2 or less (the phenotype clearly expressing the low corm weight of the taro variety) were the lines having the Kyushu 199 type mutant allele in their genomic DNA (the genotype is the heterozygous type of the Kyushu 199 type sequence / normal type sequence). Here, regarding the parent potato weight ratio values indicating the phenotypic expression of seed potato hypertrophy / hypohypertrophy numerically, depending on cultivation conditions and the influence of diseases, etc. for each individual, the formation of daughter potatoes may be poor due to factors unrelated to the genotype. In a strain including such individuals, even a genotype having a mutant allele (a genotype having a hypohypertrophy mutant gene) may show a relatively higher value of the parent potato weight ratio. Also, for the same reason, the hypertrophy of parent potatoes may be hindered by environmental factors, etc., and even a genotype having no mutant allele (a genotype having only a hypertrophy gene) may show a relatively lower value of the weight ratio of parent potatoes. However, as a result of analyzing the "entire F1 population" by the histogram analysis and genotyping analysis of this example, it was confirmed that there is a clear correlation between the "genotype having the Kyushu 199 type mutant allele for DNA markers 1 to 4" and the "phenotype of seed potato hypohypertrophy". Regarding the above points, it was recognized that any of the four DNA markers 1 to 4 is a DNA marker showing a correlation with the "phenotype of seed potato hypohypertrophy".

[0116] [Experimental Example 4] Verification regarding the genotype of allelic genes Regarding the Kyushu 199 type sequences (sequences having mutant alleles showing the Kyushu 199 type polymorphism) in each region related to DNA markers 1 to 4, verification was carried out regarding the relationship with their allelic normal type sequences (sequences having normal alleles not showing the Kyushu 199 type polymorphism), and regarding the genotype (allele type) in the hexaploid genome of sweet potato plants.

[0117] (1) ALT allele frequency Regarding the "Kyushu 199 strain" showing seed potato hypohypertrophy and "Koganegasane" showing normal seed potato hypertrophy used in the mating (crossing) in Experimental Example 1(1), the appearance frequency (ALT allele frequency) of the Kyushu 199 type sequence (sequence showing a mutant allele) with respect to the total number of allelic genes in the large-scale sequence data (NGS library) obtained by the GRAS-Di analysis in Experimental Example 1(2) was confirmed. As a result, the occurrence frequency (ALT allele frequency in genome library) of each Kyushu 199 type sequence (sequence indicating mutant allele) related to DNA markers 1 to 4 was “0” in the genome library of the ladybug, and it was confirmed that no mutant allele existed in the genome of the ladybug for any of DNA markers 1 to 4. In contrast, in the genome library of the Kyushu 199 line, it showed “0.02 to 0.186” with respect to the number of sequences of all alleles in the hexaploid genome of the sweet potato plant. Here, since the genome of the sweet potato plant is hexaploid, if the Kyushu 199 type sequence existed only on one of the six chromosomes, it was recognized that the value would be about 0.16 or less (about 1 / 6 or less).

[0118] Based on these results, it was strongly suggested that each of the Kyushu 199 type sequences (sequences indicating mutant alleles) related to DNA markers 1 to 4 is a mutant sequence existing on one chromosome in the hexaploid genome possessed by the Kyushu 199 line. In addition, it has been confirmed that there exists a normal type sequence (sequence indicating normal allele) that does not show the Kyushu 199 type polymorphism as its allele in the large-scale sequence data (NGS library) obtained from the GRAS-Di analysis in the above Experimental Example 1(2). In this regard, it was recognized that the normal type sequences (sequences indicating normal alleles) related to DNA markers 1 to 4 exist in all six chromosomes in the hexaploid genome of the ladybug and in five chromosomes in the hexaploid genome of the Kyushu 199 line. Regarding the above points, while the normal type sequence commonly exists not only in the genome of the ladybug but also in the genome of the Kyushu 199 line, on the other hand, it was confirmed that the Kyushu 199 type sequence exists only on one chromosome of the Kyushu 199 line. In this regard, it was suggested that the Kyushu 199 type sequence is a “mutant type sequence” with respect to the normal type sequence.

