Compounds and methods for adjusting PLP1

Modified oligonucleotides targeting PLP1 RNA provide a therapeutic avenue for Pelizaeus-Merzbacher disease by reducing PLP1 levels, addressing the lack of effective treatments for this fatal leukodystrophy.

JP2026062868APending Publication Date: 2026-04-10IONIS PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025283671
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2020-12-11
Filing Date
2025-12-26
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

There are no effective treatments for Pelizaeus-Merzbacher disease (PMD), a severe X-linked leukodystrophy caused by PLP1 mutations or overexpression, leading to myelination failure and fatal symptoms in childhood.

Method used

Development of compounds and pharmaceutical compositions that reduce PLP1 RNA or protein levels using modified oligonucleotides, specifically oligomeric compounds targeting PLP1 RNA to decrease its activity and expression.

Benefits of technology

These compounds effectively alleviate symptoms of PMD by reducing PLP1 levels, improving conditions such as hypotonia, nystagmus, optic nerve atrophy, and spasticity, offering a potential therapeutic approach for this currently untreatable disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026062868000001
    Figure 2026062868000001
  • Figure 2026062868000002
    Figure 2026062868000002
  • Figure 2026062868000003
    Figure 2026062868000003
Patent Text Reader

Abstract

The present invention provides compounds, methods, and pharmaceutical compositions for reducing the amount or activity of PLP1 RNA in cells or subjects, and, in some cases, the amount of proteolipid protein 1 in cells or subjects. [Solution] The present invention provides an oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleic acid base sequence of the modified oligonucleotide is at least 85% complementary to equal-length portions of the PLP1 nucleic acid, and the modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified nucleoside-to-nucleoside bonds. Such compounds, methods, and pharmaceutical compositions are useful for improving at least one symptom or characteristic of leukodystrophy.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Sequence List This application is filed electronically along with the sequence listing. The sequence listing is provided as a file titled BIOL0382WOSEQ_ST25.txt, created on June 22, 2021, with a size of 456 KB. The electronic information of this sequence listing is incorporated herein by reference in its entirety.

[0002] field Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of proteolipid protein 1 (PLP1) RNA in cells or subjects, and in some cases reducing the amount of proteolipid protein 1 in cells or subjects. Such compounds, methods, and pharmaceutical compositions are useful in improving at least one symptom or feature of leukodystrophy. Such symptoms and features include hypotonia, nystagmus, optic nerve atrophy, dyspnea, motor delay, cognitive impairment, speech impairment, spasticity, ataxia, seizures, choroidal motion, and death. Such leukodystrophy includes Pelizaeus-Merzbacher disease. [Background technology]

[0003] Pelizaeus-Merzbacher disease (PMD) is a severe, fatal childhood X-linked leukodystrophy associated with widespread loss or absence of myelination in the central nervous system, caused by duplication or sequence mutations in the gene encoding proteolipid protein 1 (PLP1). Hundreds of mutations in PLP1 have been identified, leading to misfolding and toxic gain of function due to myelination failure (Hobson, G., 2012, Semin. Neurol. 32, 62-67; Nevin, ZS, 2017, American J. Hum. Genetics 100, 617-634; Sima, AAF, et al., 2009, Acta Neuropathologica 118, 431-439). The majority of PMD cases are due to the overexpression of otherwise normal PLP1 protein as a result of duplication or triplication of PLP1 (Inoue, K., 2005, Neurogenetics 6, 1-16; Karim, SA, 2010, Glia 58, 1727-1738). PLP1 is expressed in myelin-forming oligodendrocytes and oligodendrocyte progenitor cells (OPCs) in the central nervous system (CNS), accounting for approximately 50% of the total protein content of myelin, and in Schwann cells in the peripheral nervous system (PNS) (Klugman, W., et al., 1997, Neuron, 18 59-70; Harlow, DE, et al., 2014, J. Neurosci. 34, 1333-1343; Baumann, N., et al., 2001, Physiol. Rev. 81, 871-927).

[0004] Due to the genetic heterogeneity associated with PMD, symptoms and characteristics vary and are classified into two main categories: severe and standard. Severe PMD (severe / early onset) is caused by mutations in PLP1, resulting in hypomyelination. This most severe form of PMD is fatal in infancy, usually within the first few years of life, and presents with symptoms such as nystagmus, dyspnea, extrapyramidal signs, laryngeal stridor, feeding difficulties, optic nerve atrophy, seizures, and extreme neonatal hypotonia. Standard PMD, associated with PLP1 overexpression due to duplication or triplication, presents before the age of one, exhibiting a series of motor delays, hypotonia, nystagmus, and / or infantile motor delays, and showing progressive spasticity, ataxia, and / or choroidal motion development throughout adolescence and early adulthood. Other PMD phenotypes include transitional PMD, associated with PLP1 overexpression or PLP1 mutations, which combines clinical features of both standard and severe forms. The less severe phenotype, spastic paraplegia type 2 (SPG2), has a later onset than standard PMD and is associated with mild, delayed-onset spasticity of the legs or central nervous system deficits and a range of mild peripheral neuropathy. Patients with PLP1 deletion ("null" patients) have significantly milder symptoms than patients with PLP1 mutations or duplications and can live to 40–60 years of age. There is no approved treatment for PMD, and current treatments are mainly limited to symptomatic management for pain relief (Nevin, 2017; Inoue, 2005; Madry, J., et al., 2010, Neurol. Neurochir. Pol. 44, 511-515; Osorio, MJ, et al., 2017, Stem Cells 35, 311-315; Wang, PJ, et al., 2001, J. Clin. Neurophys. 18, 25-32).

[0005] Currently, there are no acceptable treatment options for leukodystrophy such as PMD. Therefore, the objective of this specification is to provide compounds, methods, and pharmaceutical compositions for treating such diseases. [Overview of the Initiative]

[0006] Provided herein are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of PLP1 RNA in cells or animals, and in specific embodiments for reducing the expression of proteolipid protein 1. In specific embodiments, the subject has a disease or disorder associated with PLP1 overexpression or mutation in PLP1. In specific embodiments, the subject has leukodystrophy. In specific embodiments, the subject has Pelizaeus-Merzbacher disease. In specific embodiments, the compound useful for reducing the amount or activity of PLP1 RNA is an oligomeric compound. In specific embodiments, the compound useful for reducing the amount or activity of PLP1 RNA is a modified oligonucleotide. In specific embodiments, the compound useful for reducing the expression of proteolipid protein 1 is an oligomeric compound. In specific embodiments, the compound useful for reducing the expression of proteolipid protein 1 is a modified oligonucleotide.

[0007] Also provided is a method useful for improving at least one symptom or feature of leukodystrophy. In a particular embodiment, the leukodystrophy is Pelizaeus-Merzbacher disease. In a particular embodiment, the symptoms or features include hypotonia, nystagmus, optic nerve atrophy, dyspnea, motor delay, cognitive impairment, speech impairment, spasticity, ataxia, seizures, or choroidal motion. [Modes for carrying out the invention]

[0008] Please understand that the general descriptions above and the detailed descriptions below are illustrative and descriptive only, and not limiting. In this specification, the use of the singular includes the plural unless otherwise explicitly stated. When used in this specification, the use of "or" means "and / or" unless otherwise specified. Furthermore, the use of the term "contains," as well as other forms such as "contains" and "includes," is not limiting. In addition, terms such as "element" or "component" include both elements and components containing one unit, and elements and components containing two or more subunits, unless otherwise explicitly stated.

[0009] The section headings used herein are for structural purposes only and should not be construed as limiting the subject matter of the inventions described herein. All documents or parts of documents cited herein, including but not limited to patents, patent applications, articles, books, papers, and GenBank, ENSEMBL, and NCBI reference sequence records, are expressly incorporated herein by reference, as are the parts of documents considered herein, in whole.

[0010] definition Unless otherwise specified, the nomenclature, procedures, and techniques used in relation to analytical chemistry, synthetic organic chemistry, and medical and pharmaceutical chemistry described herein are well known and commonly used in the art. Where permitted, all patents, patent applications, patent application publications, and other publications and data referenced throughout this disclosure are incorporated herein by reference in their entirety.

[0011] Unless otherwise specified, the following terms have the meanings set forth below.

[0012] definition As used herein, “2'-deoxynucleoside” means a nucleoside containing a 2'-H(H)deoxyfuranosyl sugar moiety. In certain embodiments, the 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside containing a 2'-β-D-deoxyribosyl sugar moiety having a β-D ribosyl configuration similar to that found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, the 2'-deoxynucleoside may contain a modified nucleic acid base or an RNA nucleic acid base (uracil).

[0013] As used herein, "2'-MOE" refers to the 2'-OCH2CH2OCH3 group instead of the 2'-OH group in the furanosyl sugar moiety. "2'-MOE sugar moiety" refers to the sugar moiety having a 2'-OCH2CH2OCH3 group instead of the 2'-OH group in the furanosyl sugar moiety. Unless otherwise specified, the 2'-MOE sugar moiety is in a β-D-ribosyl configuration. "MOE" refers to O-methoxyethyl.

[0014] As used herein, "2'-MOE nucleoside" means a nucleoside containing a 2'-MOE sugar moiety.

[0015] As used herein, "2'-OMe" refers to a 2'-OCH3 group instead of the 2'-OH group in the furanosyl sugar moiety. "2'-O-methyl sugar moiety" or "2'-OMe sugar moiety" refers to a sugar moiety that has a 2'-OCH3 group instead of the 2'-OH group in the furanosyl sugar moiety. Unless otherwise specified, the 2'-OMe sugar moiety is in a β-D-ribosyl configuration.

[0016] As used herein, "2'-OMe nucleoside" means a nucleoside containing a 2'-OMe sugar moiety.

[0017] As used herein, “2'-substituted nucleoside” means a nucleoside containing a 2'-substituted sugar moiety. As used herein with respect to a sugar moiety, “2'-substituted” means a sugar moiety containing at least one 2'-substituent other than H or OH.

[0018] As used herein, "5-methylcytosine" refers to cytosine modified with a methyl group attached to the 5-position. 5-methylcytosine is a modified nucleic acid base.

[0019] As used herein, “administer” means to give a medicinal agent to a subject.

[0020] As used herein, “antisense activity” means any detectable and / or measurable change resulting from the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such a target nucleic acid, compared to the level of the target nucleic acid or target protein in the absence of the antisense compound.

[0021] As used herein, "antisense compound" means an oligomeric compound capable of achieving at least one antisense activity.

[0022] When used herein in relation to treatment, “improvement” means improvement in at least one symptom or feature compared to the same symptom or feature without treatment. In certain embodiments, improvement is a decrease in the severity or frequency of the symptom or feature, or a delay in its onset or a delay in the progression of the severity or frequency of the symptom or feature. In certain embodiments, the symptom or feature is one or more of hypotonia, nystagmus, optic atrophy, dyspnea, motor dysregulation, cognitive impairment, speech impairment, spasticity, ataxia, seizures, choroidal motion, and death.

[0023] As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside containing a bicyclic sugar moiety.

[0024] As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety containing two rings, wherein the second ring is formed via a bridge connecting two atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the furanosyl sugar moiety is a ribosyl moiety. In certain embodiments, the bicyclic sugar moiety does not contain a furanosyl moiety.

[0025] As used herein, “cerebrospinal fluid” or “CSF” means the fluid that fills the space around the brain and spinal cord. “Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has the specific properties of cerebrospinal fluid.

[0026] As used herein, “cleavable portion” means a bond or group of atoms that is cleaved under physiological conditions, for example, within a cell, animal, or human.

[0027] When used herein with respect to oligonucleotides, “complementary” means that at least 70% of the nucleic acid bases of an oligonucleotide or one or more parts thereof and the nucleic acid bases of another nucleic acid or one or more parts thereof can form hydrogen bonds with each other when the nucleic acid base sequences of the oligonucleotide and the other nucleic acid are aligned in opposite directions. When used herein, “complementary nucleic acid bases” means nucleic acid bases that can form hydrogen bonds with each other. Examples of complementary nucleic acid base pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine ( mExamples include C) and guanine (G). Complementary oligonucleotides and / or target nucleic acids do not need to have complementary nucleic acid bases at each nucleoside. Rather, some mismatches are acceptable. When used herein with respect to an oligonucleotide or a part thereof, “fully complementary” or “100% complementary” means that an oligonucleotide or a part thereof is complementary to another oligonucleotide or target nucleic acid at each of the two oligonucleotides’ shorter nucleic acid bases, or complementary at each nucleoside if the oligonucleotides are the same length.

[0028] As used herein, “conjugate group” means an atomic group directly or indirectly bonded to an oligonucleotide. A conjugate group includes a conjugate moiety and a conjugate linker that bonds the conjugate moiety to an oligonucleotide.

[0029] As used herein, “conjugate linker” means a single bond or group of atoms that contains at least one bond connecting the conjugate portion to an oligonucleotide. ru.

[0030] As used herein, “conjugate moiety” means a group of atoms that are bound to an oligonucleotide via a conjugate linker.

[0031] When used herein in relation to oligonucleotides, “consecutive” refers to nucleosides, nucleic acid bases, sugar moieties, or internucleoside bonds that are directly adjacent to each other. For example, “consecutive nucleic acid bases” means nucleic acid bases that are directly adjacent to each other in sequence.

[0032] As used herein, "cEt" means a 4'-to-2' bridge in place of the 2'OH- group of the ribosyl sugar moiety, where the bridge has the formula 4'-CH(CH3)-O-2' and the methyl group of the bridge is in the S position. "cEt sugar moiety" is a bicyclic sugar moiety having a 4'-to-2' bridge in place of the 2'OH group of the ribosyl sugar moiety, where the bridge has the formula 4'-CH(CH3)-O-2' and the methyl group of the bridge is in the S position. "cEt" means restrained ethyl.

[0033] As used herein, "cEt nucleoside" means a nucleoside containing a cEt sugar moiety.

[0034] As used herein, “chiral-enriched population” means a population of multiple molecules of the same molecular formula in which the number or proportion of molecules containing a particular stereochemical configuration at a particular chiral center is greater than the number or proportion of molecules in the population that would be expected to contain the same particular stereochemical configuration at the same particular chiral center if that particular chiral center were sterically random. A chiral-enriched population of molecules having multiple chiral centers in each molecule may contain one or more sterically random chiral centers. In certain embodiments, the molecule is a modified oligonucleotide. In certain embodiments, the molecule is a compound comprising a modified oligonucleotide.

[0035] As used herein, "chiral-controlled" with respect to nucleoside bonds means that the chirality at that bond is concentrated for a particular stereochemical configuration.

[0036] As used herein, “deoxy region” means a region of 5 to 12 consecutive nucleotides, where at least 70% of the nucleosides are 2'-β-D-deoxynucleosides. In certain embodiments, each nucleoside is selected from 2'-β-D-deoxynucleosides, bicyclic nucleosides, and 2'-substituted nucleosides. In certain embodiments, the deoxy region supports RNA-degrading enzyme H activity. In certain embodiments, the deoxy region is a gap or internal region of a gapmer.

[0037] As used herein, “gapmer” means a modified oligonucleotide comprising an internal region having multiple nucleosides that assist in RNA-degrading enzyme H cleavage, located between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleosides (singular) or nucleosides (plural) comprising the external region. The internal region may be referred to as a “gap,” and the external region may be referred to as a “wing” or “wing segment.” In certain embodiments, the internal region is a deoxy region. The position of the internal region or gap refers to the order of the nucleosides in the internal region, counted starting from the 5' end of the internal region. Unless otherwise specified, “gapmer” refers to a sugar motif. In certain embodiments, each nucleoside in the gap is a 2'-β-D-deoxynucleoside. In certain embodiments, the gap contains one 2'-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remainder of the gap nucleoside is a 2'-β-D-deoxynucleoside. When used herein, "MOE gapmer" The term refers to a gapmer having a gap containing a 2'-β-D-deoxynucleoside and a wing containing a 2'-MOE nucleoside. As used herein, the term “mixed-wing gapmer” refers to a gapmer having a wing containing modified nucleosides with at least two different sugar modifications. Unless otherwise indicated, a gapmer may contain one or more modified nucleoside bonds and / or modified nucleic acid bases, and such modifications do not necessarily follow the gapmer pattern of sugar modifications.

[0038] As used herein, “hotspot region” refers to a range of nucleic acid bases on a target nucleic acid that is prone to a reduction in the amount or activity of the target nucleic acid mediated by the oligomeric compound.

[0039] As used herein, “hybrid formation” means complementary pairing or annealing of oligonucleotides and / or nucleic acids. While not limited to a specific mechanism, hydrogen bonding is involved in the most common mechanisms of hybrid formation, and this may be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding between complementary nucleic acid bases.

[0040] As used herein, “nucleoside bond” means a covalent bond between consecutive nucleosides in an oligonucleotide. As used herein, “modified nucleoside bond” means any nucleoside bond other than a phosphodiester nucleoside bond. A “phosphorothioate nucleoside bond” or “PS nucleoside bond” is a modified nucleoside bond in which one of the non-bridged oxygen atoms of a phosphodiester nucleoside bond is replaced with a sulfur atom.

[0041] As used herein, "leukodystrophy" refers to a disorder caused by abnormalities in the myelin sheath of neurons.

[0042] As used herein, “linker nucleoside” means a nucleoside that directly or indirectly links an oligonucleotide to a conjugate moiety. The linker nucleoside is located within the conjugate linker of the oligomeric compound. Even if adjacent to an oligonucleotide, the linker nucleoside is not considered part of the oligonucleotide moiety of the oligomeric compound.

[0043] As used herein, “non-bicyclic modified sugar moiety” means a modified sugar moiety that includes a substituent or other modification that does not form a bridge between the two atoms of the sugar to form a second ring.

[0044] As used herein, “mismatch” or “non-complementarity” means that when the first and second oligonucleotides are placed side by side, the nucleic acid base of the first oligonucleotide is not complementary to the second oligonucleotide or the corresponding nucleic acid base of the target nucleic acid.

[0045] As used herein, “motif” means the pattern of unmodified and / or modified sugar moieties, nucleic acid bases, and / or nucleoside bonds in an oligonucleotide.

[0046] As used herein, “nucleic acid base” means an unmodified nucleic acid base or a modified nucleic acid base. As used herein, “unmodified nucleic acid base” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, “modified nucleic acid base” is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleic acid base. “5-methylcytosine” is one of the modified nucleic acid bases. A universal base is a modified nucleic acid base that can pair with any one of the five unmodified nucleic acid bases. As used herein, “nucleus "Acid-base sequence" refers to the sequence of consecutive nucleic acid bases in a nucleic acid or oligonucleotide that is independent of any modification of sugar or nucleoside bonds.

[0047] As used herein, “nucleoside” means a compound or fragment of a compound comprising a nucleic acid base and a sugar moiety. The nucleic acid base and sugar moiety are either independently unmodified or modified. As used herein, “modified nucleoside” means a nucleoside comprising a modified nucleic acid base and / or a modified sugar moiety. Modified nucleosides include debasic nucleosides that do not contain a nucleic acid base. As used herein, “linked nucleosides” are nucleosides linked in a continuous sequence (i.e., there are no further nucleosides between the linked nucleosides).

[0048] As used herein, “oligomer compound” means an oligonucleotide and optionally one or more additional features such as a conjugate group or terminal group. An oligomer compound may or may not be paired with a second oligomer compound that is complementary to a first oligomer compound. A “single-stranded oligomer compound” is an unpaired oligomer compound. The term “oligomer double-stranded” means a double-stranded structure formed by two oligomer compounds having complementary nucleic acid base sequences. Each oligomer compound in an oligomer double-stranded structure may be called a “double-stranded oligomer compound.”

[0049] As used herein, “oligonucleotide” means a chain of linked nucleosides connected via internucleoside bonds, where each nucleoside and internucleoside bond may or may not be modified. Unless otherwise indicated, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide in which at least one nucleoside or internucleoside bond is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not contain any nucleoside modifications or internucleoside modifications.

[0050] As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administration to a subject. Certain such carriers enable the formulation of pharmaceutical compositions into, for example, tablets, pills, sugar-coated tablets, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral administration by a subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer, or sterile artificial cerebrospinal fluid.

[0051] As used herein, “pharmaceutically acceptable salt” means a physiologically and pharmaceutically acceptable salt of a compound. A pharmaceutically acceptable salt retains the desired biological activity of the parent compound and does not impart any undesirable toxicological effects to the parent compound.

[0052] As used herein, “pharmaceutical composition” means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may include an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in a specific cell line.

[0053] As used herein, “prodrug” means a therapeutic agent in an ex vivo form that is converted into a different form within a subject or its cells. Typically, the conversion of a prodrug within a subject is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in the cell or tissue, and / or by physiological conditions.

[0054] When used herein, “reducing the amount or activity” means reducing the untreated or control. This refers to a reduction or blockage of transcriptional expression or activity compared to the transcriptional expression or activity of the sample, and does not necessarily indicate a complete disappearance of transcriptional expression or activity.

[0055] As used herein, "RNA" means RNA transcripts, including pre-mRNA and mature mRNA unless otherwise specified.

[0056] As used herein, “RNAi compound” means an antisense compound that acts to modulate a target nucleic acid and / or the protein encoded by the target nucleic acid, at least partially via RISC or Ago2. RNAi compounds include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimetic compounds. In certain embodiments, RNAi compounds modulate the quantity, activity, and / or splicing of the target nucleic acid. The term RNAi compound excludes antisense compounds that act via RNA-degrading enzyme H.

[0057] As used herein with respect to oligonucleotides, “self-complementarity” means oligonucleotides that form at least partially hybrid forms with themselves.

[0058] As used herein, “standard in vitro assay” means the assay described in Example 1 and its reasonable modifications.

[0059] As used herein, “standard in vivo assay” means the assay described in Example 5 and its appropriate variations.

[0060] When used herein in relation to a group of molecules of the same molecular formula, “stereorandom chiral center” means a chiral center having a random stereochemical configuration. For example, in a group of molecules containing stereorandom chiral centers, the number of molecules having stereorandom chiral centers in (S) configuration may be the same as, but not necessarily the same as, the number of molecules having stereorandom chiral centers in (R) configuration. The stereochemical configuration of a chiral center is considered random if it is the result of a synthetic method not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate nucleoside bond.

[0061] As used herein, “subject” means human or non-human animal. The terms “subject” and “individual” are used interchangeably.

[0062] As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a 2'-OH(H)β-D-ribosyl sugar moiety found in RNA (“unmodified RNA sugar moiety”) or a 2'-H(H)β-D-deoxyribosyl sugar moiety found in DNA (“unmodified DNA sugar moiety”). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or sugar substitute.

[0063] As used herein, “sugar substitute” means a modified sugar moiety having a furanosyl moiety other than a nucleoside base that can be linked to another group, such as an internucleoside bond, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides containing sugar substitutes can be incorporated at one or more positions within an oligonucleotide, and such oligonucleotides can hybridize with complementary oligomeric compounds or target nucleic acids.

[0064] As used herein, “symptoms or features” means any physical feature or test result indicating the presence or degree of a disease or disorder. In certain embodiments, symptoms are evident to the subject or to a medical professional examining or testing the subject. In certain embodiments, features are evident by invasive diagnostic tests, including but not limited to post-mortem examinations. In certain embodiments, features are evident by MRI scans of the brain.

