Recombinant virus products and methods for inhibiting expression of dystrophia myotonica protein kinase and / or interfering with trinucleotide repeat expansion in 3'-untranslated region of DMPK gene

RNA interference using AAVs to target DMPK gene expression and CTG repeats addresses the lack of effective treatments for myotonic dystrophy by suppressing gene expression and creating a suitable mouse model for therapy development.

JP2025166094APending Publication Date: 2025-11-05RES INST AT NATIONWIDE CHILDRENS HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025132404
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2018-08-22
Filing Date
2025-08-07
Publication Date
2025-11-05

AI Technical Summary

Technical Problem

Current treatments for myotonic dystrophy, particularly type 1 (DM1), are lacking, and existing mouse models do not adequately replicate the disease characteristics, complicating the development of effective therapies.

Method used

The use of RNA interference-based products, specifically adeno-associated viruses (AAVs) delivering inhibitory RNAs such as siRNA, shRNA, or miRNA, to target and suppress the expression of the DMPK gene and interfere with CTG repeat expansions in the 3' untranslated region, using viral vectors like AAVs to deliver nucleic acids encoding U6 or U7 snRNAs.

Benefits of technology

This approach effectively suppresses DMPK gene expression and interferes with toxic CTG repeats, potentially providing a therapeutic benefit for myotonic dystrophy, and establishes a reliable mouse model for testing new treatments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025166094000028
    Figure 2025166094000028
  • Figure 2025166094000029
    Figure 2025166094000029
  • Figure 2025166094000030
    Figure 2025166094000030
Patent Text Reader

Abstract

To provide recombinant virus products and methods for inhibiting the expression of the dystrophia myotonica protein kinase and / or interfering with the trinucleotide repeat expansion in the 3'-untranslated region of the DMPK gene.SOLUTION: The present disclosure relates to RNA interference-based methods for inhibiting the expression of the dystrophia myotonica protein kinase (DMPK) gene. Recombinant adeno-associated viruses of the disclosure deliver DNAs encoding inhibitory RNAs that knock down the expression of DMPK or interfere with the expression of the CTG repeat associated with myotonic dystrophy type 1 (DM1). The methods have application in treatment of myotonic dystrophy, including DM1, and other disorders associated with aberrant DMPK expression.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present disclosure relates to RNA interference-based products and methods for suppressing the expression of myotonic dystrophy protein kinase (DMPK) gene and / or interfering with the repeat expansion of CTG trinucleotide repeats in the 3' untranslated region of the myotonic dystrophy protein kinase (DMPK) gene. The recombinant adeno-associated virus of the present disclosure delivers DNA encoding a non-coding RNA that knocks down the expression of DMPK or interferes with the CTG repeat expansion. The method is applied in the treatment of muscular dystrophy, particularly myotonic dystrophy.

[0002] Incorporation as part of the sequence listing This application contains, as an independent part of the disclosure, a computer-readable form (filename: 53317A_Seqlisting.txt, 48,018 bytes, ASCII text file created on August 21, 2019), the entire contents of which are incorporated by reference herein as if they were part of this specification. [Background technology]

[0003] Myotonic dystrophy (DM) is characterized by myotonia, muscle dysfunction, and, rarely, cardiac conduction defects. Two major forms exist: type 1 (DM1) is caused by mutations in the myotonic dystrophy protein kinase (DMPK) gene, and type 2 (DM2) is caused by mutations in the CCHC zinc finger nucleic acid binding protein (CNBP) gene. Patients and their families are severely affected by the disease's detrimental effects on muscles and the heart, as well as cognitive impairment due to neurological causes. Currently, no curative treatments are available for either of these devastating disorders, leaving patients with only symptom management options.

[0004] DM1 is one of the most common forms of adult-onset muscular dystrophy. It affects skeletal muscle, heart, brain, skin, eyes, and the endocrine system. The prevalence of myotonic dystrophy is estimated to be 1 in 8,000, although higher prevalence rates have been reported in Finland and other European countries.

[0005] DM1, at least in some instances, is caused by the presence of CTG nucleotide repeats in the 3' untranslated region of the DMPK gene. These toxic repeats are processed and accumulate in the nucleus, where they trap other proteins. This prevents the proteins from functioning normally, leading to the observed disease symptoms. There remains a need in the art for treatments for DM, including DM1, as well as products and methods for testing new means for treatment.

[0006] Few mouse models for DM1 are available, and these models cannot reproduce all the characteristics of DM1 disease.This is a burden in the DM1 research field, which complicates the testing of new drugs for potential treatment.There is still a need in the art for models for testing treatments for DM1 and new methods for treating DM1. Summary of the Invention [Problem to be solved by the invention]

[0007] Provided herein are products and methods for treating myotonic dystrophy type I (DM1) in a subject in need thereof. The present disclosure provides RNA interference (RNAi)-based products and methods for preventing or suppressing expression of the myotonic dystrophy protein kinase (DMPK) gene, which contains CTG nucleotide repeats, also known as toxic repeats, in the 3' untranslated region of the DMPK gene. The methods involve delivering an inhibitory RNA specific to the DMPK gene to cells of a subject. In some embodiments, the methods use adeno-associated viruses (AAVs) to deliver an inhibitory RNA that targets DMPK mRNA or the CUG repeats in the 3' untranslated region of the DMPK gene. DMPK inhibitory RNAs of the present disclosure include, but are not limited to, antisense RNA, small inhibitory RNA (siRNA), short hairpin RNA (shRNA), small nuclear RNA (snRNA or U-RNA), or artificial microRNA (DMPK miRNA) that suppress DMPK expression. [Means for solving the problem]

[0008] In some aspects, the disclosure includes a nucleic acid comprising an inhibitory RNA that reduces expression of a DMPK gene (e.g., a DMPK gene comprising a CTG repeat expansion in its 3' untranslated region) operably linked to a U6 snRNA promoter (hereinafter "DMPK U6 shRNA nucleotides") or a U7 snRNA promoter (hereinafter "DMPK U7 snRNA nucleotides"). In some embodiments of these aspects, the inhibitory RNA that reduces expression of the DMPK gene is, inter alia, an siRNA, shRNA, snRNA, or miRNA.

[0009] In some embodiments, the present disclosure includes a nucleic acid comprising a nucleotide sequence encoding an RNA comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in any one of SEQ ID NOs:3-19.

[0010] In some embodiments, the present disclosure includes a nucleic acid comprising a nucleotide sequence encoding an RNA under the control of a U6 promoter, the nucleotide sequence comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs:3-7, or a complementary sequence thereof. In some embodiments, the present disclosure includes a nucleic acid comprising a nucleotide sequence encoding an RNA comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs:8-19, or a complementary sequence thereof, under the control of a U7 promoter.

[0011] The present disclosure provides a method for detecting a DMPK polypeptide comprising: (a) at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs: 3-19, or a complementary sequence thereof; (b) a nucleotide sequence encoding an RNA; and (c) a DMPK comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs:20-24, or a complementary sequence thereof. (c) a nucleotide sequence encoding a U6 shRNA; and (d) a DMPK comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs: 25-36 or a complementary sequence thereof. (d) a nucleotide sequence encoding a DMPK RNA comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs: 37-48 or a complementary sequence thereof; (e) a DMPK RNA bound to a sequence set forth in one of SEQ ID NOs: 37-48. a nucleotide sequence encoding an RNA; (f) a DMPK RNA reverse complement sequence comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs:49-60;(g) a reverse complement sequence encoding an RNA comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs: 61-72; and / or (h) a nucleic acid comprising a combination of any one or more of (a), (b), (c), (d), (e), (f), and / or (g);

[0012] The present disclosure provides a DMPK polypeptide having at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs: 20-24. a nucleotide sequence encoding a U6 shRNA, comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs: 25-36 and 61-72; DMPK comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a nucleotide sequence encoding U7 snRNA or a sequence set forth in one of SEQ ID NOs:20-24. Nucleic acids are provided that include a nucleotide sequence encoding a U6shRNA and / or a combination with a nucleotide sequence encoding a DMPK U7snRNA that comprises at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs: 25-36 and SEQ ID NOs: 61-72.

[0013] The present disclosure additionally provides a viral vector comprising any of the nucleic acids described herein. In some embodiments, the viral vector is an adeno-associated virus (AAV), an adenovirus, a lentivirus, a retrovirus, a poxvirus, a baculovirus, a herpes simplex virus, a vaccinia virus, or a synthetic virus (e.g., a chimeric virus, a mosaic virus, or a pseudotyped virus, and / or a virus comprising a heterologous protein, a synthetic polymer, a nanoparticle, or a small molecule).

[0014] In some embodiments, the viral vector is selected from the group consisting of AAV1 (i.e., an AAV comprising AAV1 inverted terminal repeats (ITRs) and AAV1 capsid proteins), AAV2 (i.e., an AAV comprising AAV2 ITRs and AAV2 capsid proteins), AAV3 (i.e., an AAV comprising AAV3 ITRs and AAV3 capsid proteins), AAV4 (i.e., an AAV comprising AAV4 ITRs and AAV4 capsid proteins), AAV5 (i.e., an AAV comprising AAV5 ITRs and AAV5 capsid proteins), AAV6 (i.e., an AAV comprising AAV6 ITRs and AAV6 capsid proteins), AAV7 (i.e., an AAV comprising AAV7 ITRs and AAV7 capsid proteins), AAV8 (i.e., an AAV comprising AAV8 ITRs and AAV8 capsid proteins), AAV9 (i.e., an AAV and AAV9 capsid protein), AAV10 (i.e., an AAV comprising AAV10 ITR and AAV10 capsid protein), AAV11 (i.e., an AAV comprising AAV11 ITR and AAV11 capsid protein), AAV12 (i.e., an AAV comprising AAV12 ITR and AAV12 capsid protein), AAV13 (i.e., an AAV comprising AAV13 ITR and AAV13 capsid protein), AAVrh74 (i.e., an AAV comprising AAVrh74 ITR and AAVrh74 capsid protein), AAVrh.8 (i.e., an AAV comprising AAVrh.8 ITR and AAVrh.8 capsid protein), or AAVrh.10 (i.e., an AAV comprising AAVrh.10 ITR and AAVrh.10 capsid protein).

[0015] In some embodiments, the viral vector is a recombinant AAV (rAAV) or a self-complementary recombinant AAV (scAAV). In some embodiments, the AAV, rAAV, or scAAV is AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, AAVrh.74, AAVrh.8, or AAVrh.10.

[0016] In some embodiments, the viral vector is a pseudotyped AAV comprising ITRs from one AAV serotype and capsid proteins from a different AAV serotype. In some embodiments, the pseudotyped AAV is AAV2 / 9 (i.e., AAV comprising AAV2 ITRs and AAV9 capsid proteins). In some embodiments, the pseudotyped AAV is AAV2 / 8 (i.e., AAV comprising AAV2 ITRs and AAV8 capsid proteins). In some embodiments, the pseudotyped AAV is AAV2 / 1 (i.e., AAV comprising AAV2 ITRs and AAV1 capsid proteins).

[0017] In some embodiments, the AAV comprises a recombinant capsid protein, such as a capsid protein comprising a chimera of one or more capsid proteins from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-anc80, AAVrh74, AAVrh.8 or AAVrh.10.

[0018] In some embodiments, the AAV lacks the rep and cap genes. In some embodiments, the AAV is a recombinant linear AAV (rAAV) or a recombinant self-complementary AAV (scAAV).

[0019] In some embodiments, the present disclosure provides a nucleic acid comprising a nucleotide sequence encoding an inhibitory RNA under the control of a U6 promoter and comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in any one of SEQ ID NOs: 3-7, and / or a nucleic acid comprising a nucleotide sequence encoding an inhibitory RNA under the control of a U7 promoter. Provided herein are viral vectors (e.g., viral vectors described herein, such as AAV) comprising a nucleic acid comprising a nucleotide sequence encoding RNA that comprises at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in any one of SEQ ID NOs:8-19.

[0020] In some embodiments, the disclosure provides a DMPK polypeptide that shares at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with a sequence set forth in one of SEQ ID NOs:20-24. a nucleotide sequence encoding a U6 shRNA, comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs: 25-36 and 61-72; DMPK comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a nucleotide sequence encoding U7 snRNA or a sequence set forth in one of SEQ ID NOs:20-24. Provided are viral vectors (e.g., viral vectors described herein, such as AAV) comprising a nucleic acid comprising a nucleotide sequence encoding a U6 shRNA and / or a combination thereof with a nucleotide sequence encoding a DMPK U7 snRNA that comprises at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs: 25-36 and SEQ ID NOs: 61-72.

[0021] In some embodiments, the present disclosure provides a composition comprising any adeno-associated virus as described herein and a pharmaceutically acceptable carrier.

[0022] The present disclosure also provides a method for inhibiting and / or interfering with the expression of the DMPK gene in a cell, or for inhibiting a CUG triplet repeat expansion (CTG) in the 3' untranslated region of the DMPK gene.exp(DMPK) comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs:20-24. a nucleotide sequence encoding a U6 shRNA, comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs: 25-36 and 61-72; DMPK comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a nucleotide sequence encoding U7 snRNA or a sequence set forth in one of SEQ ID NOs:20-24. The present invention also includes nucleic acids comprising a nucleotide sequence encoding a U6shRNA and / or a combination thereof with a nucleotide sequence encoding a DMPK U7snRNA that comprises at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs: 25-36 and SEQ ID NOs: 61-72.In some embodiments, the viral vector (e.g., an AAV such as a linear AAV or scAAV) comprises a nucleoside encoding an inhibitory RNA comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in any one of SEQ ID NOs: 3-7 under the control of a U6 promoter. The nucleic acids include one or more nucleic acids comprising a nucleotide sequence encoding an RNA under the control of a U7 promoter, and / or a nucleotide sequence encoding an RNA comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in any one of SEQ ID NOs:8-19.

[0023] The present disclosure provides a method for treating a subject suffering from myotonic dystrophy, comprising administering to the subject an effective amount of a viral vector (e.g., an AAV, such as a linear AAV or scAAV) comprising a nucleic acid encoding an interfering RNA targeting DMPK, as described herein. In some embodiments, the viral vector (e.g., an AAV, such as a linear AAV or scAAV) comprises at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs:20-24. a nucleotide sequence encoding a U6 shRNA, comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs: 25-36 and 61-72; DMPK comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a nucleotide sequence encoding U7 snRNA or a sequence set forth in one of SEQ ID NOs:20-24. The present invention also includes nucleic acids comprising a nucleotide sequence encoding a U6shRNA and / or a combination thereof with a nucleotide sequence encoding a DMPK U7snRNA that comprises at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs: 25-36 and SEQ ID NOs: 61-72.In some embodiments, the viral vector (e.g., an AAV such as a linear AAV or scAAV) comprises a nucleoside encoding an inhibitory RNA comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in any one of SEQ ID NOs: 3-7 under the control of a U6 promoter. The nucleic acids include one or more nucleic acids comprising a nucleotide sequence encoding an RNA under the control of a U7 promoter, and / or one or more nucleic acids comprising a nucleotide sequence encoding an RNA comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in any one of SEQ ID NOs:8-19.

[0024] In some embodiments, the present disclosure provides a method of treating myotonic dystrophy in a subject in need thereof, comprising administering to the subject an effective amount of a viral vector (e.g., an AAV such as linear AAV or scAAV) comprising a nucleic acid encoding an interfering RNA targeting DMPK as described herein, wherein the genome of the viral vector (e.g., AAV) contains an interfering RNA encoding an interfering RNA that (1) silences the expression of exon 5 of the DMPK gene; (2) silences the expression of exon 8 of the DMPK gene; and / or (3) contains a CUG triplet repeat expansion (CTG) in the 3' untranslated region of the DMPK gene. exp) or DMPK gene, or at least one U6 shRNA polynucleotide and / or at least one U7 snRNA polynucleotide, or a combination thereof, targeted to interfere with untranslated exon 15. In some embodiments, the polynucleotide encoding the U6 shRNA comprises at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in any one of SEQ ID NOs:20-24. In some embodiments, the polynucleotide encoding the U7sRNA contains at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the sequence set forth in any one of SEQ ID NOs: 25-36 and 61-72. In some embodiments, the viral vector (e.g., an AAV such as a linear AAV or scAAV) comprises a nucleoside encoding an inhibitory RNA comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in any one of SEQ ID NOs: 3-7 under the control of a U6 promoter. The nucleic acids include one or more nucleic acids comprising a nucleotide sequence encoding an RNA under the control of a U7 promoter, and / or one or more nucleic acids comprising a nucleotide sequence encoding an RNA comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in any one of SEQ ID NOs:8-19.

[0025] The present disclosure provides a method of treating myotonic dystrophy in a subject in need thereof, comprising administering to the subject an effective amount of a viral vector (e.g., an AAV such as linear AAV or scAAV), wherein the genome of the viral vector (e.g., an AAV such as linear AAV or scAAV) contains at least one U6 shRNA polynucleotide targeted to suppress expression of exon 5 of the DMPK gene, at least one U6 shRNA polynucleotide targeted to suppress expression of exon 8 of the DMPK gene, or a CUG triplet repeat expansion (CTG exp The present invention comprises at least one U6 shRNA polynucleotide targeted to suppress expression of the DMPK gene or untranslated exon 15 of the DMPK gene. In some embodiments, the polynucleotide encoding the U6 shRNA contains at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in any one of SEQ ID NOs:20-24.

[0026] The present disclosure provides a method for treating myotonic dystrophy in a subject in need thereof, comprising administering to the subject an effective amount of a viral vector (e.g., an AAV such as a linear AAV or scAAV), wherein the genome of the viral vector (e.g., an AAV such as a linear AAV or scAAV) comprises at least one U7snRNA polynucleotide targeted to suppress expression of exon 5 of the DMPK gene, at least one U7shRNA polynucleotide targeted to suppress expression of exon 8 of the DMPK gene, or at least one U7shRNA polynucleotide targeted to suppress expression of a CUG triplet repeat expansion (CTGexp) in the 3' untranslated region of the DMPK gene or expression of untranslated exon 15 of the DMPK gene. In some embodiments, the polynucleotide encoding the U7snRNA contains at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the sequence set forth in any one of SEQ ID NOs: 25-36 and 61-72.

[0027] The present disclosure provides a method of treating myotonic dystrophy in a subject in need thereof, comprising administering to the subject an effective amount of a viral vector (e.g., an AAV such as a linear AAV or a scAAV), wherein the genome of the viral vector (e.g., an AAV such as a linear AAV or a scAAV) contains at least one nucleic acid encoding a U7snRNA polynucleotide targeted to suppress expression of exon 5 of the DMPK gene, at least one nucleic acid encoding a U7snRNA polynucleotide targeted to suppress expression of exon 8 of the DMPK gene, and / or a CUG triplet repeat expansion (CTGexp) or DMPK polynucleotide in the 3' untranslated region of the DMPK gene. The present invention includes at least one nucleic acid encoding a U6 shRNA polynucleotide targeted to suppress the expression of exon 5 of the DMPK gene, at least one nucleic acid encoding a U7 snRNA polynucleotide targeted to suppress the expression of exon 8 of the DMPK gene, and / or at least one nucleic acid encoding a U6 shRNA polynucleotide targeted to suppress the expression of a CUG triplet repeat expansion (CTGexp) in the 3' untranslated region of the DMPK gene or untranslated exon 15 of the DMPK gene, in combination with at least one nucleic acid encoding a U7 snRNA polynucleotide targeted to suppress the expression of untranslated exon 15 of the DMPK gene. In some embodiments, the polynucleotide encoding the U6 shRNA comprises at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in any one of SEQ ID NOs:20-24, and and / or a polynucleotide encoding U7snRNA contains at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in any one of SEQ ID NOs: 25-36 and 61-72.

[0028] The present disclosure relates to a method for treating, ameliorating, and / or preventing myotonic dystrophy in a subject in need thereof, comprising: (a) a DMPK polypeptide comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs: 3-19; (b) a nucleotide sequence encoding an RNA; and (c) a DMPK comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs:20-24. (c) a nucleotide sequence encoding a U6 shRNA; and (d) a DMPK comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs: 25-36. (d) a nucleotide sequence encoding a DMPK RNA that contains at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs: 37-48; (e) a DMPK RNA bound to a sequence set forth in one of SEQ ID NOs: 37-48. a nucleotide sequence encoding an RNA; (f) a DMPK comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs: 49-60. (g) a reverse complement sequence encoding DMPK U7RNA that comprises at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the sequence set forth in one of SEQ ID NOs: 61-72; and / or (h) at least one nucleic acid comprising any one or more combinations of (a), (b), (c), (d), (e), (f), and / or (g), or a composition comprising said one or more nucleic acids.

[0029] The present disclosure provides for the use of at least one viral vector (e.g., an AAV, such as a linear AAV or scAAV) described herein in treating, ameliorating, and / or preventing myotonic dystrophy in a subject in need thereof.

[0030] In some embodiments, the myotonic dystrophy treated by the method of the present disclosure is DM1. The present disclosure also provides a novel viral vector (e.g., AAV, such as linear AAV or scAAV)-induced multisystem mouse model of DM1 (iDM1), as described herein. This model is useful for testing new therapeutics for DM, including DM1.