[0119]

Table 8

[0120] (2) Verification of segregation ratio In the result of the phenotypic histogram analysis of Experimental Example 1(3), regarding the F1 population obtained by crossing "Kyushu 199 line showing low tuber hypertrophy of sweet potato" and "Koganegasengan showing normal tuber hypertrophy of sweet potato", the segregation ratio of phenotypes between "low tuber hypertrophy of sweet potato (parent tuber weight ratio ≤ 0.2)" and "tuber hypertrophy and intermediate type of sweet potato (parent tuber weight ratio > 0.2)" showed approximately "1:1", and the appearance rate of the phenotype showing low tuber hypertrophy of sweet potato was about 50% (half the appearance rate). Regarding the "appearance rate regarding the phenotype", when assuming that the causative gene of the phenotype is one mutant gene showing dominance, regarding the F1 population obtained by crossing a "line having a heterozygous type of normal gene / mutant gene" and a "line having a homozygous type of normal gene", the appearance rate of the "line having a heterozygous type of normal gene / mutant gene" in the F1 population was recognized as a value consistent with the theoretical value of 50% (half the appearance rate).

[0121] Here, in the results of the genotyping analysis according to Experimental Example 3(1) to (4), the appearance rate of the genotype (heterozygous type of mutant allele / normal allele type) having the Kyushu 199 type sequence (mutant allele) of DNA markers 1 to 4 shows a correlation with the phenotype showing low tuber hypertrophy of sweet potato (parent tuber weight 0.2 or less) for any of DNA markers 1 to 4. The measured values of the appearance rate showed frequencies of 59 to 62% (almost half), which were almost the same values for any of DNA markers 1 to 4 (see Tables 4 to 7). Also, in the above (1) of this example, the results show that each of the Kyushu 199 type sequences (mutant alleles) of DNA markers 1 to 4 is a mutant allele present on one chromosome in the hexaploid genome for any of DNA markers 1 to 4.

[0122] In view of the above findings, it was strongly suggested that each of the Kyushu 199 type sequences (mutant alleles) of DNA markers 1 to 4 is a mutant allele in which all of these four DNA markers are present on the "same chromosome" as the mutant gene related to the causal gene for sweet potato hypertrophy / hypohypertrophy (a gene mutated to express sweet potato hypohypertrophy) and are in "linkage relationship" with each other. Here, the causal gene was presumed to be present in or around a specific genomic region (5.64 Mb) on chromosome 11 where DNA markers 1 to 4 are collectively present. Also, the genotype (combination of alleles) in the "Kyushu 199 line" showing sweet potato hypohypertrophy was recognized as a "heterozygous (simplex) for one Kyushu 199 type mutant sequence / five normal type sequences" (a heterozygous genotype having a Kyushu 199 type sequence on one chromosome in the autotetraploid genome and normal type sequences on the remaining five chromosomes). On the other hand, the genotype (combination of alleles) of the "cultivar Koganesengan" showing normal sweet potato hypertrophy was recognized as a "recessive homozygous (nulliplex) for six normal type sequences" (a recessive homozygous genotype having normal type sequences on all six chromosomes in the autotetraploid genome) (see Fig. 8). In addition, since the genome of sweet potato plants is composed of autotetraploids, as for the combination of alleles (genotype) of the sweet potato hypertrophy / hypohypertrophy gene, if it is a heterozygous genotype having one gene sequence (mutant gene) showing sweet potato hypohypertrophy in the genome, it was recognized that the phenotype showing sweet potato hypohypertrophy is expressed as a "dominant trait".

[0123] [Experimental Example 5] 'Discrimination Test in Other Sweet Potato Cultivar Lines' Regarding the DNA markers whose discriminability for the above sweet potato hypohypertrophy was confirmed, it was verified whether it is possible to discriminate between sweet potato hypertrophy / hypohypertrophy for the cultivar lines of sweet potato plants including 17 major cultivar lines widely spread in Japan (covering 88% of the domestic planting area).