[0065] As used herein, “target nucleic acid” and “target RNA” mean the nucleic acid to which an antisense compound is designed to affect. Target RNA means RNA transcripts and includes pre-mRNA and mature mRNA unless otherwise specified.

[0066] As used herein, “target region” means the portion of a target nucleic acid with which an oligomeric compound is designed to hybridize.

[0067] As used herein, “end group” means a chemical group or atomic group that is covalently bonded to the end of an oligonucleotide.

[0068] As used herein, "therapeutic dose" refers to the amount of drug that produces a therapeutic effect on a subject. For example, a therapeutic dose improves the symptoms or characteristics of a disease or disorder.

[0069] As used herein, “to treat” means to improve the disease or disorder of interest by administering the oligomeric agent or oligomeric compound described herein. In certain embodiments, treating the subject means improving the symptoms compared to the same symptoms without treatment. In certain embodiments, treatment means reducing the severity or frequency of symptoms, delaying the onset of symptoms, slowing the progression of symptoms, or blunting the severity or frequency of symptoms.

[0070] Specific Embodiments This disclosure provides the following non-limiting numbered embodiments.

[0071] An oligomer compound comprising a modified oligonucleotide consisting of linked nucleosides of Embodiment 1.12 to 30, wherein the nucleic acid base sequence of the modified oligonucleotide is at least 85% complementary to equal-length portions of the PLP1 nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond.

[0072] An oligomer compound comprising linked nucleosides of Embodiment 2.12 to 30 and a modified oligonucleotide having a nucleic acid base sequence comprising at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases from any of the nucleic acid base sequences of SEQ ID NOs. 20 to 2155, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond.

[0073] It consists of linked nucleosides of Embodiments 3.12 to 30, and The equal-length portions of nucleic acid bases 9198-9222 in sequence number 2; The equal-length portions of nucleic acid bases 13702-13766 in sequence number 2; The equal-length portions of nucleic acid bases 14037-14062 in sequence number 2; The equal-length portions of nucleic acid bases 16761-16800 in sequence number 2; The equal-length portions of nucleic acid bases 17558-17602 in sequence number 2; The equal-length portions of nucleic acid bases 17615-17667 in sequence number 2; The equal-length portions of nucleic acid bases 17853-17883 in sequence number 2; The equal-length portions of nucleic acid bases 18097-18160 in sequence number 2; The equal-length portions of nucleic acid bases 18206-18237 in sequence number 2; The equal-length portions of nucleic acid bases 18237-18340 in sequence number 2; The equal-length portions of nucleic acid bases 18350-18387 in sequence number 2; The equal-length portions of nucleic acid bases 18412-18469 in sequence number 2; The equal-length portions of nucleic acid bases 18461-18506 in Sequence ID No. 2; The equal-length portions of nucleic acid bases 18539-18579 in sequence number 2; The equal-length portions of nucleic acid bases 18697-18727 in sequence number 2; The equal-length portions of nucleic acid bases 18755-18793 in sequence number 2; The equal-length portions of nucleic acid bases 18797-18819 in sequence number 2; The equal-length portions of nucleic acid bases 18839-18862 in sequence number 2; The equal-length portions of nucleic acid bases 18974-19021 in sequence number 2; The equal-length portions of nucleic acid bases 19028-19080 in sequence number 2; The equal-length portions of nucleic acid bases 19146-19173 in sequence number 2; The equal-length portions of nucleic acid bases 19228-19253 in sequence number 2; The equal-length portions of nucleic acid bases 19347-19393 in sequence number 2; The equal-length portions of nucleic acid bases 19550-19523 in SEQ ID NO: 2; or An oligomer compound comprising a modified oligonucleotide having a nucleic acid base sequence containing at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases complementary to the equal-length portion of nucleic acid bases 19512-19534 of SEQ ID NO: 2, The oligomer compound wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond.

[0074] Embodiment 4. An oligomeric compound comprising 12 to 30 linked nucleosides, Sequence IDs 1050, 1124, 2145, 2151, 2152, 2153; Sequence IDs 36, 86, 114, 164, 191, 242, 269, 426, 523, 602, 691, 780; Sequence IDs 89, 167, 245, 322, 323; Sequence IDs 720, 808, 904, 937, 1058, 1097, 1184, 1278, 1340; Sequence IDs 40, 41, 117, 118, 195, 196, 273, 274, 588, 690; Sequence IDs 42, 43, 119, 120, 197, 198, 275, 276, 373, 460, 1431, 1542, 1645, 1850, 1965, 2109; Sequence IDs 1451, 1499, 1543, 1654, 1733, 2154, 2155, Sequence IDs 200, 420, 504, 620, 646, 709, 823, 980, 1029, 1149, 1196, 1253, 1323, 1423, 1476, 1605, 1613, 1728, 1832; Sequence IDs 45, 46, 123, 124, 201, 202, 279, 280, 538, 562, 2091; Sequence numbers 48, 49, 50, 51, 52, 53, 125, 126, 127, 128, 129, 130, 131, 203, 204, 205, 206, 207, 208, 281, 282, 283, 284, 285, 286, 414, 459, 485, 503, 579, 580, 693, 724, 840, 873, 911, 1034, 1081, 1125, 1159, 1318, 1413, 1513, 1548, 1672, 1701, 1794, 186 8, 1958, 2002; Sequence IDs 209, 287, 335, 439, 506, 606, 659, 1922, 2033, 2104; Sequence IDs 784, 842, 869, 978, 1082, 1131, 1218, 1250, 1320, 1453, 1529, 1538, 1616, 1712, 1821; Sequence IDs 54, 55, 132, 133, 210, 288, 419, 499, 564, 665, 764, 800, 881, 993, 1059, 1200, 1295, 1354, 1422, 1465, 1544, 1705, 1802, 2149; Sequence IDs 338, 438, 525, 604, 658, 758, 813, 887, 977, 1043, 1108, 1199, 1258, 1336, 1395, 1514, 1557, 1668, 1697, 2089; Sequence IDs 875, 934, 1047, 1110, 1229, 1243, 1373, 1438, 2146, 2147; Sequence IDs 761, 798, 890, 946, 1022, 1120, 1198, 1293, 1358, 1398, 1463; Sequence IDs 56, 134, 683, 718; Sequence IDs 1610, 1663, 1702, 1786; Sequence IDs 212, 1060, 1090, 1181, 1277, 1446, 1510, 1589, 1646, 1693, 1772, 2148; Sequence IDs 57, 586, 666, 714, 812, 914, 951, 1052, 1138, 1162, 1248, 1363, 1455; Sequence IDs 385, 416, 545, 621, 682, 1968, 2055, 2101, 2150; Sequence IDs 363, 467, 541, 2008, 2111; Sequence IDs 58, 59, 136, 213, 214, 291, 292, 383, 417, 519, 612, 671, 730, 900, 986, 1019, 1136, 1353, 1457, 1504, 1546, 2093; Sequence IDs 398, 435, 2095, 2010, 2144; or The modified oligonucleotide comprises a nucleic acid base sequence having at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleic acid bases of a sequence selected from SEQ ID NOs. 1201, 1238, 1341, and 1435, The oligomer compound wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond.

[0075] Embodiment 5. The oligomer compound according to any one of Embodiments 1 to 4, wherein, when measured over the entire nucleic acid base sequence of the modified oligonucleotide, the modified oligonucleotide has a nucleic acid base sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleic acid base sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

[0076] Embodiment 6. The oligomer compound according to any one of Embodiments 1 to 5, wherein the modified oligonucleotide comprises at least one modified nucleoside containing a modified sugar moiety.

[0077] Embodiment 7. The oligomer compound according to Embodiment 6, wherein the modified oligonucleotide comprises at least one modified nucleoside containing a bicyclic sugar moiety.

[0078] Embodiment 8. The oligomer compound according to Embodiment 7, wherein the bicyclic sugar portion includes a 4'-2' crosslink, and the 4'-2' crosslink is selected from -CH2-O- and -CH(CH3)-O-.

[0079] Embodiment 9. The oligomer compound according to any one of Embodiments 6 to 8, wherein the modified oligonucleotide comprises at least one modified nucleoside containing a non-bicyclic modified sugar moiety.

[0080] Embodiment 10. The oligomer compound according to Embodiment 9, wherein the non-bicyclic modified sugar portion is a 2'-MOE sugar portion or a 2'-OMe sugar portion.

[0081] Embodiment 11. The oligomer compound according to any one of Embodiments 6 to 10, wherein the modified oligonucleotide comprises at least one modified nucleoside containing a sugar substitute.

[0082] Embodiment 12. The oligomer compound according to Embodiment 11, wherein the sugar substitute is any of morpholino, modified morpholino, PNA, THP, and F-HNA.

[0083] Embodiment 13. The oligomer compound according to any one of Embodiments 1 to 6 or 9 to 12, wherein the modified oligonucleotide does not contain a bicyclic sugar moiety.

[0084] Embodiment 14. The oligomer compound according to any one of Embodiments 1 to 13, wherein the modified oligonucleotide is a gapmer.

[0085] Embodiment 15. The modified oligonucleotide is A 5' region consisting of linked 5' region nucleosides 1-7; A central region consisting of 6-10 linked central region nucleosides; It includes a 3' region consisting of linked 3' region nucleosides 1 to 7, The oligomer compound according to any one of Embodiments 1 to 14, wherein each of the 5' region nucleosides and each of the 3' region nucleosides contains a modified sugar moiety, and each of the central region nucleosides contains a 2'-deoxyfuranosyl sugar moiety.

[0086] Embodiment 16. The modified oligonucleotide is A 5' region consisting of 5 linked 5' region nucleosides; A central region consisting of 10 linked central region nucleosides; It includes a 3' region consisting of 5 linked 3' region nucleosides, The oligomer compound according to Embodiment 15, wherein each of the 5' region nucleosides and each of the 3' region nucleosides is a 2'-MOE nucleoside, and each of the central region nucleosides is a 2'-β-D-deoxynucleoside.

[0087] Embodiment 17. The modified oligonucleotide is A 5' region consisting of six linked 5' region nucleosides, A central region consisting of 10 linked central region nucleosides, It includes a 3' region consisting of four linked 3' region nucleosides, The oligomer compound according to Embodiment 15, wherein each of the 5' region nucleosides and each of the 3' region nucleosides is a 2'-MOE nucleoside, and each of the central region nucleosides is a 2'-β-D-deoxynucleoside.

[0088] Embodiment 18. The oligomer compound according to any one of Embodiments 1 to 17, wherein the modified oligonucleotide comprises at least one modified nucleoside bond.

[0089] Embodiment 19. The oligomer compound according to Embodiment 18, wherein each nucleoside bond in the modified oligonucleotide is a modified nucleoside bond.

[0090] Embodiment 20. At least one nucleoside bond is a phosphorothioate nucleo The oligomer compound according to embodiment 18 or 19, wherein the bond is an interside bond.

[0091] Embodiment 21. The oligomer compound according to Embodiment 18 or 20, wherein the modified oligonucleotide comprises at least one phosphodiester nucleoside interbonding linkage.

[0092] Embodiment 22. The oligomer compound according to any one of Embodiments 18, 20, or 21, wherein each nucleoside bond is either a phosphodiester nucleoside bond or a phosphorothioate nucleoside bond.

[0093] Embodiment 23. The oligomer compound according to Embodiment 19, wherein each nucleoside bond is a phosphorothioate nucleoside bond.

[0094] Embodiment 24. The modified oligonucleotide has a nucleoside-to-nucleoside binding motif of soooosssssssssssooss or soooossssssssssss, in which case, The oligomeric compound according to any one of Embodiments 1 to 18 or 20 to 22, wherein s is a phosphorothioate nucleoside internucleoside linkage and o is a phosphodiester nucleoside internucleoside linkage.

[0095] Embodiment 25. The oligomeric compound according to any one of Embodiments 1 to 24, wherein the modified oligonucleotide contains at least one modified nucleobase.

[0096] Embodiment 26. The oligomeric compound according to Embodiment 25, wherein the modified nucleobase is 5-methylcytosine.

[0097] Embodiment 27. The oligomeric compound according to any one of Embodiments 1 to 26, wherein the modified oligonucleotide consists of 12 to 30, 12 to 22, 12 to 20, 14 to 18, 14 to 20, 15 to 17, 15 to 25, 16 to 18, 16 to 20, 17 to 20, 18 to 20 or 18 to 22 linked nucleosides.

[0098] Embodiment 28. The oligomeric compound according to any one of Embodiments 1 to 26, wherein the modified oligonucleotide consists of 16, 17, 18, 19, or 20 linked nucleosides.

[0099] Embodiment 29. The oligomeric compound according to Embodiment 28, wherein the modified oligonucleotide consists of 20 linked nucleosides.

[0100] Embodiment 30. The oligomeric compound according to Embodiment 28, wherein the modified oligonucleotide consists of 18 linked nucleosides.

[0101] Embodiment 31. An oligomeric compound having the following chemical notation: m C es m C eo m C eo A eo A eo T ds A ds G ds A dsT ds T ds m C ds A ds A ds m C ds T eo A eo G es m C es m C e (Array number 134); A es m C eo A eo m C eo A eo A ds m C ds T ds m C ds T ds T ds T ds A ds m C ds A ds A eo m C eo A es A es A e (Array number 411); T es m C eo T eo m C eo m C eo A ds G ds A ds m C ds A ds T ds T ds T ds m C ds T ds G eo A eo T es G es m C e (Array number 934); Ges T eo G eo T eo G eo T ds T ds A ds A ds A ds A ds T ds T ds G ds m C ds A eo A eo T es T es m C e (SEQ ID NO: 1238); A es T eo T eo G eo m C eo A ds A ds T ds T ds m C ds T ds A ds T ds A ds T ds m C eo A eo G es A es A e (SEQ ID NO: 2010); A es T eo G eo T eo G eo A ds T ds m C ds T ds A ds T ds A ds T ds m C ds A ds G eo G eo A es G es A e (SEQ ID NO: 1772); or A es m C eo m C eo A eo G eo A ds G ds G ds G ds m C ds m C ds A ds T ds m C ds T ds m C eo A eo G es G es T e (SEQ ID NO: 881) T es G eo T eo A eo G eo T ds A ds m C ds A ds A ds A ds T ds m C ds T ds T ds T eo m C eo m C es T es T e (SEQ ID NO: 2101); G es m C eo A eo T eo m C eo A ds G ds A<00002​​​​​​​​​​​​​​​​​eo T eo m C es T es T e (Sequence ID 1050); m C es m C eo T eo m C eo m C eo A ds T ds T ds m C ds m C ds T ds T ds T ds G ds T ds G eo A eo m C es T es T e (SEQ ID NO: 1449) contains a modified oligonucleotide, In the text, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, The oligomer compound wherein o is a phosphodiester nucleoside bond.

[0102] Embodiment 32. An oligomer compound, with the following chemical notation: T es G eo T eo A eo G eo T ds A ds m Cds A ds A ds A ds T ds m C ds T ds T ds T eo m C eo m C es T es T e Contains oligonucleotides related to (SEQ ID NO: 2101), as indicated in the text. A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, The oligomer compound wherein o is a phosphodiester nucleoside bond.

[0103] Embodiment 33. An oligomer compound, with the following chemical notation: A es m C eo A eo A eo A eo T eo m C ds T ds T ds T ds m C ds m C ds T ds T ds m C ds A ds A eo T es T es A e Includes modified oligonucleotides related to (SEQ ID NO: 682), as indicated in the notation: A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, The oligomer compound wherein o is a phosphodiester nucleoside bond.

[0104] Embodiment 34. An oligomer compound, with the following chemical notation: m C es A eo G eo A eo T eo G eo T ds T ds m C ds A ds T ds m C ds T ds m C ds T ds T ds m C eo A es m C es A e Modification related to (Sequence ID 1124) Contains oligonucleotides, as indicated: A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, The oligomer compound wherein o is a phosphodiester nucleoside bond.

[0105] Embodiment 35. An oligomer compound, with the following chemical notation: m C es A eo T eo m C eo A eo G eo A ds T ds G ds T ds T ds m C ds A ds T ds m C ds T ds m C eo T es T es m C e Includes modified oligonucleotides related to (SEQ ID NO: 2145), as indicated in the notation: A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, The oligomer compound wherein o is a phosphodiester nucleoside bond.

[0106] Embodiment 36. The oligomer compound according to any one of Embodiments 1 to 35, wherein the oligomer compound is a single-chain oligomer compound.

[0107] Embodiment 37. An oligomer compound according to any one of Embodiments 1 to 36, comprising the modified oligonucleotide.

[0108] Embodiment 38. An oligomer compound according to any one of Embodiments 1 to 36, further comprising a conjugate group.

[0109] Embodiment 39. The oligomer compound according to Embodiment 38, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.

[0110] Embodiment 40. The oligomer compound according to Embodiment 38, comprising a GalNAc cluster containing 1 to 3 GalNAc ligands as conjugate groups.

[0111] Embodiment 41. The oligomer compound according to Embodiment 38 or 39, wherein the conjugate linker consists of a single bond.

[0112] Embodiment 42. The oligomer compound according to Embodiment 39 or 41, wherein the conjugate linker is cleavable.

[0113] Embodiment 43. The oligomer compound according to Embodiment 39 or 42, wherein the conjugate linker comprises 1 to 3 linker nucleosides.

[0114] Embodiment 44. The oligomer compound according to any one of Embodiments 38 to 43, wherein the conjugate group is bonded to the modified oligonucleotide at the 5' end of the modified oligonucleotide.

[0115] Embodiment 45. The oligomer compound according to any one of Embodiments 38 to 43, wherein the conjugate group is bonded to the modified oligonucleotide at the 3' end of the modified oligonucleotide.

[0116] Embodiment 46. An oligomer compound according to any one of Embodiments 1 to 36 or 38 to 45, further comprising terminal groups.

[0117] Embodiment 47. The oligomer compound according to any one of Embodiments 1 to 42 or 44 to 46, wherein the oligomer compound does not contain a linker nucleoside.

[0118] Embodiment 48. The oligomer compound according to any one of Embodiments 1 to 47, wherein the modified oligonucleotide of the oligomer compound is a salt, and the salt is a sodium salt or a potassium salt.

[0119] Embodiment 49. The oligomer compound according to any one of Embodiments 1 to 48, wherein the modified oligonucleotide is an RNAi compound.

[0120] Embodiment 50. An oligomeric double chain comprising the oligomeric compound described in any of Embodiments 1 to 35 or 37 to 49.

[0121] Embodiment 51. An antisense compound comprising an oligomer compound described in any of Embodiments 1 to 49 or an oligomer double chain described in Embodiment 50, or comprising the oligomer compound or the oligomer double chain.

[0122] Embodiment 52. The following chemical structure: [ka] (Sequence ID 2101) Modified oligonucleotides or salts thereof relating to the above.

[0123] Embodiment 53. The modified oligonucleotide according to Embodiment 52, which is a sodium salt or a potassium salt.

[0124] Embodiment 54. Modified oligonucleotide relating to the following chemical structure: [ka] (Sequence ID 2101)

[0125] Embodiment 55. The following chemical structure: [ka] (Sequence No. 682) Modified oligonucleotides or salts thereof relating to the above.

[0126] Embodiment 56. The modified oligonucleotide according to Embodiment 55, which is a sodium salt or a potassium salt.

[0127] Embodiment 57. Modified oligonucleotides relating to the following chemical structures: [ka] (Sequence number 682).

[0128] Embodiment 58. The following chemical structure: [ka] (Sequence ID 1124) Modified oligonucleotides or salts thereof relating to the above.

[0129] Embodiment 59. The modified oligonucleotide according to Embodiment 58, which is a sodium salt or a potassium salt.

[0130] Embodiment 60. Modified oligonucleotide relating to the following chemical structure: [ka] (Sequence ID 1124).

[0131] Embodiment 61. The following chemical structure: [ka] (Sequence ID 2145) Modified oligonucleotides or salts thereof relating to the above.

[0132] Embodiment 62. The modified oligonucleotide according to Embodiment 61, which is a sodium salt or a potassium salt.

[0133] Embodiment 63. Modified oligonucleotide relating to the following chemical structure: [ka] (Sequence ID 2145).

[0134] Embodiment 64. A pharmaceutical composition comprising an oligomeric compound according to any of Embodiments 1 to 49, an oligomeric double-chain according to Embodiment 50, an antisense compound according to Embodiment 51, or a modified oligonucleotide according to any of Embodiments 52 to 63, and a pharmaceutically acceptable diluent or carrier.

[0135] Embodiment 65. The pharmaceutical composition according to Embodiment 64, comprising a pharmaceutically acceptable diluent, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate-buffered saline (PBS).

[0136] Embodiment 66. The pharmaceutical composition according to Embodiment 65, wherein the pharmaceutical composition essentially consists of the oligomer compound or the modified oligonucleotide and aCSF.

[0137] Embodiment 67. The pharmaceutical composition according to Embodiment 65, wherein the pharmaceutical composition essentially consists of the oligomer compound or the modified oligonucleotide and PBS.

[0138] Embodiment 68. A pharmaceutical composition comprising a modified oligonucleotide according to any one of Embodiments 52 to 63 and a pharmaceutically acceptable diluent.

[0139] Embodiment 69. The pharmaceutical composition according to Embodiment 68, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate-buffered saline (PBS).

[0140] Embodiment 70. The pharmaceutical composition according to Embodiment 69, wherein the pharmaceutical composition essentially consists of the modified oligonucleotide and aCSF.

[0141] Embodiment 71. The pharmaceutical composition according to Embodiment 69, wherein the pharmaceutical composition essentially consists of the modified oligonucleotide and PBS.

[0142] Embodiment 72. A pharmaceutical composition comprising an oligomer compound according to any of Embodiments 32 to 35 and a pharmaceutically acceptable diluent.

[0143] Embodiment 73. The pharmaceutical composition according to Embodiment 72, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate-buffered saline (PBS).

[0144] Embodiment 74. The pharmaceutical composition is essentially composed of the oligomer compound and aCSF. The pharmaceutical composition according to Embodiment 73.

[0145] Embodiment 75. The pharmaceutical composition according to Embodiment 73, wherein the pharmaceutical composition essentially consists of the oligomer compound and PBS.

[0146] Embodiment 76. A chiral enrichment of modified oligonucleotides according to any one of Embodiments 52 to 63, wherein the enrichment is concentrated with respect to modified oligonucleotides having a specific stereochemical configuration and containing at least one specific phosphorothioate nucleoside bond.

[0147] Embodiment 77. The chiral enriched population according to Embodiment 76, wherein the population is enriched with respect to modified oligonucleotides containing at least one specific phosphorothioate nucleoside bond having a (Sp) configuration.

[0148] Embodiment 78. The chiral enriched population according to Embodiment 76, wherein the population is enriched with respect to modified oligonucleotides containing at least one specific phosphorothioate nucleoside bond having a (Rp) configuration.

[0149] Embodiment 79. The chiral enriched population according to Embodiment 76, wherein the population is enriched with respect to modified oligonucleotides having a specific, independently selected stereochemical configuration at each phosphorothioate nucleoside bond.