[0031] Other features and advantages of the present disclosure will become apparent from the following description of the drawings and detailed description. It should be noted that the drawings, detailed description, and examples, while indicating embodiments of the disclosed subject matter, are given by way of illustration only. Various changes and modifications within the spirit and scope of the present disclosure will become apparent from the drawings, detailed description, and examples.

[0032] definition The terms used herein generally have the meanings common to the art, within the context of this specification and the specific context in which each term is used. Certain terms are described below or elsewhere in this specification to provide further guidance to the practitioner when describing the methods of the invention or how to use the methods.

[0033] As used herein, the term "about" refers to a value that is within 10% or less than 10% of a stated value. For example, the phrase "about 100 nucleic acid residues" refers to a value between 90 and 110 nucleic acid residues.

[0034] As used herein, the term "myotonic dystrophy protein kinase" and its abbreviation "DMPK" refer to a serine / threonine kinase protein involved in regulating skeletal muscle structure and function, for example, in human subjects. The terms "myotonic dystrophy protein kinase" and "DMPK" are used interchangeably herein and refer not only to the wild-type form of the DMPK gene, but also to nucleic acids encoding variants and similar of the wild-type DMPK protein. The nucleic acid sequences of two isoforms of human DMPK mRNA are GenBank accession numbers BC026328.1 and BC062553.1, respectively (excluding the 3'UTR).

[0035] As used herein, the term "interfering RNA" refers to RNAs such as short interfering RNA (siRNA), microRNA (miRNA) or short hairpin RNA (shRNA). They suppress the expression of target RNA transcripts by (i) annealing with the target RNA transcript, thereby forming double-stranded nucleic acid, and (ii) promoting nuclease-mediated degradation of the RNA transcript, and / or (iii) delaying, suppressing or preventing the translation of the RNA transcript, for example, by sterically hindering the formation of functional ribosomal RNA-transcript complexes or otherwise attenuating the formation of functional protein products derived from the target RNA transcript. The interfering RNA described herein can be provided to patients, such as human patients suffering from myotonic dystrophy, for example, in the form of single-stranded or double-stranded oligonucleotides or in the form of a vector (e.g., a viral vector such as the adeno-associated viral vector described herein) containing a transgene encoding the interfering RNA. Representative interfering RNA platforms are described, for example, in Lam et al., Molecular Therapy-Nucleic Acids 4:e252 (2015); Rao et al., Advanced Drug Delivery Reviews 61:746-769 (2009); and Borel et al., Molecular Therapy 22:692-701 (2014), the disclosures of each of which are incorporated herein by reference in their entirety.

[0036] As used herein, the term "myotonic dystrophy" refers to an inherited muscle wasting disorder characterized by the nuclear retention of RNA transcripts encoding DMPK and containing an expanded CUG trinucleotide repeat region in the 3' untranslated region (UTR), such as an expanded CUG trinucleotide repeat region with 50 to 4,000 CUG repeats. In comparison, wild-type RMPK RNA transcripts typically contain 5 to 37 CUG repeats in the 3' UTR. In patients with myotonic dystrophy, the expanded CUG repeat region interacts with RNA-binding splicing factors, such as muscleblind-like protein. This interaction retains the mutant transcript in nuclear foci, sequestering RNA-binding proteins away from other pre-mRNA substrates. This then promotes the aberrant splicing of proteins involved in regulating muscle structure and function. In myotonic dystrophy type 1 (DM1), skeletal muscle is often the most severely affected tissue. However, the disease also has toxic effects on the heart and smooth muscle, lens, and brain. The skull, distal limbs, and diaphragm muscles are preferentially affected. Manual dexterity is lost early, resulting in severe disability lasting decades. The median age at death for patients with myotonic dystrophy is 55 years, usually due to respiratory failure (de Die-Smulders CE, et al., Brain 121:1557-1563 (1998)).

[0037] As used herein, the term "operably linked" refers to a first molecule (e.g., a first nucleic acid) linked to a second molecule (e.g., a second nucleic acid). These molecules are positioned so that the first molecule affects the function of the second molecule. The two molecules may or may not be part of a single, adjacent molecule, or the molecules may or may not be adjacent to each other. For example, a promoter is operably linked to a transcribable polynucleotide molecule of interest if the promoter regulates the transcription of the transcribable polynucleotide molecule in a cell. Furthermore, two portions of a transcriptional regulator are operably linked to each other if the transcriptional activation function of one portion is not adversely affected by the presence of the other portion. Two transcriptional regulators may be operably linked to each other via a linker nucleic acid (e.g., an intervening non-coding nucleic acid) or may be operably linked to each other in the absence of intervening nucleotides.

[0038] As used herein, the terms "subject" and "patient" refer to an organism receiving treatment for a particular disease or condition as described herein (e.g., a genetic muscle-wasting disorder such as myotonic dystrophy). Examples of subjects and patients include mammals, such as humans, receiving treatment for a disease or condition as described herein.

[0039] As used herein, the term "treat" or "treatment" refers to therapeutic treatment. In this therapeutic treatment, the purpose is to prevent or slow down (reduce) undesirable physiological changes or disorders, such as the progression of hereditary muscle atrophy disorders, such as myotonic dystrophy, and in particular type I myotonic dystrophy. In the context of treating myotonic dystrophy, the beneficial or desired therapeutic results that refer to successful treatment include, but are not limited to, symptom relief, reduction in the extent of disease, stable disease (i.e., not worsening), delaying or slowing the progression of disease, amelioration or alleviation of disease state, and remission (either partial or total), whether detectable or not.

[0040] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication containing one or more color drawing(s) will be provided by the Office upon request and payment of the necessary fee. The present invention provides, for example, the following items. (Item 1) A nucleic acid, a) a nucleotide sequence encoding a myotonic dystrophy protein kinase (DMPK) RNA that contains at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in any one of SEQ ID NOs: 3-19; b) a nucleotide sequence encoding a DMPK U6 shRNA that contains at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in any one of SEQ ID NOs: 20-24; c) a nucleotide sequence encoding a DMPK U7snRNA that contains at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in any one of SEQ ID NOs: 25-36; d) a nucleotide sequence encoding a DMPK RNA that contains at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in any one of SEQ ID NOs: 37-48; e) DMPK that binds to any one of the sequences set forth in SEQ ID NOs: 37 to 48 nucleotide sequences that encode RNA; f) a DMPK RNA reverse complement sequence that contains at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in any one of SEQ ID NOs: 49-60; g) a reverse complement sequence encoding DMPK U7RNA that contains at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the sequence set forth in any one of SEQ ID NOs: 61-72; and / or h) A nucleic acid comprising any combination of one or more of (a), (b), (c), (d), (e), (f), and / or (g). (Item 2) A viral vector comprising the nucleic acid of item 1. (Item 3) Item 4. The viral vector according to Item 2, wherein the viral vector is an adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, poxvirus, baculovirus, herpes simplex virus, vaccinia virus, or synthetic virus. Item 4. The viral vector according to item 3, wherein the viral vector is AAV. (Item 5) 5. The viral vector of item 4, wherein the AAV is deficient in the rep gene and the cap gene. (Item 6) 6. The viral vector of item 4 or 5, wherein the AAV is a recombinant AAV (rAAV) or a self-complementary recombinant AAV (scAAV). (Item 7) 7. The viral vector of any one of items 4 to 6, wherein the AAV has a capsid serotype selected from the group consisting of AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, and AAVrh.74. (Item 8) 8. The viral vector of any one of items 4 to 7, wherein the AAV has a capsid serotype of AAV-9. (Item 9) 9. The viral vector of any one of items 4 to 8, wherein the AAV is a pseudotyped AAV. (Item 10) Item 10. The viral vector of item 9, wherein the AAV is AAV2 / 8 or AAV2 / 9. (Item 11) 11. A composition comprising the viral vector of any one of items 2 to 10 and a pharmaceutically acceptable carrier. (Item 12) In a cell, the expression of the myotonic dystrophy protein kinase (DMPK) gene is suppressed and / or the expression of this gene is interfered with, or the CUG triplet repeat expansion (CTG) in the 3' untranslated region of the DMPK gene is suppressed. exp 11. A method for interfering with a viral vector comprising contacting said cell with the viral vector of any one of items 4 to 10. (Item 13) 11. A method for treating a subject suffering from myotonic dystrophy (DM), comprising administering to the subject an effective amount of the viral vector of any one of items 4 to 10. (Item 14) Item 14. The method of item 13, wherein the DM is DM1. (Item 15) 1. A method of treating myotonic dystrophy (DM) in a subject in need thereof, comprising administering to the subject an effective amount of a viral vector, wherein the genome of the viral vector comprises: a) Suppression of the expression of exon 5 of the myotonic dystrophy protein kinase (DMPK) gene; b) inhibiting the expression of exon 8 of the DMPK gene; and / or c) a CTG triplet repeat expansion (CTG) in the 3' untranslated region of the DMPK gene exp ), or at least one U6 shRNA polynucleotide and / or at least one U7 snRNA polynucleotide targeted to interfere with untranslated exon 15 of the DMPK gene, or a combination thereof. (Item 16) 16. The method of claim 15, wherein the viral vector is an AAV, adenovirus, lentivirus, retrovirus, poxvirus, baculovirus, herpes simplex virus, vaccinia virus, or synthetic virus. (Item 17) Item 17. The method of item 16, wherein the viral vector is AAV. (Item 18) 18. The method of claim 17, wherein the AAV is deficient in the rep gene and the cap gene. (Item 19) 19. The method of item 17 or 18, wherein the AAV is a recombinant AAV (rAAV) or a self-complementary recombinant AAV (scAAV). (Item 20) 20. The method of any one of paragraphs 17 to 19, wherein the AAV has a capsid serotype selected from the group consisting of AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, and AAVrh.74. (Item 21) 21. The method of any one of items 17 to 20, wherein the AAV has a capsid serotype of AAV-9. (Item 22) 22. The method of any one of items 17 to 21, wherein the AAV is a pseudotyped AAV. (Item 23) 23. The method of item 22, wherein the AAV is AAV2 / 8 or AAV2 / 9. (Item 24) 24. The method of any one of items 15 to 23, wherein the polynucleotide encoding the U6 shRNA comprises a nucleotide sequence comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs: 20 to 24. (Item 25) 25. The method of any one of items 15 to 24, wherein the polynucleotide encoding the U7snRNA comprises a nucleotide sequence comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs: 25-36 and 61-72. (Item 26) 26. The method of any one of items 15 to 25, wherein the DM is DM1. (Item 27) 1. A method of treating myotonic dystrophy (DM) in a subject in need thereof, comprising administering to the subject an effective amount of a viral vector, wherein the genome of the viral vector contains at least one U6 shRNA polynucleotide targeted to suppress expression of exon 5 of the myotonic dystrophy protein kinase (DMPK) gene, at least one U6 shRNA polynucleotide targeted to suppress expression of exon 8 of the DMPK gene, or at least one U6 shRNA polynucleotide targeted to suppress expression of a CUG triplet repeat expansion (CTG) in the 3' untranslated region of the DMPK gene. exp ) or untranslated exon 15 of the DMPK gene. (Item 28) 28. The method of claim 27, wherein the viral vector is an AAV, adenovirus, lentivirus, retrovirus, poxvirus, baculovirus, herpes simplex virus, vaccinia virus, or synthetic virus. (Item 29) 29. The method of item 28, wherein the viral vector is AAV. (Item 30) 30. The method of item 29, wherein the AAV is deficient in the rep gene and the cap gene. (Item 31) 31. The method of item 29 or 30, wherein the AAV is recombinant AAV (rAAV) or self-complementary recombinant AAV (scAAV). (Item 32) 32. The method of any one of paragraphs 29 to 31, wherein the AAV has a capsid serotype selected from the group consisting of AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, and AAVrh.74. (Item 33) 33. The method of any one of items 29 to 32, wherein the AAV has a capsid serotype of AAV-9. (Item 34) 34. The method of any one of items 29 to 33, wherein the AAV is a pseudotyped AAV. (Item 35) 35. The method of item 34, wherein the AAV is AAV2 / 8 or AAV2 / 9. (Item 36) 36. The method of any one of items 27 to 35, wherein the polynucleotide encoding the U6 shRNA comprises a nucleotide sequence comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs: 20 to 24. (Item 37) 37. The method of any one of items 27 to 36, wherein the DM is DM1. (Item 38) 1. A method of treating myotonic dystrophy (DM) in a subject in need thereof, comprising administering to the subject an effective amount of a viral vector, wherein the genome of the viral vector contains at least one U7 snRNA polynucleotide targeted to suppress expression of exon 5 of the myotonic dystrophy protein kinase (DMPK) gene, at least one U7 shRNA polynucleotide targeted to suppress expression of exon 8 of the DMPK gene, or at least one U7 snRNA polynucleotide targeted to suppress expression of exon 8 of the DMPK gene, or a CUG triplet repeat expansion (CTG exp ) or untranslated exon 15 of the DMPK gene. (Item 39) 39. The method of claim 38, wherein the viral vector is an AAV, adenovirus, lentivirus, retrovirus, poxvirus, baculovirus, herpes simplex virus, vaccinia virus, or synthetic virus. (Item 40) 40. The method of item 39, wherein the viral vector is AAV. (Item 41) 41. The method of claim 40, wherein the AAV is deficient in the rep and cap genes. (Item 42) 42. The method of item 40 or 41, wherein the AAV is a recombinant AAV (rAAV) or a self-complementary recombinant AAV (scAAV). (Item 43) 43. The method of any one of paragraphs 40 to 42, wherein the AAV has a capsid serotype selected from the group consisting of AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, and AAVrh.74. (Item 44) 44. The method of any one of items 40 to 43, wherein the AAV has a capsid serotype of AAV-9. (Item 45) 45. The method of any one of items 40 to 44, wherein the AAV is a pseudotyped AAV. (Item 46) 46. ​​The method of item 45, wherein the AAV is AAV2 / 8 or AAV2 / 9. (Item 47) 47. The method of any one of Items 38 to 46, wherein the polynucleotide encoding the U7snRNA comprises a nucleotide sequence comprising at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence set forth in one of SEQ ID NOs: 25-36 and 61-72. (Item 48) 48. The method of any one of items 38 to 47, wherein the DM is DM1. (Item 49) 12. Use of at least one nucleic acid of item 1, the viral vector of any one of items 2 to 10, or the composition of item 11 in treating, ameliorating, and / or preventing myotonic dystrophy (DM) in a subject in need thereof. [Brief explanation of the drawings]

[0041] [Figure 1-1] The sequence of the U6 shRNA construct is shown. [Figure 1-2] The sequence of the U6 shRNA construct is shown. [Figure 1-3] The sequence of the U6 shRNA construct is shown. [Figure 1-4] The sequence of the U6 shRNA construct is shown. [Figure 1-5]The sequences of the U6 shRNA constructs are shown. Figure 1A is U6.sh2577; Figure 1B is U6T6.sh4364-ex8; Figure 1C is U6T6.sh5475-ex5; Figure 1D is U6T6.shD6; and Figure 1E is U6T6.sh2683.

[0042] [Figure 2-1] The U7 snRNA construct is shown. [Figure 2-2] The U7 snRNA construct is shown. [Figure 2-3] The U7 snRNA construct is shown. [Figure 2-4] The U7 snRNA construct is shown. [Figure 2-5] The U7 snRNA construct is shown. [Figure 2-6] The U7 snRNA construct is shown. [Figure 2-7] The U7 snRNA construct is shown. [Figure 2-8] The U7 snRNA construct is shown. [Figure 2-9] The U7 snRNA construct is shown. [Figure 2-10] The U7 snRNA construct is shown. [Figure 2-11] The U7 snRNA construct is shown. [Figure 2-12]U7 snRNA constructs are shown. Figures 2A-2D target exon 5. Figures 2E-2H target exon 8. Figures 2I-2L target the CTG repeat in the 3' UTR. Each of these sequences was designed to disrupt the DMPK reading frame and / or interfere with the repeat expansion of the CTG trinucleotide repeat in the 3' untranslated region of the DMPK gene. Nucleotides highlighted in green represent the snRNA loop. Nucleotides highlighted in green and in italics represent the loop label sequence. Nucleotides highlighted in purple represent the Sm binding site. Nucleotides highlighted in yellow represent the U7 promoter and 3' UTR. Sequences highlighted in gray represent the antisense sequence. Sequences highlighted in red in Figure 2A indicate XbaI and NheI cleavage sites.

[0043] [Figure 3-1] RT-qPCR and Northern blot results are shown. [Figure 3-2] RT-qPCR and Northern blot results are shown. Figure 3A shows RT-qPCR of DMPK expression in total mRNA isolated from DM1 myoblasts treated with recombinant AAV short hairpin RNAs (rAAV.shRNAs) (i.e., 2577, 2685, and DH6.5). shRNAs 2577 and 2683 target the 3' untranslated region of the DMPK gene, while shRNA DH6.5 targets the DMPK coding region. Figure 3B shows Northern blot analysis of total RNA after infection with the indicated AAV.shRNAs, showing a decrease in the expanded DMPK transcript "[CTG]2000." Lane 1, labeled "-ve," represents untreated control cells.

[0044] [Figure 4-1] The various sequence designs are shown. [Figure 4-2] The various sequence designs are shown. [Figure 4-3]The designs of various sequences are shown. Figure 4A shows where an antisense sequence was designed in exon 5 for a disruption in the DMPK sequence (SEQ ID NO: 1 (nucleotide), SEQ ID NO: 2 (amino acid)) for targeting by shRNA and snRNA. Figure 4B shows where an antisense sequence was designed in exon 8 for a disruption in the DMPK sequence (SEQ ID NO: 1 (nucleotide), SEQ ID NO: 2 (amino acid)) for targeting by shRNA and snRNA. Figure 4C shows where an antisense sequence was designed to target the CUG repeat in the 3' untranslated region of the DMPK sequence (SEQ ID NO: 1 (nucleotide), SEQ ID NO: 2 (amino acid)) for targeting by shRNA and snRNA.

[0045] [Figure 5-1] 1 shows the induction of pathological features of DM1 in C57BL / 6J mice (The Jackson Laboratory) after injection of AAV.480CTG. [Figure 5-2]Figure 5B shows the induction of pathological features of DM1 in C57BL / 6J mice (The Jackson Laboratory) after injection of AAV.480CTG. Figure 5A shows that injection of AAV.CTG0 does not induce central nucleation compared to injection of AAV.480CTG (Figure 5B). In mouse skeletal muscle, expression of AAV.CTG480 induces widespread inflammation 2 weeks after injection and the appearance of central nucleation, one of the major pathological changes commonly observed in dystrophic muscle, 4 weeks after injection. Figure 5C shows the splicing changes of differential mRNAs in mouse muscle after administration of AAV.CTG480 compared to the control. RT-PCR on RNA isolated from injected tibialis anterior (TA) muscles 2 weeks after injection of AAV.480CTG or AAV.0CTG revealed alternatively spliced ​​exons for the chloride voltage-gated channel 1 (CLCN1), sarcoplasmic-endoplasmic reticulum calcium transport adenosine triphosphatase (SERCA) 1 (SERCA1), muscle blind-like protein 2 (MBNL2), and insulin receptor (IR or INSR) genes only in AAV.CTG480-injected muscles. These results demonstrate the ability of the AAV.GFP-CTG480 approach to induce DM1 characteristics in muscle in vivo. [Figure 5-3]Figure 5B shows the induction of pathological features of DM1 in C57BL / 6J mice (The Jackson Laboratory) after injection of AAV.480CTG. Figure 5A shows that injection of AAV.CTG0 does not induce central nucleation compared to injection of AAV.480CTG (Figure 5B). In mouse skeletal muscle, expression of AAV.CTG480 induces widespread inflammation 2 weeks after injection and the appearance of central nucleation, one of the major pathological changes commonly observed in dystrophic muscle, 4 weeks after injection. Figure 5C shows the splicing changes of differential mRNAs in mouse muscle after administration of AAV.CTG480 compared to the control. RT-PCR on RNA isolated from injected tibialis anterior (TA) muscles 2 weeks after injection of AAV.480CTG or AAV.0CTG revealed alternatively spliced ​​exons for the chloride voltage-gated channel 1 (CLCN1), sarcoplasmic-endoplasmic reticulum calcium transport adenosine triphosphatase (SERCA) 1 (SERCA1), muscle blind-like protein 2 (MBNL2), and insulin receptor (IR or INSR) genes only in AAV.CTG480-injected muscles. These results demonstrate the ability of the AAV.GFP-CTG480 approach to induce DM1 characteristics in muscle in vivo.