[0124] As seed potato low-hypertrophy-related DNA markers, focusing on the above four types of DNA markers 1 to 4, a detection test of PCR amplification fragments was performed on a DNA sample extracted from the leaves of the following sweet potato plants using the primer sets designed in Experimental Example 2 above. Specific means such as PCR reaction and detection were carried out as described in Experimental Examples 2(1) to (4). The results are shown in Table 9. In Table 9 below, when PCR amplification was detected (indicated by the symbol “+” in the table), it was determined that the sweet potato plant of the target sample had a genotype having the Kyushu 199 type mutant allele in its genome (the genotype was a heterozygous type of Kyushu 199 type sequence / normal type sequence, or a homozygous type of Kyushu 199 type sequence). On the other hand, when PCR amplification was not detected (indicated by the symbol “-” in the table), it was determined that the sweet potato plant of the target sample had a genotype not having the Kyushu 199 type mutant allele in its genome (the genotype was a homozygous type of normal type sequence). Here, for the variety lines (Koganegen, Shiroyutaka, Murasaki Masari, Beniharuka) indicated by “※1” regarding the “characteristics of seed potatoes” in Table 9 below, they are variety lines that have been confirmed to exhibit seed potato hypertrophy based on the reference value of the parent potato weight ratio in the cultivation test. Also, the variety lines (Konaishin, Shirosatsuma, Chura Koihong, Tamayutaka, Daichino Yume, Quick Sweet, Beniazuma, Takase 14, Silk Sweet, Benimasari, Anna Red, Ayamurasaki, Anna Kogane) indicated by “※2” are variety lines that are not indicated by the reference value of the parent potato weight ratio but are generally recognized to have seed potatoes that hypertrophy empirically. Further, the variety lines (Kyushu 199 line, Tamaakane, Resisto) indicated by “※3” are variety lines that have been confirmed to exhibit seed potato low-hypertrophy based on the reference value of the parent potato weight ratio in the cultivation test.

[0125] As a result, it was confirmed that for the Kyushu 199 line, Tamaakane, and Resisto (Samples 18 to 20), which are variety lines showing “seed potato low-hypertrophy”, all genotypes of DNA markers 1 to 4 are variety lines having a genotype with the Kyushu 199 type mutant allele (PCR detection symbol “+” in the table). Here, the Tamahakane and Resisto used in the tests of this example correspond to the ancestral lines (varieties) showing low tuber bulking of sweet potato used in creating the Kyushu 199 line. That is, it is recognized that the genetic characteristics showing low tuber bulking of sweet potato possessed by the Kyushu 199 line are characteristics inherited from these varietal lines. In this regard, when performing cross-breeding in future variety improvement, it was recognized that by using DNA markers 1 to 4, it is possible to identify the low tuber bulking of the sweet potato plants to be identified.

[0126] Here, in the analysis results of this example, regarding 8 varietal lines (Samples 1 to 3, 5 to 9 in the following table: approximately half of the major varieties) among the 17 major varietal lines in Japan (varietal lines confirmed to show "normal tuber bulking of sweet potato" or generally recognized), it was confirmed that all genotypes of DNA markers 1 to 4 are genotypes without the Kyushu 199 type mutant allele (PCR detection symbol "-" in the table). In this regard, by using the DNA markers 1 to 4 related to tuber bulking of sweet potato found on chromosome 11 of the sweet potato plant genome as an index, it was recognized that the traits related to tuber bulking / low tuber bulking of the sweet potato plants to be identified can be identified for at least approximately half of the major varieties in Japan.

[0127] Regarding the analysis results of this example, when using DNA markers 1 and 2 as an index, PCR detection showed false positives (symbol "+") for Samples 10 to 17 (8 varietal lines) among the 17 major varietal lines in Japan. Also, when using DNA marker 4 as an index, PCR detection showed false positives (symbol "+") for Samples 4, 12 to 14 (4 varietal lines). Here, as reasons for false positives when using DNA markers 1, 2, and 4, some mutant alleles already existed at the stage of the ancestral varieties of some of the above-mentioned cultivar lines and the Kyushu 199 line. Subsequently, mutant genes of the causative gene related to sweet potato hypertrophy / hypohypertrophy occurred in a certain line and were inherited by the Kyushu 199 line, etc. Or, recombination occurred at the stage of the ancestral variety of the Kyushu 199 line where some mutant alleles segregated, and only some mutant alleles were inherited by some of the above-mentioned cultivar lines through subsequent mating. Or, it was speculated that the same mutation as the mutant allele occurred in parallel at the corresponding base sites in these cultivar lines, etc. On the other hand, when using "DNA marker 3" as an indicator, no false positives were detected for some of the above-mentioned cultivar lines. It was also confirmed that genotypes without the Kyushu 199 type sequence (PCR detection symbol "-" in the table) were shown for cultivar lines (samples 4, 10 - 17) that could not be discriminated by DNA markers 1, 2, and 4. In this regard, it was also recognized that discrimination regarding sweet potato hypohypertrophy was possible by using DNA marker 3 for the progeny population produced by crossing all of the 17 major cultivar lines (samples 1 - 17 in the following table) with the Kyushu 199 line (or a cultivar line showing sweet potato hypohypertrophy having a similar causative gene) as the trait donor parent for sweet potato hypohypertrophy.