[0150] Embodiment 80. The chiral enriched population according to Embodiment 79, wherein the population is enriched with respect to modified oligonucleotides having a (Sp) configuration at each phosphorothioate nucleoside bond, or with respect to modified oligonucleotides having a (Rp) configuration at each phosphorothioate nucleoside bond.

[0151] Embodiment 81. The chiral enriched population according to Embodiment 79, wherein the population is enriched with respect to modified oligonucleotides having a (Rp) configuration at one specific phosphorothioate nucleoside bond and a (Sp) configuration at each of the remaining phosphorothioate nucleoside bonds.

[0152] Embodiment 82. The chiral enriched population according to Embodiment 79, wherein the population is enriched with respect to modified oligonucleotides having at least three consecutive phosphorothioate nucleoside bonds in an Sp, Sp, and Rp configuration in the 5' to 3' direction.

[0153] Embodiment 83. A group of modified oligonucleotides according to any one of Embodiments 52 to 63, wherein all of the phosphorothioate nucleoside bonds of the modified oligonucleotide are sterically random.

[0154] Embodiment 84. A chiral enrichment population of oligomer compounds according to any one of Embodiments 32 to 35, wherein the population is enriched with respect to oligomer compounds having a specific stereochemical configuration and containing at least one specific phosphorothioate nucleoside bond.

[0155] Embodiment 85. The chiral enriched population according to Embodiment 84, wherein the population is enriched with respect to an oligomeric compound comprising at least one specific phosphorothioate nucleoside interbond having a (Sp) configuration.

[0156] Embodiment 86. The group has at least one specific phosphorothio having a (Rp) arrangement A chiral enrichment population according to Embodiment 84, wherein oligomeric compounds containing ethonucleoside bonds are enriched.

[0157] Embodiment 87. The chiral enriched population according to Embodiment 84, wherein the population is enriched with respect to oligomeric compounds having a specific, independently selected stereochemical configuration at each phosphorothioate nucleoside bond.

[0158] Embodiment 88. The chiral enriched population according to Embodiment 87, wherein the population is enriched with respect to oligomeric compounds having an (Sp) configuration at each phosphorothioate nucleoside bond, or with respect to modified oligonucleotides having an (Rp) configuration at each phosphorothioate nucleoside bond.

[0159] Embodiment 89. The chiral enriched population according to Embodiment 87, wherein the population is enriched with respect to oligomeric compounds having a (Rp) configuration at one specific phosphorothioate nucleoside bond and a (Sp) configuration at each of the remaining phosphorothioate nucleoside bonds.

[0160] Embodiment 90. The chiral enriched population according to Embodiment 87, wherein the population is enriched with respect to oligomeric compounds having at least three consecutive phosphorothioate nucleoside bonds in an Sp, Sp, and Rp configuration in the 5' to 3' direction.

[0161] Embodiment 91. A group of oligomeric compounds according to any one of Embodiments 32 to 35, wherein all of the phosphorothioate nucleoside bonds of the modified oligonucleotide are sterically random.

[0162] Embodiment 92. A pharmaceutical composition comprising a chiral concentrated population according to any one of Embodiments 76-82 or 84-90, or the population according to claim 83, or the population according to claim 91, and a pharmaceutically acceptable diluent.

[0163] Embodiment 93. The pharmaceutical composition according to claim 92, wherein the pharmaceutically acceptable diluent is artificial CSF (aCSF) or phosphate-buffered saline (PBS).

[0164] Embodiment 94. The pharmaceutical composition according to claim 93, wherein the pharmaceutical composition essentially consists of the oligomer compound or the modified oligonucleotide and artificial CSF (aCSF).

[0165] Embodiment 95. The pharmaceutical composition according to Embodiment 93, wherein the pharmaceutical composition essentially consists of the oligomer compound or the modified oligonucleotide and PBS.

[0166] Embodiment 96. A method comprising administering to an animal a pharmaceutical composition according to any one of Embodiments 64-75 or 92-95.

[0167] Embodiment 97. A method for treating a disease or disorder related to PLP1, comprising administering a therapeutically effective amount of a pharmaceutical composition according to any one of Embodiments 64-75 or 92-95 to a subject who has or is at risk of developing a disease related to PLP1, thereby treating the disease or disorder related to PLP1.

[0168] Embodiment 98. A method for reducing PLP1 protein in the CSF of a subject having or at risk of developing a disease or disorder related to PLP1, wherein the PLP1 protein is reduced in the CSF by a therapeutically effective amount of the pharmaceutical composition described in any of Embodiments 64-75 or 92-95. A method for reducing protein.

[0169] Embodiment 99. The method according to Embodiment 97 or 98, wherein the disease or disorder associated with PLP1 is a neurodegenerative disease.

[0170] Embodiment 100. The method according to any one of Embodiments 97 to 99, wherein the disease or disorder associated with PLP1 is leukodystrophy.

[0171] Embodiment 101. The method according to Embodiment 100, wherein the leukodystrophy is PMD.

[0172] Embodiment 102. The method according to Embodiment 101, wherein the PMD is one of severe PMD, standard PMD, or transitional PMD.

[0173] Embodiment 103. The method according to Embodiment 101, wherein the PMD is caused by overexpression of the PLP1 protein.

[0174] Embodiment 104. The method according to Embodiment 101, wherein the PMD is caused by multiple copies of the PLP1 gene.

[0175] Embodiment 105. The method according to Embodiment 101, wherein the PMD is caused by the expression of a replicated copy of the PLP1 gene.

[0176] Embodiment 106. The method according to any one of Embodiments 100 to 105, wherein at least one symptom or characteristic of the leukodystrophy is improved.

[0177] Embodiment 107. The method according to Embodiment 97 or 98, wherein the disease or disorder associated with PLP1 is SPG2.

[0178] Embodiment 108. The method according to Embodiment 107, wherein at least one symptom or characteristic of SPG2 is improved.

[0179] Embodiment 109. The method according to Embodiment 106 or 108, wherein the symptom or feature is any one of hypotonia, nystagmus, optic nerve atrophy, dyspnea, motor delay, cognitive impairment, speech impairment, spasticity, ataxia, seizures, choroidal motion, and death.

[0180] Embodiment 110. The method according to any one of Embodiments 96 to 109, wherein administration of the modified oligonucleotide reduces muscle tone, nystagmus, optic nerve atrophy, dyspnea, motor delay, cognitive impairment, speech impairment, spasticity, ataxia, seizures, or choroidal motion in a subject, or delays death.

[0181] Embodiment 111. The method according to any one of Embodiments 96 to 110, wherein the pharmaceutical composition is administered to the central nervous system or systemically.

[0182] Embodiment 112. The method according to Embodiment 111, wherein the pharmaceutical composition is administered to the central nervous system or systemically.

[0183] Embodiment 113. The method according to any one of Embodiments 96 to 110, wherein the pharmaceutical composition is administered intrathecally, systemically, subcutaneously, or intramuscularly.

[0184] Embodiment 114. A method for reducing intracellular PLP1 RNA, comprising contacting the cells with an oligomeric compound described in any of Embodiments 1 to 49, an oligomeric double-stranded compound described in Embodiment 50, an antisense compound described in Embodiment 51, or a modified oligonucleotide described in any of Embodiments 52 to 63, thereby reducing PLP1 RNA in the cells.

[0185] Embodiment 115. A method for reducing intracellular PLP1 protein, comprising contacting the cells with an oligomeric compound according to any of Embodiments 1 to 49, an oligomeric double-chain according to Embodiment 50, an antisense compound according to Embodiment 51, or a modified oligonucleotide according to any of Embodiments 52 to 63, thereby reducing PLP1 protein in the cells.

[0186] Embodiment 116. The method according to Embodiment 114 or 115, wherein the cells are oligodendrocytes or oligodendrocyte progenitor cells.

[0187] Embodiment 117. The method according to Embodiment 114 or 115, wherein the cells are Schwann cells or Schwann cell progenitor cells.

[0188] Embodiment 118. The method according to any one of Embodiments 114 to 117, wherein the cells are present in an animal.

[0189] Embodiment 119. The method according to Embodiment 96 or 118, wherein the animal is a human.

[0190] Embodiment 120. A method comprising administering a pharmaceutical composition described in any of Embodiments 68 to 71 to a target.

[0191] Embodiment 121. A method for treating a disease or disorder related to PLP1, comprising administering a therapeutically effective amount of a pharmaceutical composition described in any of Embodiments 68 to 71 to a subject who has or is at risk of developing a disease or disorder related to PLP1, thereby treating the disease or disorder related to PLP1.

[0192] Embodiment 122. The method according to Embodiment 121, wherein the disease associated with PLP1 is a neurodegenerative disease.

[0193] Embodiment 123. The method according to Embodiment 122, wherein the neurodegenerative disease is leukodystrophy.

[0194] Embodiment 124. The method according to Embodiment 123, wherein the leukodystrophy is PMD.

[0195] Embodiment 125. The method according to Embodiment 124, wherein the PMD is one of severe PMD, standard PMD, or transitional PMD.

[0196] Embodiment 126. The method according to Embodiment 124, wherein the PMD is caused by overexpression of the PLP1 protein.

[0197] Embodiment 127. The method according to Embodiment 124, wherein the PMD is caused by multiple copies of the PLP1 gene.

[0198] Embodiment 128. The PMD is triggered by the expression of a replicated copy of the PLP1 gene. The method described in Embodiment 124 is brought about.

[0199] Embodiment 129. The method according to any one of Embodiments 122 to 128, wherein at least one symptom or characteristic of the neurodegenerative disease is improved.

[0200] Embodiment 130. The method according to Embodiment 129, wherein the symptom or feature is any one of hypotonia, nystagmus, optic nerve atrophy, dyspnea, motor delay, cognitive impairment, speech impairment, spasticity, ataxia, seizures, choroidal motion, and death.

[0201] Embodiment 131. The method according to any one of Embodiments 121 to 130, wherein administration of the pharmaceutical composition reduces muscle hypotonia, nystagmus, optic nerve atrophy, dyspnea, motor delay, cognitive impairment, speech impairment, spasticity, ataxia, seizures, or choroidal motion, or delays death in the subject.

[0202] Embodiment 132. The method according to any one of Embodiments 120 to 131, wherein the subject is a human.

[0203] Embodiment 133. A method for reducing the expression of PLP1 in cells, comprising contacting the cells with a modified oligonucleotide described in any of Embodiments 52 to 63.

[0204] Embodiment 134. The method according to Embodiment 133, wherein the cells are human cells.

[0205] Embodiment 135. Use of an oligomeric compound according to any of Embodiments 1 to 49, an oligomeric double-strand according to Embodiment 50, an antisense compound according to Embodiment 51, or a modified oligonucleotide according to any of Embodiments 52 to 63 to reduce PLP1 expression in cells.

[0206] Embodiment 136. The use according to Embodiment 135, wherein the RNA level of PLP1 is reduced in the cells.

[0207] Embodiment 137. The use according to Embodiment 135, wherein the level of the PLP1 protein in the cells is reduced.

[0208] Embodiment 138. The use according to any one of Embodiments 133 to 137, wherein the cells are oligodendrocytes or oligodendrocyte precursor cells.

[0209] Embodiment 139. The use according to any one of Embodiments 133 to 137, wherein the cells are Schwann cells or Schwann cell progenitor cells.

[0210] Specific oligonucleotides In certain embodiments, this specification provides oligomeric compounds comprising oligonucleotides consisting of bound nucleosides. The oligonucleotide may be an unmodified oligonucleotide (RNA or DNA) or a modified oligonucleotide. The modified oligonucleotide includes at least one modification to the unmodified RNA or DNA. That is, the modified oligonucleotide includes at least one modified nucleoside (a nucleoside containing a modified sugar and / or a modified nucleic acid base) and / or at least one modified nucleoside bond.

[0211] A. Specific modified nucleosides Modified nucleosides contain either a modified sugar moiety, a modified nucleic acid base, or both.

[0212] 1. Specific sugar portion In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar substitute. Such a sugar substitute may contain one or more substitutions corresponding to substitutions of other types of substituted sugar moieties.

[0213] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanosyl ring having one or more substituents such that none of them bridge two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridged substituents may be at any position of the furanosyl ring, including but not limited to the 2', 4', and / or 5' substituents. In certain embodiments, one or more non-bridged substituents of the non-bicyclic modified sugar moiety are branched. Examples of suitable 2'- substituents for the non-bicyclic modified sugar moiety include, but are not limited to, 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE" or "O-methoxyethyl"). In certain embodiments, the 2'- substituents may be halo, allyl, amino, azide, SH, CN, OCN, CF3, OCF3, O-C1~C 10 Alkoxy, O-C1~C 10Substitutive alkoxy, O-C1~C 10 Alkyl, O-C1~C 10 Substitutive alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-Alkenyl, O-Alkinyl, S-Alkinyl, N(R m )-Alkynyl, O-Alkyrenyl-O-Alkyl, Alkynyl, Alkalyl, Aralkyl, O-Alkalyl, O-Aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), or OCH2C(=O)-N(R m )(R n ) are selected, and in that case, each R m and R n These are independently H, an amino protecting group, or substituted or unsubstituted C1-C1. 10 These are alkyl and 2'-substituents as described in Cook et al., US6,531,584, Cook et al., US5,859,221, and Cook et al., US6,005,087. Specific embodiments of these 2'-substituents can be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Suitable 4'-substituents for the non-bicyclic modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO2015 / 106128. Suitable 5'-substituents for the non-bicyclic modified sugar moiety include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, the non-bicyclic modified sugar moiety includes a plurality of non-crosslinked sugar substituents, such as a 2'-F-5'-methyl sugar moiety, as well as modified sugar moieties and modified nucleosides described in Migawa et al., WO2008 / 101157 and Rajeev et al., US2013 / 0203836.

[0214] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is F, NH2, N3, OCF 3、 OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)-N(R m )(R n )) comprises a sugar moiety containing a non-crosslinked 2'- substituent selected from, in which case each R m and R n These are independently H, an amino protecting group, or substituted or unsubstituted C1-C1. 10 It is alkyl.

[0215] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is F, OCF 3、 OCH3 The sugar moiety includes a non-crosslinked 2'-substituent selected from OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").

[0216] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety containing a non-crosslinked 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.

[0217] In certain embodiments, the modified furanosyl sugar moiety and the nucleoside incorporating such modified furanosyl sugar moiety are further defined by their isomer configuration. For example, the 2'-deoxyfuranosyl sugar moiety may have seven isomer configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described, for example, in WO2019 / 157531, which is incorporated herein by reference. The 2'-modified sugar moiety has an additional stereocenter at the 2' position relative to the 2'-deoxyfuranosyl sugar moiety; thus, such a sugar moiety has a total of 16 possible isomer configurations. The 2'-modified sugar moieties described herein are in the β-D-ribosyl isomer configuration unless otherwise specified.

[0218] Certain modified sugar moieties include substituents that result in a bicyclic sugar moiety by bridging two atoms of a furanosyl ring to form a second ring. Nucleosides containing such a bicyclic sugar moiety are called bicyclic nucleosides (BNAs), locked nucleosides, or conformationally restricted nucleotides (CRNs). Certain such compounds are described in U.S. Patent Publication 2013 / 0190383 and PCT Publication WO2013 / 036868. In certain such embodiments, the bicyclic sugar moiety includes a bridge between a 4'-furanose ring atom and a 2'-furanose ring atom. In certain such embodiments, the furanose ring is a ribose ring. Examples of such 4'-to-2' bridging sugar substituents include 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "restricted ethyl" or "cEt" in the S configuration), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CH2OCH3)-O-2' ("restricted MOE" or "cMOE") and their analogues (e.g., Seth et al., US7, 399, 845, Bhat et al., US7, 569, 686, Swayze et al.) al.,US7,741,457, and Swayze See et al., US8, 022, 193), 4'-C(CH3)(CH3)-O-2' and its analogues (see, for example, Seth et al., US8, 278, 283), 4'-CH2-N(OCH3)-2' and its analogues (see, for example, Prakash et al., US8, 278, 425), 4'-CH2-ON(CH3)-2' (see, for example, Allerson et al., US7, 696, 345 and Allerson et al., US8, 124, 745), 4'-CH2-C(H)(CH3)-2' (see, for example, Zhou, et al. See al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and its analogues (see, for example, Seth et al., US8, 278, 426), 4'-C(R a R b )-N(R)-O-2',4'-C(R a R b Examples include )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2', but are not limited to these, and each R, R a , and R b These are independently H, protecting groups, or C1-C 12 It is alkyl (see, for example, Imanishi et al., US 7,427,672).

[0219] In certain embodiments, such a 4' to 2' crosslink is -[C(R a )(R b )] n -,-[C(R a )(R b )] n -O-, -C(R a )=C(R b )-,-C(R a )= N-, -C (=NR) a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x -, and -N(Ra )- is independently composed of 1 to 4 linking groups independently selected from; During the ceremony, x is 0, 1, or 2, n is 1, 2, 3, or 4. Each R a and R b These are independently H, protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2~C 12 Alkenyl substitution C2~C 12 Alkenyl, C2~C 12 Alkinyl substitution C2~C 12 Alkinyl, C5~C 20 Aryl substitution C5~C 20 Aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1), where each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2~C 12 Alkenyl substitution C2~C 12 Alkenyl, C2~C 12 Alkinyl substitution C2~C 12 Alkinyl, C5~C 20 Aryl substitution C5~C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1~C 12 Aminoalkyl, substituted C1-C 12 It is an aminoalkyl group or a protecting group.

[0220] The particle size of the solvent was determined by Freier et al.,Nucleic Acids Research,1997,25(22),4429-4443,Albaek et al.,J.Org.Chem.,2006,71,7731-7740,Singh et al.,Chem.Commun.,1998,4,455-456;Koshkin et al al.,Tetrahedron,1998,54,3607-3630;Wahlestedt et al.,Proc.Natl.Acad.Sci.USA,2000,97,5633-5638;Kumar et al.,Bioorg.Med.Chem.Lett.,1998,8,2219-2222;Singh et al al.,J.Org.Chem.,1998,63,10035-10039;Srivastava et al.,J.Am.Chem.Soc.,2007,129,8362-8379;Elayadi et al.,Curr.Opinion Invens.Drugs,2001,2,558-561;Braasch et al al.,Chem.Biol.,2001,8,1-7;Orum et al.,Curr.Opinion Mol.Ther.,2001,3,239-243;Wengel et al.,US7,053,207,Imanishi et al.,US6,268,490,Imanishi et al.US6,770,748,Imanishi et al al.,USRE44,779;Wengel et al.,US6,794,499,Wengel et al.,US6,670,461;Wengel et al.,US7,034,133,Wengel et al.,US8,080,644; al.,US7,572,582;In addition to Ramasamy et al.,US6,525,191,Torsten et al.,WO 2004 / 106356,Wengel et al.,WO 1999 / 014226;Seth et al.,WO 2007 / 134181;Seth et al.,US7,547,684;Seth et al.,US7,666,854;Seth et al.,US8,088,746;Seth et al.,US7,750,131;Seth et al.,US8,030,467;Seth et al. al.,US8,268,980;Seth et al.,US8,546,556;Seth et al.,US8,530,640;Migawa et al.,US9,012,421;Se. See th et al., US8, 501, 805; Allerson et al., US2008 / 0039618; and Migawa et al., US2015 / 0191727. In certain embodiments, the bicyclic sugar moiety and the nucleoside incorporating such a bicyclic sugar moiety are further defined by their isomer configuration. For example, an LNA nucleoside (as described herein) may be in an α-L configuration or a β-D configuration.

[0221] [ka] α-L-methyleneoxy(4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides exhibiting antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this specification, the general description of bicyclic nucleosides includes both isomer configurations. In the examples illustrated herein, when the position of a particular bicyclic nucleoside (e.g., LNA or cEt) is specified, they are in the β-D configuration unless otherwise specified.

[0222] In certain embodiments, the modified sugar moiety includes one or more non-crosslinked sugar substituents and one or more crosslinked sugar substituents (e.g., 5'-substituted and 4'-2'-crosslinked sugars).

[0223] In certain embodiments, the modified sugar moiety is a sugar substitute. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur atom, a carbon atom, or a nitrogen atom. In certain such embodiments, such a modified sugar moiety also includes bridging substituents and / or non-bridging substituents as described herein. For example, certain sugar substitutes include a 4'-sulfur atom and substitutions at the 2' position (see, e.g., Bhat et al., US7,875,733 and Bhat et al., US7,939,677) and / or the 5' position.

[0224] In certain embodiments, the sugar substitute comprises a ring having atoms other than five atoms. For example, in certain embodiments, the sugar substitute comprises a six-membered ring tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, for example, Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA: [ka] Examples include, but are not limited to, nucleosides containing ("F-HNA," e.g., Swayze et al., US8,088,904; Swayze et al., US8,440,803; Swayze et al., US8,796,437; and Swayze et al., US9,005,906; F-HNA can also be called F-THP or 3'-fluorotetrahydropyran), and further modified THP compounds having the following formula. [ka] In the formula, independently for each of the modified THP nucleosides, Bx is the nucleic acid base portion, T3 and T4 are independently internucleoside linking groups that link a modified THP nucleoside to the rest of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group that links a modified THP nucleoside to the rest of the oligonucleotide, and the other of T3 and T4 is H, a hydroxyl protecting group, a linking conjugate group, or a 5' or 3' terminal group. q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl. Each of R1 and R2 is independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each of J1, J2, and J3 is independently H or C1-C6 alkyl.

[0225] In certain embodiments, modified THP nucleosides are provided in which q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is not H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided in which one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0226] In certain embodiments, the sugar substitute comprises a ring having more than 5 atoms and more than 1 heteroatom. For example, the use of nucleosides and oligonucleotides containing morpholino sugar moieties has been reported (see, e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510, and Summerton et al., US5, 698, 685; Summerton et al., US5, 166, 315; Summerton et al., US5, 185, 444; and Summerton et al., US5, 034, 506). As used herein, the term “morpholino” means a sugar substitute having the following structure: [ka] In certain embodiments, the morpholino can be modified, for example, by adding or altering various substituents to the morpholino structure. Such sugar substitutes are referred to herein as “modified morpholinos.”

[0227] In certain embodiments, the sugar substitute includes an acyclic moiety. Examples of nucleosides and oligonucleotides containing such acyclic sugar substitutes include peptide nucleic acids ("PNA") and acyclic butyl nucleic acids (e.g., Kumar et al., Org. Biomol. CHem., 2 Examples include, but are not limited to, the nucleosides and oligonucleotides described in 013,11,5853-5865 and Manoharan et al., WO2011 / 133876.

[0228] Many other bicyclic and tricyclic sugars, as well as sugar substitute ring systems, that can be used in modified nucleosides are known in the art.

[0229] 2. Specific modified nucleic acid bases In certain embodiments, the modified oligonucleotide comprises one or more nucleosides containing unmodified nucleic acid bases. In certain embodiments, the modified oligonucleotide comprises one or more nucleosides containing modified nucleic acid bases. In certain embodiments, the modified oligonucleotide comprises one or more nucleosides that do not contain nucleic acid bases, called debased nucleosides.