[0046] [Figure 6] Figure 6 shows the sequence and structure of the native mi / shRNA hsa-miR-30a and illustrates how the suppressor mRNA is designed. The native miR-30a mature sequence is replaced by its own sense (blue text) sequence and an antisense (red text) sequence targeting the region of interest. The orange nucleotides are derived from human miR-30a, except for the 3'-terminal polyU, which is added to serve as a termination signal for the PolIII-dependent U6 promoter. The Drosha and Dicer cleavage sites of the native miR-30a are maintained and are indicated by blue and yellow arrows, respectively. The mismatch located immediately upstream of the Drosha cleavage site (-2 position) is maintained for proper processing.

[0047] [Figure 7] The modified U7 snRNA target region of interest is shown. By replacing the wild-type U7 Sm binding site with a consensus sequence derived from the spliceosomal snRNA (U7smOPT; red letters correspond to nucleotide changes between wt sm and smOPT), the resulting RNA is assembled with the seven Sm proteins found in the spliceosomal snRNA. The blue donut-shaped regions correspond to the Lsm proteins that bind to the modified U7, which are important for recruiting splicing factors, allowing for the modulation of specific splicing events.

[0048] [Figure 8] Figure 1 shows downregulation of DMPK expression in human PANC-1 and HEK293 cells by AAV containing DNA encoding short hairpin RNA (rAAV.shRNA) (i.e., 2577 and 2685).

[0049] [Figure 9-1] Figure 1 shows downregulation of hDMPK expression in hemizygous DMSXL mice treated at 4 weeks of age with AAV8 (1.25 x 1011 vg / animal) containing various constructs designed to downregulate or interfere with hDMPK mRNA transcripts. [Figure 9-2] Figure 1 shows downregulation of hDMPK expression in hemizygous DMSXL mice treated at 4 weeks of age with AAV8 (1.25 x 1011 vg / animal) containing various constructs designed to downregulate or interfere with hDMPK mRNA transcripts. [Figure 9-3]Figure 9A shows downregulation of hDMPK expression in hemizygous DMSXL mice treated at 4 weeks of age with AAV8 (1.25 x 10 vg / animal) containing various constructs designed to downregulate or interfere with hDMPK mRNA transcripts. Figure 9A shows the study design. The three constructs listed in the table (PLA1 (SEQ ID NO: 20), PLA3 (SEQ ID NO: 34), and PLA4 (SEQ ID NO: 31)) were each injected intramuscularly (IM) at 1.25 x 10 vg / animal into the left tibialis anterior (TA) muscle of 4-week-old hemizygous DMSXL mice (Hemi). The contralateral leg served as an untreated control. Mice were sacrificed 4 weeks after treatment, and their tissues were collected for RNA expression analysis by RNA sequencing (RNAseq). Figure 9B shows that PLA1 reduced hDMPK RNA expression in treated limbs compared with untreated contralateral limbs as assessed by RNAseq, and Figure 9C shows a 22% reduction in hDMPK levels in the limbs of PLA1-treated TA muscle mice. DETAILED DESCRIPTION OF THE INVENTION

[0050] In some embodiments, the methods and products described herein are used in the treatment of myotonic dystrophy (DM), the most common muscular dystrophy in adults. The present disclosure includes methods and products for the treatment of both DM1 and DM2. Both type I (DM1) and type II (DM2) are autosomal dominant, multisystem disorders with similar clinical manifestations. Clinical symptoms in DM1 and DM2 include progressive muscle weakness, myotonia, elevated CK levels, cardiac conduction defects, and cataracts. In DM2, symptoms are more discordant and highly variable. DM1, at least in some instances, is caused by an expanded (CTG)n repeat sequence (CTG expansion (CTG)) in the 3' untranslated region of a protein kinase (myotonic dystrophy protein kinase (DMPK) gene in exon 15 on chromosome 19q13.3). exp ) is caused by CTG. expThis results in a CUG triplet repeat expansion producing toxic RNA that forms intranuclear foci.

[0051] In some embodiments, the present disclosure includes products and methods for treating DM1. DM1 is the most common form of adult-onset muscular dystrophy, affecting skeletal muscle, heart, brain, skin, eyes, and endocrine system. The prevalence of myotonic dystrophy is estimated to be 1 in 8,000, with higher prevalence reported in Finland and other European countries.

[0052] The DMPK gene encodes a protein of approximately 69.4 kDa (also known as myotonin protein kinase, DM-kinase, DM1 protein kinase, and myotonic dystrophy protein kinase; see UniProtKB-Q09013 (DMPK_HUMAN)) that is required for maintaining skeletal muscle structure and function. DMPK is a serine-threonine kinase closely related to other kinases that interact with members of the Rho family of small GTPases. Substrates for this enzyme include myogenin, the β-subunit of the L-type calcium channel, and phospholemman. The 3' untranslated region of this gene contains approximately 5 to 38 copies of a CTG trinucleotide repeat. Expansion of this unstable motif to 50 to 5,000 copies causes myotonic dystrophy type 1 (DM1), with severity increasing with increasing copy number of the repeat element. Repeat expansion is associated with local chromatin condensation, which disrupts gene expression in this region.

[0053] DMPK is also critical for regulating myocardial contractility and maintaining proper cardiac conduction activity. In some embodiments, a nucleic acid encoding human DMPK is set forth in the nucleotide sequence set forth in SEQ ID NO: 1. In some embodiments, the amino acid sequence of human DMPK is set forth in the amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, mouse DMPK (UniProtKB-P54265) or a nucleic acid sequence encoding mouse DMPK is also used. In various embodiments, the methods of the present disclosure also target isoforms and variants of the nucleotide sequence set forth in SEQ ID NO: 1. In some embodiments, the variants include 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, and 70% identity to the nucleotide sequence set forth in SEQ ID NO: 1. In some embodiments, the methods of the disclosure target isoforms and variants of nucleic acids comprising a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO:2. In some embodiments, the variant comprises 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79%, 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71% and 70% identity to the nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO:2.

[0054] In most people, the number of CTG repeats in this gene ranges from about 5 to 34. People with DM1 have about 50 to 5,000 CTG repeats in most of their cells. The number of repeats may be even higher in certain cell types, such as muscle cells. The size of the trinucleotide repeat expansion correlates with the severity of signs and symptoms. People with classic DM1 characteristics, including muscle weakness and wasting in early adulthood, usually have between 100 and 1,000 CTG repeats. People born with the more severe congenital form of DM1 tend to have a large number of CTG repeats (often greater than 2,000). This form of the condition becomes apparent during infancy and can be associated with life-threatening health problems. The present disclosure includes methods for treating DM1.

[0055] As shown above, mutant DMPK genes produce altered forms of mRNA. These altered mRNAs trap proteins and form aggregates inside cells. These aggregates interfere with the production of many other proteins. For example, secondary RNA structures trap the splicing factor muscleblind-like protein 1 (MBNL1; UniProtKB-Q9NR56(MBNL1_HUMAN)) within these foci and upregulate the CUG-binding protein / Elav-like family protein (CUGBP / CELF1; UniProtKB-Q92879(CELF1_HUMAN)). As a result, adult patients with DM1 demonstrate increased presence of embryonic protein isoforms generated by aberrant splicing, such as sarcoplasmic / sarcoplasmic reticulum calcium adenosine triphosphatase 1 (SERCA1; UniProtKB-O14983 (AT2A1_HUMAN)), chloride voltage-gated channel 1 (CLCN1; UniProtKB-P35523 (CLCN1_HUMAN)), and bridge integrator 1 (BIN1; UniProtKB-O00499 (BIN1_HUMAN)). These alterations disrupt the proper function of muscle cells and cells in other tissues, causing muscle weakness and wasting, as well as other hallmarks of DM1, including cataracts, hypogonadism, defective endocrine function, male pattern baldness, and cardiac arrhythmias.

[0056] In patients with DM1, myotonia / muscle rigidity causes impaired motor control and mobility. Myotonia is one of the most prevalent symptoms in DM1 patients. Various aspects of myotonia can be quantified electrophysiologically by testing muscle hyperexcitability using electromyography (EMG) [Kanadia et al., Science 302(5652):1978-80(2003); Wheeler et al., J. Clin. Invest. 117(12):3952-7(2007); Statland et al., JAMA 308(13):1357-65(2012)].

[0057] The severity of the disease varies with the number of repeats. Mild patients have 50–150 repeats, those with classic DM have 100–1,000 repeats, and congenital cases have more than 2,000 repeats. As the altered DMPK gene is passed from one generation to the next, the size of the CTG repeat expansion often increases. Individuals with approximately 35–49 CTG repeats have not been reported to develop myotonic dystrophy type I; however, their children are at risk for the disorder if the number of CTG repeats increases. Repeat lengths of approximately 35–49 are called premutations.

[0058] Currently, there is no therapeutic treatment for patients suffering from this disease other than symptom management. Furthermore, until now, there has been no animal model that adequately recapitulates the DM1 phenotype, including its multisystemic aspects. The therapeutic approach of the present disclosure delivers an antisense sequence (via inhibitory RNA, including non-coding RNA) to target the CUG triplet repeat expansion (CTG) in the DMPK gene and / or the 3' untranslated region or untranslated exon 15. expThe use of viral vectors such as AAV to knockdown / interfere with the expression of DM1, because this repeat alone causes the formation of foci that trap muscleblind-like protein 1 (MBLN1), mediating pre-mRNA alternative splicing regulation, thereby inducing overexpression of CUG-BP, Elav-like family member 1 (CELF1), a highly conserved RNA-binding protein that regulates pre-mRNA alternative splicing, mRNA translation, and stability. The present disclosure includes such therapeutic approaches for treating DM1.

[0059] The present disclosure includes the use of RNA interference to downregulate DMPK expression and / or downregulate or interfere with the expression of CTG repeats for the purpose of ameliorating and / or treating subjects suffering from DM1 or other disorders resulting from a mutant DMPK gene and consequently altered mRNA. RNA interference (RNAi) is a gene regulation mechanism in eukaryotic cells that has been investigated to treat various diseases. RNAi refers to the post-transcriptional control of gene expression mediated by inhibitory RNA.

[0060] As our understanding of the natural RNAi pathway has progressed, researchers have designed artificial shRNAs and snRNAs for use in regulating target gene expression to treat disease. Several classes of small RNAs are known to trigger the RNAi process in mammalian cells, including short (or small) interfering RNAs (siRNAs), short (or small) hairpin RNAs (shRNAs), and microRNAs (miRNAs), which comprise similar classes of vector-expressed triggers [Davidson et al., Nat. Gene Rev. 12:329-40, 2011; Harper, Arch. Neurol. 66:933-8, 2009]. Because shRNAs and miRNAs are expressed in vivo from plasmid- or virus-based vectors, long-term gene silencing can be achieved with a single administration, as long as the vector is present in the target cell nucleus and the driving promoter is active (Davidson et al., Methods Enzymes. 392:145-73, 2005). Importantly, this vector expression approach builds on decades of progress already made in the field of muscle gene therapy. However, instead of expressing a protein-encoding gene, the vector cargo in the RNAi therapeutic strategy is an artificial shRNA or miRNA cassette targeting the disease gene of interest. This strategy is used to express a native miRNA. Each shRNA / miRNA is based on the hsa-miR-30a sequence and structure. The native miR-30a mature sequence is replaced by unique sense (Figure 6, blue text) and antisense (Figure 6, red text) sequences derived from the target gene. The orange nucleotides are derived from human miR-30a, except for the 3'-terminal polyU, which is added to serve as a termination signal for the PolIII-dependent U6 promoter. The Drosha and Dicer cleavage sites of the native miR-30a are maintained, as indicated by the blue and yellow arrows, respectively. The mismatch located immediately upstream of the Drosha cleavage site (-2 position) must be maintained for proper processing.

[0061] In some embodiments, the disclosed products and methods include short hairpin RNAs or small hairpin RNAs (shRNAs) that negatively affect DMPK expression (e.g., knock down or suppress expression) or interfere with the CUG repeat expansion in the 3' untranslated region of the DMPK gene. Short hairpin RNAs (shRNAs / hairpin vectors) are artificial RNA molecules with tight hairpin turns that can be used to silence target gene expression via RNA interference (RNAi). shRNAs are beneficial mediators of RNAi because they have relatively low rates of degradation and turnover, but they require the use of an expression vector. Once the vector transduces the host genome, the shRNA is then transcribed in the nucleus by polymerase II or polymerase III, depending on the promoter selection. The product mimics a primary microRNA (pri-miRNA) and is processed by Drosha. The resulting pre-shRNA is exported from the nucleus by exportin 5. The product is then processed by Dicer and loaded into the RNA-induced silencing complex (RISC). The sense (passenger) strand is degraded. The antisense (guide) strand directs RISC to mRNA with a complementary sequence. In the case of perfect complementarity, RISC cleaves the mRNA. In the case of imperfect complementarity, RISC blocks translation of the mRNA. In both of these cases, the shRNA causes target gene silencing. In some embodiments, the present disclosure includes the production and administration of AAV vectors expressing DMPK antisense sequences via shRNA. The expression of shRNA is regulated by the use of various promoters. Promoter selection is essential to obtain robust shRNA expression. In various embodiments, polymerase II promoters such as U6 and H1, and polymerase III promoters are used. In some embodiments, U6 shRNA is used.

[0062] In some embodiments, the present disclosure uses U6 shRNA molecules to suppress, knock down, or interfere with gene expression. Conventional small / short hairpin RNA (shRNA) sequences are typically transcribed into the cell nucleus from vectors containing a Pol III promoter, such as U6. The endogenous U6 promoter typically controls the expression of U6 RNA, a small nuclear RNA (snRNA) involved in splicing, and has been well characterized [Kunkel et al., Nature. 322(6074):73-7(1986); Kunkel et al., Genes Dev. 2(2):196-204(1988); Paule et al., Nucleic Acids Res. 28(6):1283-98(2000)]. In some embodiments, the U6 promoter is used to control vector-based expression of shRNA molecules in mammalian cells [Paddison et al., Proc. Natl. Acad. Sci. USA 99(3):1443-8(2002); Paul et al., Nat. Biotechnol. 20(5):505-8(2002)]. This is because (1) the promoter is recognized by RNA polymerase III (polyIII) and controls high-level constitutive expression of shRNAs, and (2) the promoter is active in most mammalian cell types. In some embodiments, the promoter is a type III pol III promoter, in that all factors necessary to control expression of the shRNA are located upstream of the transcription start site (Paule et al., Nucleic Acids Res. 28(6):1283-98(2000)). The present disclosure includes both mouse and human U6 promoters. The shRNA, which contains sense and antisense sequences from the target gene connected by a loop, is transported from the nucleus to the cytoplasm where Dicer processes it into small / short interfering RNAs (siRNAs).

[0063] In some embodiments, the products and methods of the present disclosure include small nuclear RNAs (snRNAs), also commonly referred to as U-RNAs, which influence DMPK expression. snRNAs are a class of small RNAs found within splicing speckles and Cajal bodies in the nucleus of eukaryotic cells. Small nuclear RNAs are associated with a series of specific proteins, and the complexes are called small nuclear ribonucleoproteins (snRNPs, often pronounced "snrps"). Each snRNP particle consists of an snRNA component and multiple snRNP-specific proteins, including Sm proteins, a family of nuclear proteins. snRNAs, along with their associated proteins, form ribonucleoprotein complexes (snRNPs) that bind to specific sequences on pre-mRNA substrates. They are transcribed by either RNA polymerase II or RNA polymerase III. snRNAs are often classified into two classes based on both common sequence features and associated protein factors, such as the RNA-binding LSm proteins. The first class, known as Sm-class snRNA, consists of U1, U2, U4, U4atac, U5, U7, U11, and U12. Sm-class snRNAs are transcribed by RNA polymerase II. The second class, known as Lsm-class snRNA, consists of U6 and U6atac. Lsm-class snRNAs are transcribed by RNA polymerase III and, compared to Sm-class snRNAs, do not leave the nucleus. In some embodiments, the present disclosure includes the production and administration of an AAV vector containing U7 snRNA to deliver a DMPK antisense sequence.

[0064] In some embodiments, the present disclosure uses U7 snRNA molecules to suppress, knockdown, or interfere with gene expression. U7 snRNA is normally involved in histone pre-mRNA 3'-end processing, but in some embodiments, it has been converted into a versatile tool for splicing regulation or as an antisense RNA that is continuously expressed in cells [Goyenvalle et al., Science 306(5702):1796-9(2004)]. By replacing the wild-type U7 Sm binding site with a consensus sequence derived from spliceosomal snRNA, the resulting RNA associates with the seven Sm proteins found within spliceosomal snRNA (Figure 7). As a result, this U7 SmOPT RNA accumulates more efficiently in the nucleocytoplasm and no longer mediates histone pre-mRNA cleavage. However, this U7 SmOPT RNA can still bind to histone pre-mRNA and function as a competitive inhibitor for wild-type U7 snRNP. By further replacing the sequence that binds to downstream histone factors with a sequence complementary to a specific target in the splicing substrate, U7 snRNA can be generated that can regulate specific splicing events. The advantage of using U7 derivatives is that the antisense sequence is embedded within the small nuclear ribonucleoprotein (snRNP) complex. Furthermore, when embedded in gene therapy vectors, these small RNAs can be permanently expressed in target cells after a single injection [Levy et al., Eur. J. Hum. Genet. 18(9):969-70(2010); Wein et al., Hum. Mutat. 31(2):136-42, (2010); Wein et al., Nat. Med. 20(9):992-1000(2014)]. The use of U7 to alter the expression of CUG repeats has been tested in vitro in DM1 patient cell lines [Francois et al., Nat. Struct. Mol. Biol. 18(1):85-7(2011)]. Here, U7 RNA targeting the CUG repeats has been shown to reduce the amount of DMPK-associated foci and correct aberrant splicing patterns.However, this approach was lentivirus-based and was not further pursued in vivo. The potential of the U7 snRNA system in neuromuscular disorders was investigated in vivo using an AAV approach (AAV.U7) [Levy et al., Eur. J. Hum. Genet. 18(9):969-70(2010); Wein et al., Hum. Mutat. 31(2):136-42(2010); Wein et al., Nat. Med. 20(9):992-1000(2014)]. A single injection of this AAV9.U7 targeting the defective RNA in a mouse model of Duchenne muscular dystrophy resulted in long-term correction of the disease in all muscles, including the heart and diaphragm. The ability to target the heart is particularly important given the cardiac abnormalities observed in DM1 patients.

[0065] U7 snRNA is usually involved in histone pre-mRNA 3'-end processing, but it is also used as a flexible tool for splicing regulation or as an antisense sequence that is continuously expressed in cells. One advantage of using U7 derivatives is that the antisense sequence is embedded in small nuclear ribonucleoprotein (snRNP) complexes. Furthermore, when embedded in gene therapy vectors, these small RNAs can be continuously expressed in target cells after a single injection.

[0066] In some embodiments, the present disclosure includes sequences encoding inhibitory RNAs that prevent and suppress expression of the DMPK gene, which contains CTG nucleotide repeats, also known as toxic repeats, in the 3' untranslated region of the DMPK gene. The inhibitory RNAs comprise antisense sequences that suppress expression of exon 5 and / or exon 8 of the DMPK gene and / or interfere with trinucleotide repeat expansions in the 3' untranslated region of the DMPK gene. In some embodiments, the antisense sequence is any of the sequences set forth in any of SEQ ID NOs: 3-19, or a variant sequence comprising at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any of the sequences set forth in any of SEQ ID NOs: 3-19. In some embodiments, the present disclosure includes an antisense sequence set forth in any of SEQ ID NOs: 3-7, or a variant sequence thereof comprising at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any one of the sequences set forth in any of SEQ ID NOs: 3-7, under the control of a U6 promoter. In some embodiments, the present disclosure includes an antisense sequence set forth in any of SEQ ID NOs: 8-19, or a variant sequence thereof comprising at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any one of the sequences set forth in any of SEQ ID NOs: 8-19, under the control of a U7 promoter.

[0067] Representative antisense sequences used within shRNAs to target DMPK or its CUG triplet repeat expansion include: U6.sh2577 Antisense sequence targeting DMPK: CTCGAGTGAGCGAGCCTGCTTACTCGGGAAATTTCTGTAAAGCCACAGATGGGAAATTTCCCGAGTAAGCAGGCACGCCTACTAGA (SEQ ID NO: 3); U6T6.sh4364-ex8 Antisense sequence targeting DMPK: CTCGAGTGAGCGAACCTGCCTTTTGTGGGCTACTCTGTAAAGCCACAGATGGGAGTAGCCCACAAAAGGCAGGTGTGCCTACTAG (SEQ ID NO: 4); U6T6.sh5475-ex5 Antisense sequence targeting DMPK: CTCGAGTGAGCGACGACTTCGGCTCTTGCCTCAACTGTAAAGCCACAGATGGGTTGAGGCAAGAGCCGAAGTCGGTGCCTACTAG (SEQ ID NO: 5); U6T6.shD6 antisense sequence targeting DMPK: CTCGAGTGAGCGAAGGGACGACTTCGAGATTCTGCTGTAAAGCCACAGATGGGCAGAATCTCGAAGTCGTCCCTCCGCCTA (SEQ ID NO: 6); and U6T6.sh2683 Antisense sequences targeting DMPK include, but are not limited to, CTCGAGTGACGATTCGGCGGTTTGGATATTTATCTGTAAAGCCACAGATGGGATAAATATCCAAACCGCCGAAGCGCCTA (SEQ ID NO: 7). The DNA sequences specified above encode RNA antisense sequences for targeting DMPK.