[0128] Regarding the above points, it was confirmed that by using the DNA markers 1 - 4 related to sweet potato hypertrophy found on chromosome 11 of the sweet potato plant genome as indicators, it was possible to discriminate the traits related to sweet potato hypertrophy / hypohypertrophy of the sweet potato plants (and their cultivar lines) to be discriminated. Regarding this point, specifically, by using DNA markers 1 - 4 as indicators, it was confirmed that it was possible to discriminate the traits related to sweet potato hypertrophy / hypohypertrophy of the sweet potato plants to be discriminated for Koganegen, Shiroyutaka, Konai Shin, Chura Koihong, Murasaki Masari, Tamayutaka, Daichino Yume, or Quick Sweet included in 17 major cultivar lines in Japan. Furthermore, by using DNA marker 3 or 4 as an indicator, it was confirmed that the traits related to the tuberous swelling / hypotrophy of the sweet potato plants to be identified can be discriminated for the range (Koganegen, Shiroyutaka, Konai Shin, Chura Koihong, Murasaki Masari, Tama Yutaka, Daichi no Yume, Quick Sweet, Beni Haruka, Beni Azuma, Anna Red, Ayamurasaki, or Anna Kogane) containing 76% of the 17 major cultivar lines in Japan. In particular, by using "DNA marker 3" as an indicator, it was confirmed that the traits related to the tuberous swelling / hypotrophy of the sweet potato plants to be identified can be discriminated for the range (Koganegen, Shiroyutaka, Konai Shin, Shiro Satsuma, Chura Koihong, Murasaki Masari, Tama Yutaka, Daichi no Yume, Quick Sweet, Beni Haruka, Beni Azuma, Takitsuke 14, Silk Sweet, Beni Masari, Anna Red, Ayamurasaki, or Anna Kogane) containing all of the 17 major cultivar lines in Japan.

[0129] [Table 9]

[0130] [Biological Deposit] The applicant of this application submitted an application for deposit of the Kyushu 199 line, a sweet potato line showing tuberous hypohypertrophy, to the following depositary institution, and the following accession number was notified.

[0131] (1) Name and address of the depositary institution Name: National Institute of Technology and Evaluation, Patent Biological Depositary Center Address: Room 120, 2-5-8 Kazusa Kamashita, Kisarazu City, Chiba Prefecture 292-0818 (2) Accession number and date related to the deposit · Accession number FERM P-22485: Ipomoea batatas ‘Kyushu 199’ · Date of deposit (date of acceptance) October 5, 2023 · Date of notification of the deposit certificate: December 15, 2023 (3) Characteristics of the deposited organism The characteristics of the deposited organism related to FERM P-22485 are as described in the forms and examples for carrying out the invention according to the present specification. Also, information regarding the taxonomic position and scientific nature of the deposited organism is as follows. · Taxonomic position: Ipomoea batatas (L.) Lam. (sweet potato species), belonging to the genus Ipomoea in the family Convolvulaceae Ipomoea batatas (L.) Lam. · Information regarding scientific nature: The genome is autopolyploid hexaploid. The above-ground part is mainly composed of stems, petioles, and leaf blades. The petioles are arranged in an alternate phyllotaxis of 2 / 5, and branches occur from the main stem. Adventitious roots extending from the root primordia at the nodes become thickened to form tuberous roots, which are starch storage organs. Flower buds differentiate under short-day conditions and flower if a certain air temperature is present.

[0132] [Information regarding nucleotide sequences] Information regarding the nucleotide sequences related to the present application is shown below. Also, the English title of the present invention described in the attached sequence listing is expressed as "Method for identifying sweetpotatoes producing seed roots with limited enlargement".