[0230] In certain embodiments, the modified nucleic acid base is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6-substituted purines. In certain embodiments, the modified nucleic acid bases are 5-methylcytosine, 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl(-C≡C-CH3)uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azocymine, 5-ribosyluracil (pseudracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo The following are selected from, in particular, 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl4-N-benzoylcytosine, 5-methyl4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleic acid bases include tricyclic pyrimidines such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleic acid bases may also include those in which a purine base or pyrimidine base is replaced with another heterocycle, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleic acid bases are disclosed in Merigan et al., US3, 687, 808; The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288; and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0231] For publications instructing on the preparation of specific modified nucleic acid bases and other modified nucleic acid bases, see Manoharan et al., US2003 / 0158403;M anoharan et al.,US2003 / 0175906;Dinh et al.,US4,845,205;Spielvogel et al.,US5,130,302;Rogers et al.,US5,134,066;Bischofberger et al.,US5,175,273;Urdea et al. al.,US5,367,066;Benner et al.,US5,432,272;Matteucci et al.,US5,434,257;Gmeiner et al.,US5,457,187;Cook et al.,US5,459,255;Froehler et al.,US5,484,908;Matteucci et al al.,US5,502,177;Hawkins et al.,US5,525,711;Haralambidis et al.,US5,552,540;Cook et al.,US5,587,469;Froehler et al.,US5,594,121;Switzer et al.,US5,596,091;Cook et al.,US5,614,617;Froehler et al.,US5,645,985;Cook et al.,US5,681,941; et al.,US5,948,903;Cook et al.,US5,587,470;Cook et al.,US5,457,191;Matteucci et al.,US5,763,588;Froehler et al.,US5,830,653;Cook et al.,US5,808,027;Cook et al.,US5,808,027; al.,6,166,199;also available in Matteucci et al.,US6,005,096;

[0232] 3.Federal snowflakes In certain embodiments, the nucleosides of modified oligonucleotides may be linked to each other using arbitrary internucleoside bonds. Two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside bonds include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates ("P(O2)=S") and phosphorodithioates ("HS-P=S") containing phosphodiester bonds ("P(O2)=O") (also called unmodified bonds or naturally occurring bonds). Representative phosphorus-free internucleoside linkages include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiesters, thionocarbamates (-OC(=O)(NH)-S-), siloxanes (-O-SiH2-O-), and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages can be used to alter, or typically enhance, the nuclease resistance of oligonucleotides compared to naturally occurring phosphodiester internucleoside linkages. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing and phosphorus-free internucleoside linkages are well known to those skilled in the art.

[0233] Representative nucleoside bonds containing a chiral center include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing nucleoside bonds containing a chiral center can be prepared as a group of modified oligonucleotides containing sterically random nucleoside bonds, or as a group of modified oligonucleotides containing phosphorothioate nucleoside bonds with a specific stereochemical configuration. In certain embodiments, the group of modified oligonucleotides contains phosphorothioate nucleoside bonds, all of which are sterically random. Such modified oligonucleotides can be produced using synthetic methods that result in a random selection of the stereochemical configuration of each phosphorothioate nucleoside bond. Nevertheless, as will be well understood by those skilled in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereochemistry. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides containing one or more specific phosphorothioate nucleoside bonds in a specific stereochemical configuration, which are independently selected. In certain embodiments, the specific configuration of the specific phosphorothioate nucleoside bond is present in at least 65% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate nucleoside bond is present in at least 70% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate nucleoside bond is present in at least 80% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate nucleoside bond is present in at least 90% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate nucleoside bond is present in at least 99% of the molecules in the population. Such chiral-enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, e.g., Oka et al., JACS, 2003, 125, 8307, Wan et al., Nuc. Acid. Res., 2014, 42, 13456, and WO2017 / 015555. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides containing (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulas, where "B" represents a nucleic acid base. [ka] Unless otherwise specified, the chiral nucleoside bonds of the modified oligonucleotides described herein may be sterically random or in a specific stereochemical configuration.

[0234] Examples include phosphotriesters, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Further neutral nucleoside bonds include nonionic bonds, which include siloxanes (dialkylsiloxanes), carboxylic acid esters, carboxamides, sulfides, sulfonic acid esters, and amides (see, for example, Carbohydrate Modifications in Antisense Research; YSSanghvi and PDCook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral nucleoside bonds include nonionic bonds, which include the N, O, S, and CH2 component moieties of the mixture.

[0235] B. Specific motifs In certain embodiments, the modified oligonucleotide comprises one or more modified nucleosides containing a modified sugar moiety. In certain embodiments, the modified oligonucleotide comprises one or more modified nucleosides containing a modified nucleic acid base. In certain embodiments, the modified oligonucleotide comprises one or more This includes modified nucleoside-interbonding. In such embodiments, the modified, unmodified, and otherwise modified sugar moieties, nucleic acid bases, and / or nucleoside-interbonding of the modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of the sugar moieties, nucleic acid bases, and nucleoside-interbonding are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleic acid base motif, and / or nucleoside-interbonding motif (wherein use herein, the nucleic acid base motif describes a modification to the nucleic acid base that is independent of the sequence of the nucleic acid base).

[0236] 1. Specific sugar motifs In certain embodiments, the oligonucleotide comprises one or more modified sugar moieties and / or unmodified sugar moieties arranged along the oligonucleotide or a portion thereof in a defined pattern or sugar modification motif. In certain examples, such sugar motifs include, but are not limited to, any of the sugar modifications discussed herein.

[0237] In certain embodiments, the modified oligonucleotide has a gapmer motif defined by two external regions, i.e., "wings," and a central or internal region, i.e., a "gap." The three regions of the gapmer motif (5'-wing, gap, and 3'-wing) form a contiguous sequence of nucleosides, where at least a portion of the sugar moieties of each nucleoside in the wings differs from at least a portion of the sugar moieties of the nucleosides in the gap. Specifically, the sugar moieties of at least the nucleosides in each wing closest to the gap (the 3'-side nucleoside of the 5'-wing and the 5'-side nucleoside of the 3'-wing) are different from the sugar moieties of the adjacent gap nucleosides, thus defining a boundary between the wings and the gap (i.e., a wing / gap junction). In certain embodiments, the sugar moieties within the gap are identical to each other. In certain embodiments, the gap contains one or more nucleosides having sugar moieties different from the sugar moieties of one or more other nucleosides in the gap. In certain embodiments, the sugar motifs of the two wings are identical (symmetric gapmer). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric gapmer).

[0238] In certain embodiments, the gapmer wing contains 1 to 6 nucleosides. In certain embodiments, each nucleoside in each wing of the gapmer contains a modified sugar moiety. In certain embodiments, at least one nucleoside in each wing of the gapmer contains a modified sugar moiety. In certain embodiments, at least two nucleosides in each wing of the gapmer contain modified sugar moieties. In certain embodiments, at least three nucleosides in each wing of the gapmer contain modified sugar moieties. In certain embodiments, at least four nucleosides in each wing of the gapmer contain modified sugar moieties. In certain embodiments, at least five nucleosides in each wing of the gapmer contain modified sugar moieties.

[0239] In certain embodiments, the gap of the gapmer contains 7 to 12 nucleosides. In certain embodiments, each nucleoside of the gapmer contains a 2'-deoxyribosyl sugar moiety. In certain embodiments, at least 6 nucleosides of the gapmer contain a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of the gapmer contains a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gapmer contains a modified sugar moiety. In certain embodiments, at least one nucleoside of the gapmer contains a 2'-OMe sugar moiety.

[0240] In certain embodiments, the gapmer is a deoxygapmer. In certain embodiments, the gap-side nucleoside of each wing / gap junction contains a 2'-deoxyribosyl sugar moiety, and the wing-side nucleoside of each wing / gap junction contains a modified sugar moiety. In particular embodiments, at least six nucleosides of the gap in the gapmer contain a 2'-β-D-deoxyribosyl sugar moiety. In particular embodiments, each nucleoside of the gap in the gapmer contains a 2'-deoxyribosyl sugar moiety. In particular embodiments, each nucleoside of each wing in the gapmer contains a modified sugar moiety. In particular embodiments, one nucleoside of the gap contains a modified sugar moiety, and each of the remaining nucleosides of the gap contains a 2'-deoxyribosyl sugar moiety.

[0241] In certain embodiments, a modified oligonucleotide includes or consists of a portion having a fully modified sugar motif. In such embodiments, each nucleoside in the fully modified portion of the modified oligonucleotide contains a modified sugar moiety. In certain embodiments, each nucleoside in the entire modified oligonucleotide contains a modified sugar moiety. In certain embodiments, a modified oligonucleotide includes or consists of a portion having a fully modified sugar motif, where each nucleoside in the fully modified portion contains the same modified sugar moiety, referred herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside in a uniformly modified nucleotide contains the same 2' modification.

[0242] In this specification, the lengths (number of nucleosides) of the three regions of a gapmer may be given using the notation [5'-number of nucleosides in the wing]-[number of nucleosides in the gap]-[3'-number of nucleosides in the wing]. Thus, a 5-10-5 gapmer consists of 5 linked nucleosides in each wing and 10 linked nucleosides in the gap. If such nomenclature is followed by a specific modification, that modification is a modification of each sugar moiety in each wing, and the nucleosides in the gap contain a 2'-β-D-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer consists of 5 linked 2'-MOE nucleosides in the 5'-wing, 10 linked 2'-β-D-deoxynucleosides in the gap, and 5 linked 2'-MOE nucleosides in the 3'-wing. The 3-10-3 cEt gapmer consists of 3 linked cEt nucleosides in the 5'-wing, 10 linked 2'-β-D-deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3'-wing. The 5-8-5 gapmer consists of 5 linked nucleosides containing a modified sugar moiety in the 5'-wing, 8 linked 2'-β-D-deoxynucleosides in the gap, and 5 linked nucleosides containing a modified sugar moiety in the 3'-wing. The mixed-wing gapmer has at least two different modified sugar moieties in the 5'- and / or 3'-wings. The 5-8-5 or 5-8-4 mixed-wing gapmer has at least two different modified sugar moieties in the 5'- and / or 3'-wings.

[0243] In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 6-10-4 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 4-10-6 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 4-8-6 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 6-8-4 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 5-8-4 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-7 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 7-10-3 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 5-8-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 5-9-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is an XYZ MOE gapmer, where X and Z are independently selected from 1, 2, 3, 4, 5, 6, or 7 linked 2'-MOE nucleosides, and Y is selected from 7, 8, 9, 10, or 11 linked deoxynucleosides.

[0244] In certain embodiments, the modified oligonucleotide has the following sugar motifs (in 5' to 3' order): eeeeeddddddddddeeeee, eeeeeeddddddddddeeee, or eeeeedyddddddddeeeee, where "d" represents the 2'-deoxyribosyl sugar moiety, "e" represents the 2'-MOE sugar moiety, and "y" represents the 2'-OMe sugar moiety.

[0245] 2. Specific nucleic acid base motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified nucleic acid bases arranged along the oligonucleotide or a portion thereof in a defined pattern or motif. In certain embodiments, each nucleic acid base is modified. In certain embodiments, none of the nucleic acid bases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleic acid bases of the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleic acid bases are 5-methylcytosine, and all of the other nucleic acid bases of the modified oligonucleotide are unmodified nucleic acid bases.

[0246] In certain embodiments, the modified oligonucleotide includes a block of modified nucleic acid bases. In certain such embodiments, the block is located at the 3' end of the oligonucleotide. In certain embodiments, the block is located within 3 nucleosides from the 3' end of the oligonucleotide. In certain embodiments, the block is located at the 5' end of the oligonucleotide. In certain embodiments, the block is located within 3 nucleosides from the 5' end of the oligonucleotide.

[0247] In certain embodiments, the oligonucleotide having a gapmer motif comprises a nucleoside containing a modified nucleic acid base. In certain such embodiments, one nucleoside containing the modified nucleic acid base is located in the central gap of the oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleic acid base is selected from 2-thiopyrimidine and 5-propympyrimidine.

[0248] 3. Specific nucleoside bond motifs In certain embodiments, the oligonucleotide includes modified and / or unmodified nucleoside links arranged along the oligonucleotide or a portion thereof in a defined pattern or motif. In certain embodiments, each nucleoside linking group is a phosphodiester nucleoside link (P=O). In certain embodiments, each nucleoside linking group of the modified oligonucleotide is a phosphorothioate nucleoside link (P=S). In certain embodiments, each nucleoside link in the modified oligonucleotide is independently selected from phosphorothioate nucleoside links and phosphodiester nucleoside links. In certain embodiments, each phosphorothioate nucleoside link is independently selected from sterically random phosphorothioate, (Sp)phosphorothioate, and (Rp)phosphorothioate. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all nucleoside links within the gap are modified. In certain such embodiments, some or all of the nucleoside bonds within the wing are unmodified phosphodiester nucleoside bonds. In certain embodiments, the terminal nucleoside bonds are modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the nucleoside bond motif is less in at least one wing. Each contains one phosphodiester nucleoside bond, where at least one phosphodiester nucleoside bond is not a terminal nucleoside bond, and the remaining nucleoside bonds are phosphorothioate nucleoside bonds. In certain such embodiments, all of the phosphorothioate nucleoside bonds are sterically random. In certain embodiments, all of the phosphorothioate nucleoside bonds within the wing are (Sp)phosphorothioates, and the gap contains at least one Sp,Sp,Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides containing such nucleoside bond motifs.

[0249] In certain embodiments, the modified oligonucleotide has a nucleoside-to-nucleoside linkage motif of soooosssssssssssss or soooossssssssssss, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphodiester nucleoside linkage.

[0250] C. Specific length The length of oligonucleotides can be increased or decreased without losing activity. For example, Woolf et al. (Proc. Natl. Acad. Sci. USA, 1992, 89:7305-7309, 1992) investigated the ability of a series of oligonucleotides ranging from 13 to 25 nucleic acid bases in length to induce cleavage of target nucleic acids in an oocyte injection model. Oligonucleotides with 25 nucleic acid bases in length, accompanied by 8 or 11 mismatched bases near the end, were able to direct specific cleavage of target nucleic acids, albeit to a lower degree than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13 nucleic acid base oligonucleotides, including those with 1 or 3 mismatches.

[0251] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have lengths within a range of varying lengths. In certain embodiments, the oligonucleotide consists of linked nucleosides X to Y, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, provided that X is less than or equal to Y, X and Y are independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, respectively. For example, in a particular embodiment, oligonucleotides are 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13-18, 13-19 , 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 13-26, 13-27, 13-28, 13-29, 13-30, 14-15, 14-16, 14-17, 14-18, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, 14-25, 14-26, 14-27, 14-28, 14-29, 14-30, 15-1 6, 15-17, 15-18, 15-19, 15-20, 15-21, 15-22, 15-23, 15-24, 15-25, 15-26, 15-27, 15-28, 15-29, 15-30, 16-17, 16-18, 16-19, 16-20, 16-21, 16-22, 16-23, 16-24, 16-25, 16-26, 16-27, 16-28, 16-29, 16- 30, 17-18, 17-19, 17-20, 17-21, 17-22, 17-23, 17-24, 17-25, 17-26, 17-27, 17-28, 17-29, 17-30, 18-19, 18-20, 18-21, 18-22, 18-23, 18-24, 18-25, 18-26, 18-27, 18-28, 18-29, 18-30, 19-20, 19-21, 19- 22, 19-23, 19-24, 19-25, 19-26, 19-29, 19-28, 19-29, 19-30, 20-21, 20-22, 20-23, 20-24, 20-25, 20-26, 20-27, 20-28, 20-29, 20-30, 21-22, 21-23, 21-24, 21-25, 21-26, 21-27, 21-28, 21-29, 21-30, 22-23, 22-24, 22-25, 22-26, 22-27, 22-28 It consists of linked nucleosides of 22-29, 22-30, 23-24, 23-25, 23-26, 23-27, 23-28, 23-29, 23-30, 24-25, 24-26, 24-27, 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30.

[0252] In certain embodiments, the oligonucleotide consists of 16 linked nucleosides. In certain embodiments, the oligonucleotide consists of 17 linked nucleosides. In certain embodiments, the oligonucleotide consists of 18 linked nucleosides. In certain embodiments, the oligonucleotide consists of 19 linked nucleosides. In certain embodiments, the oligonucleotide consists of 20 linked nucleosides.

[0253] D. Specific modified oligonucleotides In certain embodiments, the above modifications (sugars, nucleic acid bases, nucleoside bonds) are incorporated into modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modification motifs and total length. In certain embodiments, such parameters are independent of each other. Therefore, unless otherwise indicated, each nucleoside bond of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow the gapmer modification pattern of the sugar modification. For example, the nucleoside bonds in the wing region of a sugar gapmer may be the same or different from each other, and may be the same or different from the nucleoside bonds in the gap region of the sugar motif. Similarly, such a sugar gapmer oligonucleotide may contain one or more modified nucleic acid bases independently of the gapmer pattern of the sugar modification. Unless otherwise indicated, all modifications are independent of the nucleic acid base sequence.

[0254] E. A specific group of modified oligonucleotides A population of modified oligonucleotides in which all modified oligonucleotides have the same molecular formula can be a sterically random population or a chiral-enriched population. In a sterically random population, all chiral centers of all modified oligonucleotides are sterically random. In a chiral-enriched population, at least one specific chiral center is not sterically random in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chiral-enriched population are enriched with respect to the β-D-ribosyl sugar moiety, and all phosphorothioate nucleoside bonds are sterically random. In certain embodiments, the modified oligonucleotides of a chiral-enriched population are enriched with respect to both the β-D-ribosyl sugar moiety and at least one specific phosphorothioate nucleoside bond in a particular stereochemical configuration.

[0255] F. Nucleic acid base sequence In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleic acid base sequences. In certain embodiments, oligonucleotides have a nucleic acid base sequence that is complementary to an identified reference nucleic acid, such as a second oligonucleotide or target nucleic acid. In certain such embodiments, a portion of the oligonucleotides has a nucleic acid base sequence that is complementary to an identified reference nucleic acid, such as a second oligonucleotide or target nucleic acid. In certain embodiments, a portion of the oligonucleotides or The full-length nucleic acid sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a nucleic acid such as a second oligonucleotide or target nucleic acid.

[0256] I. Specific Oligomer Compounds In certain embodiments, the oligomeric compounds provided herein consist of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and / or terminal groups. A conjugate group consists of one or more conjugate moieties and a conjugate linker that links the conjugate moieties to the oligonucleotide. The conjugate group may be bonded to either end or both ends and / or any internal position of the oligonucleotide. In certain embodiments, the conjugate group is bonded to the 2' position of the nucleoside of the modified oligonucleotide. In certain embodiments, a conjugate group bonded to either end or both ends of the oligonucleotide is a terminal group. In certain such embodiments, the conjugate group or terminal group is bonded to the 3' end and / or 5' end of the oligonucleotide. In certain such embodiments, the conjugate group (or terminal group) is bonded to the 3' end of the oligonucleotide. In certain embodiments, the conjugate group is bonded near the 3' end of the oligonucleotide. In certain embodiments, the conjugate group (or terminal group) is bonded to the 5' end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' end of the oligonucleotide.

[0257] Examples of terminal groups include, but are not limited to, conjugate groups, capping groups, phosphate moieties, protecting groups, debased nucleosides, modified or unmodified nucleosides, and two or more independently modified or unmodified nucleosides.

[0258] A. Specific conjugate groups In certain embodiments, an oligonucleotide is covalently bonded to one or more conjugate groups. In certain embodiments, the conjugate groups modify one or more properties of the conjugated oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In certain embodiments, the conjugate groups confer novel properties to the conjugated oligonucleotide, such as a fluorophore or reporter group that enables detection of the oligonucleotide. Specific conjugate groups and conjugate moieties have been described to date, for example, the cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NYA Acad. Sci., 1992, 660, 306-309, Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), and thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains, e.g., dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118, Kabanov et al., FEBS Lett., 1990, 259, 327-330, Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids, e.g., dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654, Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetate, palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220 and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or N-acetylgalactosamine (GalNAc) cluster (e.g., WO2014 / 179620).

[0259] In certain embodiments, the conjugate group may be selected from any of the following: C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0260] In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, in which case the alkyl chain has one or more unsaturated bonds.

[0261] 1. Conjugate portion The conjugate portion may include, but is not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin portions, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid portions, folic acid, lipids, lipophilic groups, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and pigments.

[0262] In certain embodiments, the conjugate portion includes effective pharmaceutical ingredients, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansyl sarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazine, chlorothiazide, diazepine, indomethacin, barbiturate, cephalosporin, sulfonamide, antidiabetic agent, antibacterial agent, or antibiotic.

[0263] 2. Conjugate Linker The conjugate moiety is bound to the oligonucleotide via a conjugate linker. In certain oligomeric compounds, the conjugate linker is a single bond (i.e., the conjugate moiety is directly bound to the oligonucleotide via a single bond). In certain oligomeric compounds, the conjugate moiety is bound to the oligonucleotide via a more complex conjugate linker containing one or more conjugate linker moieties, which are subunits constituting the conjugate linker. In certain embodiments, the conjugate linker includes a chain structure such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, a nucleoside, or an amino acid unit.

[0264] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0265] In certain embodiments, conjugate linkers, including the conjugate linker described above, are known in the art to be useful for attaching a conjugate group to a parent compound, such as a difunctional linkage, for example, an oligonucleotide provided herein. Generally, a difunctional linkage includes at least two functional groups. One functional group is selected to bond to a specific site on the parent compound, and the other is selected to bond to a conjugate group. Examples of functional groups used in a difunctional linkage include, but are not limited to, electrophiles for reacting with a nucleophile and nucleophiles for reacting with an electrophile. In certain embodiments, the difunctional linkage includes one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl groups.

[0266] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C12. 10Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 This includes, but is not limited to, alkynyl substituents, in which case a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl substituents.

[0267] In certain embodiments, the conjugate linker contains 1 to 10 linker nucleosides. In certain embodiments, the conjugate linker contains 2 to 5 linker nucleosides. In certain embodiments, the conjugate linker contains just 3 linker nucleosides. In certain embodiments, the conjugate linker contains a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides contain a modified sugar moiety. In certain embodiments, the linker nucleosides are unmodified. In certain embodiments, the linker nucleosides contain a purine, a substituted purine, a pyrimidine, or an optionally protected heterocyclic base selected from substituted pyrimidines. In certain embodiments, the cleavable portion is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. It is usually desirable that the linker nucleoside be cleaved from the oligomer compound after reaching the target tissue. Therefore, the linker nucleosides are typically linked to each other and to the rest of the oligomer compound via cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.

[0268] In this specification, linker nucleosides are not considered part of the oligonucleotide. Therefore, in embodiments in which an oligomeric compound contains a specific percentage of complementarity to an oligonucleotide and / or reference nucleic acid consisting of a specific number or range of linked nucleosides, and the oligomeric compound also contains a conjugate group containing a conjugate linker containing a linker nucleoside, these linker nucleosides are not counted in the length of the oligonucleotide and are not used to determine the percentage of complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may contain (1) a modified oligonucleotide consisting of 8 to 30 nucleosides, and (2) a conjugate group containing 1 to 10 linker nucleosides adjacent to the nucleosides of the modified oligonucleotide. The total number of adjacent linked nucleosides in such an oligomeric compound is greater than 30. Alternatively, an oligomeric compound may contain a modified oligonucleotide consisting of 8 to 30 nucleosides and not containing a conjugate group. The total number of adjacent linked nucleosides in such an oligomeric compound is 30 or less. Unless otherwise specified, a conjugate linker contains 10 or fewer linker nucleosides. In certain embodiments, a conjugate linker contains 5 or fewer linker nucleosides. In certain embodiments, a conjugate linker contains 3 or fewer linker nucleosides. In certain embodiments, a conjugate linker contains 2 or fewer linker nucleosides. In certain embodiments, a conjugate linker contains only 1 linker nucleoside.