[0068] Representative antisense sequences used within snRNAs to target DMPK or its CUG triplet repeat expansion include: #1 39bp:-2_37 Antisense sequence targeting DMPK: ACAGCGGTCCAGCAGGATGTTGTCGGGTTTGATGTCCCT (SEQ ID NO: 8); #2 49bp:70_+24 Antisense sequence targeting DMPK:TCTGTGGCCAGGGCACTGGCTCACCGTTCCATCTGCCCGCAGCTTGAGG (SEQ ID NO: 9); #3 35bp:62_+2 Antisense sequence targeting DMPK: ACCGTTCCATCTGCCCGCAGCTTGAGGCAAGAGCC (SEQ ID NO: 10); #4 31bp: -61_-31 Antisense sequence targeting DMPK: AATGAACCTCCCTTCTGTGGTCCCACCAGGC (SEQ ID NO: 11); #1 39bp:-5_34 Antisense sequence targeting DMPK: GCGGCGCACCTTCCCGAATGTCCGACAGTGTCTCCTGCG (SEQ ID NO: 12); #2 39bp:27_66 Antisense sequence targeting DMPK: GGAGTAGCCCACAAAAGGCAGGTGGACCCCTAGCGGCGCA (SEQ ID NO: 13); #3 29bp:60_+2 Antisense sequence targeting DMPK: ACCTGAGGGCCATGCAGGAGTAGGAGTAG (SEQ ID NO: 14); #4 39bp:-35_4 Antisense sequence targeting DMPK: TCTCCTGCGCAAGACACACAGATGTGAGCAGCAGTCGTC (SEQ ID NO: 15); U7-15CTG Antisense sequence targeting DMPK: CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 16); U7-20CTG Antisense sequence targeting DMPK: CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 17); U7-5'CTG DMPK-targeting antisense sequence: CAGCAGCAGCAGCAGCAGCAGCATTCCCGGCTACAAGGACC (SEQ ID NO: 18); and U7-3'CTG Antisense sequence targeting DMPK: Examples include, but are not limited to, GAAATGGTCTGTGATCCCCCCAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 19). The DNA sequences specified above encode RNA antisense sequences for targeting DMPK.

[0069] In some embodiments, the present disclosure provides DMPK shRNAs and snRNAs or U-RNAs that suppress or interfere with the expression of the DMPK gene and / or interfere with the trinucleotide repeat expansion in the 3' untranslated region of the DMPK gene. In some embodiments, the shRNAs are driven by or under the control of a human or mouse U6 promoter, i.e., U6 shRNA. In some embodiments, the snRNAs are driven by or under the control of a human or mouse U7 promoter, i.e., U7 snRNA.

[0070] In some embodiments, the present disclosure includes complete constructs (herein a DMPK U6 shRNA polynucleotide or polynucleotide construct and / or a DMPK U7 snRNA polynucleotide or polynucleotide construct) that suppress expression of exon 5 and / or exon 8 of the DMPK gene and / or interfere with a trinucleotide repeat expansion in the 3' untranslated region of the DMPK gene. Thus, the present disclosure provides polynucleotides encoding DMPK U6 shRNA and polynucleotides encoding DMPK U7 snRNA. Representative sequences encoding inhibitory RNAs responsible for sequence-specific gene silencing include, but are not limited to, SEQ ID NOs: 20-36, or variant sequences thereof that contain at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the sequence set forth in any one of SEQ ID NOs: 20-36. In some embodiments, these constructs are combined into a single vector, which is referred to as a combination of a polynucleotide encoding a DMPK U6 shRNA and a polynucleotide encoding a DMPK U7 snRNA.

[0071] Representative sequences used to target DMPK or its CUG triplet repeat expansion include, but are not limited to: U6.sh2577: GACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTTGCGTTTAGTGAACCGTCAGATGGTACCGTTTAAACTCGAGTGAGCGAGCCTGCTTACTCGGGAAATTTCTGTAAAGCCACAGATGGGAAATTTCCCGAGTAAGCAGGCACGCCTACTAGAGCGGCCGCCACAGCGGGGAGATCCAGACATGATAAGATACATTTTTT (SEQ ID NO: 20); U6T6.sh4364-ex8: GACGCCGCCATCTAGGCCCGCCGCCGGCCCCTCGCCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATAATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATAACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTGAAAGTAATTGTGTTTTGAGACTATAAATATCCCTTGGGAAAAGCCTTGTTGCGTTTAGTGAACCGTCAGATGGTACCGTTTAAACTCGAGTGGACGCAACCTGCCTTTTGGGCTACTCTGTAAAGCCACAGTGGGAGTAGCCCACAAAAGGCAGGTGTCCTACTAGCGGCCGCCACAAGCGGGGAGATCCAGACATGATAAGATACATTTTTT(sequence number:21); U6T6.sh5475-ex5: GACGCCGCCATCTAGGCCCGCCGCCGGCCCCTCGCCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATAACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTTTTAAAAAACAGCACAAAAGGAAACTCACCTAACTGTAAAGTAATTGTGTTTTGAGACTATAAATATCCCTTGGGAGAAAAGCCTTGTTTGCGTTAGTGAACCGTCAGATGGTTCCGGTTAAACTCGAGTGAGCGACGACTTCGGCTTGCCTCTAACTGTAAAGCCACAGTGGGTTGAGGCAAGAGCCGAAGTCGGTGCCTACTAGCGGCCGCCACAGCGGGAGATCCAGACATGATAAGATACATTTTTT(sequence number:22); U6T6.shD6: GACGCCGCCATCTAGGCCCGCCGCCGGCCCCTCGCCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATAACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTGAAAGTAATTGTGTTTTGAGACTATAAATATCCCTTGGGAGAAAAGCCTTGTTTTGCGTTTAGTGAACCGTCAGATGGTACCGTTTAAAACCTCGAGTGAGCGAAGGGACGACTTCGAGATTCTGCTGTAAAGCCAGATGGGCAGAATCTCGAAGTCGTCCTCCGCCCTACTAGAGCGCCGCCACAGCGGGAGATCCAGACATGATAAGATACATTTTTT(sequence number:23); U6T6.sh2683: GACGCCGCCATCTAGGCCCGCCGCCGGCCCCTCGCCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATAATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATAACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTTTTAAAAAACAGCACAAAAGGAAACTCACCTAACTGTGAAAGTAATTGTGTTTTGAGACTATAAATATCCCTTGGGAGAAAAGCCTTGTTTTGCGTTTAGTGAACCGTCAGATGGTACCGGTTTTGGATATTTATCTGTAAAGCCAGATGGGATAAATATCCAAACCGCCGAAGCGCCTACTAGAGCGCCGCCACAGCGGGAGATCCAGACATGATAAGATACATTTTTT(sequence number:24); U7EX5#1: GGGTCTAGATAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATTTGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGGTCATCACATATCAGTGGGAGGGTTGTGGAAATGGCACCTTGATCTCACCCCTCATCGAAAGTGGAGTTGGATGTCCTCCCTGCTACAGAGCGCACTTCCGCAAACAGCGGTCCAGCAGGATGTTGTCGGTTTGATGTCCCTAATTTTTGGAGCAGGTTTTCTGACTTCGGTCGGAAACCCCTCCCAATTTCACTGGTCTACAATGAAAGCAAAACAGTTCTCTCCCGCTCCCGGTGTGTGGAGAGGGCTTTGATCCTTCTCTGGTTTCCTAGGAAACGCGTATGTGGCTAGCAAA(sequence number:25); U7EX5#2: GGGTCTAGATAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATTTGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGGTCATCACATATCAGTGGAGGGTGTGGAAATGGCACCTTGATCTCACCCCTCATCGAAAGTGGAGTTGGATGTCCTCCCTGGCTGCTACAGACGCACTTCCGCAATCTGTGGCCAGGGCACTGGCTCACCGTTCCATCTGCCCGCAGCTTGAGGAATTTTTGGAGCAGGTTTTCTGACTTCGGTCGGAAACCCCTCCCAATTTCACTGGTCTACAATGAAAGCAAAACAGTTCTCTCCCGCTCCCGGTGTGTGGAGGGGCTTTTGGATCCTTCTCTGGTTTCCCTAGGAAACGCGTATGTGGCTAGCAAA(sequence number:26); U7EX5#3: GGGTCTAGATAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATTTGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGGTCATCACATATCAGTGGAGGGTGTGGAAATGGCACCTTGATCTCACCCCTCATCGAAAGTGGAGTTGGATGTCCTCCCTGGCTGCTACAGAGCGCACTTCCGCAAACCGTTTCCATCTGCCCGCAGCTTGAGCAAGAGCCAATTTTTGGAGCCAGGTTTTTCTGACTTCGGTCGGAAACCCCTCCCAATTTCACTGGTCTACAATGAAAGCAAAACAGTTCTCTCCCGCTCCCGGTGTGGAGAGGGCTTTGATCCTTCTCTGGTTTCCTAGGAAACGCGTATGTGGCTAGCAAA(sequence number:27); U7EX5#4: GGGTCTAGATAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATTTGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGGTTCCATATCAGTGGAGGGTGTGGAAATGGCACCTTGATCTCACCCCTCATCGAAAGTGGAGTTGGATGTCCTCCCTGGCTGCTACAGAGCACTTCCGCAAAATGAACCTCCTTCTTGTGGTCCCAACGAGGCAATTTTTGGAGCAGGTTTTCTGACTTCGGTCGGAAACCCCTCCCAATTTCACTGGTCTACAATGAAAGCAAAACAGTTCTCTCCCGCTCCCGGTGTGTGGAGAGGGCTTTGATCCTTCTCTGGTTTCCTAGGAAACGCGTATGTGGCTAGCAAA(sequence number:28); U7EX8#1: GGGTCTAGATAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATTTGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGGTCATCACATATCAGTGGAGGGTGTGGAAATGGCACCTTGATCTCACCTCATCGAAAGTGGAGTTGTCCTTCCTGGCTGCTACAGACGCACTTCCGCAAGCGGCGCACCTTCCGAATGTCCGACAGTGTTCTCCTGCGAATTTTTGGAGCAGGTTTTCTGACTTCGGTCGGAAACCCCTCCCAATTTCACTGGTCTACAATGAAAGCAAAACAGTTCTCTCCCGCTCCCGGTGTGTGGAGAGGGCTTTGATCCTTCTCTGGTTTCCTAGGAAACGCGTATGTGGCTAGCAAA(sequence number:29); U7EX8#2: GGGTCTAGATAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATTTGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGGTCATCACATATCAGTGGAGGGTGTGGAAATGGCACCTTGATCTCACCCCTCATCGAAAGTGGAGTTGGATCCTTCCCTGGCTCGCTACAGACGCACTTCCGCAAGGAGTAGCCCACAAAAGGCAGGTGGACCCCTAGCGGCGCAAATTTTTGGAGCAGGTTTTCTGACTTCGGTCGGAAACCCCTCCCAATTTCACTGGTCTACAATGAAAGCAAAACAGTTCTCTCCCGCTCCCGGTGTGTGGAGGGGCTTTGATCCTTCTCTGGTTTCCTAGGGAACGCGTATGTGGCTAGCAAA(sequence number:30); U7EX8#3 GGGTCTAGATAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATTTGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGGTCATCACATATCAGTGGAGGGTGTGGAAATGGCACCTTGATCTCACCCCTCATCGAAAGTGGAGTTGGATGTCCTCCCTGGCTGCTACAGACGCACTTCCGCAAACCTGAGGGCCATGCAGGAGTAGGAGTAGAATTTTTGGAGCAGGTTTTCTGACTTCGGTCGGAAACCCCTCCCAATTTCACTGGTCTACAATGAAAGCAAAACAGTTCTCTCCCGCTCCCCGGTGTTGTGGAGAGGGCTTTGATCCTTCTCTGGTTTCCTAGGAAACGCGTATGTGGCTAGCAAA(sequence number:31); U7EX8#4: GGGTCTAGATAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATTTGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGGTCATCACATATCAGTGGAGGGTGTGGAAATGGCACCTTGATCTCACCCCTCATCGAAAGTGGAGTTGGAGTGTCCCTGCTCGCTACAGAGCACTTCCGCAATCTCCTCGCGCAAGACACACAGATGGAGCAGTCGTCAATTTTTGGAGCAGGTTTTCTGACTTCGGTCGGAAACCCCTCCCAATTTCACTGGTCTACAATGAAAGCAAAACAGTTCTCTCCCGCTCCCGGTGTGTGGAGAGGGCTTTGATCCTTCTCTGGTTTCCTAGGAAACGCGTATGTGGCTAGCAAA(sequence number:32); U7-15CTG: GGGTCTAGATAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATTTGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGGTCATCACATATCAGTGGAGGGTGTGGAAATGGCACCTTGATCTCACCTCATCGAAAGTGGAGTTGGATGTCCTCCTGGCTCGCTACAGACGCACTTCCGCAACAGCAGCAGCAGCAGCAGCAGCAGCAGACAGAATTTTTGGAGCAGGTTTTCTGACTTCGGTCGGAAACCCCTCCCAATTTCACTGGTCTACAATGAAAGCAAAACAGTTCTCTCCCGCTCCCGGTGTGTGGAGGGGCTTTGATCCTTCTCTGGTTTCCTAGGAAACGCGTATGTGGCTAGCAAA(sequence number:33); U7-20CTG: GGGTCTAGATAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATTTGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGTGATTCACATATCAGTGGAGGGGTGTGGAAATGGCACCTTGATCTCACCCTCATCGAAAGTGGAGTTGATGTCCTTCCCTGGCTCGCTACAGACGCACTTCCGCAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGAATTTTTGGAGCAGGTTTTCTGACTTCGGTCGGAAAACCCCTCCCAATTTCACTGGTCTACAATGAAAGCAAAACAGTTCTCTTCCCCGCTCCCCGGTGTGTGAGAGGGGCTTTGATCCTTCTCTGGTTTCCTAGGAAACGCGTATGTGGCTAGCAAA(SEQ ID NO: 34); U7-5’CTG: GGGTCTAGATAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATTTGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGTGATTCACATATCAGTGGAGGGGTGTGGAAATGGCACCTTGATCTCACCCTCATCGAAAGTGGAGTTGATGTCCTTCCCTGGCTCGCTACAGACGCACTTCCGCAACAGCAGCAGCAGCAGCAGCAGCATTCCCGGCTACAAGGACCAATTTTTGGAGCAGGTTTTCTGACTTCGGTCGGAAAACCCCTCCCAATTTCACTGGTCTACAATGAAAGCAAAACAGTTCTCTTCCCCGCTCCCCGGTGTGTGAGAGGGGCTTTGATCCTTCTCTGGTTTCCTAGGAAACGCGTATGTGGCTAGCAAA(SEQ ID NO: 35); and U7-3’CTG: GGGTCTAGATAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATTTGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGTGATTCACATATCAGTGGAGGGGTGTGGAAATGGCACCTTGATCTCACCCTCATCGAAAGTGGAGTTGATGTCCTTCCCTGGCTCGCTACAGACGCACTTCCGCAAGAAATGGTCTGTGATCCCCCCAGCAGCAGCAGCAGCAGCAGAATTTTTGGAGCAGGTTTTCTGACTTCGGTCGGAAAACCCCTCCCAATTTCACTGGTCTACAATGAAAGCAAAACAGTTCTCTTCCCCGCTCCCCGGTGTGTGAGAGGGGCTTTGATCCTTCTCTGGTTTCCTAGGAAACGCGTATGTGGCTAGCAAA(SEQ ID NO: 36). The DNA sequences specified above encode U6 shRNA or U7 snRNA sequences for targeting DMPK.

[0072] In some embodiments, these constructs are 5#1 (or #1 39bp:-2_37), 5#2 (or #2 49bp:70_+24), 5#3 (or #3 35bp:62_+2), 5#4 (#4 31bp:-61_-31), 8#1 (or #1 39bp:-5_34), 8#2 (or #2 39bp:27_66), 8#3 (#3 29bp:60_+2), 8#4 (#4 These four antisense sequences targeting the CUG repeats are designated U6.sh2577, U6T6.sh4364-ex8, U6T6.sh5475-ex5, U6T6.shD6, and U6T6.sh2683. The four antisense sequences targeting the CUG repeats can be combined several times.

[0073] Exemplary DMPK shRNA constructs (i.e., U6shrRNA constructs) are encoded by nucleic acids comprising the nucleotide sequences set forth in SEQ ID NOs: 20-24. Exemplary DMPK snRNA constructs (i.e., U7snRNA) are encoded by nucleic acids comprising the nucleotide sequences set forth in SEQ ID NOs: 25-36.

[0074] In some embodiments, the present disclosure includes target sequences to which U6 shRNA and U7 snRNA are designed to bind. Exemplary target sequences include, but are not limited to, the nucleotide sequences set forth in SEQ ID NOS: 37-48, as set forth below. Targeting exon 5 #1 39bp:-2_37 Target sequence: AGGGACATCAAACCCGACAACATCCTGCTGGACCGCTGT (SEQ ID NO: 37) #2 49bp:70_+24 Target sequence: CCTCAAGCTGCGGGCAGATGGAACGGTGAGCCAGTGCCCTGGCCACAGA (SEQ ID NO: 38) #3 35bp:62_+2 Target sequence: GGCTCTTGCCTCAAGCTGCGGGCAGATGGAACGGT (SEQ ID NO: 39) #4 31bp:-61_-31 Target sequence: GCCTGGTGGGACCACAGAAGGGAGGTTCATT (SEQ ID NO: 40) Targeting exon “8” #1 39bp:-5_34 Target sequence: CGCAGGAGACACTGTCGGACATTCGGGAAGGTGCGCCGC (SEQ ID NO: 41) #2 39bp:27_66 Target sequence: TGCGCCGCTAGGGGTCCACCTGCCTTTTGTGGGCTACTCC (SEQ ID NO: 42) #3 29bp:60_+2: Target sequence: CTACTCCTACTCCTGCATGGCCCTCAGGT (SEQ ID NO: 43) #4 39bp:-35_4 Target sequence: GACGACTGCTGCTCACATCTGTGTGTCTTGCGCAGGAGA (SEQ ID NO: 44) Targeting CTG repeats U7-15CTG Targeted sequence: CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG (SEQ ID NO: 45) U7-20CTG Target sequence: CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG (SEQ ID NO: 46) U7-5'CTG Target sequence: GGTCCTTGTAGCCGGGAATGCTGCTGCTGCTGCTGCTGCTG (SEQ ID NO: 47); and U7-3'CTG Target sequence: CTGCTGCTGCTGCTGCTGCTGGGGGGATCACAGACCATTTC (SEQ ID NO: 48)

[0075] In some embodiments, the present disclosure includes reverse complement sequences that suppress expression of exon 5 and / or exon 8 of the DMPK gene and / or interfere with a trinucleotide repeat expansion in the 3' untranslated region of the DMPK gene. Accordingly, the present disclosure provides DNA sequences encoding the reverse complement sequences and RNA sequences of the reverse complement sequences. Representative sequences include, but are not limited to, SEQ ID NOS: 8-19, 49-60, and 61-72, or variant sequences thereof having at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to a sequence set forth in any one of SEQ ID NOS: 8-19, 49-60, and 61-72. In some embodiments, these sequences are under the control of a U6 or U7 promoter, i.e., see, e.g., SEQ ID NOs:61-72. In some embodiments, one or more copies of these sequences are combined into a single vector.