[0133] (1) SEQ ID NO: 1 · Sequence name: Chr11:5719438 and the surrounding region in reference genome sequence · Nucleotide length: 4001 · Molecular species: genomic DNA · Origin: Ipomoea trifida 'Mx23Hm' · Remarks: A reference sequence showing the nucleotide site (chr11:5719438) and its surrounding region in the diploid genome of a wild relative of sweet potato corresponding to DNA marker 1. Details are described in this specification.

[0134] (2) Sequence number 2 · Array name: Mutant type sequence of DNA marker1 and the surrounding region · Base length: 129 · Molecular species: genomic DNA · Origin: Ipomoea batatas ‘Kyushu No.199’ · Remarks: The nucleotide sequence showing the Kyushu 199 type mutant allele related to DNA marker 1 and its surrounding region, details are described in this specification · Nucleotide sequence: TGAAGAAATGTAGAAGCCATTAAAACAAAAACATATCAAATAAATATGCATGTGGCCGTTCAGAAACATTCATACTCTCACATAATAAATATGAAATTAAATAGCATTCAAGGAAAATTTACCTCTCTC

[0135] (3) Sequence number 3 · Array name: Normal type sequence of DNA marker1 and the surrounding region · Base length: 43 · Molecular species: genomic DNA · Origin: Ipomoea batatas ‘Koganesengan’ · Remarks: The nucleotide sequence showing the normal type allele related to DNA marker 1 and its surrounding region, details are described in this specification · Nucleotide sequence: GAAGAAATGGAGAAGCCATTAAAACAAAAACATATCAAATAAA

[0136] (4) Sequence number 4 · Array name: Chr11:6183279 and the surrounding region in reference genome sequence · Base length: 4002 · Molecular species: genomic DNA · Origin: Ipomoea trifida ‘Mx23Hm’ · Note: A reference sequence showing the base site (chr11:6183279) and its surrounding region in the diploid genome of a sweet potato-related wild species corresponding to DNA marker 2. Details are described in this specification

[0137] (5) Sequence number 5 · Array name: Mutant type sequence of DNA marker2 and the surrounding region · Base length: 150 · Molecular species: genomic DNA · Origin: Ipomoea batatas ‘Kyushu No.199’ · Remarks: Base sequence showing the Kyushu 199 type mutant allele related to DNA marker2 and its surrounding region, details are described in this specification · Base sequence: CCTTCTCTCGTGAGAGCCGGCTGAGTCCATTGCACCAGTTGTTTCACGAATCGAACATCAGAAAATAGAGCTTCGCTGATCGGGAGTATAGGCAAGAGTTGTATTCCCAGCCTGCACTCTCTCCATTCAGCAGGAGCGAACCAGAGGCCG

[0138] (6) Sequence number 6 · Array name: Normal type sequence of DNA marker2 and the surrounding region · Base length: 18 · Molecular species: genomic DNA · Origin: Ipomoea batatas ‘Koganesengan’ · Remarks: Base sequence showing the normal type allele related to DNA marker2 and its surrounding region, details are described in this specification · Base sequence: AGTTGTTTCACGAATTGA

[0139] (7) Sequence number 7 · Array name: Chr11:8693418~chr11:8693419 and the surrounding region in reference genome sequence · Base length: 4001 · Molecular species: genomic DNA · Origin: Ipomoea trifida ‘Mx23Hm’ · Note: A reference sequence showing the base site (chr11:8693418~chr11:8693419) and its surrounding region in the diploid genome of a sweet potato-related wild species corresponding to DNA marker 3. Details are described in this specification

[0140] (8) Sequence number 8 · Sequence name: Mutant type sequence of DNA marker3 and the surrounding region · Base length: 117 · Molecular species: genomic DNA · Origin: Ipomoea batatas ‘Kyushu No.199’ · Remarks: Base sequence showing the Kyushu 199 type mutant allele related to DNA marker3 and its surrounding region, details are described in this specification · Base sequence: GCACATACTTTGTAGGTAACACAATTGTCTTTACTAACCTTGAGTTATCATCTCCACCGTGCTGCCTGTTATCTTCTTTAAGTATGTATTTTGGATGATGTTGCTGGGTAGAGTTCG