[0269] In certain embodiments, it is desirable that the conjugate group be cleaved from the oligonucleotide. For example, in certain circumstances, an oligomeric compound containing a particular conjugate moiety is readily taken up by a particular cell type, but after the oligomeric compound is taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Therefore, a particular conjugate linker may contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group containing at least one cleavable bond. In certain embodiments, the cleavable moiety contains an atomic group having one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved intracellularly or within an intracellular compartment such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme such as a nuclease.

[0270] In certain embodiments, the cleavable bond is selected from amide bonds, ester bonds, ether bonds, ester bonds of one or both of the phosphodiester bonds, phosphate ester bonds, carbamate bonds, or disulfide bonds. In certain embodiments, the cleavable bond is one or both of the esters of the phosphodiester. In certain embodiments, the cleavable portion comprises a phosphate or phosphodiester. In certain embodiments, the cleavable portion is a phosphate bond or phosphodiester bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0271] In certain embodiments, the cleavable portion comprises or consists of one or more linker nucleosides. In certain such embodiments, one or more linker nucleosides are linked to each other and / or to the rest of the oligomeric compound via cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, the cleavable portion is a 2'-deoxynucleoside that is bonded to either the 3' or 5' terminal nucleoside of the oligonucleotide by a phosphodiester nucleoside bond and covalently bonded to the conjugate linker or the rest of the conjugate portion by a phosphate or phosphorothioate nucleoside bond. In certain such embodiments, the cleavable portion is 2'-deoxyadenosine.

[0272] 3.Cell targeting part In certain embodiments, the conjugate group includes a cell targeting moiety. In certain embodiments, the conjugate group has the following general formula: [ka] In the formula, n is between 1 and approximately 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.

[0273] In a particular embodiment, n is 1, j is 1, and k is 0. In a particular embodiment, n is 1, j is 0, and k is 1. In a particular embodiment, n is 1, j is 1, and k is 1. In a particular embodiment, n is 2, j is 1, and k is 0. In a particular embodiment, n is 2, j is 0, and k is 1. In a particular embodiment, n is 2, j is 1, and k is 1. In a particular embodiment, n is 3, j is 1, and k is 0. In a particular embodiment, n is 3, j is 0, and k is 1. In a particular embodiment, n is 3, j is 1, and k is 1.

[0274] In certain embodiments, the conjugate group comprises a cell-targeting moiety having at least one tether ligand. In certain embodiments, the cell-targeting moiety comprises two tether ligands covalently bonded to the branching group. In certain embodiments, the cell-targeting moiety comprises three tether ligands covalently bonded to the branching group.

[0275] B. Specific terminal groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. The stabilized 5'-phosphate includes, but is not limited to, 5'-vinylphosphonates, and other 5'-phosphonates. In certain embodiments, the terminal group comprises one or more debasic nucleosides and / or inverse nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleosides are debasic nucleosides.

[0276] III. Oligomer double strands In certain embodiments, the oligomeric compounds described herein include oligonucleotides having a nucleic acid base sequence complementary to the nucleic acid base sequence of the target nucleic acid. In certain embodiments, the oligomeric compound pairs with a second oligomeric compound to form an oligomeric duplex. Such an oligomeric duplex includes a first oligomeric compound having a portion complementary to the target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of the oligomeric duplex includes, or comprises, (1) a modified or unmodified oligonucleotide and optionally a conjugate group, and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. One or both oligomeric compounds of the oligomeric duplex may include a conjugate group. The oligonucleotides of each oligomeric compound in the oligomeric duplex may include uncomplementary protruding nucleosides.

[0277] IV. Antisense Activation In certain embodiments, the oligomeric compound and the oligomeric double strand are hybridized to the target nucleic acid. An oligomeric compound and oligomeric double-stranded oligomeric compound can hybridize and yield at least one antisense activity; such oligomeric compounds and oligomeric double-stranded oligomeric compounds are antisense compounds. In certain embodiments, an antisense compound has antisense activity if it reduces the amount or activity of a target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, an antisense compound selectively affects one or more target nucleic acids. Such an antisense compound comprises nucleic acid base sequences that hybridize with one or more target nucleic acids to yield one or more desired antisense activities, and that do not hybridize with one or more non-target nucleic acids, or do not hybridize with one or more non-target nucleic acids in a manner that yields significant undesirable antisense activity.

[0278] In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in cleavage of the target nucleic acid mediated by RNA-degrading enzyme H. RNA-degrading enzyme H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA double strand. The DNA in such an RNA:DNA double strand does not need to be unmodified DNA. In certain embodiments, what is described herein is an antisense compound that is sufficiently "DNA-like" to induce RNA-degrading enzyme H activity. In certain embodiments, one or more non-DNA-like nucleosides in the gapmer gap are acceptable.

[0279] In certain antisense activities, the antisense compound or a portion of the antisense compound is incorporated into the RNA-induced silencing complex (RISC), ultimately leading to cleavage of the target nucleic acid. For example, certain antisense compounds result in cleavage of the target nucleic acid by Argonaut. The antisense compound incorporated into RISC is an RNAi compound. The RNAi compound may be double-stranded (siRNA) or single-stranded (ssRNA).

[0280] In certain embodiments, hybridization of an antisense compound with a target nucleic acid does not result in the recruitment of proteins that cleave the target nucleic acid. In certain embodiments, hybridization of an antisense compound with a target nucleic acid results in a change in the splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound with a target nucleic acid results in the inhibition of binding interactions between the target nucleic acid and proteins or other nucleic acids. In certain embodiments, hybridization of an antisense compound with a target nucleic acid results in a change in the translation of the target nucleic acid.

[0281] Antisense activity may be observed directly or indirectly. In certain embodiments, observation or detection of antisense activity includes observing or detecting changes in the amount of a target nucleic acid or the protein encoded by such a target nucleic acid, changes in the ratio of splice variants of the nucleic acid or protein, and / or changes in the phenotype of a cell or object.

[0282] V. Specific target nucleic acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide containing a portion complementary to the target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA containing intronic, exonic, and untranslated regions. In certain embodiments, the target nucleic acid is mature mRNA. In certain embodiments, the target nucleic acid is pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, at least 50% of the target region is within an intron.

[0283] A. Complementarity / mismatch with target nucleic acid It is possible to introduce mismatched bases without losing activity. For example, Ga Utschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to bcl-2 mRNA and 3 mismatches to bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide also showed potent antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) investigated the ability of a series of tandem 14-nucleotide oligonucleotides, as well as 28 and 42-nucleotide oligonucleotides composed of sequences of 2 or 3 tandem oligonucleotides, to halt human DHFR translation using a rabbit reticulocyte assay. Each of the three 14-nucleotide oligonucleotides could inhibit translation individually, although to a lower level than the 28 or 42-nucleotide oligonucleotides.

[0284] In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over its entire length. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over its entire length and includes portions that are 100% or completely complementary to the target nucleic acid. In certain embodiments, the completely complementary portions are 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleic acid bases long.

[0285] In certain embodiments, the oligonucleotide contains one or more mismatched nucleic acid bases with respect to the target nucleic acid. In certain embodiments, such mismatches reduce antisense activity against the target, but reduce activity against non-targets even more significantly. Thus, in certain embodiments, the selectivity of the oligonucleotide is improved. In certain embodiments, the mismatches are specifically located within the oligonucleotide having a gapmer motif. In certain embodiments, the mismatches are located at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 from the 5' end of the gap region. In certain embodiments, the mismatches are located at positions 1, 2, 3, 4, 5, or 6 from the 5' end of the 5' wing region or 3' wing region.

[0286] B.PLP1 In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide complementary to the target nucleic acid, where the target nucleic acid is the nucleic acid of PLP1. In certain embodiments, the nucleic acid of PLP1 has the sequence described in SEQ ID NO: 1 (GENBANK acceptance number: NM_001128834.2) or SEQ ID NO: 2 (GENBANK acceptance number NC_000023.11, truncated from nucleotides 103773001 to 103795000).

[0287] In certain embodiments, contact with cells of an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of PLP1 RNA in the cells, and in certain embodiments, reduces the amount of PLP1 protein in the cells. In certain embodiments, contact with cells of a modified oligonucleotide complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of PLP1 RNA in the cells, and in certain embodiments, reduces the amount of PLP1 protein in the cells. In certain embodiments, the cells are in vitro. In certain embodiments, the cells are present in the subject. In certain embodiments, contact with cells in the subject of an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 improves one or more symptoms or characteristics of leukodystrophy. In certain embodiments, leukodystrophy is PMD. In certain embodiments, the symptoms or characteristics are selected from hypotonia, nystagmus, optic atrophy, dyspnea, motor delay, cognitive impairment, speech impairment, spasticity, ataxia, seizures, or choroidal motion. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide.

[0288] In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 can reduce the detectable amount of PLP1 RNA in a standard in vitro assay by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in vitro. In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 can reduce the detectable amount of PLP1 RNA in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to a standard in vivo assay. In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 can reduce the detectable amount of PLP1 protein in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to a standard in vivo assay. In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 can reduce the detectable amount of PLP1 RNA in the target CSF by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 can reduce the detectable amount of PLP1 protein in the target CSF by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0289] C. Specific target nucleic acids in specific tissues In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide containing a region complementary to the target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is cells and tissues including the central nervous system (CNS). Such tissues include the brain and spinal cord. In certain embodiments, the pharmacologically relevant tissue includes the white matter tracts extending through the brain and spinal cord, such tissues including the corpus callosum, cortex, cerebellum, hippocampus, brainstem, striatum, and spinal cord. In certain embodiments, the pharmacologically relevant tissue includes the cortex, cerebellum, hippocampus, brainstem, and spinal cord. In certain embodiments, the pharmacologically relevant cells are oligodendrocytes and oligodendrocyte progenitor cells. In certain embodiments, the pharmacologically relevant cells are Schwann cells or Schwann cell progenitor cells.

[0290] VI. Specific Pharmaceutical Compositions In certain embodiments, the pharmaceutical composition described herein comprises one or more oligomeric compounds. In certain embodiments, each of the one or more oligomeric compounds consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of sterile saline and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical-grade PBS. In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds The formulation comprises or consists of a ligomer compound and artificial cerebrospinal fluid ("artificial CSF" or "aCSF"). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0291] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition essentially consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is of pharmaceutical grade.

[0292] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients. In certain such embodiments, the excipients are selected from water, saline solution, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0293] In certain embodiments, the oligomeric compound may be mixed with pharmaceutically acceptable active and / or inactive substances to prepare a pharmaceutical composition or pharmaceutical formulation. The compositions and methods for formulating the pharmaceutical composition depend on a number of criteria, including, but not limited to, the route of administration, the severity of the disease, or the dose administered.

[0294] In certain embodiments, a pharmaceutical composition comprising an oligomeric compound includes any pharmaceutically acceptable salt of the oligomeric compound, an ester of the oligomeric compound, or a salt of such an ester. In certain embodiments, a pharmaceutical composition comprising an oligomeric compound comprising one or more oligonucleotides may, when administered to a subject including a human, provide (directly or indirectly) a biologically active metabolite or its residue. Therefore, for example, this disclosure is also of interest to pharmaceutically acceptable salts of the oligomeric compound, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Preferred pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, a prodrug comprises one or more conjugate groups bonded to an oligonucleotide, wherein the conjugate groups are cleaved by endogenous nucleases in the body.

[0295] Lipid moieties are used in various ways in nucleic acid therapy. In certain such methods, nucleic acids, such as oligomeric compounds, are introduced into pre-formed liposomes or lipoplexes prepared from a mixture of cationic and neutral lipids. In certain methods, DNA complexes with mono- or polycationic lipids are formed in the absence of neutral lipids. In certain embodiments, lipid moieties are selected to increase the distribution of a pharmaceutical agent to specific cells or tissues. In certain embodiments, lipid moieties are selected to increase the distribution of a pharmaceutical agent to adipose tissue. In certain embodiments, lipid moieties are selected to increase the distribution of a pharmaceutical agent to muscle tissue.

[0296] In certain embodiments, the pharmaceutical composition includes a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including those containing hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0297] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents, including the oligomeric compounds provided herein, to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises liposomes coated with tissue-specific antibodies.

[0298] In certain embodiments, the pharmaceutical compositions provided herein include a cosolvent system. Certain such cosolvent systems include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such cosolvent systems are used with hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which is a solution of anhydrous ethanol containing 3 w / v% benzyl alcohol, 8 w / v% the nonpolar surfactant Polysorbate 80™, and 65 w / v% polyethylene glycol 300. The proportions of such cosolvent systems may be significantly altered without significantly changing their solubility and toxic properties. Furthermore, the identity of the cosolvent components may be altered; for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be altered; other biocompatible polymers may be substituted for polyethylene glycol, for example, polyvinylpyrrolidone; and other sugars or polysaccharides may be substituted for dextrose.

[0299] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for intrabuccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intraventricular (ICV), intraneuronal, perineurial, etc.). In certain such embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution, e.g., water, or a physiologically compatible buffer, e.g., Hanks' solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other components (e.g., components that contribute to solubility or act as preservatives) are included. In certain embodiments, the injectable suspension is prepared using a suitable liquid carrier, suspension agent, etc. Specific pharmaceutical compositions for injection are presented in unit dosage forms, e.g., in ampoules or in multi-dose containers. Specific pharmaceutical compositions for injection are suspensions, solutions, or emulsions in an oily or aqueous vehicle and may contain formulation agents such as suspension agents, stabilizers, and / or dispersants. Specific solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

[0300] Under certain conditions, certain compounds disclosed herein act as acids. Such compounds may be illustrated or described in protonated (free acid) form or in ionized and associated with a cation (salt) form, but aqueous solutions of such compounds exist in equilibrium between such forms. For example, the phosphate bond of an oligonucleotide in aqueous solution exists in equilibrium between the free acid, anion, and salt forms. Unless otherwise indicated, the compounds described herein are intended to include all such forms. Furthermore, certain oligonucleotides have several such bonds, each of which is in equilibrium. Thus, oligonucleotides in solution exist as a collection of each form at multiple positions, all in equilibrium. The term “oligonucleotide” is intended to include all such forms. A depicted structure necessarily represents a single form. Nevertheless, unless otherwise indicated, such drawings are also intended to include the corresponding forms. Herein, structures depicting the free acid of a compound followed by the term “or its salt” explicitly include all such forms, which may be fully or partially protonated / deprotonated / associated with a cation. In some cases, one or more specific cations are identified.

[0301] In certain embodiments, the modified oligonucleotide or oligomer compound is present in an aqueous solution containing sodium. In certain embodiments, the modified oligonucleotide or oligomer compound is present in an aqueous solution containing potassium. In certain embodiments, the modified oligonucleotide or oligomer compound is present in PBS. In certain embodiments, the modified oligonucleotide or oligomer compound is present in water. In certain such embodiments... The pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.

[0302] This specification describes specific dosages. Doses may be in the form of dosage units. For clarity, the dosage (or dosage unit) of a modified oligonucleotide or oligomer compound in milligrams represents the mass of the free acid form of the modified oligonucleotide or oligomer compound. As described above, in aqueous solution, the free acid is in equilibrium with the anionic and salt forms. However, for the purpose of calculating dosage, it is assumed that the modified oligonucleotide or oligomer compound exists as a solvent-free, sodium acetate-free, anhydrous free acid. For example, if a modified oligonucleotide or oligomer compound is in a sodium-containing solution (e.g., physiological saline), the modified oligonucleotide or oligomer compound may be partially or completely deprotonated and associate with Na+ ions. However, the mass of the proton is still added to the weight of the dose, while the mass of the Na+ ion is not. Therefore, for example, the dosage or dosage unit of compound number 1362458 at 10 mg is equal to the number of fully protonated molecules weighing 10 mg. This corresponds to 10.47 mg of solvent-free, sodium acetate-free, anhydrous sodium-protonated compound number 1362458. For example, the unit of dose or administration of 10 mg of compound number 1523605 is equal to the number of fully protonated molecules weighing 10 mg. This corresponds to 10.59 mg of solvent-free, sodium acetate-free, anhydrous sodium-protonated compound number 1523605. If an oligomeric compound contains a conjugate group, the mass of the conjugate group is included in the calculation of the dose of such an oligomeric compound. If the conjugate group also has an acid, it is assumed that the conjugate group is also fully protonated for the purpose of calculating the dose.

[0303] VII. Specific Compositions 1. Compound number 1363235 In a particular embodiment, compound number 1363235 is characterized as a 5-10-5 MOE gapmer having the sequence (5' to 3') of TGTAGTACAAATCTTTCCTT (SEQ ID NO: 2101), where each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside. The nucleoside bonds in nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester nucleoside bonds, and the nucleoside bonds in nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate nucleoside bonds, with each cytosine being 5-methylcytosine.

[0304] In certain embodiments, compound 1363235 is represented by the following chemical notation: T es G eo T eo A eo G eo T ds A ds m C ds A ds A ds A ds T ds m C ds T ds T ds T eo m C eo m C es T es T e (Sequence ID 2101), at that time, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, o is a phosphodiester nucleoside bond.

[0305] In certain embodiments, compound 1363235 is represented by the following chemical structure: [ka] (Sequence ID 2101). Structure 1. Compound number 1363235

[0306] In certain embodiments, the sodium salt of compound 1363235 is represented by the following chemical structure: [ka] (Sequence ID 2101). Structure 2. Sodium salt of compound number 1363235

[0307] 2. Compound number 1523601 In a particular embodiment, compound number 1523601 is characterized as a 6-10-4 MOE gapmer having the sequence (5' to 3') of ACAAATCTTTCCTTCAATTA (SEQ ID NO: 682), where nucleosides 1-6 and 17-20 (5' to 3') are each 2'-MOE nucleosides, and nucleosides 7-16 are... These are 2'-β-D-deoxynucleosides, and the internucleoside bonds of nucleosides 2-3, 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester internucleoside bonds, and nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, The nucleoside bonds between 19 and 20 are phosphorothioate nucleoside bonds, and each cytosine is 5-methylcytosine.

[0308] In certain embodiments, compound number 1523601 is represented by the following chemical notation: A es m C eo A eo A eo A eo T eo m C ds T ds T ds T ds m C ds m C ds T ds T ds m C ds A ds A eo T es T es A e (Sequence No. 682), at that time, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate nucleoside bond, o is a phosphodiester nucleoside bond.

[0309] In certain embodiments, compound 1523601 is represented by the following chemical structure: [ka] (Sequence number 682). Structure 3. Compound number 1523601

[0310] In certain embodiments, the sodium salt of compound 1523601 is represented by the following chemical structure: [ka] (Sequence number 682). Structure 4. Sodium salt of compound number 1523601

[0311] 3. Compound number 1523605 In a particular embodiment, compound number 1523605 is characterized as a 6-10-4 MOE gapmer having the sequence (5' to 3') of CAGATGTTCATCTCTTCACA (SEQ ID NO: 1124), where each of nucleosides 1-6 and 17-20 (5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 7-16 is a 2'-β-D-deoxynucleoside. The nucleoside bonds in nucleosides 2-3, 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester nucleoside bonds, and the nucleoside bonds in nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate nucleoside bonds, with each cytosine being 5-methylcytosine.

[0312] In certain embodiments, compound number 1523605 is represented by the following chemical notation: m C es A eo G eo A eo T eo G eo T ds T ds m C ds A ds T ds m C ds T ds m C ds T ds T ds m C eo A es m C es A e (Sequence ID 1124), in which case A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, o is a phosphodiester nucleoside bond.

[0313] In certain embodiments, compound 1523605 is represented by the following chemical structure: [ka] (Sequence ID 1124). Structure 5. Compound number 1523605

[0314] In certain embodiments, the sodium salt of compound 1523605 is represented by the following chemical structure: [ka] (Sequence ID 1124). Structure 6. Sodium salt of compound number 1523605

[0315] 4. Compound number 1523608 In a particular embodiment, compound number 1523608 is characterized as a 6-10-4 MOE gapmer having the sequence (5' to 3') of CATCAGATGTTCATCTCTTC (SEQ ID NO: 2145), where each of nucleosides 1-6 and 17-20 (5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 7-16 is a 2'-β-D-deoxynucleoside. The nucleoside bonds in nucleosides 2-3, 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester nucleoside bonds, and the nucleoside bonds in nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate nucleoside bonds, with each cytosine being 5-methylcytosine.

[0316] In certain embodiments, compound number 1523608 is represented by the following chemical notation: m C es A eo T eo m C eo A eo G eo A ds T ds G ds T ds T ds m C ds A ds T ds m C ds T ds m C eo T es T es m C e (Sequence ID 2145), in which case A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, o is a phosphodiester nucleoside bond.

[0317] In certain embodiments, compound 1523608 is represented by the following chemical structure: [ka] (Sequence ID 2145). Structure 7. Compound number 1523608

[0318] In certain embodiments, the sodium salt of compound 1523608 is represented by the following chemical structure: [ka] (Sequence ID 2145). Structure 8. Sodium salt of compound number 1523608

[0319] 5. Compound number 1362445 In a particular embodiment, compound number 1362445 is characterized as a 5-10-5 MOE gapmer having the sequence (5' to 3') of CCAATAGATTCAACTAGCC (SEQ ID NO: 134), where each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside. The nucleoside bonds of nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester nucleoside bonds, and the nucleoside bonds of nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate nucleoside bonds, with each cytosine being 5-methylcytosine.

[0320] In certain embodiments, compound number 1362445 is represented by the following chemical notation: m C es m C eo m C eo A eo A eo T ds A ds G ds A ds T ds T ds m C ds A ds A ds m C ds T eo A eo G es m C es m C e (Sequence No. 134), at that time, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, o is a phosphodiester nucleoside bond.

[0321] 6. Compound number 1362449 In a particular embodiment, compound number 1362449 is characterized as a 5-10-5 MOE gapmer having the sequence (5' to 3') of ACACAACTCTTTACAACAAA (SEQ ID NO: 411), where each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, and nucleosides 2- The nucleoside bonds of nucleosides 3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester nucleoside bonds, and the nucleoside bonds of nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate nucleoside bonds, with each cytosine being 5-methylcytosine.

[0322] In certain embodiments, compound number 1362449 is represented by the following chemical notation: A es m C eo A eo m C eo A eo A ds m C ds T ds m C ds T ds T ds T ds A ds m C ds A ds A eo m C eo A es A es A e (Sequence ID 411), at that time, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, o is a phosphodiester nucleoside bond.

[0323] 7. Compound number 1362458 In a particular embodiment, compound number 1362458 is characterized as a 5-10-5 MOE gapmer having the sequence (5' to 3') of TCTCCAGACATTTCTGATGC (SEQ ID NO: 934), where each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside. The nucleoside bonds of nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester nucleoside bonds, and the nucleoside bonds of nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate nucleoside bonds, with each cytosine being 5-methylcytosine.