[0076] In some embodiments, representative DNA and RNA sequences encoding reverse complement sequences were used for targeting DMPK or CUG triplet repeat expansions. Such representative sequences include, but are not limited to, those set forth below: Targeting exon 5 #1 39bp:-2_37: Reverse complement: ACAGCGGTCCAGCAGGATGTTGTCGGGTTTGATGTCCCT (SEQ ID NO: 8) RNA reverse complement sequence: ACAGCGGUCCAGCAGGAUGUUGUCGGGUUUGAUGUCCCU (SEQ ID NO: 49) reverse complementary sequence U7EX5#1:TTTGCTAGCCACATACGCGTTTCCTAGGAAACCAGAGAAGGATCAAAGCCCCTCTCACACACCGGGGAGCGGGGAAGAGAACTGTTTTGCTTTCATTGTAGACCAGTGAAAT TGGGAGGGGTTTTCCGACCGAAGTCAGAAAACCTGCTCAAAAAAATTAGGGACATCAAACCCGACAACATCCTGCTGGACCGCTGTTTGCGGAAGTGCGTCTGTAGCGAGCCAGGGAAGGAC ATCAACTCCACTTTCGATGAGGGTGAGATCAAGGTGCCATTTCCACACCCCTCCACTGATATGTGAATCACAAAGCACAGTTCCTTATTCGGTTCGATAAACAATATTCTAAAAGACTATTAAAACCGCTCGTTTCTTGAGTTTGTGACCGCTTGTAAAGGCTATGCAAATGAGTCAGTGCTGATTGGCTGAAACAGCCAATCACAGCTCCTATGTTGTTATCTAGACCC (SEQ ID NO: 61); #2 49bp:70_+24: Reverse complement sequence: TCTGTGGCCAGGGCACTGGCTCACCGTTCCATCTGCCCGCAGCTTGAGG (SEQ ID NO: 9) RNA reverse complement sequence: UCUGUGGCCAGGGCACUGGCUCACCGUUCCAUCUGCCCGCAGCUUGAGG (SEQ ID NO: 50) Reverse complement sequence U7EX5#2: TTTGCTAGCCACATACGCGTTTCCTAGGAAACCAGAGAAGGATCAAAGCCCCTCTCACACACCGGGGAGCGGGGAAGAGAACTGTTTTGCTTTCATTGTAGACCAGTGAAATTGGGAGGGG TTTTCCGACCGAAGTCAGAAAACCTGCTCCAAAAAATTCCTCAAGCTGCGGGCAGATGGAACGGTGAGCCAGTGCCCTGGCCACAGATTGCGGAAGTGCGTCTGTAGCGAGCCAGGGAAGGA CATCAACTCCACTTTCGATGAGGGTGAGATCAAGGTGCCATTTCCACACCCCTCCACTGATATGTGAATCACAAAGCACAGTTCCTTATTCGGTTCGATAAACAATATTCTAAAAGACTATTAAAACCGCTCGTTTCTTGAGTTTGTGACCGCTTGTAAAGGCTATGCAAATGAGTCAGTGCTGATTGGCTGAAACAGCCAATCACAGCTCCTATGTTGTTATCTAGACCC (SEQ ID NO: 62); #3 35bp:62_+2: Reverse complement sequence: acCGTTCCATCTGCCCGCAGCTTGAGGCAAGAGCC (SEQ ID NO: 10) RNA reverse complement sequence: ACCGUUCCAUCUGCCCGCAGCUUGAGGCAAGAGCC (SEQ ID NO: 51) Reverse complement sequence U7EX5#3: TTTGCTAGCCACATACGCGTTTCCTAGGAAACCAGAGAAGGATCAAAGCCCCTCTCACACACCGGGGAGCGGGGAAGAGAACTGTTTTGCTTTCATTGTAGACCAGTGAAATTGGGAGGGTTTTCCGACCGAAGTCAGAAAACCTGCTCCAAAAATTGGCTCTTGCCTCAAGCTGCGGGCAGATGGAACGGTTTGCGGAAGTGCGTCTGTAGCGAGCCAGGGAAGGACATCAAC TCCACTTTCGATGAGGGTGAGATCAAGGTGCCATTTCCACACCCCTCCACTGATATGTGAATCACAAAGCACAGTTCCTTATTCGGTTCGATAAACAATATTCTAAAAGACTATTAAAACCGCTCGTTTCTTGAGTTTGTGACCGCTTGTAAAGGCTATGCAAATGAGTCAGTGCTGATTGGCTGAAAACAGCCAATCACAGCTCCTATGTTGTTATCTAGACCC (SEQ ID NO: 63); #4 31bp:-61_-31: Reverse complement sequence: AATGAACCTCCCTTCTGTGGTCCCACCAGGC (SEQ ID NO: 11) RNA reverse complement sequence: AAUGAACCUCCCUUCUGUGGUCCCACCAGGC (SEQ ID NO: 52) Reverse complement sequence U7EX5#4: TTTGCTAGCCACATACGCGTTTCCTAGGAAACCAGAGAAGGATCAAAGCCCCTCTCACACACCGGGGAGCGGGGAAGAGAACTGTTTTGCTTTCATTGTAGACCAGTGAAATTGGGAGGGGTTTTCCGACCGAAGTCAGAAAACCTGCTCCAAAAATTGCCTGGTGGGACCACAGAAGGGAGGTTCATTTTGCGGAAGTGCGTCTGTAGCGAGCCAGGGAAGGACATCAACTC CACTTTCGATGAGGGTGAGATCAAGGTGCCATTTCCACACCCCTCCACTGATATGTGAATCACAAAGCACAGTTCCTTATTCGGTTCGATAAACAATATTCTAAAAGACTATTAAAACCGCTCGTTTCTTGAGTTTGTGACCGCTTGTAAAGGCTATGCAAATGAGTCAGTGCTGATTGGCTGAAAACAGCCAATCACAGCTCCTATGTTGTTATCTAGACCC (SEQ ID NO: 64); Targeting exon “8” #1 39bp:-5_34: Reverse complement: GCGGCGCACCTTCCCGAATGTCCGACAGTGTCTCCTGCG (SEQ ID NO: 12) RNA reverse complement sequence: GCGGCGCACCUUCCCGAAUGUCCGACAGUGUCUCCUGCG (SEQ ID NO: 53) Reverse complement sequence U7EX8#1: TTTGCTAGCCACATACGCGTTTCCTAGGAAACCAGAGAAGGATCAAAGCCCCTCTCACACACCGGGGAGCGGGGAAGAGAACTGTTTTGCTTTCATTGTAGACCAGTGAAATTGGGAGGGGTTTTCCGACCGAAGTCAGAAAACCTGCTCCAAAAATTCGCAGGAGACACTGTCGGACATTCGGGAAGGTGCGCCGCTTGCGGAAGTGCGTCTGTAGCGAGCCAGGGAAGGACATC AACTCCACTTTCGATGAGGGTGAGATCAAGGTGCCATTTCCACACCCCTCCACTGATATGTGAATCACAAAGCACAGTTCCTTATTCGGTTCGATAAACAATATTCTAAAAGACTATTAAAACCGCTCGTTTCTTGAGTTTGTGACCGCTTGTAAAGGCTATGCAAATGAGTCAGTGCTGATTGGCTGAAACAGCCAATCACAGCTCCTATGTTGTTATCTAGACCC (SEQ ID NO: 65) #2 39bp:27_66: Reverse complement sequence: GGAGTAGCCCACAAAAGGCAGGTGGACCCCTAGCGGCGCA (SEQ ID NO: 13) RNA reverse complement sequence: GGAGUAGCCCACAAAAGGCAGGUGGACCCCUAGCGGCGCA (SEQ ID NO: 54) Reverse complement sequence U7EX8#2: TTTGCTAGCCACATACGCGTTTCCTAGGAAACCAGAGAAGGATCAAAGCCCCTCTCACACACCGGGGAGCGGGGAAGAGAACTGTTTTGCTTTCATTGTAGACCAGTGAAATTGGGAGGGTTTTCCGACCGAAGTCAGAAAACCTGCTCCAAAAATTTGCGCCGCTAGGGGGTCCACCTGCCTTTTGTGGGCTACTCCTTGCGGAAGTGCGTCTGTAGCGAGCCAGGGAAGGACATC AACTCCACTTTCGATGAGGGTGAGATCAAGGTGCCATTTCCACACCCCTCCACTGATATGTGAATCACAAAGCACAGTTCCTTATTCGGTTCGATAAACAATATTCTAAAAGACTATTAAAACCGCTCGTTTCTTGAGTTTGTGACCGCTTGTAAAGGCTATGCAAATGAGTCAGTGCTGATTGGCTGAAACAGCCAATCACAGCTCCTATGTTGTTATCTAGACCC (SEQ ID NO: 66); #3 29bp:60_+2: Reverse complement sequence: ACCTGAGGGCCATGCAGGAGTAGGAGTAG (SEQ ID NO: 14) RNA reverse complement sequence: ACCUGAGGGCCAUGCAGGAGUAGGAGUAG (SEQ ID NO: 55) Reverse complementary sequence U7EX8#3 TTTGCTAGCCACATACGCGTTTCCTAGGAAACCAGAGAAGGATCAAAGCCCCTCTCACACACCGGGGAGCGGGGAAGAGAACTGTTTTGCTTTCATTGTAGACCAGTGAAATTGGGAGGGTTTTCCGACCGAAGTCAGAAAACCTGCTCCAAAAATTCTACTCCTACTCCTGCATGGCCCTCAGGTTTGCGGAAGTGCGTCTGTAGCGAGCCAGGGAAGGACATCAACTCC ACTTTCGATGAGGGTGAGATCAAGGTGCCATTTCCACACCCCTCCACTGATATGTGAATCACAAAGCACAGTTCCTTATTCGGTTCGATAAACAATATTCTAAAAGACTATTAAAACCGCTCGTTTCTTGAGTTTGTGACCGCTTGTAAAGGCTATGCAAATGAGTCAGTGCTGATTGGCTGAAAACAGCCAATCACAGCTCCTATGTTGTTATCTAGACCC (SEQ ID NO: 67); #4 39bp:-35_4: Reverse complement: TCTCCTGCGCAAGACACACAGATGTGAGCAGCAGTCGTC (SEQ ID NO: 15) RNA reverse complement sequence: UCUCCUGCGCAAGACACACAGAUGUGAGCAGCAGUCGUC (SEQ ID NO: 56) Reverse complement sequence U7EX8#4: TTTGCTAGCCACATACGCGTTTCCTAGGAAACCAGAGAAGGATCAAAGCCCCTCTCACACACCGGGGAGCGGGGAAGAGAACTGTTTTGCTTTCATTGTAGACCAGTGAAATTGGGAGGGGTTTTCCGACCGAAGTCAGAAAACCTGCTCCAAAAATTGACGACTGCTGCTCACATCTGTGTGTCTTGCGCAGGAGATTGCGGAAGTGCGTCTGTAGCGAGCCAGGGAAGGACATCA ACTCCACTTTCGATGAGGGTGAGATCAAGGTGCCATTTCCACACCCCTCCACTGATATGTGAATCACAAAGCACAGTTCCTTATTCGGTTCGATAAACAATATTCTAAAAGACTATTAAAACCGCTCGTTTCTTGAGTTTGTGACCGCTTGTAAAGGCTATGCAAATGAGTCAGTGCTGATTGGCTGAAACAGCCAATCACAGCTCCTATGTTGTTATCTAGACCC (SEQ ID NO: 68); Targeting CTG repeats U7-15CTG: Reverse complement sequence: CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 16) RNA reverse complement sequence: CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 57) Reverse complementary sequence U7-15CTG TTTGCTAGCCACATACGCGTTTCCTAGGAAACCAGAGAAGGATCAAAGCCCCTCTCACACACCGGGGAGCGGGGAAGAGAACTGTTTTGCTTTCATTGTAGACCAGTGAAATTGGGAGGGGTTTTCCGACCGAAGTCAGAAAACCTGCTCCAAAAATTCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGTTGCGGAAGTGCGTCTGTAGCGAGCCAGGGAAGGACA TCAACTCCACTTTCGATGAGGGTGAGATCAAGGTGCCATTTCCACACCCCTCCACTGATATGTGAATCACAAAGCACAGTTCCTTATTCGGTTCGATAAACAATATTCTAAAAGACTATTAAAACCGCTCGTTTCTTGAGTTTGTGACCGCTTGTAAAGGCTATGCAAATGAGTCAGTGCTGATTGGCTGAAACAGCCAATCACAGCTCCTATGTTGTTATCTAGACCC (SEQ ID NO: 69); U7-20CTG: Reverse complement sequence: CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 17) RNA reverse complement sequence: CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 58) Reverse complement sequence U7-20CTG: TTTGCTAGCCACATACGCGTTTCCTAGGAAACCAGAGAAGGATCAAAGCCCCTCTCACACACCGGGGAGCGGGGAAGAGAACTGTTTTGCTTTCATTGTAGACCAGTGAAATTGGGAGGGGTT TTCCGACCGAAGTCAGAAAACCTGCTCAAAAAAATTCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGTTGCGGAAGTGCGTCTGTAGCGAGCCAGG GAAGGACATCAACTCCACTTTCGATGAGGGTGAGATCAAGGTGCCATTTCCACACCCCTCCACTGATATGTGAATCACAAAGCACAGTTCCTTATTCGGTTCGATAAACAATATTCTAAAAGAC TATTAAAACCGCTCGTTTCTTGAGTTTGACCGCTTGTAAAGGCTATGCAAATGAGTCAGTGCTGATTGGCTGAAAACAGCCAATCACAGCTCCTATGTTGTTATCTAGACCC (SEQ ID NO: 70); U7-5'CTG: Reverse complement: CAGCAGCAGCAGCAGCAGCAGCATTCCCGGCTACAAGGACC (SEQ ID NO: 18) RNA reverse complement sequence: CAGCAGCAGCAGCAGCAGCAGCAUUCCCGGCUACAAGGACC (SEQ ID NO: 59) Reverse complement sequence U7-5'ctg: TTTGCTAGCCACATACGCGTTCCTAGGAAACCAGAGAAGGATCAAAGCCCCTCTCACACACCGGGGAGCGGGGAAGAGAACTGTTTTGCTTTCATTGTAGACCAGTGAAATTGGGAGGGTTTTCCGACCGAAGTCAGAAAACCTGCTCCAAAAATTGGTCCTTGTAGCCGGGAATGCTGCTGCTGCTGCTGCTGCTGTTGCGGAAGTGCGTCTGTAGCGAGCCAGGGAAGGACATCA and U7-3'CTG: Reverse complement sequence: GAAATGGTCTGTGATCCCCCCAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 19) RNA reverse complement sequence: GAAAUGGUCUGUGAUCCCCCCAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 60) Reverse complement sequence U7-3'CTG: TTTGCTAGCCACATACGCGTTTCCTAGGAAAACCAGAGAAGGATCAAAGCCCCTCTCCACACACCGGGGAGCGGGGAAGAGACTGTTTTGCTTTCATTGTAGACCAGTGAAATTGGGAGGGGTTTTCCGACCGAAGTCAGAAACCTGCTCCAAAATTCTGCTGCTGCTGCTGCTGGGGGGATCACAGCACCATTTCTGCGGAAGTGCGTCTGTAGCGAGCCAGGAAGGACATCAACTCCACTTTCGATGAGGGTGAGATCAAGGTGCCATTTCCACACCCCTCCCACTGATATGTGGAATCACAAAGCACAGTTCCTTATTCGTTTCGATAAACAATATTCTAAAAGACTATTAAAACCGCTCGTTCTTGAGTTTGTGACGCTTGTAAAGGCTATGCAAATGAGTCAGTGCTGATTGGCTGAAAACACCCAATCACAGCTCTCTATGTTTATCTAGACCC (sequence number: 72).

[0077] In some aspects, the disclosure includes vectors comprising one or more of the nucleotide sequences set forth in any one or more of SEQ ID NOs:3-72, or variant sequences thereof having at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the sequences set forth in any of SEQ ID NOs:3-72. In some aspects, the present disclosure includes vectors comprising one or more combinations or multiple copies of the nucleotide sequence set forth in any one or more of SEQ ID NOs:3-72, or variant sequences thereof having at least about 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to a sequence set forth in any of SEQ ID NOs:3-72. In some aspects, the vector is an AAV vector. In some aspects, the AAV is a recombinant AAV (rAAV). In some aspects, the rAAV lacks the rep and cap genes. In some embodiments, the rAAV is a self-complementary (sc) AAV.

[0078] Embodiments of the present disclosure use vectors (e.g., viral vectors such as adeno-associated virus (AAV), adenovirus, retrovirus, lentivirus, equine-associated virus, alphavirus, poxvirus, herpesvirus, herpes simplex virus, poliovirus, Sindbis virus, vaccinia virus, or synthetic viruses, e.g., chimeric, mosaic, or pseudotyped viruses, and / or viruses containing heterologous proteins, synthetic polymers, nanoparticles, or small molecules) to deliver the nucleic acids described herein.

[0079] In some embodiments, the viral vector is selected from the group consisting of AAV1 (i.e., an AAV comprising AAV1 inverted terminal repeats (ITRs) and AAV1 capsid proteins), AAV2 (i.e., an AAV comprising AAV2 ITRs and AAV2 capsid proteins), AAV3 (i.e., an AAV comprising AAV3 ITRs and AAV3 capsid proteins), AAV4 (i.e., an AAV comprising AAV4 ITRs and AAV4 capsid proteins), AAV5 (i.e., an AAV comprising AAV5 ITRs and AAV5 capsid proteins), AAV6 (i.e., an AAV6 ITRs and AAV6 capsid proteins), AAV7 (i.e., an AAV comprising AAV7 ITRs and AAV7 capsid proteins), AAV8 (i.e., an AAV8 ITRs and AAV8 capsid proteins), AAV9 (i.e., an AAV9 ITRs and AAV9 capsid proteins), AAV10 (i.e., an AAV9 ITRs and AAV9 capsid proteins), AAV11 (i.e., an AAV9 ITRs and AAV10 capsid proteins), AAV12 (i.e., an AAV9 ITRs and AAV12 capsid proteins), AAV13 (i.e., an AAV9 ITRs and AAV13 capsid proteins), AAV14 (i.e., an AAV9 ITRs and AAV14 capsid proteins), AAV15 (i.e., an AAV9 ITRs and AAV15 capsid proteins), AAV16 (i.e., an AAV9 ITRs and AAV16 capsid proteins), AAV17 (i.e., an AAV9 ITRs and AAV17 capsid proteins), AAV18 (i.e., an AAV9 ITRs and AAV18 capsid proteins), AAV19 The AAV may be an AAV such as AAV9 (i.e., an AAV containing AAV9 ITRs and AAV9 capsid proteins), AAVrh.74 (i.e., an AAV containing AAVrh74 ITRs and AAVrh74 capsid proteins), AAVrh.8 (i.e., an AAV containing AAVrh.8 ITRs and AAVrh.8 capsid proteins), AAVrh.10 (i.e., an AAV containing AAVrh.10 ITRs and AAVrh.10 capsid proteins), AAV11 (i.e., an AAV containing AAV11 ITRs and AAV11 capsid proteins), AAV12 (i.e., an AAV containing AAV12 ITRs and AAV12 capsid proteins), or AAV13 (i.e., an AAV containing AAV13 ITRs and AAV13 capsid proteins).

[0080] In some embodiments, the present disclosure uses adeno-associated viruses (AAVs) to deliver inhibitory RNAs targeting DMPK mRNA or CUG repeats, which knock down DMPK and / or toxic RNAs that form nuclear foci. AAVs are replication-deficient parvoviruses, and their single-stranded DNA genomes are approximately 4.7 kb long, including 145 nucleotide inverted terminal repeats (ITRs). There are multiple serotypes of AAVs. The nucleotide sequences of the genomes of the AAV serotypes are known. For example, the complete genome of AAV-1 is provided under GenBank Accession No. NC_002077, the complete genome of AAV-2 is provided under GenBank Accession No. NC_001401 and Srivastava et al., J. Virol., 45:555-564 (1983), the complete genome of AAV-3 is provided under GenBank Accession No. NC_1829, the complete genome of AAV-4 is provided under GenBank Accession No. NC_001829, the AAV-5 genome is provided under GenBank Accession No. AF085716, the complete genome of AAV-6 is provided under GenBank Accession No. NC_001862, and at least portions of the AAV-7 and AAV-8 genomes are provided under GenBank Accession No. NC_001862, respectively. Nos. AX753246 and AX753249 (see also U.S. Patent Nos. 7,282,199 and 7,790,449 relating to AAV-8), the AAV-9 genome is provided in Gao et al., J. Virol., 78:6381-6388 (2004), the AAV-10 genome is provided in Mol. Ther., 13(1):67-76 (2006), and the AAV-11 genome is provided in Virology, 330(2):375-383 (2004). Cis-acting sequences that direct viral DNA replication (rep), encapsidation / packaging, and introduction into host cell chromosomes are contained within the AAV ITRs.Three AAV promoters (designated p5, p19, and p40 for their relative map positions) drive the expression of two AAV internal open reading frames encoding the rep and cap genes. Coupled with differential splicing of a single AAV intron (at nucleotides 2107 and 2227), the two rep promoters (p5 and p19) drive the production of four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene. The rep proteins possess multiple enzymatic properties that ultimately contribute to viral genome replication. The cap gene is expressed from the p40 promoter and encodes three capsid proteins: VP1, VP2, and VP3. Alternative splicing and non-consensus translation initiation sites are responsible for the production of the three related capsid proteins. A single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158:97-129 (1992).

[0081] AAV has unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cells in culture is noncytopathic, and natural infection in humans and other animals is silent and asymptomatic. Furthermore, AAV can infect many mammalian cells, enabling the potential for targeting many different tissues in vivo. Furthermore, AAV can transduce slowly dividing and non-dividing cells and persist essentially for the lifespan of those cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is infectious as cloned DNA in a plasmid, making the construction of recombinant genomes feasible. Furthermore, because signals directing AAV replication, genome encapsidation, and transduction are contained within the ITRs of the AAV genome, part or all of the internal approximately 4.3 kb genome (encoding replication and structural capsid proteins, rep-cap) can be replaced with foreign DNA. The rep and cap proteins can be provided in trans. Another important feature of AAV is that it is an extremely stable and robust virus. It readily tolerates conditions used to inactivate adenovirus (56-65°C for several hours), reducing the importance of cryopreservation of AAV. AAV can be lyophilized, and AAV-infected cells are not resistant to superinfection. In some embodiments, AAV is used to deliver shRNA under the control of the U6 promoter. In some embodiments, AAV is used to deliver snRNA under the control of the U7 promoter. In some embodiments, AAV is used to deliver both snRNA and shRNA under the control of the U7 promoter and the U6 promoter. In some embodiments, AAV is used to deliver both shRNA under the control of the U6 promoter and snRNA under the control of the U7 promoter.