[0141] (9) Sequence number 9 · Sequence name: Normal type sequence of DNA marker3 and the surrounding region · Base length: 15 · Molecular species: genomic DNA · Origin: Ipomoea batatas ‘Koganesengan’ · Remarks: Base sequence showing the normal type allele related to DNA marker3 and its surrounding region, details are described in this specification · Base sequence: TTGTCTTACTAACCT

[0142] (10) Sequence number 10 · Sequence name: Chr11:11357940~chr11:11357942 and the surrounding region in reference genome sequence · Base length: 4003 · Molecular species: genomic DNA · Origin: Ipomoea trifida ‘Mx23Hm’ · Note: Reference sequence showing the base site (chr11:11357940~chr11:11357942) and its surrounding region in the diploid genome of a sweet potato-related wild species corresponding to DNA marker 4. Details are described in this specification.

[0143] (11) Sequence number 11 · Array name: Mutant type sequence of DNA marker4 and the surrounding region · Base length: 123 · Molecular species: genomic DNA · Origin: Ipomoea batatas ‘Kyushu No.199’ · Remarks: Base sequence showing the Kyushu 199 type mutant allele related to DNA marker4 and its surrounding region, details are described in this specification · Base sequence: GGTGACTGTTATCACGGATACATGACGAATGGTCTCTAGGCTGCATACAGAAAGAGTGTAATGGAAGCTCAGGCAACTATTCAACGCTCTGAAGTTAGGAATATTCTAAAGGGAAACACAGTG

[0144] (12) Sequence number 12 · Array name: Normal type sequence of DNA marker4 and the surrounding region · Base length: 36 · Molecular species: genomic DNA · Origin: Ipomoea batatas ‘Koganesengan’ · Remarks: Base sequence showing the normal type allele related to DNA marker4 and its surrounding region, details are described in this specification · Base sequence: CAGGCAACTATTCAAAGTTCTGAAGTTAGGAATATT

[0145] (13) Sequence number 13 · Array name: Forward primer for DNA marker1 mutant allele · Base length: 25 · Molecular species: other DNA · Origin: synthetic construct · Note: PCR primer (fwd), details are described in this specification · Base sequence: CTTTGAAGAGACGGTGAAGAAAGGT

[0146] (14) SEQ ID NO: 14 · Sequence name: Reverse primer for DNA marker1 normal / mutant allele · Base length: 20 · Molecular species: other DNA · Origin: synthetic construct · Note: PCR primer (rev), details are described in this specification · Base sequence: AGAGGGAAGACATTGCGACG

[0147] (15) SEQ ID NO: 15 · Sequence name: Forward primer for DNA marker2 mutant allele · Base length: 20 · Molecular species: other DNA · Origin: synthetic construct · Note: PCR primer (fwd), details are described in this specification · Base sequence: CACCAGTTGTTTCACGATTC

[0148] (16) SEQ ID NO: 16 · Sequence name: Reverse primer for DNA marker2 normal / mutant allele · Base length: 20 · Molecular species: other DNA · Origin: synthetic construct · Note: PCR primer (rev), details are described in this specification · Base sequence: TGCTGAATGGAGAGAGTGCA

[0149] (17) SEQ ID NO: 17 · Array Name: Forward primer for DNA marker3 mutant allele · Base Length: 26 · Molecular Species: other DNA · Origin: synthetic construct · Remarks: PCR primer (fwd), details are described in this specification · Base Sequence: ACTTTGTAGGTAACACAATTGTCGTT

[0150] (18) Sequence Number 18 · Array Name: Reverse primer for DNA marker3 normal / mutant allele · Base Length: 20 · Molecular Species: other DNA · Origin: synthetic construct · Remarks: PCR primer (rev), details are described in this specification · Base Sequence: TCTACCCAGCAACATCATCC

[0151] (19) Sequence Number 19 · Array Name: Forward primer for DNA marker4 normal / mutant allele · Base Length: 22 · Molecular Species: other DNA · Origin: synthetic construct · Remarks: PCR primer (fwd), details are described in this specification · Base Sequence: AATCCAACTCCTTCTTCGACAG

[0152] (20) Sequence Number 20 · Array Name: Reverse primer for DNA marker4 mutant allele · Base Length: 27 · Molecular Species: other DNA · Origin: synthetic construct · Note: PCR primer (rev), details are described in this specification · Base sequence: CTTTAGAATATTCCTAACTTCAGAGCG

Industrial Applicability

[0153] The identification technology according to the present invention is a technology that enables efficient creation of useful sweet potato variety lines that allow "direct seeding cultivation" at the cultivation site of sweet potato (Ipomoea batatas tuberous root) production. In this regard, the present invention is expected to be used in research institutions and seedling manufacturers that are engaged in breeding business of useful sweet potato variety lines. In addition, the identification technology according to the present invention is expected to be a technology that significantly reduces the on-site labor during transplantation of seedlings in current sweet potato cultivation and contributes to improving the efficiency of sweet potato production.