[0324] In certain embodiments, compound number 1362458 is represented by the following chemical notation: T es m C eo T eo m C eo m C eo A ds G ds A ds m C ds A ds T ds T ds T ds m C ds T ds G eo A eo T es G es m C e (Sequence ID 934), at that time, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, o is a phosphodiester nucleoside bond.

[0325] 8. Compound number 1362602 In a particular embodiment, compound number 1362602 is characterized as a 5-10-5 MOE gapmer having the sequence (5' to 3') of GTGTGTTAAAATTGCAATTC (SEQ ID NO: 1238), where each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside. The nucleoside bonds in nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester nucleoside bonds, and the nucleoside bonds in nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate nucleoside bonds, with each cytosine being 5-methylcytosine.

[0326] In certain embodiments, compound number 1362602 is represented by the following chemical notation::G es T eo G eo T eo G eo T ds T ds A ds A ds A ds A ds T ds T ds G ds m C ds Aeo A eo T es T es m C e (Sequence No. 1238), at that time, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, o is a phosphodiester nucleoside bond.

[0327] 9. Compound number 1362842 In a particular embodiment, compound number 1362842 is characterized as a 5-10-5 MOE gapmer having the sequence (5' to 3') of ATTGCAATTCTATATCAGAA (SEQ ID NO: 2010), where each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside. The nucleoside bonds in nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester nucleoside bonds, and the nucleoside bonds in nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate nucleoside bonds, with each cytosine being 5-methylcytosine.

[0328] In certain embodiments, compound number 1362842 is represented by the following chemical notation: A es T eo T eo G eo m C eo A ds A ds Tds T ds m C ds T ds A ds T ds A ds T ds m C eo A eo G es A es A e (Sequence ID 2010), at that time, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, o is a phosphodiester nucleoside bond.

[0329] 10. Compound number 1362892 In a particular embodiment, compound number 1362892 is characterized as a 5-10-5 MOE gapmer having the sequence ATGTGATCTATATCAGGAGA (SEQ ID NO: 1772) (5' to 3'), where nucleosides 1-5 and 16-20 (5' to 3') are each 2'-MOE nucleosides, and nucleosides 6-15 are each 2'-β-D-deoxynucleosides. The nucleoside bonds in nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester nucleoside bonds, and the nucleoside bonds in nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate nucleoside bonds, with each cytosine being 5-methylcytosine.

[0330] In certain embodiments, compound number 1362892 is represented by the following chemical notation: A es T eo G eo T eo G eo A ds T ds m C ds T ds A ds T ds A ds T ds m C ds A ds G eo G eo A es G es A e (Sequence No. 1772), at that time, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, o is a phosphodiester nucleoside bond.

[0331] 11. Compound number 1363013 In a particular embodiment, compound number 1363013 is characterized as a 5-10-5 MOE gapmer having the sequence ACCAGAGGGCCATCTCAGGT (SEQ ID NO: 881) (5' to 3'), where nucleosides 1-5 and 16-20 (5' to 3') are each 2'-MOE nucleosides, and nucleosides 6-15 are each 2'-β-D-deoxynucleosides. The nucleoside bonds of nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester nucleoside bonds, and the nucleoside bonds of nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate nucleoside bonds, with each cytosine being 5-methylcytosine.

[0332] In certain embodiments, compound number 1363013 is represented by the following chemical notation: A es m C eo m C eo A eo G eo A ds G ds G ds G ds m C ds m C ds A ds T ds m C ds T ds m C eo A eo G es G es T e (Sequence number 881), at that time, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, o is a phosphodiester nucleoside bond.

[0333] 12. Compound number 1363398 In a particular embodiment, compound number 1363398 is characterized as a 5-10-5 MOE gapmer having the sequence (5' to 3') of GCATCAGATGTTCATCTCTT (SEQ ID NO: 1050), where each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside. The nucleoside bonds in nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester nucleoside bonds, and the nucleoside bonds in nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate nucleoside bonds, with each cytosine being 5-methylcytosine.

[0334] In certain embodiments, compound 1363398 is represented by the following chemical notation: G es m C eo A eo T eo m C eo A ds G ds A ds T ds G ds T ds T ds m C ds A ds T ds m C eo T eo m C es T es T e (Sequence ID 1050), at that time, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, o is a phosphodiester nucleoside bond.

[0335] 13. Compound number 1363557 In a particular embodiment, compound number 1363557 is characterized as a 5-10-5 MOE gapmer having the sequence CCTCCATTCCTTTGTGACTT (SEQ ID NO: 1449) (5' to 3'), where nucleosides 1-5 and 16-20 (5' to 3') are each 2'-MOE nucleosides, and nucleosides 6-15 are each 2'-β-D-deoxynucleosides. The nucleoside bonds in nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester nucleoside bonds, and the nucleoside bonds in nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate nucleoside bonds, with each cytosine being 5-methylcytosine.

[0336] In certain embodiments, compound 1363557 is represented by the following chemical notation: m C es m C eo T eo m C eo m C eo A ds T ds T ds m C ds m C ds Tds T ds T ds G ds T ds G eo A eo m C es T es T e (Sequence ID 1449), at that time, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, o is a phosphodiester nucleoside bond.

[0337] VIII. Specific Hotspot Areas In certain embodiments, nucleic acid bases within the range shown below include the hotspot region of the PLP1 nucleic acid. In certain embodiments, modified oligonucleotides complementary to a portion of the hotspot region of the PLP1 nucleic acid achieve an average reduction of 50% or more of PLP1 RNA in vitro using a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of the hotspot region of the PLP1 nucleic acid achieve an average reduction of 50% or more of PLP1 RNA in vivo using a standard in vivo assay.

[0338] 1. Nucleic acid bases 9198-9222 of Sequence ID No. 2 In certain embodiments, nucleic acid bases 9198-9222 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleic acid bases 9198-9222 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 (5' to 3') of the gap.

[0339] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0340] The nucleic acid base sequences of sequence numbers 1050, 1124, 2145, 2151, 2152, and 2153 are complementary to some of the nucleic acid bases 9198-9222 of sequence number 2.

[0341] The nucleic acid sequences of compounds with numbers 1363398, 1363516, 1523604, 1523605, 1523606, 1523607, 1523608, and 1523609 are complementary to some of the nucleic acid bases 9198-9222 of SEQ ID NO: 2.

[0342] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 9198-9222 of SEQ ID NO: 2 are used in a standard in vitro assay to obtain at least 6% of the RNA of PLP1. A 5% reduction is achieved. In certain embodiments, a modified oligonucleotide complementary to some of the nucleic acid bases 9198-9222 of SEQ ID NO: 2 achieves an average 71.5% reduction of PLP1 RNA in a standard in vitro assay.

[0343] 2. Nucleic acid bases 13702-13766 of Sequence ID No. 2 In certain embodiments, nucleic acid bases 13702-13766 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to some of the nucleic acid bases 13702-13766 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 (5' to 3') of the gap.

[0344] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0345] The nucleic acid base sequences of SEQ ID NOs. 36, 86, 114, 164, 191, 242, 269, 426, 523, 602, 691, and 780 are complementary to some of the nucleic acid bases 13702-13766 of SEQ ID NO. 2.

[0346] The nucleic acid base sequences of compound numbers 1218139, 1218140, 1218141, 1218142, 1218341, 1218342, 1218343, 1362839, 1363565, 1363589, 1363758, and 1364150 are complementary to some of the nucleic acid bases 13702-13766 of SEQ ID NO: 2.

[0347] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 13702-13766 of SEQ ID NO: 2 achieve at least a 60% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 13702-13766 of SEQ ID NO: 2 achieve an average 68.6% reduction in PLP1 RNA in a standard in vitro assay.

[0348] 3. Nucleic acid bases 14037-14062 of Sequence ID No. 2 In certain embodiments, nucleic acid bases 14037-14062 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleic acid bases 14037-14062 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order of 5' to 3').

[0349] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0350] The nucleic acid base sequences of SEQ ID NOs. 89, 167, 245, 322, and 323 are complementary to some of the nucleic acid bases 14037-14062 of SEQ ID NO. 2.

[0351] The nucleic acid base sequences of compounds with numbers 1218352, 1218353, 1218354, 1362909, 1362866, 1218355, and 1218356 are complementary to some of the nucleic acid bases 14037-14062 of SEQ ID NO: 2.

[0352] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 14037-14062 of SEQ ID NO: 2 achieve at least a 64% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 14037-14062 of SEQ ID NO: 2 achieve an average 79.9% reduction in PLP1 RNA in a standard in vitro assay.

[0353] 4. Nucleic acid bases 16761-16800 of Sequence ID No. 2 In certain embodiments, nucleic acid bases 16761-16800 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleic acid bases 16761-16800 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18 The length is 19, 20, 21, or 22 nucleic acid bases. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order of 5' to 3').

[0354] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0355] The nucleic acid base sequences of SEQ ID NOs. 720, 808, 904, 937, 1058, 1097, 1184, 1278, and 1340 are complementary to some of the nucleic acid bases 16761-16800 of SEQ ID NO. 2.

[0356] The nucleic acid base sequences of compounds with numbers 1362547, 1362649, 1362825, 1363052, 1363131, 1363205, 1363559, 1363590, and 1363607 are complementary to some of the nucleic acid bases 16761-16800 of SEQ ID NO: 2.

[0357] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 16761-16800 of SEQ ID NO: 2 achieve at least a 60% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 16761-16800 of SEQ ID NO: 2 achieve an average 70.7% reduction in PLP1 RNA in a standard in vitro assay.

[0358] 5. Nucleic acid bases 17558-17602 of Sequence ID No. 2 In certain embodiments, nucleic acid bases 17558-17602 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleic acid bases 17558-17602 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the gapmer is 5-1 It is a 0-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order of 5' to 3').

[0359] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0360] The nucleic acid base sequences of SEQ ID NOs. 40, 41, 117, 118, 195, 196, 273, 274, 588, and 690 are complementary to some of the nucleic acid bases 17558-17602 of SEQ ID NO. 2.

[0361] The nucleic acid base sequences of compounds with numbers 1218154, 1218155, 1218156, 1218157, 1218158, 1218159, 1218160, 1218161, 1363257, 1363439, and 1363756 are complementary to some of the nucleic acid bases 17558-17602 of SEQ ID NO: 2.

[0362] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 17558-17602 of SEQ ID NO: 2 achieve at least a 62% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 17558-17602 of SEQ ID NO: 2 achieve an average 74.6% reduction in PLP1 RNA in a standard in vitro assay.

[0363] 6. Nucleic acid bases 17615-17667 of Sequence ID No. 2 In certain embodiments, nucleic acid bases 17615-17667 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleic acid bases 17615-17667 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. Yes. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order of 5' to 3').

[0364] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0365] The nucleic acid base sequences of SEQ ID NOs. 42, 43, 119, 120, 197, 198, 275, 276, 373, 460, 1431, 1542, 1645, 1850, 1965, and 2109 are complementary to some of the nucleic acid bases 17615-17667 of SEQ ID NO. 2.

[0366] The nucleic acid base sequences of compound numbers 1218162, 1218163, 1218164, 1218165, 1218166, 1218167, 1218168, 1218169, 1362484, 1362497, 1362517, 1362591, 1362749, 1362970, 1363246, 1363342, 1363415, 1363474, 1363544, 1363725, and 1363736 are complementary to some of the nucleic acid bases 17615-17667 of SEQ ID NO: 2.

[0367] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 17615-17667 of SEQ ID NO: 2 achieve at least a 28% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 17615-17667 of SEQ ID NO: 2 achieve an average 74.4% reduction in PLP1 RNA in a standard in vitro assay.

[0368] 7. Nucleic acid bases 17853-17883 of Sequence ID No. 2 In certain embodiments, nucleic acid bases 17853-17883 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleic acid bases 17853-17883 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer is eeeeeddddddddd in order from 5' to 3'. The sugar motif is deeeee or eeeeeeddddddddddeeee, where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order 5' to 3').

[0369] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0370] The nucleic acid base sequences of SEQ ID NOs. 1451, 1499, 1543, 1654, 1733, 2154, and 2155 are complementary to some of the nucleic acid bases 17853-17883 of SEQ ID NO. 2.

[0371] The nucleic acid base sequences of compounds with numbers 1362611, 1363392, 1363557, 1363795, 1364094, 1523610, 1523611, 1523612, and 1523613 are complementary to some of the nucleic acid bases 17853-17883 of SEQ ID NO: 2.

[0372] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 17853-17883 of SEQ ID NO: 2 achieve at least a 65% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 17853-17883 of SEQ ID NO: 2 achieve an average 73.5% reduction in PLP1 RNA in a standard in vitro assay.

[0373] 8. Nucleic acid bases 18097-18160 of Sequence ID No. 2 In certain embodiments, nucleic acid bases 18097-18160 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleic acid bases 18097-18160 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order of 5' to 3').

[0374] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0375] The nucleic acid base sequences of SEQ ID NOs. 200, 420, 504, 620, 646, 709, 823, 980, 1029, 1149, 1196, 1253, 1323, 1423, 1476, 1605, 1613, 1728, and 1832 are complementary to some of the nucleic acid bases 18097-18160 of SEQ ID NO. 2.

[0376] The nucleic acid base sequences of compound numbers 1218175, 1362441, 1362447, 1362750, 1362769, 1362774, 1362926, 1362945, 1362957, 1362963, 1362967, 1363191, 1363253, 1363427, 1363489, 1363691, 1363993, 1364083, 1364097, and 1364099 are complementary to some of the nucleic acid bases 18097-18160 of SEQ ID NO: 2.

[0377] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18097-18160 of SEQ ID NO: 2 achieve at least a 53% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18097-18160 of SEQ ID NO: 2 achieve an average 70.1% reduction in PLP1 RNA in a standard in vitro assay.

[0378] 9. Nucleic acid bases 18206-18237 of Sequence ID No. 2 In certain embodiments, nucleic acid bases 18206-18237 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleic acid bases 18206-18237 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order of 5' to 3').

[0379] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0380] The nucleic acid base sequences of 45, 46, 123, 124, 201, 202, 279, 280, 538, 562, and 2091 are complementary to some of the nucleic acid bases 18206-18237 of Sequence ID No. 2.

[0381] The nucleic acid base sequences of compound numbers 1218177, 1218178, 1218179, 1218180, 1218181, 1218182, 1218183, 1218184, 1362490, 1362584, 1362927, 1363103, 1363121, 1363314, and 1363983 are complementary to some of the nucleic acid bases 18206-18237 of SEQ ID NO: 2.

[0382] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18206-18237 of SEQ ID NO: 2 achieve at least a 64% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18206-18237 of SEQ ID NO: 2 achieve an average 81.8% reduction in PLP1 RNA in a standard in vitro assay.

[0383] 10. Nucleic acid bases 18237-18340 of Sequence ID No. 2 In certain embodiments, nucleic acid bases 18237-18340 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleic acid bases 18237-18340 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order of 5' to 3').

[0384] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester This is an internucleoside bond. In certain embodiments, the phosphodiester ("o") internucleoside bonds and the phosphorothioate ("s") internucleoside bonds are arranged in a 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate internucleoside bond and each "o" represents a phosphodiester internucleoside bond.

[0385] The nucleic acid base sequences of SEQ ID NOs. 48, 49, 50, 51, 52, 53, 125, 126, 127, 128, 129, 130, 131, 203, 204, 205, 206, 207, 208, 281, 282, 283, 284, 285, 286, 414, 459, 485, 503, 579, 580, 693, 724, 840, 873, 911, 1034, 1081, 1125, 1159, 1318, 1413, 1513, 1548, 1672, 1701, 1794, 1868, 1958, and 2002 are complementary to some of the nucleic acid bases 18237-18340 of SEQ ID NO. 2.

[0386] Compound numbers: 1218186, 1218187, 1218188, 1218189, 1218190, 1218191, 1218192, 1218193, 1218194, 1218195, 1218196, 1218197, 1218198, 1218199, 1218200, 12182 01, 1218202, 1218203, 1218204, 1218205, 1218206, 1218207, 1218208, 1218209, 1218210, 1362429, 1362468, 1362571, 1362623, 1362659, 1362697, 1362699, 1 362710, 1362714, 1362723, 1362734, 1362821, 1362902, 1362924, 1362955, 1362977, 1363036, 1363051, 1363069, 1363149, 1363206, 1363269, 1363286, 13633 The nucleic acid base sequences of 55, 1363429, 1363518, 1363687, 1363748, 1363790, 1363856, 1363872, 1363884, 1364129, 1364227, and 1364246 are complementary to some of the nucleic acid bases 18237-18340 of SEQ ID NO: 2.

[0387] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18237-18340 of SEQ ID NO: 2 achieve at least a 44% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18237-18340 of SEQ ID NO: 2 achieve an average 70.9% reduction in PLP1 RNA in a standard in vitro assay.

[0388] 11. Nucleic acid bases 18350-18387 of Sequence ID No. 2 In certain embodiments, nucleic acid bases 18350-18387 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleic acid bases 18350-18387 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order of 5' to 3').

[0389] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0390] The nucleic acid base sequences of SEQ ID NOs. 209, 287, 335, 439, 506, 606, 659, 1922, 2033, and 2104 are complementary to some of the nucleic acid bases 18350-18387 of SEQ ID NO. 2.

[0391] The nucleic acid base sequences of compound numbers 1218211, 1218212, 1362567, 1362579, 1362987, 1363166, 1363184, 1363310, 1363502, and 1363644 are complementary to some of the nucleic acid bases 18350-18387 of SEQ ID NO: 2.

[0392] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18350-18387 of SEQ ID NO: 2 achieve at least a 64% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18350-18387 of SEQ ID NO: 2 achieve an average 76.2% reduction in PLP1 RNA in a standard in vitro assay.

[0393] 12. Nucleic acid bases 18412-18469 of Sequence ID No. 2 In certain embodiments, nucleic acid bases 18412-18469 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to some of the nucleic acid bases 18412-18469 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order 5'→3').

[0394] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0395] The nucleic acid base sequences of SEQ ID NOs. 784, 842, 869, 978, 1082, 1131, 1218, 1250, 1320, 1453, 1529, 1538, 1616, 1712, and 1821 are complementary to some of the nucleic acid bases 18412-18469 of SEQ ID NO. 2.

[0396] The nucleic acid base sequences of compound numbers 1362519, 1362535, 1362684, 1362724, 1362885, 1363026, 1363457, 1363648, 1363838, 1363887, 1363933, 1364125, 1364192, 1364197, and 1364255 are complementary to some of the nucleic acid bases 18412-18469 of SEQ ID NO: 2.

[0397] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18412-18469 of SEQ ID NO: 2 achieve at least a 67% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18412-18469 of SEQ ID NO: 2 achieve an average 75% reduction in PLP1 RNA in a standard in vitro assay.

[0398] 13. Nucleic acid bases 18461-18506 of Sequence ID No. 2 In certain embodiments, nucleic acid bases 18461-18506 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to some of the nucleic acid bases 18461-18506 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order of 5' to 3').

[0399] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0400] The nucleic acid base sequences of SEQ ID NOs. 54, 55, 132, 133, 210, 288, 419, 499, 564, 665, 764, 800, 881, 993, 1059, 1200, 1295, 1354, 1422, 1465, 1544, 1705, 1802, and 2149 are complementary to some of the nucleic acid bases 18461-18506 of SEQ ID NO. 2.

[0401] Compound numbers: 1218213, 1218214, 1218215, 1218216, 1218217, 1218218, 1362618, 1362620, 1362632, 1362704, 1362718, 1362815, 1363013, 1363023, 1363128, 1363328, 1 The nucleic acid base sequences of 363400, 1363431, 1363519, 1363533, 1363570, 1363709, 1363762, 1363975, 1364180, 1523591, 1523592, and 1523593 are complementary to some of the nucleic acid bases 18461-18506 of SEQ ID NO: 2.

[0402] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18461-18506 of SEQ ID NO: 2 achieve at least a 40% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18461-18506 of SEQ ID NO: 2 achieve an average 69.7% reduction in PLP1 RNA in a standard in vitro assay.

[0403] 14. Nucleic acid bases 18539-18579 of Sequence ID No. 2 In certain embodiments, nucleic acid bases 18539-18579 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleic acid bases 18539-18579 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order of 5' to 3').

[0404] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0405] The nucleic acid base sequences of SEQ ID NOs. 338, 438, 525, 604, 658, 758, 813, 887, 977, 1043, 1108, 1199, 1258, 1336, 1395, 1514, 1557, 1668, 1697, and 2089 are complementary to some of the nucleic acid bases 18539-18579 of SEQ ID NO: 2.

[0406] The nucleic acid base sequences of compound numbers 1362619, 1362637, 1362652, 1362830, 1362901, 1363079, 1363118, 1363143, 1363145, 1363146, 1363176, 1363193, 1363287, 1363422, 1363451, 1363569, 1363592, 1363611, 1363796, and 1363860 are complementary to some of the nucleic acid bases 18539-18579 of SEQ ID NO: 2.

[0407] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18539-18579 of SEQ ID NO: 2 achieve at least a 62% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18539-18579 of SEQ ID NO: 2 achieve an average 68.8% reduction in PLP1 RNA in a standard in vitro assay.

[0408] 15. Nucleic acid bases of Sequence ID No. 2: 18697-18727 In certain embodiments, nucleic acid bases 18697-18727 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleic acid bases 18697-18727 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order of 5' to 3').

[0409] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphates. This is a holothioate nucleoside bond. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in a 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0410] The nucleic acid base sequences of SEQ ID NOs. 875, 934, 1047, 1110, 1229, 1243, 1373, 1438, 2146, and 2147 are complementary to some of the nucleic acid bases 18697-18727 of SEQ ID NO. 2.

[0411] The nucleic acid base sequences of compound numbers 1362458, 1362696, 1362878, 1363179, 1363351, 1363697, 1364107, 1364147, 1523584, 1523586, and 1523587 are complementary to some of the nucleic acid bases 18697-18727 of SEQ ID NO: 2.

[0412] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18697-18727 of SEQ ID NO: 2 achieve at least a 66% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18697-18727 of SEQ ID NO: 2 achieve an average 77.7% reduction in PLP1 RNA in a standard in vitro assay.

[0413] 16. Nucleic acid bases 18755-18793 of Sequence ID No. 2 In certain embodiments, nucleic acid bases 18755-18793 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleic acid bases 18755-18793 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order of 5' to 3').

[0414] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in the order 5' to 3'. They are arranged as oooossssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0415] The nucleic acid base sequences of SEQ ID NOs. 761, 798, 890, 946, 1022, 1120, 1198, 1293, 1358, 1398, and 1463 are complementary to some of the nucleic acid bases 18755-18793 of SEQ ID NO. 2.

[0416] The nucleic acid base sequences of compounds with numbers 1362575, 1362680, 1362698, 1362856, 1363019, 1363172, 1363357, 1363391, 1363591, 1363639, and 1363889 are complementary to some of the nucleic acid bases 18755-18793 of SEQ ID NO: 2.

[0417] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18755-18793 of SEQ ID NO: 2 achieve at least a 65% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18755-18793 of SEQ ID NO: 2 achieve an average 77.7% reduction in PLP1 RNA in a standard in vitro assay.