[0082] The recombinant AAV genome of the present disclosure comprises one or more AAV ITRs flanking at least one exon 2-targeting U7 snRNA polynucleotide construct. In some embodiments, including exemplary embodiments, the U7 snRNA polynucleotide comprises its own promoter. The AAV DNA within the rAAV genome may be derived from any AAV serotype from which a recombinant virus can be derived, including, but not limited to, AAV serotypes AAV-anc80, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-rh74, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, and AAV-13. As described in the background section above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art.

[0083] The DNA plasmid of the present disclosure contains the rAAV genome of the present disclosure. The DNA plasmid is transferred to a cell permissive for infection with an AAV helper virus (e.g., adenovirus, E1-deleted adenovirus, or herpesvirus) to assemble the rAAV genome into infectious viral particles. Techniques for producing rAAV particles are standard in the art, in which the AAV genome to be packaged, the rep and cap genes, and helper virus functions are provided to the cell. rAAV production requires the presence of the following components in a single cell (referred to herein as a packaging cell): the rAAV genome, AAV rep and cap genes separated from the rAAV genome (i.e., not present in the rAAV genome), and helper virus functions. The AAV rep gene may be derived from an AAV serotype different from the rAAV genomic ITRs or may be from any AAV serotype from which the recombinant virus is derived, including, but not limited to, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, and AAV-rh.74. In some embodiments, the AAV DNA in the rAAV genome is derived from any AAV serotype from which a recombinant virus can be derived, including, but not limited to, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, and AAV-rh.74. Other types of rAAV variants, such as rAAVs with capsid mutations, are also included in the present disclosure. See, for example, Marsic et al., Molecular Therapy, 22(11):1900-1909 (2014). As described above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art. The use of cognate components is particularly contemplated. The production of pseudotyped rAAV is disclosed, for example, in WO 01 / 83692, which is incorporated herein by reference in its entirety.

[0084] In some embodiments, the viral vector is a pseudotyped AAV comprising ITRs from one AAV serotype and capsid proteins from a different AAV serotype. In some embodiments, the pseudotyped AAV is AAV2 / 9 (i.e., AAV comprising AAV2 ITRs and AAV9 capsid proteins). In some embodiments, the pseudotyped AAV is AAV2 / 8 (i.e., AAV comprising AAV2 ITRs and AAV8 capsid proteins). In some embodiments, the pseudotyped AAV is AAV2 / 1 (i.e., AAV comprising AAV2 ITRs and AAV1 capsid proteins).

[0085] In some embodiments, the AAV comprises a recombinant capsid protein, such as a capsid protein comprising a chimera of one or more capsid proteins from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh74, AAVrh.8 or AAVrh.10.

[0086] In some embodiments, the AAV lacks the rep and cap genes. In some embodiments, the AAV is a recombinant linear AAV (rAAV), a single-stranded AAV, or a recombinant self-complementary AAV (scAAV).

[0087] The recombinant AAV genome of the present disclosure includes, for example, one or more AAV ITRs flanked by polynucleotides encoding one or more myotonic dystrophy protein kinase (DMPK) inhibitory RNAs. Commercial providers such as Ambion Inc. (Austin, TX), Darmacon Inc. (Lafayette, CO), InvivoGen (San Diego, CA), and Molecular Research Laboratories, LLC (Herndon, VA) generates custom inhibitory RNA molecules. In addition, commercially available kits, such as the SILENCER™ siRNA Construction Kit (Ambion Inc., Austin, TX) or the psiRNA System (InvivoGen, San Diego, CA), are available for producing made-to-order siRNA molecules. Embodiments include an rAAV genome comprising a nucleic acid comprising a nucleotide sequence set forth in any of SEQ ID NOS: 25-36.

[0088] The method for generating packaging cells is to create a cell line that stably expresses all the components necessary for AAV particle production: for example, a rAAV genome lacking the AAV rep and cap genes, the AAV rep and cap genes separated from the rAAV genome, and a plasmid (or multiple plasmids) containing a selectable marker such as a neomycin resistance gene are integrated into the cell's genome. The AAV genome can be modified by GC tailing (Samulski et al., 1982, Proc. USA, 79:2077-2081), the addition of synthetic linkers containing restriction endonuclease cleavage sites (Laughlin et al., 1983, Gene, 23:65-73), or direct blunt-end ligation (Senapathy & Carter, 1984, J. Immunol. 2010, 102:101-102). The packaging cell line is then infected with a helper virus, such as adenovirus. The advantage of this method is that the cells are selectable and are suitable for large-scale production of rAAV. Other examples of suitable methods use adenovirus or baculovirus rather than plasmids to introduce the rAAV genome and / or the rep and cap genes into the packaging cells.

[0089] General principles of rAAV production have been reviewed, for example, in Carter, 1992, Current Opinions in Biotechnology, 1533-539; and Muzyczka, 1992, Curr. Topics in Microbial and Immunol., 158:97-129. Various approaches have been described by Ratschin et al., Mol. Biol. 4:2072 (1984); Hermonat et al., Proc. Natl. Acad. Sci. USA, 81:6466 (1984); Tratschin et al., Mol. Cell. Biol. 5:3251 (1985); McLaughlin et al., J. Virol., 62:1963 (1988); and Lebkowski et al., 1988 Mol. Cell. Biol., 7:349 (1988), Virol., 63:3822-3828), U.S. Pat. No. 5,173,414, WO95 / 13365 and corresponding U.S. Pat. No. 5,658,776, WO95 / 13392, WO96 / 17947, PCT / US98 / 18600, WO97 / 09441 (PCT / US96 / 14423), WO97 / 08298 (PCT / US96 / 13872), WO97 / 21825 (PCT / US96 / 20777), W97 / 06243 (PCT / FR96 / 01064), WO99 / 11764, Perrin et al. (1995) Vaccine 13:1244-1250, Paul et al. (1993) Human Gene Therapy 4:609-615, Clark et al. (1996) Gene Therapy 3:1124-1132, U.S. Patents: U.S. Patent Nos. 5,786,211; 5,871,982; and U.S. Patent No. 6,258,595. The foregoing documents are incorporated herein by reference in their entireties, with particular emphasis being placed on the portions of the documents relating to rAAV production.

[0090] Thus, the present disclosure provides packaging cells that produce infectious rAAV. In one embodiment, the packaging cells can be stably transformed cancer cells, such as HeLa cells, 293 cells, and PerC.6 cells (allogeneic 293 cells). In another embodiment, the packaging cells are not transformed cancer cells, such as low-passage 293 cells (human fetal kidney cells transformed with adenovirus E1), MRC-5 cells (human fetal fibroblasts), WI-38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells), and FRhL-2 cells (rhesus fetal lung cells).

[0091] rAAV can be purified by standard methods in the art, such as column chromatography or cesium chloride gradients. Methods for purifying rAAV vectors from helper viruses are known in the art, including, for example, those disclosed in Clark et al., Hum. Gene Ther., 10(6):1031-1039 (1999), Schenpp and Clark, Methods Mol. Med., 69 427-443 (2002), U.S. Patent No. 6,566,118, and WO 98 / 09657.

[0092] In another embodiment, the present disclosure includes a composition comprising an rAAV comprising any of the constructs described herein. In one aspect, the present disclosure includes a composition comprising an rAAV for delivering shRNA and snRNA described herein. The composition of the present disclosure includes an rAAV and a pharmaceutically acceptable carrier. The composition may also include other components, such as a diluent. Acceptable carriers and diluents are nontoxic to recipients and preferably inert at the dosages and concentrations employed, and include buffers such as phosphate, citrate, or other organic acid salts; antioxidants such as ascorbic acid; low molecular weight polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants such as Tween, Pluronic®, or polyethylene glycol (PEG).

[0093] Sterile injectable solution is prepared by incorporating the required amount of rAAV into a suitable solvent, and then sterilizing by filtration, as necessary, with various other components listed above.Generally, dispersion is prepared by mixing sterilized active ingredient into a sterile vehicle that contains a basic dispersion medium and other required components listed above.For the preparation of sterile powder for sterile injectable solution, the preferred method of preparation is vacuum drying and freeze-drying technology, which produces powder of active ingredient plus any additional desired components from the solution that has been previously sterilized and filtered.

[0094] The titer of the rAAV administered in the methods of the present disclosure will vary depending, for example, on the particular rAAV, the mode of administration, the therapeutic goal, the targeted individual, and the cell type(s), and can be determined by standard methods in the art. The titer of the rAAV is approximately 1 x 10 per mL. 6, about 1×10 7 , about 1×10 8 , about 1×10 9 , about 1×10 10 , about 1×10 11 , about 1×10 12 , about 1×10 13 ~Approx. 1×10 14 Dosages can range from units of viral genomes (vg) (e.g., 1 x 10 each) to DNase-resistant particles (DRP) or more. 7 vg, 1×10 8 vg, 1×10 9 vg, 1×10 10 vg, 1×10 11 vg, 1×10 12 vg, 1×10 13 vg and 1 × 10 14 vg).

[0095] In some aspects, the present disclosure provides a method for delivering DNA encoding a DMPK-inhibitory RNA set forth in any of SEQ ID NOs: 20-36 to a subject in need thereof, the method comprising administering to the subject an AAV encoding a DMPK shRNA and snRNA.

[0096] In some aspects, the present disclosure provides AAV-transduced cells for delivery of DMPK shRNA and snRNA.

[0097] The present disclosure includes a method for transducing target cells in vivo or in vitro using rAAV. The method includes administering to a subject an effective amount or multiple effective amounts of a composition comprising an rAAV of the present disclosure, including an animal (e.g., a human) in need thereof. If the dose is administered before the onset of DM-1, the administration is prophylactic. If the dose is administered after the onset of DM-1, the administration is therapeutic. In embodiments of the present disclosure, an effective amount is a dose that alleviates (eliminates or reduces) at least one symptom associated with the DM-1 being treated, delays or prevents progression to DM-1, delays or prevents progression of a disorder / disease state, reduces the extent of the disease, causes disease remission (partial or complete), and / or prolongs survival.

[0098] An effective amount of AAV, rAAV, or one or more compositions comprising AAV, rAAV, or the nucleic acid of the present disclosure can be administered by a route standard in the art, including, but not limited to, intramuscular, parenteral, intravascular, intravenous, oral, buccal, nasal, pulmonary, intracerebral, intraventricular, intraspinal, intraosseous, intraocular, intrarectal, or intravaginal administration. In various embodiments, an effective amount is delivered by a combination of routes. For example, in various embodiments, an effective amount is delivered intravenously and intramuscularly, or intravenously and intraventricularly, or equivalently. In some embodiments, an effective amount is delivered sequentially or sequentially. In some embodiments, an effective amount is delivered simultaneously. The administration route(s) and serotype(s) of the AAV components (particularly the AAV ITRs and capsid proteins) of the rAAV of the present disclosure can be selected and / or adapted by those skilled in the art taking into consideration the infection and / or disease state to be treated and the target cell / tissue(s), such as cells expressing DMPK. In some embodiments, the administration route is intramuscular administration. In some embodiments, the administration route is intravenous administration.

[0099] In particular, the actual administration of the rAAV of the present disclosure can be achieved by using any physical method that delivers the rAAV recombinant vector to the target tissue of an animal. Administration according to the present disclosure includes, but is not limited to, injection into muscle, the bloodstream, the central nervous system, and / or directly into the brain or other organs. Simply resuspending rAAV in phosphate-buffered saline has been demonstrated to be sufficient to provide a vehicle useful for expression in muscle tissue, and there are no known limitations on the carriers or other components that can be co-administered with rAAV (compositions that degrade DNA should be avoided in typical methods involving rAAV). The capsid protein of rAAV may be modified to target the rAAV to a specific target tissue of interest, such as muscle. See, for example, International Publication No. WO 02 / 053703, the disclosure of which is incorporated herein by reference. Pharmaceutical compositions can be prepared as injectable formulations or as local formulations delivered to muscle via transdermal delivery. Numerous formulations for both intramuscular injection and transdermal delivery have been previously developed and may be used in practicing the present disclosure. The rAAV can be used with any pharmaceutically acceptable carrier to facilitate administration and handling.

[0100] For intramuscular injection, solutions in adjuvants such as sesame oil or peanut oil, or aqueous propylene glycol solutions, and sterile aqueous solutions can be used. Such aqueous solutions can be buffered, if necessary, and the liquid diluent is first rendered isotonic with saline or glucose. Solutions of rAAV as a free acid (DNA contains acidic phosphate groups) or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions of rAAV can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, as well as in oils. Under ordinary storage and use conditions, these formulations contain a preservative to prevent the growth of microorganisms. In this regard, all sterile aqueous media employed are readily available by standard techniques well known to those skilled in the art.

[0101] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. In some embodiments, proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0102] Sterile injectable solution is prepared by incorporating the required amount of rAAV into a suitable solvent, and then sterilizing by filtration, as necessary, with various other components listed above.Generally, dispersion is prepared by mixing sterilized active ingredient into a sterile vehicle that contains a basic dispersion medium and other required components listed above.For the preparation of sterile powder for sterile injectable solution, the preferred method of preparation is vacuum drying and freeze-drying technology, which produces powder of active ingredient plus any additional desired components from the solution that has been previously sterilized and filtered.

[0103] The term "transduction" is used to refer to the administration / delivery of a DMPK-inhibitory RNA to a recipient cell, either in vivo or in vitro, via a replication-deficient rAAV of the present disclosure, resulting in expression of the DMPK-inhibitory RNA by the recipient cell.

[0104] In one aspect, transduction using rAAV is carried out in vitro. In one embodiment, the desired target cells are removed from the subject, transduced with rAAV, and then reintroduced into the subject. Alternatively, syngeneic or xenogeneic cells can be used if they do not generate an inappropriate immune response in the subject.

[0105] Suitable methods for transduction and reintroduction of transduced cells into a subject are known in the art. In one embodiment, cells can be transduced in vitro, for example, by combining rAAV with cells in an appropriate medium and screening for cells carrying the DNA of interest using conventional techniques such as Southern blot and / or PCR, or by using a selectable marker. The transduced cells can then be formulated into a pharmaceutical composition, and the composition can be introduced into a subject by various techniques, such as intramuscular, intravenous, subcutaneous, and intraperitoneal injection, or by injection into smooth muscle and cardiac muscle using, for example, a catheter.

[0106] The present disclosure provides methods for administering to a subject in need thereof an effective amount (or substantially simultaneous or spaced doses) of an rAAV encoding an inhibitory RNA, and an rAAV encoding a combination of inhibitory RNAs including shRNA and / or snRNA targeting DMPK.

[0107] Transduction of cells with the rAAV of the present disclosure results in the sustained expression of inhibitory RNA that targets DMPK expression.Therefore, the present disclosure provides a method for administering / delivering rAAV that expresses inhibitory RNA to a subject.The subject is an animal subject, and in some embodiments, the subject is a human.

[0108] These methods include transducing the vasculature, central nervous system, and tissues (including, but not limited to, myocytes and neurons, tissues such as muscle, including skeletal muscle, organs such as the heart, brain, skin, and eye, and the endocrine system and glands, such as endocrine and oral glands) with one or more rAAVs of the present disclosure. In some embodiments, transduction is carried out with a gene cassette comprising tissue-specific regulatory elements. For example, one embodiment of the present disclosure provides a method for the detection of actin and myosin gene families, such as the myoD gene family (see Weintraub et al., Science, 251:761-766 (1991)), muscle cell-specific enhancer-binding factor MEF-2 (Cserjesi and Olson, Mol Cell Biol 11:4854-4862 (1991)), a regulatory element from the human skeletal actin gene (Muscat et al., Mol Cell Biol, 7:4089-4099 (1987)), the cardiac actin gene, and the muscle creatine kinase sequence element (Johnson et al., Mol Cell Biol, 9:3393-3399 (1989)), and regulatory elements derived from the mouse creatine kinase enhancer (mCK) element, the fast-twitch skeletal troponin C gene, the slow-twitch cardiac troponin C gene, and the slow-twitch cardiac troponin I gene: hypoxia-inducible nuclear factor (Semenza et al., Proc. Natl. Acad. Sci. USA, 88:5680-5684 (1991)), steroid-inducible elements and promoters containing glucocorticoid response elements (GREs) (Mader and White, Proc. Natl. Acad. Sci. USA, 90:5603-5607 (1993)), the tMCK promoter [Wang et al., Gene Therapy, 15:1489-1499 (2008)], the CK6 promoter [Wang et al. The present invention provides methods for transducing muscle cells and muscle tissue that are directed by muscle-specific regulatory elements, including, but not limited to, those derived from [see, e.g., [J.S. et al., supra] and other regulatory elements.

[0109] Because AAV targets all organs affected by DM1, the present disclosure includes delivery of DNA encoding an inhibitory RNA to all cells, tissues, and organs of a subject. In some embodiments, the vasculature, central nervous system, muscle tissue, heart, and brain are attractive targets for in vivo DNA delivery. The present disclosure includes sustained expression of shRNAs and / or snRNAs from transduced cells that affect DMPK expression (e.g., knockdown or suppression of expression) or interfere with the CUG repeat expansion in the 3' untranslated region of the DMPK gene. In some embodiments, the present disclosure includes sustained expression of shRNAs and / or snRNAs from transduced muscle fibers. "Muscle cell" or "muscle tissue" refers to a cell or group of cells derived from any type of muscle (e.g., skeletal muscle and smooth muscle from, e.g., the gastrointestinal tract, bladder, blood vessels, or cardiac tissue). In some embodiments, these muscle cells may or may not be differentiated into myoblasts, myocytes, myotubes, cardiomyocytes, and cardiomyoblasts, etc.

[0110] In yet another embodiment, the disclosure provides a method for preventing or suppressing expression of the DMPK gene in a cell, comprising contacting the cell with an rAAV encoding a DMPK shRNA and snRNA, wherein the RNA is encoded by a DNA set forth in SEQ ID NOs: 20-36. In some aspects, DMPK expression is suppressed by at least about 5 percent, about 10 percent, about 15 percent, about 20 percent, about 25 percent, about 30 percent, about 35 percent, about 40 percent, about 45 percent, about 50 percent, about 55 percent, about 60 percent, about 65 percent, about 70 percent, about 75 percent, about 80 percent, about 85 percent, about 90 percent, about 95 percent, about 96 percent, about 97 percent, about 98 percent, about 99 percent, or about 100 percent. In some embodiments, expression of the CTG repeat number is inhibited by at least about 5 percent, about 10 percent, about 15 percent, about 20 percent, about 25 percent, about 30 percent, about 35 percent, about 40 percent, about 45 percent, about 50 percent, about 55 percent, about 60 percent, about 65 percent, about 70 percent, about 75 percent, about 80 percent, about 85 percent, about 90 percent, about 95 percent, about 96 percent, about 97 percent, about 98 percent, about 99 percent, or about 100 percent.

[0111] In yet another aspect, the present disclosure provides a method for preventing or treating myotonic dystrophy (including, but not limited to, DM1 and / or DM2) comprising administering to a subject an AAV encoding a DMPK shRNA and snRNA. The shRNA and snRNA are encoded by any one of the polynucleotides set forth in SEQ ID NOs: 20-36. In some aspects, the AAV is a recombinant AAV (rAAV). In some aspects, the rAAV lacks the rep and cap genes. In some embodiments, the rAAV is a self-complementary (sc) AAV.

[0112] "Treatment" includes reversing or suppressing one or more symptoms of myotonic dystrophy (including, but not limited to, muscle wasting, muscle weakness, myotonia, skeletal muscle problems, abnormal heart function, difficulty breathing, cataracts, speech and swallowing problems (dysarthria and dysphagia), cognitive impairment, excessive daytime sleepiness, or symptoms of diabetes).

[0113] Molecular, biological, histological, and functional endpoints demonstrate the therapeutic efficacy of DMPK shRNAs and snRNAs. Endpoints contemplated by the present disclosure include one or more of the following: reduction or elimination of DMPK protein expression; reduction or elimination of CTG repeats (i.e., toxic repeats) that interfere with protein function in the nucleus; and / or restoration of normal gene splicing patterns in genes including, but not limited to, CLCN (and CLCN1, CLCN2, CLCN3, CLCN4, CLCN5, CLCN6, etc.), BIN1, SERCA-1, MLBN1, MLBN2, and IR; and / or reduction in the expression of CELF1 and MBLN1; and / or reduction or elimination of myotonic dystrophy symptoms, including, but not limited to, a reduction in the number of nuclear foci or CUG foci (including foci that trap genes such as MBLN1) or a reduction in centronucleation; and recovery of muscle hyperexcitability as assessed using electromyography.