Explanation of Symbols

[0154] 1: Lane 1 (PCR reaction solution using DNA solution of Kyushu 199 line as a sample) 2: Lane 2 (PCR reaction solution using DNA solution of Koganegenkan as a sample) M: DNA size marker D1m: PCR amplification fragment detected by PCR reaction using primer set for detecting DNA marker 1 polymorphism D2m: PCR amplification fragment detected by PCR reaction using primer set for detecting DNA marker 2 polymorphism D3m: PCR amplification fragment detected by PCR reaction using primer set for detecting DNA marker 3 polymorphism D4m: PCR amplification fragment detected by PCR reaction using primer set for detecting DNA marker 4 polymorphism

[0155] 3: Underground part of sweet potato plant grown by direct seeding cultivation 4: Parent tuber 5: Offspring tuber

[0156] 11: A polymorphic mutation group on chromosome 11 that has been statistically highly reliably shown to be associated with parental tuber low hypertrophy (phenotype)

Accession number

[0157] FERM P-22485

Claims

1. Regarding a method for identifying characteristics related to the low tuberous growth of sweet potato plants of the cultivar "Satsumaimo", (Detection step) Regarding the "DNA marker showing the relationship with the phenotype of low tuberous growth of Satsumaimo" shown below in the genomic DNA of a sweet potato plant (Ipomoea batatas), a step of detecting a base site showing the "Kyushu 199 type mutant allele" related to the DNA marker from the genomic DNA of the sweet potato plant to be identified, and (Determination step) In the detection step, when a base site showing the "Kyushu 199 type mutant allele" related to the DNA marker is detected, a step of determining that the sweet potato plant to be identified is a sweet potato plant showing low tuberous growth of Satsumaimo, A method for identifying a sweet potato plant showing low tuberous growth of Satsumaimo, characterized by including: ; (DNA marker showing the relationship with the phenotype of low tuberous growth of Satsumaimo) The "DNA marker showing the relationship with the phenotype of low tuberous growth of Satsumaimo" is Regarding the base site of the sweet potato plant (Ipomoea batatas) corresponding to the base site of the base sequence constituting the region from "chr11:5719438" to "chr11:11357942" on chromosome 11 when shown by the genomic information (Itr_r2.2) of the diploid wild relative species (Ipomoea trifida Mx23Hm strain) of sweet potato, A DNA marker regarding the base site showing the "Kyushu 199 type mutant allele" with respect to the corresponding base site (normal allele) in the genomic DNA of the cultivar Koganegenkan showing tuberous growth of Satsumaimo, The "Kyushu 199 type mutant allele" is a mutant allele showing a polymorphism that occurs at the corresponding base site on one of the chromosomes in the hexaploid genome of the Kyushu 199 strain (FERM P-22485) showing low tuberous growth of Satsumaimo with respect to the corresponding base site (normal allele) in the genomic DNA of the cultivar Koganegenkan showing tuberous growth of Satsumaimo, ; The "DNA marker showing the relationship with the phenotype of low tuberous growth of Satsumaimo" is i) It refers to one or more DNA markers among the DNA markers shown by the following DNA markers 1 to 4, or ii) A DNA marker in which the base site showing the "Kyushu 199 type mutant allele" related to the DNA marker is in a linkage relationship with any of the base sites showing the "Kyushu 199 type mutant allele" related to the following DNA markers 1 to 4, ; (DNA markers 1 to 4) The "DNA marker 1" is a DNA marker related to a base site of a sweet potato plant (Ipomoea batatas) corresponding to "chr11:5719438" on the 11th chromosome. Regarding the corresponding base site "G" (normal allele) in the genomic DNA of the variety Koganesengan that exhibits seed potato hypertrophy, the "Kyushu 199 type allele" shows "T" at this base site. The "DNA marker 2" is a DNA marker related to a base site of a sweet potato plant (Ipomoea batatas) corresponding to "chr11:6183279" on the 11th chromosome. Regarding the corresponding base site "T" (normal allele) in the genomic DNA of the variety Koganesengan that exhibits seed potato hypertrophy, the "Kyushu 199 type allele" shows "C" at this base site. The "DNA marker 3" is a DNA marker related to consecutive base sites of a sweet potato plant (Ipomoea batatas) corresponding to "chr11:8693418~chr11:8693419" on the 11th chromosome. Regarding the corresponding base site "TA" (normal allele) in the genomic DNA of the variety Koganesengan that exhibits seed potato hypertrophy, the "Kyushu 199 type allele" shows "TTA" with "T" inserted between the two bases at this base site. The "DNA marker 4" is a DNA marker related to consecutive base sites of a sweet potato plant (Ipomoea batatas) corresponding to "chr11:11357940~chr11:11357942" on the 11th chromosome. Regarding the corresponding base site "AGT" (normal allele) in the genomic DNA of the variety Koganesengan that exhibits seed potato hypertrophy, the "Kyushu 199 type allele" shows "CGC" at this base site. ; The method for identifying a sweet potato plant that exhibits low seed potato hypertrophy.