[0418] 17. Nucleic acid bases of Sequence ID No. 2: 18797-18819 In certain embodiments, nucleic acid bases 18797-18819 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleic acid bases 18797-18819 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order of 5' to 3').

[0419] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0420] The nucleic acid base sequences of SEQ ID NOs. 56, 134, 683, and 718 are complementary to some of the nucleic acid bases 18797-18819 of SEQ ID NO. 2.

[0421] The nucleic acid base sequences of compounds with numbers 1218221, 1218222, 1362445, 1362612, 1363478, and 1363656 are complementary to some of the nucleic acid bases 18797-18819 of SEQ ID NO: 2.

[0422] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18797-18819 of SEQ ID NO: 2 achieve at least a 65% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18797-18819 of SEQ ID NO: 2 achieve an average 75.4% reduction in PLP1 RNA in a standard in vitro assay.

[0423] 18. Nucleic acid bases of Sequence ID No. 2: 18839-18862 In certain embodiments, nucleic acid bases 18839-18862 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleic acid bases 18839-18862 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order of 5' to 3').

[0424] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0425] The nucleic acid sequences of SEQ ID NOs. 1610, 1663, 1702, and 1786 are complementary to some of the nucleic acid bases 18839-18862 of SEQ ID NO: 2.

[0426] The nucleic acid sequences of compound numbers 1363076, 1362712, 1363649, and 1364195 are complementary to some of the nucleic acid bases 18839-18862 of SEQ ID NO: 2.

[0427] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18839-18862 of SEQ ID NO: 2 achieve at least a 66% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18839-18862 of SEQ ID NO: 2 achieve an average 72.8% reduction in PLP1 RNA in a standard in vitro assay.

[0428] 19. Nucleic acid bases of sequence number 2: 18974-19021 In certain embodiments, nucleic acid bases 18974-19021 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to some of the nucleic acid bases 18974-19021 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order of 5' to 3').

[0429] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0430] The nucleic acid base sequences of SEQ ID NOs. 212, 1060, 1090, 1181, 1277, 1446, 1510, 1589, 1646, 1693, 1772, and 2148 are complementary to some of the nucleic acid bases 18974-19021 of SEQ ID NO. 2.

[0431] The nucleic acid base sequences of compound numbers 1218223, 1362460, 1362600, 1362805, 1362892, 1363007, 1363316, 1363581, 1363642, 1363664, 1363773, 1363984, 1523588, 1523589, and 1523590 are complementary to some of the nucleic acid bases 18974-19021 of SEQ ID NO: 2.

[0432] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 18974-19021 of SEQ ID NO: 2 achieve at least a 54% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, nucleic acid bases 18974-19021 of SEQ ID NO: 2 Modified oligonucleotides complementary to a portion of O21 achieve an average 71.5% reduction in PLP1 RNA in standard in vitro assays.

[0433] 20. Nucleic acid bases 19028-19080 of Sequence ID No. 2 In certain embodiments, nucleic acid bases 19028-19080 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleic acid bases 19028-19080 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order of 5' → 3').

[0434] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0435] The nucleic acid base sequences of SEQ ID NOs. 57, 586, 666, 714, 812, 914, 951, 1052, 1138, 1162, 1248, 1363, and 1455 are complementary to some of the nucleic acid bases 19028-19080 of SEQ ID NO. 2.

[0436] The nucleic acid base sequences of compound numbers 1218225, 1362492, 1362565, 1362817, 1362846, 1363141, 1363160, 1363346, 1363453, 1363550, 1363765, 1363835, 1363883, and 1364201 are complementary to some of the nucleic acid bases 19028-19080 of SEQ ID NO: 2.

[0437] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 19028-19080 of SEQ ID NO: 2 achieve at least a 58% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 19028-19080 of SEQ ID NO: 2 achieve an average 73.5% reduction in PLP1 RNA in a standard in vitro assay.

[0438] 21. Nucleic acid bases of sequence number 2: 19146-19173 In certain embodiments, nucleic acid bases 19146-19173 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleic acid bases 19146-19173 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order of 5' to 3').

[0439] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0440] The nucleic acid sequences of SEQ ID NOs. 385, 416, 545, 621, 682, 1968, 2055, 2101, and 2150 are complementary to some of the nucleic acid bases 19146-19173 of SEQ ID NO. 2.

[0441] The nucleic acid base sequences of compounds with numbers 1362670, 1363235, 1363627, 1363734, 1363940, 1364008, 1364066, 1523601, 1523602, and 1523603 are complementary to some of the nucleic acid bases 19146-19173 of SEQ ID NO: 2.

[0442] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 19148-19173 of SEQ ID NO: 2 achieve at least a 54% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 19146-19173 of SEQ ID NO: 2 achieve an average 77.3% reduction in PLP1 RNA in a standard in vitro assay.

[0443] 22. Nucleic acid bases 19228-19253 of Sequence ID No. 2 In certain embodiments, nucleic acid bases 19228-19253 of SEQ ID NO: 2 contain a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleic acid bases 19228-19253 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide has 18 nuclei This is the length of the acid-base pair. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order of 5' to 3').

[0444] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0445] The nucleic acid sequences of SEQ ID NOs. 363, 467, 541, 2008, and 2111 are complementary to some of the nucleic acid bases 19228-19253 of SEQ ID NO. 2.

[0446] The nucleic acid sequences of compounds with numbers 1364015, 1363882, 1363157, 1363485, and 1362808 are complementary to some of the nucleic acid bases 19228-19253 of SEQ ID NO: 2.

[0447] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 19228-19253 of SEQ ID NO: 2 achieve at least a 69% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 19228-19253 of SEQ ID NO: 2 achieve an average 77.4% reduction in PLP1 RNA in a standard in vitro assay.

[0448] 23. Nucleic acid bases of sequence number 2: 19347-19393 In certain embodiments, nucleic acid bases 19347-19393 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleic acid bases 19347-19393 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 This is a MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order of 5' to 3').

[0449] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0450] The nucleic acid base sequences of SEQ ID NOs. 58, 59, 136, 213, 214, 291, 292, 383, 417, 519, 612, 671, 730, 900, 986, 1019, 1136, 1353, 1457, 1504, 1546, and 2093 are complementary to some of the nucleic acid bases 19347-19393 of SEQ ID NO. 2.

[0451] The nucleic acid base sequences of compound numbers 1218227, 1218228, 1218229, 1218230, 1218231, 1218232, 1218233, 1362526, 1362624, 1362677, 1362685, 1362799, 1362806, 1363094, 1363419, 1363425, 1363472, 1363499, 1363597, 1363628, 1363681, 1363744, 1363759, 1363800, and 1364257 are complementary to some of the nucleic acid bases 19347-19393 of SEQ ID NO: 2.

[0452] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 19347-19393 of SEQ ID NO: 2 achieve at least a 52% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 19347-19393 of SEQ ID NO: 2 achieve an average 71.6% reduction in PLP1 RNA in a standard in vitro assay.

[0453] 24. Nucleic acid bases 19500-19523 of Sequence ID No. 2 In certain embodiments, nucleic acid bases 19500-19523 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleic acid bases 19500-19523 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 This is a MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in the order of 5' to 3', where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order of 5' to 3').

[0454] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0455] The nucleic acid base sequences of SEQ ID NOs. 398, 435, 2095, 2010, and 2144 are complementary to some of the nucleic acid bases 19500-19523 of SEQ ID NO. 2.

[0456] The nucleic acid base sequences of compound numbers 1362842, 1363110, 1363153, 1363982, 1523594, and 1523595 are complementary to some of the nucleic acid bases 19500-19523 of SEQ ID NO: 2.

[0457] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 19500-19523 of SEQ ID NO: 2 achieve at least a 62% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 19500-19523 of SEQ ID NO: 2 achieve an average 69.5% reduction in PLP1 RNA in a standard in vitro assay.

[0458] 25. Nucleic acid bases of sequence number 2: 19512-19534 In certain embodiments, nucleic acid bases 19512-19534 of SEQ ID NO: 2 include a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleic acid bases 19512-19534 of SEQ ID NO: 2. In certain embodiments, the modified oligonucleotide is 20 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 18 nucleic acid bases long. In certain embodiments, the modified oligonucleotide is 16, 17, 18, 19, 20, 21, or 22 nucleic acid bases long. In certain embodiments, the modified oligonucleotide consists of 17-19 or 21-30 linked nucleosides. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the gapmer is a 6-10-4 MOE gapmer. In certain embodiments, the gapmer is a 4-10-6 MOE gapmer. In certain embodiments, the gapmer is a 4-8-6 MOE gapmer. In certain embodiments, the gapmer is a 6-8-4 MOE gapmer. In certain embodiments, the gapmer is a 5-8-5 MOE gapmer. In certain embodiments, the gapmer has sugar motifs of eeeeeddddddddddeeeee or eeeeeeddddddddddeeee in order from 5' to 3', and In this example, "d" represents the 2'-β-D-deoxyribosyl sugar moiety, and "e" represents the 2'-MOE sugar moiety. In certain embodiments, the gapmer contains a 2'-substituted nucleoside within the gap. In certain embodiments, the 2'-substituted nucleoside contains a 2'-OMe sugar moiety. In certain embodiments, the 2'-substituted nucleoside is located at position 2 of the gap (in the order of 5' to 3').

[0459] In certain embodiments, all nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds. In certain embodiments, the nucleoside bonds of the modified oligonucleotide are phosphorothioate nucleoside bonds and phosphodiester nucleoside bonds. In certain embodiments, the phosphodiester ("o") nucleoside bonds and phosphorothioate ("s") nucleoside bonds are arranged in 5' to 3' order sooooosssssssssssooss or soooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside bond and each "o" represents a phosphodiester nucleoside bond.

[0460] The nucleic acid sequences of sequence numbers 1201, 1238, 1341, and 1435 are complementary to some of the nucleic acid bases 19512-19534 of sequence number 2.

[0461] The nucleic acid base sequences of compound numbers 1362602, 1363268, 1363452, and 1363678 are complementary to some of the nucleic acid bases 19512-19534 of SEQ ID NO: 2.

[0462] In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 19512-19534 of SEQ ID NO: 2 achieve at least a 63% reduction in PLP1 RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to some of the nucleic acid bases 19512-19534 of SEQ ID NO: 2 achieve an average 80% reduction in PLP1 RNA in a standard in vitro assay.

[0463] Non-exclusive disclosure and incorporation by reference Each of the documents and patent publications cited herein is incorporated herein in their entirety by reference.

[0464] While specific compounds, compositions, and methods described herein have been described in detail based on specific embodiments, the following examples are merely illustrative of the compounds described herein and are not intended to limit them. Each of the references, GenBank reference numbers, etc., cited in this application is incorporated herein by reference in their entirety.

[0465] While the sequence listings attached to this application may identify each sequence as either "RNA" or "DNA" as necessary, in practice, these sequences may be modified with any combination of chemical modifications. Those skilled in the art will readily understand that designations such as "RNA" or "DNA" for describing modified oligonucleotides are arbitrary in certain cases. For example, an oligonucleotide containing a nucleoside with a 2'-OH sugar moiety and a thymine base may be described as DNA having a modified sugar (a 2'-OH instead of one 2'-H in DNA) or as RNA having a modified base (thymine (methylated uracil) instead of uracil in RNA). Thus, nucleic acid sequences provided herein, including but not limited to those in the sequence listings, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to those containing such nucleic acids with modified nucleic acid bases. As further examples, though not limited to them, oligomeric compounds having the nucleic acid base sequence "ATCGATCG" include those having the sequence "AUCGAUCG" and those containing RNA bases such as "AUCGATCG" and some DNA bases and some RNA bases. This includes, but is not limited to, any oligomeric compounds having such nucleic acid base sequences, as well as "AT m CGAUCG" (however, m This includes oligomeric compounds with other modified nucleic acid bases, such as C (which represents a cytosine base with a methyl group at position 5).

[0466] Certain compounds described herein (e.g., modified oligonucleotides) have one or more chiral centers, resulting in enantiomers, diastereomers, and other stereoisomer configurations, which may be defined as (R) or (S) with respect to absolute stereochemistry, as α or β for sugar anomers, or as (D) or (L) for amino acids, etc. Compounds provided herein that are described or described as having a specific stereoisomer configuration include only those compounds indicated. Compounds provided herein that are described or described by an undefined stereochemistry include all such conceivable isomers, including their sterically random and optically pure forms, unless otherwise specified. Similarly, all cis-trans isomers and tautomers of the compounds herein are also included unless otherwise specified. Oligomer compounds described herein include chiral pure or concentrated mixtures, as well as racemic mixtures. For example, oligomer compounds having multiple phosphorothioate nucleoside bonds include compounds in which the chirality of the phosphorothioate nucleoside bonds is controlled or random. Unless otherwise specified, the compounds described herein are intended to include their corresponding salt forms.

[0467] The compounds described herein include variations in which one or more atoms are substituted with non-radioactive or radioactive isotopes of the elements indicated. For example, the compounds described herein that contain a hydrogen atom are: 1 This includes all possible deuterium substitutions for each of the H hydrogen atoms. The isotopic substitutions included in the compounds herein include: 1 A substitute for H 2 H or 3 H, 12 A substitute for C 13 C or 14 C, 14 A substitute for N 15 N, 16 A substitute for O 17 O or 18 O, and 32 A substitute 33 S,34 S, 35 S, or 36 Examples include, but are not limited to, S. In certain embodiments, non-radioactive isotope substitution may impart novel properties to the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotope substitution may make the compound suitable for research purposes such as imaging or for diagnostic purposes. [Examples]

[0468] The following examples illustrate, but do not limit, specific embodiments of the present disclosure. Furthermore, where specific embodiments are provided, the inventors intend for those specific embodiments to be generally applicable. For example, the disclosure of an oligonucleotide having a particular motif provides reasonable support for further oligonucleotides having that motif or a similar motif. Similarly, for example, where a particular high-affinity modification is found at a particular position, other high-affinity modifications at the same position are also considered appropriate unless otherwise indicated.

[0469] Example 1: Effect of 5-10-5 MOE gapmer-modified oligonucleotide on human PLP1 RNA after single in vitro administration. We designed complementary modified oligonucleotides for human PLP1 nucleic acid and investigated the effect of their single doses on PLP1 RNA in vitro. The modified oligonucleotides were examined in a series of experiments under the same culture conditions; the results of each experiment are presented in separate tables below.

[0470] The modified oligonucleotides in the table below are 5-10-5 MOE gapmers. The gapmer is 20 nucleosides long, with the central gap segment consisting of 10 2'-β-D-deoxynucleosides and the 5' and 3' wing segments each consisting of 5 2'-MOE nucleosides. The sugar motif of the gapmer is (5' to 3 The structure is ')eeeeeddddddddddeeeee, where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. The internucleoside bonds throughout each modified oligonucleotide are phosphorothioate internucleoside bonds. Each cytosine residue is 5-methylcytosine.

[0471] The "start site" indicates the 5' nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. The "stop site" indicates the 3' nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to either the human PLP1 mRNA (GENBANK acceptance number: NM_001128834.2), referred to herein as SEQ ID NO: 1, or the human PLP1 genome sequence (GENBANK acceptance number: NC_000023.11, truncated from nucleotides 103773001 to 103795000), or both. "N / A" indicates that the modified oligonucleotide is not 100% complementary to its particular target nucleic acid sequence.

[0472] Cultured SK-MEL-28 cells were treated with modified oligonucleotides at a concentration of 7,000 nM using electroporation at a cell density of 20,000 cells per well. After approximately 24 hours of treatment, total RNA was isolated from the cells, and PLP1 RNA levels were measured by quantitative real-time RTPCR. PLP1 RNA levels were measured using the human PLP1 primer probe set RTS35092 (forward sequence specified as SEQ ID NO: 11 CTGATGCCAGAATGTATGGTGT; reverse sequence specified as SEQ ID NO: 12 AGGTGGAAGGTCATTTGGAAC; probe sequence specified as SEQ ID NO: 13 TGCAGAGGACAGAAGGTTGGAGC). PLP1 RNA levels were normalized to the total RNA content measured with RIBOGREEN®. The reduction in PLP1 RNA is presented in the following table as the percentage of PLP1 RNA compared to the amount in untreated control cells (%UTC). Each table represents the results for an individual assay plate. Values ​​marked with an asterisk (*) indicate that the modified oligonucleotide is complementary to the amplicon region of the primer-probe set. The potency and efficacy of the modified oligonucleotide complementary to the amplicon region may be measured using further assays. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5]

[0473] Example 2: Effect of 5-10-5 MOE gapmer-modified oligonucleotide on human PLP1 RNA in vitro, single dose. We designed complementary modified oligonucleotides for human PLP1 nucleic acid and investigated the effect of their single doses on PLP1 RNA levels in vitro. The modified oligonucleotides were examined in a series of experiments under the same culture conditions; the results of each experiment are presented in separate tables below.

[0474] The modified oligonucleotides in the table below are 5-10-5 MOE gapmers. The gapmer is 20 nucleosides long, with the central gap segment consisting of 10 2'-β-D-deoxynucleosides and the 5' and 3' wing segments each consisting of 5 2'-MOE modified nucleosides. The sugar motif of the gapmer (from 5' to 3') is eeeeeddddddddddeeeee, where "d" represents the 2'-β-D-deoxyribosyl sugar moiety and "e" represents the 2'-MOE sugar moiety. The nucleoside-to-nucleoside linkage motif (from 5' to 3') of the gapmer is "soooosssssssssssooss", where each "o" represents a phosphodiester nucleoside linkage and each "s" represents a phosphorothioate nucleoside linkage. Each cytosine residue is 5-methylcytosine.

[0475] The "start site" indicates the 5' nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. The "stop site" indicates the 3' nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to either human PLP1 mRNA (SEQ ID NO: 1) or human PLP1 genome sequence (SEQ ID NO: 2), or both. "N / A" indicates that the modified oligonucleotide is not 100% complementary to its particular target nucleic acid sequence.

[0476] Cultured SK-MEL-28 cells were treated with modified oligonucleotides at a concentration of 4,000 nM using electroporation at a cell density of 20,000 cells per well. After approximately 24 hours of treatment, total RNA was isolated from the cells, and PLP1 RNA levels were measured by quantitative real-time RTPCR. PLP1 RNA levels were measured using the human PLP1 primer probe set RTS35092 described in Example 1 above. PLP1 RNA levels were normalized to the total RNA content measured by RIBOGREEN®. The reduction in PLP1 RNA is shown in the table below as the percentage of PLP1 RNA compared to the amount in untreated control cells (%UTC). Each table represents the results for an individual assay plate. Values ​​marked with "*" indicate that the modified oligonucleotide is complementary to the amplicon region of the primer probe set. Further assays may be used to measure the potency and effectiveness of modified oligonucleotides complementary to the amplicon region. [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5] [Table 5-6] [Table 5-7] [Table 6-1] [Table 6-2] [Table 6-3] Table 6-4 Table 6-5 Table 7-1 Table 7-2 Table 7-3 Table 7-4 Table 7-5 Table 7-6 Table 7-7 Table 8-1 Table 8-2 Table 8-3 Table 8-4 Table 8-5 Table 9-1 Table 9-2 Table 9-3 Table 9-4 Table 9-5 Table 10-1 Table 10-2 Table 10-3 Table 10-4 Table 10-5 Table 11-1 Table 11-2 Table 11-3 Table 11-4 Table 11-5 Table 12-1 Table 12-2 Table 12-3 Table 12-4 Table 12-5 Table 13-1 Table 13-2 Table 13-3 Table 13-4 Table 13-5 Table 13-6 Table 13-7 Table 14-1 Table 14-2 Table 14-3 Table 14-4 Table 14-5 Table 14-6 Table 14-7 Table 15-1 Table 15-2 Table 15-3 Table 15-4 Table 15-5 Table 15-6 Table 15-7 Table 15-8 Table 16-1 Table 16-2 Table 16-3 Table 16-4 Table 16-5 Table 16-6 Table 16-7 Table 17-1 Table 17-2 Table 17-3 Table 17-4 Table 17-5 Table 18-1 Table 18-2 Table 18-3 Table 18-4 Table 18-5 Table 19-1 Table 19-2 Table 19-3 Table 19-4 Table 19-5 Table 20-1 Table 20-2 Table 20-3 Table 20-4 Table 20-5 Table 21-1 Table 21-2 Table 21-3 Table 21-4 Table 21-5 Table 22-1 Table 22-2 Table 22-3 Table 22-4 Table 22-5 Table 23-1 Table 23-2 Table 23-3 Table 23-4 Table 23-5 Table 24-1 Table 24-2 Table 24-3 Table 24-4 Table 24-5 Table 24-6 Table 24-7 Table 24-8 Table 25-1 Table 25-2 Table 25-3 Table 25-4 Table 25-5 Table 26-1 Table 26-2 Table 26-3 Table 26-4 Table 26-5 Table 27-1 Table 27-2 Table 27-3 [Table 27-4] [Table 27-5] [Table 28-1] [Table 28-2] [Table 28-3] [Table 28-4] [Table 28-5]

[0477] Example 3: Effect of modified oligonucleotides on human PLP1 RNA in vitro, and multiple doses Modified oligonucleotides selected from the above examples were investigated at various doses in SK-MEL-28 cells. SK-MEL-28 cells cultured at a density of 20,000 cells per well were transfused with modified oligonucleotides at the concentrations specified in the table below using electroporation. After approximately 24 hours of treatment, total RNA was isolated from the cells, and the RNA level of PLP1 was measured by quantitative real-time RTPCR. RNA levels were measured using the human PLP1 primer probe set RTS35092 as described above. The RNA level of PLP1 was normalized to the total RNA content measured by RIBOGREEN®. Modified oligonucleotides were investigated in a series of experiments using the same culture conditions; the results of each experiment are presented in separate tables below. The reduction in PLP1 RNA is shown in the table below as the percentage (%UTC) of PLP1 RNA compared to the amount of untreated control cells.

[0478] Linear regression used to plot the 50% inhibitory concentration (IC) of each modified oligonucleotide in a logarithmic / linear plot of the data in Excel. 50 We calculated the following, which is also shown in the table below. [Table 29] [Table 30] [Table 31] [Table 32] [Table 33] [Table 34] [Table 35] [Table 36] [Table 37] [Table 38] [Table 39]

[0479] Example 4: Design of modified oligonucleotides complementary to human PLP1 nucleic acid As shown in the table below, complementary modified oligonucleotides are added to human PLP1 nucleic acid. Designed. The "start site" indicates the 5' nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. The "stop site" indicates the 3' nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (described herein above), SEQ ID NO: 2 (described herein above), or both. "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular nucleic acid sequence.

[0480] The modified oligonucleotides in Table 40 are 6-10-4 MOE gapmers. The gapmer is 20 nucleosides long, and the sugar motif of the gapmer is eeeeeeddddddddddeeee (from 5' to 3'), where each "d" represents the 2'-β-D-deoxyribosyl sugar moiety and each "e" represents the 2'-MOE sugar moiety. The gapmer has a nucleoside-to-nucleoside linkage motif of soooooosssssssssssoss (from 5' to 3'), where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphodiester nucleoside linkage. Each cytosine residue is 5-methylcytosine. [Table 40-1] [Table 40-2]

[0481] Example 5: Activity of modified oligonucleotides complementary to human PLP1 in transgenic mice In a human BAC wild-type PLP1 transgenic mouse model, modified oligonucleotides selected from the above examples were investigated. Bacterial artificial chromosome (BAC) subclones carrying the human Plp1 gene, including downstream and upstream regulatory elements, were identified. Whole gene sequencing confirmed the presence of a human genomic region at position 103776506..103792619, corresponding to the current NCBI refseq assembly GRCh38.p13, ChrX sequence NC_000023.11. Taconic chromosomes were introduced via pronuclear injection. BAC subclones were introduced into the Biosciences C57BL / 6N Tac ES cell line. The cell line C57BL / 6NTac-Tg(PLP1)1483Tac-17235 was generated and used in these experiments. Human Plp1 mRNA expression was found in the brain and spinal cord.