[0114] The present disclosure also provides a novel adeno-associated virus (AAV)-induced mouse model of DM1. The inducible multilineage mouse model of DM1 (iDM1) is a virulent CTG mouse model using an AAV viral vector. expThis model was generated by delivering the DM1 repeat (in the context of human DMPK exon 15) to mice. The reason for this was that AAV targets all organs affected by DM1. This allows for an inducible model, eliminating the need for complex and inefficient mouse breeding. Because the toxic repeats are expressed in their natural context, this model was designed to fully recapitulate the DM1 phenotype for use in rapidly evaluating DM1 therapeutics without the challenges encountered with transgenic breeding.

[0115] To generate the iDM1 model, we first confirmed in vitro that expression of human DMPK exon 15 containing the 480 CTG repeat and a GFP tag (i.e., "GFP-CTG480") could accumulate in the cell nucleus and form foci that likely capture muscleblind-like protein 1 (MBLN1), which is found in DM1 patients. A control containing only human DMPK exon 15 and a GFP tag (without CTG repeats) (i.e., "GFP-CTG0") was used to confirm that toxicity was not related to the construct backbone. MBLN1 is highly expressed in myogenic cells, and a specialized human fibroblast cell line (C19GSK_htMyoD) was used to perform this experiment. This cell line has the ability to transdifferentiate into myogenic cells because it was infected with a lentivirus encoding the myogenic differentiation (MyoD) gene, a master gene for myogenesis. Ninety-six hours after infection, the GFP-CTG480 construct was able to alter the splicing patterns of bridging integrator 1 (BIN1) and insulin receptor (INSR), two genes that are misspliced ​​in the absence of MBLN1.

[0116] To evaluate whether this construct could induce the DM1 phenotype in vivo, the CMV.GFP-CTG480 construct was packaged into AAV (i.e., "AAV6.GFP-CTG480"), and AAV6.GFP-CTG480 was injected intramuscularly into 4-week-old wild-type mice. Two different doses (3e10 and 1e11 viral genomes (vg) per animal) were used. Four weeks after injection, AAV6.GFP-CTG480 was able to induce DM1 hallmarks, including nuclear foci formation, alterations in BIN1 and sarcoplasmic / sarcoplasmic calcium adenosine triphosphatase 1 (SERCA1) splicing, and nuclear colocalization of MBNL-1 with toxic RNA repeats. The formation of this AAV-induced mouse model, as described herein, provides a useful tool for more effectively evaluating relevant and promising DM1-directed therapeutic approaches in vivo. [Example]

[0117] Example Aspects and embodiments of the present disclosure are illustrated by the following examples.

[0118] Example 1 Mouse model of DM1 The objective of the experiments in this example was to generate and evaluate an inducible multilineage mouse model of DM1 (iDM1) to conduct studies without the difficulties encountered with transgenic breeding. To generate this model, a toxic CTG gene was inserted within the context of human DMPK exon 15 (5E11vg). exp AAV viral vectors expressing the repeats were injected intramuscularly into both tibialis anterior (TA) muscles of groups of 4-week-old male and female C57BL / 6 mice. Because the repeats are expressed in their natural context and AAV targets all organs affected by DM1, this model should fully recapitulate the DM1 phenotype.

[0119] Expression of human DMPK exon 15 (i.e., GFP-CTG480), containing 480 CTG repeats and a green fluorescent protein (GFP) tag, was confirmed in vitro to accumulate in the nucleus and form foci capable of trapping MBLN1, as seen in DM1 patients. A control construct containing DMPK exon 15, GFP-CTG0, was used to confirm that toxicity was not related to the construct backbone. MBLN1 is significantly expressed in myogenic cells, and a special human fibroblast cell line (i.e., C19GSK_htMyoD) was used. This cell line has the ability to transdifferentiate into myogenic cells after infection with a lentivirus encoding MyoD, a master gene for myogenesis. 96 hours after infection, the GFP-CTG480 construct was able to alter the splicing patterns of the bridging integrator 1 (Bin1) gene and the insulin receptor (IR) gene; these two genes were misspliced ​​in the absence of muscleblind-like 1 (MBNL1), confirming the expected results.

[0120] To evaluate whether this construct could induce the DM1 phenotype in mice in vivo, the CMV.GFP-CTG480 construct was packaged into AAV (AAV6.GFP-CTG480) and injected intramuscularly into the TA muscle of male and female C57BL / 6 wild-type mice at 4 weeks of age. Two different doses (3e10 and 1e11 viral genomes (vg) per animal) were used. As shown in Figure 5A, 4 weeks after injection, the AAV6.GFP-CTG480 vector was able to induce DM1 characteristics in the AAV6-induced mouse model, including central nucleation and altered splicing of multiple genes, including chloride channel protein, skeletal muscle (CLCN) and sarcoplasmic / sarcoplasmic reticulum calcium adenosine triphosphatase 1 (SERCA-1), muscleblind-like 2 (MBNL2), and insulin receptor (IR). Because splicing alterations of these genes are a common feature associated with DM1 in patients, as described herein above, these results demonstrate the ability of the AAV.GFP-CTG480 approach to induce DM1 characteristics in muscle in vivo. Thus, this example provides a novel inducible multisystem mouse model of DM1 (iDM1).

[0121] Example 2 Systemic delivery of repeat expansion in a mouse model of DM1 The purpose of this experiment is to observe the effects of systemic intravenous delivery of an AAV9 construct containing inhibitory DMPK RNA targeting the central nervous system (CNS), including the heart and diaphragm, and all muscles. Because DM1 is a multisystem disorder, an approach that can efficiently and simultaneously express CUG toxic repeats in multiple affected organs would be of great value. AAV9.CTG0 and AAV9.CTG480 vectors are delivered systemically via facial vein injection using 5E11vg / animal into the facial vein of both male and female neonatal animals (n=10) at postnatal days 1–2 (P1–P2). Ten PBS-injected mice serve as controls. Evaluations are performed in a blinded manner by an individual experimenter not involved in the injection procedure.

[0122] Four and 12 weeks after injection with the AAV9 construct, the TAs of these mice were analyzed using electromyography (EMG), force measurements, and evaluated for splicing alterations in a blinded, randomized fashion. Because myotonic dystrophy is one of the most common symptoms in DM1 patients, myotonic dystrophy was electrophysiologically quantified by testing muscle hyperexcitability using electromyography (EMG) [Kanadia et al., Science 302(5652):1978-80(2003); Wheeler et al., J. Clin. Invest. 603-604(2001); Statland et al., JAMA 308(13):1357-65(2012)]. Myotonic potentials in EMG are recorded from the TA muscle and quantified by blinded evaluators using experiments on clinical EMG assessment of myotonia in DM1 patients [Kanadia (supra); Wheeler et al. (supra); Statland et al. (supra)]. The severity of myotonia by EMG is used as a simple translational readout to identify the onset of the DM1 phenotype. In addition, muscle strength assessment tests are performed. Isometric muscle strength (providing a strength assessment) and eccentric contraction (assessing sarcolemmal stability) are also measured in ex vivo TA preparations. Test results indicate the presence of myotonia in this animal model after viral delivery of virulent repeats.

[0123] Additionally, splicing alterations of BIN1, SERCA1, IR, and CLCN1, genes whose splicing patterns are regulated by MBLN-1, were examined by RT-PCR. Aberrant splicing of BIN1, SERCA1, IR, and CLCN1 was present in mice transduced with the CUG toxic repeat. The number of nuclear CUG foci was counted, and fluorescent in situ hybridization (FISH) was performed to determine whether these foci colocalized with MBLN-1. CUG foci capture MBLN1 in DM1 and mice transduced with the CUG toxic repeat.

[0124] Because CELF-1 is overexpressed in DM1, Western blot detection of CELF1 was performed on harvested muscle homogenates using anti-CELF1 monoclonal antibody (Santa Cruz Biotechnologies) and anti-GAPDH antibody (Abcam) as loading control proteins. CELF-1 is overexpressed in mice transduced with the CUG toxic repeat.

[0125] Histology is performed to measure fiber size and confirm the presence of centrally nucleated fibers. In addition to the TA, other muscles are collected for histology, including at least the gastrocnemius, triceps, heart, diaphragm, and brain.

[0126] Because AAV9 transduces both skeletal and cardiac muscle, we predict nuclear accumulation of toxic RNAs within multiple skeletal muscles and the heart, causing splice alterations with potential myotonia. Similarly, because AAV9 can cross the blood-brain barrier and target neurons, we predict neurotransmission defects.

[0127] Example 3 DMPK-specific U6 shRNA construct This example provides the sequences of U6 shRNA constructs specific for targeting DMPK. These constructs were synthesized and cloned into pAAV shuttle plasmids. Antisense target sequences were predicted using "design rules" [Schwartz et al., Cell 115(2):199-208 (2003); Khvorova et al., Nature 115:209-16 (2003); Reynolds et al., Nat. Biotechnol. 22:326-30 (2004); Li et al., RNA 13:1765-74 (2007)]. The underlined nucleotide sequence at the 5' end of the construct encodes the mouse U6 promoter. The bolded nucleotide sequence encodes the short hairpin RNA. The underlined nucleotide sequence at the 3' end of the construct encodes the U6 terminator.

[0128] >U6.sh2577 [ka] U6.sh2577 Antisense sequence targeting DMPK: CTCGAGTGAGCGAGCCTGCTTACTCGGGAAATTTCTGTAAAGCCACAGATGGGAAATTTCCCGAGTAAGCAGGCACGCCTACTAGA (SEQ ID NO: 3)

[0129] >U6T6.sh4364-ex8 [ka] [ka] U6T6.sh4364-ex8 Antisense sequence targeting DMPK: CTCGAGTGAGCGAACCTGCCTTTTGTGGGCTACTCTGTAAAGCCACAGATGGGAGTAGCCCACAAAAGGCAGGTGTGCCTACTAG (SEQ ID NO: 4)

[0130] >U6T6.sh5475-ex5 [ka] U6T6.sh5475-ex5 Antisense sequence targeting DMPK: CTCGAGTGAGCGACGACTTCGGCTCTTGCCTCAACTGTAAAGCCACAGATGGGTTGAGGCAAGAGCCGAAGTCGGTGCCTACTAG (SEQ ID NO: 5)

[0131] >U6T6.shD6 [ka] U6T6.shD6 Antisense sequence targeting DMPK: CTCGAGTGAGCGAAGGGACGACTTCGAGATTCTGCTGTAAAGCCACAGATGGGCAGAATCTCGAAGTCGTCCCTCCGCCTA (SEQ ID NO: 6)

[0132] >U6T6.sh2683 [ka] U6T6.sh2683 Antisense sequence targeting DMPK: CTCGAGTGACGATTCGGCGGTTTGGATATTTATCTGTAAAGCCACAGATGGGATAAATATCCAAACCGCCGAAGCGCCTA (SEQ ID NO: 7)

[0133] Example 4 U6shRNA knocking down DMPK mRNA expression This example describes experiments performed to determine whether U6 shRNA can be used to interfere with the expression of toxic DMPK mRNA. AAV was used to deliver shRNA targeting DMPK mRNA or the CUG repeat itself. The sequences of the U6 shRNA constructs used in these experiments are provided above in Example 3 and Figures 1A-1E.

[0134] AAV vectors containing shRNAs targeting human DMPK RNA (sh2577, sh2683) under the control of the U6 promoter were constructed. These antisense RNAs target the 3' untranslated region of DMPK RNA. As a control, established targets against the DMPK coding region (shRNA DH6.5 or shDH6.5) [Sobczak et al., Mol. Ther. 21(2):380-7(2013)] were used. Human DM1 primary fibroblasts (GM03132, Coriell) were used to evaluate the ability of these shRNAs to knockdown DMPK.

[0135] Because MBLN1 is expressed more abundantly in myogenic cells, fibroblasts were converted to myogenic cells using a lentivirus expressing MyoD. Cells were seeded at 30% confluency in 12-well plates, with the cells reaching approximately 50% confluency the next day. For lentiviral transduction, 2–5e9 vg / mL of each lentivirus (htert-puromycin and doxycycline-inducible Myo-D-hygromycin) was added to 400 μL of growth medium. 1 mL of medium was added the following day. After 1–2 days, cells were seeded into 6-well plates and grown to 70% confluency. At this point, the growth medium was supplemented with 400 μg / mL hygromycin and 1 μg / mL puromycin. Cells were maintained under selection pressure for at least 12 days. Medium was changed every 2–3 days. 10 cm dishes were coated with laminin (0.5 mg / ml stock solution in TBS, pH 7.4; 100 μg / ml working solution in HBSS). After adding the appropriate amount of laminin, the dishes were incubated at 37°C for 2 hours. The dishes were then rinsed three times with PBS. Fibroblasts were seeded onto the 10 cm laminin-coated dishes at 50% maximum confluency. To induce myogenic cells, when the fibroblasts reached 70% confluency, the medium was replaced with myogenic medium (supplemented with freshly prepared 4 μg / mL doxycycline). After 2–3 days, the cells were 90–95% confluent and their morphology had changed. The medium was replaced with differentiation medium (supplemented with freshly prepared 4 μg / mL doxycycline).

[0136] Induced DM1 myoblasts were then transduced with AAV.U6.shRNA (sh2577, sh2683, or shDH6.5) vectors. shRNAs 2577 and 2683 target the 3' untranslated region of the DMPK gene, while shRNA DH6.5 targets the DMPK coding region. Two days after infection, cells were subjected to RT-qPCR and Northern blot assays. Both assays confirmed that RNA expression of the toxic DMPK transcript was reduced. RT-qPCR of DMPK expression in total mRNA isolated from DM1 myoblasts treated with rAAV.shRNAs demonstrated that shRNAs (2683, 2577, and DH6.5) were able to reduce DMPK expression (Figure 3A). Northern blot analysis of total RNA after infection with the indicated AAV.shRNAs confirmed a reduction in the expanded DMPK transcript, "[CTG]2000" (Figure 3B). These experiments demonstrate that both U6 shRNA constructs, sh2577 and sh2683, were able to efficiently knock down DMPK transcripts in myogenic cells.

[0137] Example 5 DMPK-specific U7snRNA construct This example provides sequences of U7snNA constructs specifically designed to cleave the DMPK reading frame, including identification of the targeted and reverse complement sequences. Four sequences were designed to target exon 5 (Figure 2A-D), four sequences were designed to target exon 8 (Figure 2E-H), and four sequences were designed to target the CTG repeat in the untranslated exon 15 (Figure 2I-L) of the DMPK gene. These constructs were synthesized and cloned into the pAAV shuttle plasmid. Antisense target sequences were predicted using the Human Splicing Finder website (www.umd.be / HSF3 / ) [Desmet et al., Nucleic Acids Res. 37(9):E67(2009)].

[0138] Targeting exon 5

[0139] #1 39bp:-2_37 Target sequence: AGGGACATCAAACCCGACAACATCCTGCTGGACCGCTGT (SEQ ID NO: 37) Reverse complement sequence: ACAGCGGTCCAGCAGGATGTTGTCGGGTTTGATGTCCCT (SEQ ID NO: 8) [ka] #1 39bp:-2_37 Antisense sequence targeting DMPK: ACAGCGGTCCAGCAGGATGTTGTCGGGTTTGATGTCCCT (SEQ ID NO: 8)

[0140] #2 49bp:70_+24 Target sequence: CCTCAAGCTGCGGGCAGATGGAACGGTGAGCCAGTGCCCTGGCCACAGA (SEQ ID NO: 38) Reverse complement sequence: TCTGTGGCCAGGGCACTGGCTCACCGTTCCATCTGCCCGCAGCTTGAGG (SEQ ID NO: 9) [ka] #2 49bp:70_+24 Antisense sequence targeting DMPK:TCTGTGGCCAGGGCACTGGCTCACCGTTCCATCTGCCCGCAGCTTGAGG (SEQ ID NO: 9)

[0141] #3 35bp:62_+2 Target sequence: GGCTCTTGCCTCAAGCTGCGGGCAGATGGAACGgt (SEQ ID NO: 39) Reverse complement sequence: acCGTTCCATCTGCCCGCAGCTTGAGGCAAGAGCC (SEQ ID NO: 10) [ka] #3 35bp:62_+2 Antisense sequence targeting DMPK: ACCGTTCCATCTGCCCGCAGCTTGAGGCAAGAGCC (SEQ ID NO: 10)

[0142] #4 31bp:-61_-31 Target sequence: gcctggtgggaccacagaagggaggttcatt (SEQ ID NO: 40) Reverse complement sequence: aatgaacctcccttctgtggtcccaccaggc (SEQ ID NO: 11) [ka] [ka] #4 31bp: -61_-31 Antisense sequence targeting DMPK: AATGAACCTCCCTTCTGTGGTCCCACCAGGC (SEQ ID NO: 11)

[0143] Targeting exon “8”

[0144] #1 39bp:-5_34 Target sequence: CGCAGGAGACACTGTCGGACATTCGGGAAGGTGCGCCGC (SEQ ID NO: 41) Reverse complement sequence: GCGGCGCACCTTCCCGAATGTCCGACAGTGTCTCCTGCG (SEQ ID NO: 12) [ka] #1 39bp:-5_34 Antisense sequence targeting DMPK: GCGGCGCACCTTCCCGAATGTCCGACAGTGTCTCCTGCG (SEQ ID NO: 12)

[0145] #2 39bp:27_66 Target sequence: TCGCCGCTAGGGGTCCACCTGCCTTTTGTGGGCTACTCC (SEQ ID NO: 42) Reverse complement sequence: GGAGTAGCCCACAAAAGGCAGGTGGACCCCTAGCGGCGCA (SEQ ID NO: 13) [ka] [ka] #2 39bp:27_66 Antisense sequence targeting DMPK: GGAGTAGCCCACAAAAGGCAGGTGGACCCCTAGCGGCGCA (SEQ ID NO: 13)

[0146] #3 29bp:60_+2: Target sequence: CTACTCCTACTCCTGCATGGCCCTCAGgt (SEQ ID NO: 43) Reverse complement sequence: acCTGAGGGCCATGCAGGAGTAGGAGTAG (SEQ ID NO: 14) [ka] #3 29bp:60_+2 Antisense sequence targeting DMPK: ACCTGAGGGCCATGCAGGAGTAGGAGTAG (SEQ ID NO: 14)

[0147] #4 39bp:-35_4 Target sequence: gacgactgctgctcacatctgtgtgtcttgcgcagGAGA (SEQ ID NO: 44) Reverse complement sequence: TCTCctgcgcaagacacacagatgtgagcagcagtcgtc (SEQ ID NO: 15) [ka] #4 39bp: -35_4 Antisense sequence targeting DMPK: TCTCCTGCGCAAGACACACAGATGTGAGCAGCAGTCGTC (SEQ ID NO: 15)

[0148] Targeting CTG repeats

[0149] >U7-15CTG Targeted sequence: CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG (SEQ ID NO: 45) Reverse complement sequence: CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 16) [ka] U7-15CTG Antisense sequence targeting DMPK: CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 16)

[0150] >U7-20CTG Target sequence: CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG (SEQ ID NO: 46) Reverse complement sequence: CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 17) [ka] U7-20CTG Antisense sequence targeting DMPK: CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 17)

[0151] >U7-5'CTG Target sequence: GGTCCTTGTAGCCGGGAATGCTGCTGCTGCTGCTGCTGCTG (SEQ ID NO: 47) Reverse complement sequence: CAGCAGCAGCAGCAGCAGCAGCATTCCCGGCTACAAGGACC (SEQ ID NO: 18) [ka] U7-5'CTG Antisense sequence targeting DMPK: CAGCAGCAGCAGCAGCAGCAGCATTCCCGGCTACAAGGACC (SEQ ID NO: 18)

[0152] >U7-3'CTG Target sequence: CTGCTGCTGCTGCTGCTGCTGGGGGGATCACAGACCATTTC (SEQ ID NO: 48) Reverse complement sequence: GAAATGGTCTGTGATCCCCCCAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 19) [ka] U7-3'CTG Antisense sequence targeting DMPK: GAAATGGTCTGTGATCCCCCCAGCAGCAGCAGCAGCAGCAG (SEQ ID NO: 19)

[0153] Example 6 Use of U7snRNA to knockdown DMPK mRNA expression This example describes the use of AAV to deliver U7 snRNA constructs that target DMPK mRNA or the CUG repeat itself to knockdown or interfere with DMPK transcripts containing toxic RNA that form nuclear foci. When embedded in gene therapy vectors, these snRNAs can be permanently expressed in target cells.

[0154] Twelve constructs were designed and ordered from GenScript® to knockdown or interfere with the DMPK transcript. Eight constructs were designed using Human Splicing Finder [Desmet et al., Nucleic Acids Res. 37(9):e67, 2009; (www.umd.be / HSF3 / )] and online bioinformatics tools to predict splicing signals. Eight constructs were designed to skip either exon 5 (n=4; 5#1, 5#2, 5#3, 5#4) or exon 8 (n=4; 8#1, 8#2, 8#3, 8#4) of the DMPK transcript. Four additional constructs (15CAG, 20CAG, 5'CAG, 3'CAG) were designed to target the DMPK repeat expansion. The sequences of these constructs are specified in Example 5 and Figure 2A–L.