2. Regarding the "DNA marker 1", the "chr11:5719438" on the 11th chromosome of the genomic information (Itr_r2.2) of the diploid related wild species (Ipomoea trifida Mx23Hm line) of sweet potato corresponding to the position information in the sweet potato plant genomic DNA is specified as the 2000th base site in the base sequence shown by SEQ ID NO:

1. Regarding the above-mentioned "DNA Marker 2", "chr11:6183279" on chromosome 11 of the genomic information (Itr_r2.2) of the diploid related wild species of sweet potato (Ipomoea trifida Mx23Hm strain) corresponding to the position information in the sweet potato plant genomic DNA is specified as the 2002nd base site in the base sequence shown in SEQ ID NO:

4. Regarding the above-mentioned "DNA Marker 3", "chr11:8693418" to "chr11:8693419" on chromosome 11 of the genomic information (Itr_r2.2) of the diploid related wild species of sweet potato (Ipomoea trifida Mx23Hm strain) corresponding to the position information in the sweet potato plant genomic DNA are specified as the 2001st to 2002nd base sites in the base sequence shown in SEQ ID NO:

7. Regarding the above-mentioned "DNA Marker 4", "chr11:11357940" to "chr11:11357942" on chromosome 11 of the genomic information (Itr_r2.2) of the diploid related wild species of sweet potato (Ipomoea trifida Mx23Hm strain) corresponding to the position information in the sweet potato plant genomic DNA are specified as the 2001st to 2003rd base sites in the base sequence shown in SEQ ID NO:

10. The method for identifying a sweet potato plant showing low shoot and root growth of sweet potato according to claim 1.

3. The "DNA marker showing the relevance to the phenotype of low shoot and root growth of sweet potato" is One or more DNA markers among the DNA markers shown by the above-mentioned DNA Markers 1 to 4. The method for identifying a sweet potato plant showing low shoot and root growth of sweet potato according to claim 1.

4. The "DNA marker showing the relevance to the phenotype of low shoot and root growth of sweet potato" refers to the above-mentioned DNA Marker 3. The method for identifying a sweet potato plant showing low shoot and root growth of sweet potato according to claim 1.

5. The detection step is a step of performing on a sweet potato plant to be identified as a sweet potato plant belonging to the progeny population of the Kyushu 199 strain (FERM P-22485), the method for identifying a sweet potato plant showing low shoot and root growth of sweet potato according to claim 1.

6. A method for producing a sweet potato plant showing low shoot and root growth of sweet potato, including using the identification method according to any one of claims 1 to 5.

7. A method for producing a sweet potato line showing low vine growth of sweet potato, comprising using the identification method according to any one of claims 1 to 5.

8. A method for producing a plant body of a sweet potato plant showing low vine growth of sweet potato, comprising using the identification method according to any one of claims 1 to 5.

Citation Information

Cited By

  • QTL fine positioning method based on homohexaploid sweet potatoes

    CN121320610A

  • SNP molecular marker closely linked with purple leaf character of sweet potato and KASP primer

    CN121496097A