[0155] The construct was cloned into the pAAV shuttle plasmid containing qPCR probes (He et al., Proc. Nat. Acad. Sci. USA 95(5):2509-14, 1998) to quantify the virus, 5' and 3' inverted terminal sequences, and kanamycin resistance gene. The construct and GFP control were transfected into 293 cells. The cells were arrested 36 hours post-transfection. RNA extraction and RT-PCR were performed. RNA extraction from the cells was performed using 325 μL of TRIzol™. Cell lysates were applied to columns using R1054 Quick-RNA (Zymo Research, Irvine, CA). RNA extraction was performed according to the manufacturer's protocol. Reverse transcription was then performed using 500 ng of RNA using the RevertAid RT Reverse Transcription Kit (Thermo Scientific™). 150 ng of reverse transcriptase was used for each PCR. PCR was performed using primers in either exon 3 and exon 6 (probing for exon 5 skipping) or exon 7 and exon 10 (probing for exon 8 skipping).

[0156] The RT-PCR results to date have shown that constructs 8#2 and 8#3 are capable of inducing exon 8 skipping.

[0157] Example 7 AAV.480CTG induces splicing alterations in DM1-associated genes in mice This example provides experimental results from an experiment conducted to determine whether AAV.480CTG causes splicing alterations in DM1-associated genes in mice. Mice were injected with the AAV.480CTG construct as described herein in Example 2 above. Two weeks after injection with the viral construct, RNA extraction was performed using 500 μL of TRIzol™ on 15 × 30 μm sections from muscles injected with either AAV.480CTG or AAV.0CTG. Lysates were then treated with TRIzol™ according to the manufacturer's protocol (Thermo Scientific™). Reverse transcription was then performed using 500 ng of RNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific™). PCR was performed using different sets of primers to amplify the CLCN, SERCA1, MBLN2, and INSR genes. PCR of the 18s gene was performed to normalize relative expression. 150 ng of RT was used for each PCR.

[0158] RT-PCR results showed altered splicing of the CLCN1, SERCA1, MBLN2, and IR genes 2 weeks after injection with the viral construct. In DM1 patients, CLCN1, SERCA1, MBLN2, and IR genes were misspliced, as observed in injected mice, indicating that this construct induced the DM1 phenotype in vivo in mice.

[0159] Example 8 Quantification of intranuclear CUG foci and colocalization with MBNL by FISH Detection of CUG foci was achieved using a Cy3-(CAG)10 probe in either fixed frozen cells or fresh frozen tissue sections (10 μm) using standard procedures. Cells were fixed with 4% PFA (or 10% NBF) in 1x PBS for 10 minutes at room temperature (RT) and then washed three times with 1x PBS (3 minutes each). Cells were then permeabilized with 1 mL of 0.1% TritonX in PBS for 5 minutes at room temperature and washed twice with 1x TBS at room temperature. Cells were blocked in 10% normal goat serum with 1% BSA in TBS for 2 hours at room temperature and evacuated using a vacuum trap. Cells were incubated overnight at 4°C with primary antibody (mouse anti-MBNL, diluted 1:500) in TBS with 1% BSA. The following day, cells were rinsed twice for 3 minutes in TBS with 0.025% TritonX. The cells were then washed once with 1x TBS. The cells were incubated with secondary antibody (goat anti-mouse A488, diluted 1:500) for 1 hour at room temperature. The cells were then washed once with 1x TBS, twice with PBS at room temperature (3 minutes each), and with 1 mL of 30% formamide, 2x SSC at room temperature for 10 minutes.

[0160] The FISH probe was then added to 2 μg / mL BSA, 66 μg / mL yeast tRNA, and 1 ng / μL Cy3-(CAG)10 in 30% formamide and 2x SSC for 2 hours at 37°C. The cells were then washed with 30% formamide and 2x SSC for 30 minutes at 37°C. The cells were then washed with 1x SSC for 30 minutes at room temperature and stained with the NucBlue probe in 1x PBS (2 drops of PBS per mL) for 25-30 minutes at room temperature. The cells were washed once with 1x PBS and then mounted with CC / Mount and coverslipped. Quantification of CAG foci was accomplished by selecting five random, non-overlapping 20x magnification fields under a microscope and quantifying the number of nuclear foci using ImageJ software. A Cy3-(CTG)10 sense probe served as a negative control. After treatment with DMPK-inhibitory RNA, a decrease in the number of CUG foci was observed, accompanied by a decrease in the colocalization of foci and MBLN1. Because the number of CUG foci is increased in patients with DM1, a decrease in CUG foci indicates that treatment with the DMPK-inhibitory RNA sequence as described herein was effective. Because MBLN1 is elevated in patients with DM1, downregulation of MBLN1 indicates that treatment with the DMPK-inhibitory RNA sequence as described herein was effective.

[0161] Example 9 Western blot analysis of CELF1 A key feature of DM1 pathogenesis is the nuclear accumulation of RNA, which alters the function of CUG-binding protein (CUGBP), leading to aberrant alternative splicing of specific pre-mRNAs. CUGBP Elav-like family member 1 (CELF1) is a member of a protein family that regulates pre-mRNA alternative splicing and may also be involved in mRNA editing and translation. Elevated CELF1 protein levels were found in nuclei containing foci of CUG repeat RNA. To determine whether the DMPK-inhibitory RNA described herein knocks down or interferes with DMPK translation and the accumulation of CUG toxic repeats, Western blot detection of CELF1 was performed on harvested muscle homogenates using an anti-CELF1 monoclonal antibody (Santa Cruz Biotechnologies) and an anti-GAPDH antibody (Abcam) as loading control proteins.

[0162] Because CELF1 is elevated in patients with DM1, downregulation of CELF1 expression in cells and tissues transduced with DMPK-inhibitory RNA indicates that treatment with DMPK-inhibitory RNA as described herein was effective.

[0163] Example 10 AAV injection and delivery Because both muscle and brain are affected by DM1, vectors are injected to ensure delivery into all cells. Mice are injected at the appropriate age (P1-12 weeks old) with an effective dose (in some examples, the dose is up to approximately 1E15, using up to 300 μL diluted in PBS (0.9% sodium chloride)). In some instances, the dose and injection volume vary depending on the injection route. For example, in most instances, the volume will not exceed 50 μL, 50 μL, 300 μL, or 5 μL or 15 μL for intramuscular, intravenous (facial or tail), intraventricular, or intracerebellar / medullary (cisterna magna) injection, respectively. In some instances, the injection route will vary based on the promoter and construct, and may be intramuscular (e.g., tibialis anterior (IM)), intravascular (e.g., tail vein (TV) or facial vein (FV)), intracerebroventricular (ICV), or intracerebellar / medullary (e.g., cisterna magna (ICM / lumbar)) injection.

[0164] In most cases, tail vein injections are performed without anesthesia, with the mouse briefly placed in a restraining cone. All other injections, except for facial vein and ICV, are performed via suction, IP, or isofluorane (5% induction, 2% maintenance) while the mouse is anesthetized with ketamine / xylazine (100 mg / kg and 10 mg / kg). For these latter procedures, due to the injections being performed on P1-P3 animals, anesthesia is achieved by placing the animal on ice (freezing anesthesia process described below). After injection, the animal is placed on a heating pad. Anesthetized mice are observed until they recover from a prone position with their chest on the ground.

[0165] Intramuscular injection (maximum volume of approximately 50 μL):

[0166] Approximately 21-day-old and 85-day-old mice were sedated with isofluorane. The legs were shaved, and up to 50 μL of AAV or 0.9% saline was injected into the anterior tibia. The animals were placed on a heating pad and observed until fully recovered, after which they were returned to their cages.

[0167] Tail vein injection (TV, volume range: approximately 150-300 μL):

[0168] Approximately 21-day-old and approximately 85-day-old mice were placed in a tail vein device. The tail was warmed using an incandescent bulb to dilate the veins. Once the tail vein was visualized, AAV9 or PBS was injected. After injection, a sterile cotton pad was placed over the injection site and pressure was applied until any bleeding had stopped. The mice were then returned to their cages.

[0169] Intracisternal cisterna magna (ICM) / lumbar puncture (volume range: approximately 3–15 μL):

[0170] Approximately 21-day-old and approximately 85-day-old mice were sedated with isofluorane. A 1-cm skin incision was made at the base of the skull using a sterile scalpel. A microcapillary needle was inserted 1 mm deep into the cisterna sac and either virus (e.g., AAV) or PBS was injected. The incision was closed using tissue glue or staples. The animals were placed on a heating pad and observed until fully recovered, after which they were returned to their cages. Because only a small skin incision was made, no pain medication was required. Lumbar puncture was performed similarly to ICM injections and followed very similar steps: A microcapillary needle was inserted into the intrathecal cavity between vertebrae L4 and L5, without an incision in the skin. This injection does not require any surgical procedures.

[0171] ICV injection (volume range: approximately 3-5 μL):

[0172] Anesthetize 1- to 3-day-old pups by placing them on ice (freezing anesthesia process described below). Place the anesthetized pup on a clean surface and hold it firmly between your thumb and index finger. Using your other hand, insert a laser-cut borosilicate glass microtube needle approximately 1 mm above each eye (on one side), to a depth of 0.5 to 1 mm. Inject less than 5 μL of virus or PBS. This is a minimally invasive procedure that takes less than 3 minutes to perform. After injection, place the pup on a heating pad or in an incubator to recover. Once the animal is mobile, place it back in its cage with its mother.

[0173] Facial vein injection (volume range: up to approximately 50 μL):

[0174] Anesthetize 1- to 3-day-old pups by placing them on ice (freezing anesthesia process described below). Place the anesthetized pup on a clean surface and hold it firmly between your thumb and index finger. Using your other hand, insert the insulin needle into the cranial vein approximately 1 mm above the eye (on one side) to a depth of 0.5 to 1 mm. Inject less than 50 μL of virus or 0.9% saline. This is a minimally invasive procedure that takes less than 3 minutes to perform. After the injection, place the pup on a heating pad to recover. Once the animal is mobile, place it back in its cage with its mother.

[0175] After transducing the DMPK-inhibitory RNA into mice, experiments are performed (e.g., RT-PCR, Northern blot analysis, Western blot analysis, FISH analysis, etc., as described herein above) to determine whether U6shRNA and U7snRNA knock down DMPK mRNA expression and / or interfere with the expression of the CTG trinucleotide repeat in the 3' untranslated region of the DMPK gene.

[0176] In mice treated with the U6shRNA and U7snRNA constructs described herein, there is a reduction or elimination of myotonic dystrophy symptoms, including, but not limited to, restoration of normal gene splicing patterns in genes including, for example, but not limited to, CLCN (and CLCN1, CLCN2, CLCN3, CLCN4, CLCN5, CLCN6, etc.), BIN1, SERCA-1, MLBN1, MLBN2, and IR, and / or a reduction in the expression of CELF1 and MBLN1, and / or a reduction in the number of nuclear foci or CUG foci (including foci capturing genes such as MBLN1), or a reduction in central nucleation, and recovery of muscle hyperexcitability using electromyography.

[0177] Example 11 U6shRNA and U7snRNA knock down DMPK mRNA expression and / or interfere with the expression of the CTG trinucleotide repeat in the 3' untranslated region of the DMPK gene in the DMSXL model The pathological features of DM1 are assessed using the DMSXL mouse model, which contains a well-characterized human DMPK containing 1000 CTG repeats, following local intramuscular and / or systemic delivery of AAV containing U6 shRNA and / or U7 snRNA as disclosed herein [Huguet et al., PLoS Genet. 8(11)(2012);8(11);doi.org / 10.1371 / journal.pgen.1003043].

[0178] At 4 and 12 weeks after injection, the tibialis anterior (TA) of mice was analyzed using electromyography (EMG), force measurements, and assessment of splicing degeneration. In patients with DM1, myotonia / rigidity causes impaired motor control and mobility [Logigian et al., Neurology 74(18):1441-8(2010)].

[0179] Previous studies have demonstrated that myotonia is one of the most prevalent symptoms, reported by 90% of DM1 patients [Heatwole et al., Neurology 79(4):348-57(2012)]. Myotonia can be quantified physiologically by testing muscle hyperexcitability using electromyography (EMG) [Kanadia et al., Science 302(5652):1978-80(2003); Wheeler et al., J. Clin. Res. 117(12):3952-7(2007); Statland et al., JAMA 308(13):1357-65(2012)]. EMG myotonic potentials were recorded from the TA muscle and quantified by blinded raters experienced in clinical EMG assessment of muscle tone in DM1 patients [Kanadia et al., Science 302(5652):1978-1980(2003); Wheeler et al., J. Clin. Res. 117(12):3952-7(2007); Statland et al., JAMA 308(13):1357-65(2012)].

[0180] The severity of myotonia by EMG is used as a simple translational readout to identify the onset of the DM1 phenotype. Additionally, force measurements are also performed. Two tests are performed on ex vivo TA preparations: isometric muscle force (providing a strength assessment) and eccentric contraction (assessing sarcolemmal stability). The goal is to perform isolated muscle function measurements on the mouse extensor TA. This assay is limited to the assessment of isometric muscle force in isolated muscles in vitro.

[0181] Assessment of muscle function requires careful surgical excision of muscle from tendon to tendon from anesthetized animals. Functional testing of mouse skeletal muscle requires a minimum of four components: (1) a force transducer to monitor force production, (2) a stimulator and electrodes to excite the muscle, (3) a bath to perfuse the muscle with oxygenated Ringer's solution, and (4) a device to record force production. During tendon excision, the muscle remains attached to the leg and continues to receive blood and oxygen from the mouse. For comparative purposes, all force measurements are expressed per unit cross-sectional area (normalized isometric muscle force or tension: mN / mm). 2 ) Cross-sectional area (CSA) is calculated using the following equation: CSA = (muscle mass in g) / [optimal fiber length in cm] × (g / cm 3 muscle density at 1.06 g / cm 3 It is calculated using the equation:

[0182] Gene splicing alterations (e.g., CLCN1, BIN1, SERCA-1, MLBN1, and MLBN2) are assessed by RT-PCR. Furthermore, the number of nuclear CUG foci is quantified (as described herein above). Fluorescence in situ hybridization (FISH) is used to confirm whether CUG foci colocalize with MBNL-1 (as described herein above). Furthermore, Western blot analysis of CELF-1 is performed to determine whether CELF-1 is overexpressed. Histology is performed to measure muscle fiber size and confirm the presence of centrally nucleated fibers. Electromyography is used to examine muscles.

[0183] In mice treated with the U6shRNA and U7snRNA constructs described herein, there is a reduction or elimination of myotonic dystrophy symptoms, including, but not limited to, restoration of normal gene splicing patterns in genes including, but not limited to, CLCN1, BIN1, SERCA-1, MLBN1, MLBN2 and IR, and / or reduced expression of CELF1 and MBLN1, and / or a reduction in the number of nuclear foci or CUG foci (including foci that capture genes such as MBLN1) or reduced central nucleation, and recovery of muscle hyperexcitability using electromyography.

[0184] Example 12 U6shRNA and U7snRNA knock down DMPK mRNA expression and / or interfere with the expression of the CTG trinucleotide repeat in the 3' untranslated region of the DMPK gene in an iDM1 model The pathological features of DM1 are evaluated in the iDM1 model (described in Examples 1 and 2 herein) following delivery of AAV (described in Example 10 herein) containing the U6shRNA and / or U7snRNA constructs described herein.

[0185] Four and 12 weeks after injection, the tibialis anterior (TA) of the mice was extracted. Cells and tissues were analyzed for histology. Muscle health was examined using electromyography (EMG) and force measurement. Cells and tissues were evaluated for splicing alterations, FISH, Western blot, RT-PCR, Northern blot analysis, and Western blot analysis. Gene splicing alterations (e.g., CLCN1, BIN1, SERCA-1, MLBN1, and / or MLBN2) were evaluated by RT-PCR. Additionally, the number of nuclear CUG foci was quantified (as described herein above). FISH was used to confirm whether CUG foci colocalized with MBNL-1 (as described herein above). Additionally, Western blot analysis of CELF-1 was performed to determine whether CELF-1 was overexpressed. Histology was performed to measure muscle fiber size and confirm the presence of centrally nucleated fibers. Muscles were examined using electromyography and force measurement.

[0186] In mice treated with the U6shRNA and U7snRNA constructs described herein, there is a reduction or elimination of myotonic dystrophy symptoms, including, but not limited to, restoration of normal gene splicing patterns in genes including, but not limited to, CLCN1, BIN1, SERCA-1, MLBN1, MLBN2 and IR, and / or reduced expression of CELF1 and MBLN1, and / or a reduction in the number of nuclear foci or CUG foci (including foci that capture genes such as MBLN1) or reduced central nucleation, and recovery of muscle hyperexcitability using electromyography.

[0187] Example 13 U6 shRNA knocks down DMPK mRNA expression in human cells This example discloses the use of AAV to deliver a U6 shRNA construct targeting DMPK mRNA (i.e., targeted to bind to the 3' UTR) to knockdown or interfere with DMPK transcripts to reduce human DMPK expression in PANC-1 and HEK293 cells in vitro.

[0188] Human pancreatic cancer cells (i.e., PANC-1) and human renal cancer cells (i.e., HEK293 cells) were seeded (2e5 cells / well) 24 hours before transfection. To knockdown or interfere with DMPK transcripts in these cell lines, constructs containing DNA encoding 2577 (i.e., SEQ ID NO:3) and 2683 (i.e., SEQ ID NO:7), and more specifically, DNA encoding U6T6.sh2577 (i.e., SEQ ID NO:20) and U6T6.sh2683 (i.e., SEQ ID NO:24), were used. The constructs (500 ng of plasmid DNA) and GFP control were transfected into PANC-1 and HEK293 cells using LipoFectamine 3000. Cells were harvested 72 hours after transfection, and RNA was isolated using the RNeasy Plus kit (Qiagen). Complementary DNA (cDNA) was generated from the RNA using SuperScribe. RNA integrity was analyzed using an Aglient 2100 Bioanalyzer. Quantitative PCR (qPCR) was performed, and data were normalized using three housekeeping genes (i.e., UBC, GUSB, and HPRT1). Fold changes were compared to cells transfected with siGAPDH (control). Cell lysates were applied to the column using R1054 Quick-RNA (Zymo Research, Irvine, CA).

[0189] qPCR results showed that AAV vectors containing shRNAs targeting human DMPK RNA (i.e., sh2577 and sh2683) under the control of the U6 promoter were successful in downregulating DMPK expression by approximately 50–53% (i.e., sh2577) and approximately 40–44% (i.e., sh2683) (see Figure 8).

[0190] Example 14 U6shRNA and U7snRNA knock down DMPK mRNA expression in hemizygous DMSXL mice The purpose of this study was to test three different DMPK-targeted adeno-associated virus (AAV) constructs in DMSXL mice, a mouse model of myotonic dystrophy type 1. The transgenic DMSXL mouse strain delivers a 45-kb human genomic fragment containing the human DMPK gene (hDMPK) with over 1000 CTG repeats. Hemizygous mice deliver and express transcripts derived from a single hDMPK copy. Each AAV construct delivers 1.25 × 10 11The left tibialis anterior (TA) muscle of hemizygous DMSXL mice (Hemi) was intramuscularly injected with a dose of 1000 mg / animal (vg / animal) (Figure 9A). The contralateral TA was left untreated and served as a control leg. Three 4-week-old female and three male hemizygous DMSXL mice were injected with each AAV construct (i.e., PLA1 (i.e., SEQ ID NO: 20 (U6.sh2577)), PLA3 (SEQ ID NO: 34 (U7-20CTG)), and PLA4 (SEQ ID NO: 31 (U7EX8#3)) (i.e., a sample size of six mice). Four weeks after administration, both the right and left TA muscles were harvested. RNA was isolated and prepared, and hDMPK RNA sequencing and RNA expression levels were analyzed. Decreased levels of hDMPK RNA expression in the treated leg compared to the untreated leg were observed in mice treated with the PLA1 construct (i.e., SEQ ID NO:20 (U6.sh2577)) (Figure 9B). The PLA1 construct demonstrated a 22% knockdown of hDMPK in the treated TA muscle relative to the untreated contralateral side (Figure 9C).

[0191] While the present disclosure has been described in terms of specific embodiments, those skilled in the art will recognize that variations and modifications thereof occur. Accordingly, only such limitations as appear in the claims should be placed on the present disclosure.

[0192] All documents referenced in this application are incorporated herein by reference in their entirety.

[0193] The nucleotide and amino acid sequences disclosed herein are set forth in Table 1, set forth below.

[0194] [Table 1-1] [Table 1-2] [Table 1-3] Table 1-4 Table 1-5 Table 1-6 Table 1-7

Claims

[Claim 1] The invention as described in the drawings of this application.