[0482] process PLP1 transgenic mice were divided into groups of two. Each mouse received a single intraventricular (ICV) bolus of 100 μg of modified oligonucleotide. Groups of 3-5 mice were administered PBS as negative controls.

[0483] RNA analysis Two weeks after treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue, spinal cord, and / or cerebellum for RTPCR analysis. Human primer probe set RTS48932 (forward sequence TGCACCAGTCATCAGCTATT, specified herein as SEQ ID NO: 14) was used. The amount of RNA in PLP1 was measured using the reverse sequence specified herein as SEQ ID NO: 15 (AGACTGAAATCTGGGAGCTATTC; probe sequence specified herein as SEQ ID NO: 16 (AGGTCTCAAACTCTTTCTGCCTGTCC)). The results are presented as the percentage of PLP1 RNA compared to a PBS control normalized to mouse GAPDH. GAPDH was amplified using the primer-probe set mGapdh_LTS00102 (forward sequence specified herein as SEQ ID NO: 17 (GGCAAATTCAACGGCACAGT); reverse sequence specified herein as SEQ ID NO: 18 (GGGTCTCGCTCCTGGAAGAT); probe sequence specified herein as SEQ ID NO: 19 (AAGGCCGAGAATGGGAAGCTTGTCATC)).

[0484] As shown in the table below, treatment with modified oligonucleotides resulted in a reduction of PLP1 RNA (% control) compared to the PBS control. [Table 41] [Table 42] [Table 43] [Table 44] [Table 45] [Table 46] [Table 47] [Table 48] [Table 49]

[0485] Example 6: Efficacy of modified oligonucleotides complementary to human PLP1 in transgenic mice The modified oligonucleotides selected from the above examples were examined in a human BAC wild-type PLP1 transgenic mouse model (as described herein).

[0486] process PLP1 transgenic mice were divided into groups of four. Each mouse received a single intraventricular bolus (ICV) dose of modified oligonucleotides at the doses shown in the table below. The groups of four mice received PBS as negative controls.

[0487] RNA analysis Two weeks after treatment, mice were sacrificed, and RNA was extracted from spinal cord and cortical brain tissue for RTPCR analysis. The amount of PLP1 RNA was measured using human primer probe sets RTS48932 (described herein) and RTS48933 (forward sequence designated as SEQ ID NO: 5 CCCTAACTCAGCCAACCTTAC; reverse sequence designated as SEQ ID NO: 6 CACCCTGTTTCTCTTCCCTAAC; probe sequence designated as SEQ ID NO: 7 AGGGAGCGTAGAATCTGTGTAGACGA). The results are presented as the percentage of human PLP1 RNA compared to a PBS control normalized to mouse GAPDH. GAPDH was amplified using primer probe set mGapdh_LTS00102 (described herein).

[0488] Dose-response and tissue concentration-response data were analyzed using Microsoft Excel (v14.4) and GraphPad Prism software (v8.2.0, San Diego, CA). ED 50The values ​​were calculated from logarithmically transformed doses and individual animal PLP1 mRNA levels using a custom equation Motulsky: Agonist vs. Response - Variable Slope (4 parameters) Y = Bottom Value + (Maximum Value - Bottom Value) / (1 + (10^logEC50 / X)^Hill Slope), with the following constraints: Bottom Value > 0, Maximum Value = 100, Hill Slope < -1 and > -2.

[0489] As shown in the table below, treatment with modified oligonucleotides resulted in a dose-dependent reduction of PLP1 RNA compared to the PBS control. [Table 50]

[0490] Example 7: Dose-dependent inhibition of human PLP1 by modified oligonucleotides in SK-MEL-28 cells Modified oligonucleotides selected from the above examples were investigated at various doses in SK-MEL-28 cells (American Type Culture Collection). Using electroporation, SK-MEL-28 cells cultured at a density of 20,000 cells per well were given modified oligonucleotides at the concentrations specified in the table below. Transfusion was performed. After a processing period of approximately 24 hours, total RNA was isolated from the cells, and the RNA level of PLP1 was measured by quantitative real-time RTPCR. The RNA level of PLP1 was measured by quantitative real-time RTPCR using the human primer probe set RTS35092 described in Example 1 above. The RNA level of PLP1 was normalized to human GAPDH amplified by the primer probe set RTS104 (forward sequence GAAGGTGAAGGTCGGAGTC, specified as SEQ ID NO: 8 herein; reverse sequence GAAGATGGTGATGGGATTTC, specified as SEQ ID NO: 9 herein; probe sequence CAAGCTTCCCGTTCTCAGCC herein).

[0491] The reduction in PLP1 RNA is shown in the table below as the percentage (%UTC) of PLP1 RNA compared to the amount of untreated control cells. The 50% inhibitory concentration (IC) of each modified oligonucleotide was measured using GraphPad Prism6 software. 50 The calculation was performed, and is also shown in the table below. IC 50 The values ​​were calculated from the dose and PLP1 RNA levels using the least squares method that fits the formula: log(inhibitor) vs. normalized response - variable slope, Y = 100 / (1 + 10^((LogIC50-X)*hill gradient)). [Table 51] In some embodiments, the present invention may be described as follows. [Aspect 1] An oligomer compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleic acid base sequence of the modified oligonucleotide is at least 85% complementary to equal-length portions of the PLP1 nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond. [Aspect 2] An oligomer compound comprising a modified oligonucleotide having a nucleic acid base sequence comprising 12 to 30 linked nucleosides and at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases from any of the nucleic acid base sequences among Sequence ID No. 20 to 2155, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond. [Aspect 3] Consists of 12 to 30 linked nucleosides, The equal-length portions of nucleic acid bases 9198-9222 in sequence number 2; The equal-length portions of nucleic acid bases 13702-13766 in sequence number 2; The equal-length portions of nucleic acid bases 14037-14062 in sequence number 2; The equal-length portions of nucleic acid bases 16761-16800 in sequence number 2; The equal-length portions of nucleic acid bases 17558-17602 in sequence number 2; The equal-length portions of nucleic acid bases 17615-17667 in sequence number 2; The equal-length portions of nucleic acid bases 17853-17883 in sequence number 2; The equal-length portions of nucleic acid bases 18097-18160 in sequence number 2; The equal-length portions of nucleic acid bases 18206-18237 in sequence number 2; The equal-length portions of nucleic acid bases 18237-18340 in sequence number 2; The equal-length portions of nucleic acid bases 18350-18387 in sequence number 2; The equal-length portions of nucleic acid bases 18412-18469 in sequence number 2; The equal-length portions of nucleic acid bases 18461-18506 in Sequence ID No. 2; The equal-length portions of nucleic acid bases 18539-18579 in sequence number 2; The equal-length portions of nucleic acid bases 18697-18727 in sequence number 2; The equal-length portions of nucleic acid bases 18755-18793 in sequence number 2; The equal-length portions of nucleic acid bases 18797-18819 in sequence number 2; The equal-length portions of nucleic acid bases 18839-18862 in sequence number 2; The equal-length portions of nucleic acid bases 18974-19021 in sequence number 2; The equal-length portions of nucleic acid bases 19028-19080 in sequence number 2; The equal-length portions of nucleic acid bases 19146-19173 in sequence number 2; The equal-length portions of nucleic acid bases 19228-19253 in sequence number 2; The equal-length portions of nucleic acid bases 19347-19393 in sequence number 2; The equal-length portions of nucleic acid bases 19550-19523 in SEQ ID NO: 2; or An oligomer compound comprising a modified oligonucleotide having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases complementary to the equal-length portion of nucleic acid bases 19512-19534 of SEQ ID NO: 2, The oligomer compound wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond. [Aspect 4] Consists of 12 to 30 linked nucleosides, Sequence IDs 1050, 1124, 2145, 2151, 2152, 2153; Sequence IDs 36, 86, 114, 164, 191, 242, 269, 426, 523, 602, 691, 780; Sequence IDs 89, 167, 245, 322, 323; Sequence IDs 720, 808, 904, 937, 1058, 1097, 1184, 1278, 1340; Sequence IDs 40, 41, 117, 118, 195, 196, 273, 274, 588, 690; Sequence IDs 42, 43, 119, 120, 197, 198, 275, 276, 373, 460, 1431, 1542, 1645, 1850, 1965, 2109; Sequence IDs 1451, 1499, 1543, 1654, 1733, 2154, 2155, Sequence IDs 200, 420, 504, 620, 646, 709, 823, 980, 1029, 1149, 1196, 1253, 1323, 1423, 1476, 1605, 1613, 1728, 1832; Sequence IDs 45, 46, 123, 124, 201, 202, 279, 280, 538, 562, 2091; Sequence IDs 48, 49, 50, 51, 52, 53, 125, 126, 127, 128, 129, 130, 131, 203, 204, 205, 206, 207, 208, 281, 282, 283, 284, 285, 286, 414, 459, 485, 503, 579, 580, 693, 724, 840, 873, 911, 1034, 1081, 1125, 1159, 1318, 1413, 1513, 1548, 1672, 1701, 1794, 1868, 1958, 2002; Sequence IDs 209, 287, 335, 439, 506, 606, 659, 1922, 2033, 2104; Sequence IDs 784, 842, 869, 978, 1082, 1131, 1218, 1250, 1320, 1453, 1529, 1538, 1616, 1712, 1821; Sequence IDs 54, 55, 132, 133, 210, 288, 419, 499, 564, 665, 764, 800, 881, 993, 1059, 1200, 1295, 1354, 1422, 1465, 1544, 1705, 1802, 2149; Sequence IDs 338, 438, 525, 604, 658, 758, 813, 887, 977, 1043, 1108, 1199, 1258, 1336, 1395, 1514, 1557, 1668, 1697, 2089; Sequence IDs 875, 934, 1047, 1110, 1229, 1243, 1373, 1438, 2146, 2147; Sequence IDs 761, 798, 890, 946, 1022, 1120, 1198, 1293, 1358, 1398, 1463; Sequence IDs 56, 134, 683, 718; Sequence IDs 1610, 1663, 1702, 1786; Sequence IDs 212, 1060, 1090, 1181, 1277, 1446, 1510, 1589, 1646, 1693, 1772, 2148; Sequence IDs 57, 586, 666, 714, 812, 914, 951, 1052, 1138, 1162, 1248, 1363, 1455; Sequence IDs 385, 416, 545, 621, 682, 1968, 2055, 2101, 2150; Sequence IDs 363, 467, 541, 2008, 2111; Sequence IDs 58, 59, 136, 213, 214, 291, 292, 383, 417, 519, 612, 671, 730, 900, 986, 1019, 1136, 1353, 1457, 1504, 1546, 2093; Sequence IDs 398, 435, 2095, 2010, 2144; or An oligomer compound comprising a modified oligonucleotide having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleic acid bases of a sequence selected from SEQ ID NOs: 1201, 1238, 1341, 1435, The oligomer compound wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified nucleoside bond. [Aspect 5] The oligomer compound according to any one of aspects 1 to 4, wherein, when measured over the entire nucleic acid base sequence of the modified oligonucleotide, the modified oligonucleotide has a nucleic acid base sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleic acid base sequence of SEQ ID NO: 1 or SEQ ID NO: 2. [Aspect 6] The oligomer compound according to any one of aspects 1 to 5, wherein the modified oligonucleotide comprises at least one modified nucleoside containing a modified sugar moiety. [Aspect 7] The oligomer compound according to aspect 6, wherein the modified oligonucleotide comprises at least one modified nucleoside containing a bicyclic sugar moiety. [Aspect 8] The oligomer compound according to aspect 7, wherein the bicyclic sugar portion includes a 4'-2' crosslink, and the 4'-2' crosslink is selected from -CH2-O- and -CH(CH3)-O-. [Aspect 9] The oligomer compound according to any one of aspects 6 to 8, wherein the modified oligonucleotide comprises at least one modified nucleoside including a non-bicyclic modified sugar moiety. [Aspect 10] The oligomer compound according to aspect 9, wherein the non-bicyclic modified sugar portion is a 2'-MOE sugar portion or a 2'-OMe sugar portion. [Aspect 11] The oligomer compound according to any one of aspects 6 to 10, wherein the modified oligonucleotide comprises at least one modified nucleoside containing a sugar substitute. [Aspect 12] The oligomer compound according to aspect 11, wherein the sugar substitute is any one of morpholino, modified morpholino, PNA, THP, and F-HNA. [Aspect 13] The oligomer compound according to any one of aspects 1 to 6 or 9 to 12, wherein the modified oligonucleotide does not contain a bicyclic sugar moiety. [Aspect 14] The oligomer compound according to any one of aspects 1 to 13, wherein the modified oligonucleotide is a gapmer. [Aspect 15] The modified oligonucleotide is A 5' region consisting of linked 5' region nucleosides 1-7; A central region consisting of 6-10 linked central region nucleosides; It includes a 3' region consisting of linked 3' region nucleosides 1 to 7, The oligomer compound according to any one of embodiments 1 to 14, wherein each of the 5' region nucleosides and each of the 3' region nucleosides contains a modified sugar moiety, and each of the central region nucleosides contains a 2'-deoxyfuranosyl sugar moiety. [Aspect 16] The modified oligonucleotide is A 5' region consisting of 5 linked 5' region nucleosides; A central region consisting of 10 linked central region nucleosides; It includes a 3' region consisting of 5 linked 3' region nucleosides, The oligomer compound according to embodiment 15, wherein each of the 5' region nucleosides and each of the 3' region nucleosides is a 2'-MOE nucleoside, and each of the central region nucleosides is a 2'-β-D-deoxynucleoside. [Aspect 17] The modified oligonucleotide is A 5' region consisting of six linked 5' region nucleosides, A central region consisting of 10 linked central region nucleosides, It includes a 3' region consisting of four linked 3' region nucleosides, The oligomer compound according to embodiment 15, wherein each of the 5' region nucleosides and each of the 3' region nucleosides is a 2'-MOE nucleoside, and each of the central region nucleosides is a 2'-β-D-deoxynucleoside. [Aspect 18] The oligomer compound according to any one of aspects 1 to 17, wherein the modified oligonucleotide comprises at least one modified nucleoside bond. [Aspect 19] The oligomer compound according to aspect 18, wherein each nucleoside bond in the modified oligonucleotide is a modified nucleoside bond. [Aspect 20] The oligomer compound according to aspect 18 or 19, wherein at least one nucleoside bond is a phosphorothioate nucleoside bond. [Aspect 21] The oligomer compound according to aspect 18 or 20, wherein the modified oligonucleotide comprises at least one phosphodiester nucleoside bond. [Aspect 22] The oligomer compound according to any one of aspects 18, 20, or 21, wherein each nucleoside bond is either a phosphodiester nucleoside bond or a phosphorothioate nucleoside bond. [Aspect 23] The oligomer compound according to aspect 19, wherein each nucleoside bond is a phosphorothioate nucleoside bond. [Aspect 24] The oligomer compound according to any one of aspects 1 to 18 or 20 to 22, wherein the modified oligonucleotide has a nucleoside linkage motif of soooossssssssssss or soooossssssssssss, where s is a phosphorothioate nucleoside linkage and o is a phosphodiester nucleoside linkage. [Aspect 25] The oligomer compound according to any one of aspects 1 to 24, wherein the modified oligonucleotide comprises at least one modified nucleic acid base. [Aspect 26] The oligomer compound according to aspect 25, wherein the modified nucleic acid base is 5-methylcytosine. [Aspect 27] The oligomer compound according to any one of aspects 1 to 26, wherein the modified oligonucleotide consists of linked nucleosides of 12-30, 12-22, 12-20, 14-18, 14-20, 15-17, 15-25, 16-18, 16-20, 17-20, 18-20, or 18-22. [Aspect 28] The oligomer compound according to any one of aspects 1 to 26, wherein the modified oligonucleotide consists of 16, 17, 18, 19, or 20 linked nucleosides. [Aspect 29] The oligomer compound according to aspect 28, wherein the modified oligonucleotide consists of 20 linked nucleosides. [Aspect 30] The oligomer compound according to aspect 28, wherein the modified oligonucleotide consists of 18 linked nucleosides. [Aspect 31] An oligomer compound, the following chemical representation: m C es m C eo m C eo A eo A eo T ds A ds G ds A ds T ds T ds m C ds A ds A ds m C ds T eo A eo G es m C es m C e (Sequence ID 134); A es m C eo A eo m C eo A eo A ds m C ds T ds m C ds Tds T ds T ds A ds m C ds A ds A eo m C eo A es A es A e (Array No. 411); T es m C eo T eo m C eo m C eo A ds G ds A ds m C ds A ds T ds T ds T ds m C ds T ds G eo A eo T es G es m C e (Array No. 934); G es T eo G eo T eo G eo T ds T ds A ds A ds A ds A ds T ds T ds G ds m C ds A eo A eo T es T es m C e (Array No. 1238); A es T eo T eo G eo m C eo Ads A ds T ds T ds m C ds T ds A ds T ds A ds T ds m C eo A eo G es A es A e (SEQ ID NO: 2010); A es T eo G eo T eo G eo A ds T ds m C ds T ds A ds T ds A ds T ds m C ds A ds G eo G eo A es G es A e (SEQ ID NO: 1772); or A es m C eo m C eo A eo G eo A ds G ds G ds G ds m C ds m C ds A ds T ds m C ds T ds m C eo A eo G es G es T e (SEQ ID NO: 881) T es G eo Teo A eo G eo T ds A ds m C ds A ds A ds A ds T ds m C ds T ds T ds T eo m C eo m C es T es T e (SEQ ID NO: 2101); G es m C eo A eo T eo m C eo A ds G ds A ds T ds G ds T ds T ds m C ds A ds T ds m C eo T eo m C es T es T e (SEQ ID NO: 1050); m C es m C eo T eo m C eo m C eo A ds T ds T ds m C ds m C ds T ds T ds T ds G ds T ds G eo Aeo m C es T es T e The modified oligonucleotide comprises one of the (SEQ ID NO: 1449) In the text, A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, The oligomer compound wherein o is a phosphodiester nucleoside bond. [Aspect 32] An oligomer compound, the following chemical representation: T es G eo T eo A eo G eo T ds A ds m C ds A ds A ds A ds T ds m C ds T ds T ds T eo m C eo m C es T es T e (SEQ ID NO: 2101) contains modified oligonucleotides, and in the notation A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, The oligomer compound wherein o is a phosphodiester nucleoside bond. [Aspect 33] An oligomer compound, the following chemical representation: A es m C eo A eo A eo A eo T eo m C ds T ds T ds T ds m C ds m C ds T ds T ds m C ds A ds A eo T es T es A e Includes modified oligonucleotides related to (SEQ ID NO: 682), as indicated in the notation: A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, The oligomer compound wherein o is a phosphodiester nucleoside bond. [Aspect 34] An oligomer compound, the following chemical representation: m C es A eo G eo A eo T eo G eo T ds T ds m C ds Ads T ds m C ds T ds m C ds T ds T ds m C eo A es m C es A e Includes modified oligonucleotides related to (SEQ ID NO: 1124), as indicated in the notation: A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, The oligomer compound wherein o is a phosphodiester nucleoside bond. [Aspect 35] An oligomer compound, the following chemical representation: m C es A eo T eo m C eo A eo G eo A ds T ds G ds T ds T ds m C ds A ds T ds m C ds T ds m C eo T es T es m C e Includes modified oligonucleotides related to (SEQ ID NO: 2145), as indicated in the notation: A is an adenine nucleic acid base, m C is a 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, The oligomer compound wherein o is a phosphodiester nucleoside bond. [Aspect 36] The oligomer compound according to any one of aspects 1 to 35, wherein the oligomer compound is a single-chain oligomer compound. [Aspect 37] An oligomer compound according to any one of aspects 1 to 36, comprising the modified oligonucleotide. [Aspect 38] The oligomer compound according to any one of aspects 1 to 36, further comprising a conjugate group. [Aspect 39] The oligomer compound according to aspect 38, wherein the conjugate group comprises a conjugate moiety and a conjugate linker. [Aspect 40] The oligomer compound according to aspect 38, comprising a GalNAc cluster containing 1 to 3 GalNAc ligands in the conjugate group. [Aspect 41] The oligomer compound according to aspect 38 or 39, wherein the conjugate linker consists of a single bond. [Aspect 42] The oligomer compound according to aspect 39 or 41, wherein the conjugate linker is cleavable. [Aspect 43] The oligomer compound according to aspect 39 or 42, wherein the conjugate linker comprises 1 to 3 linker nucleosides. [Aspect 44] The oligomer compound according to any one of aspects 38 to 43, wherein the conjugate group is bonded to the modified oligonucleotide at the 5' end of the modified oligonucleotide. [Aspect 45] The oligomer compound according to any one of aspects 38 to 43, wherein the conjugate group is bonded to the modified oligonucleotide at the 3' end of the modified oligonucleotide. [Aspect 46] The oligomer compound according to any one of aspects 1 to 36 or 38 to 45, further comprising terminal groups. [Aspect 47] The oligomer compound according to any one of aspects 1 to 42 or 44 to 46, wherein the oligomer compound does not contain a linker nucleoside. [Aspect 48] The oligomer compound according to any one of aspects 1 to 47, wherein the modified oligonucleotide of the oligomer compound is a salt, and the salt is a sodium salt or a potassium salt. [Aspect 49] The oligomer compound according to any one of aspects 1 to 48, wherein the modified oligonucleotide is an RNAi compound. [Aspect 50] An oligomer double chain comprising the oligomer compound described in any of aspects 1 to 35 or 37 to 49. [Aspect 51] An antisense compound comprising an oligomer compound according to any of aspects 1 to 49 or an oligomer double chain according to aspect 50, or comprising the oligomer compound or the oligomer double chain. [Aspect 52] The following chemical structure: [ka] Modified oligonucleotides or salts thereof relating to the above. [Aspect 53] The modified oligonucleotide according to aspect 52, wherein the modified oligonucleotide is a sodium salt or a potassium salt. [Aspect 54] Modified oligonucleotide relating to the following chemical structure: [ka] [Aspect 55] The following chemical structure: [ka] Modified oligonucleotides or salts thereof relating to the above. [Aspect 56] The modified oligonucleotide according to aspect 55, wherein the modified oligonucleotide is a sodium salt or a potassium salt. [Aspect 57] Modified oligonucleotide relating to the following chemical structure: [ka] [Aspect 58] The following chemical structure: [ka] Modified oligonucleotides or salts thereof relating to the above. [Aspect 59] The modified oligonucleotide according to aspect 58, wherein the modified oligonucleotide is a sodium salt or a potassium salt. [Aspect 60] Modified oligonucleotide relating to the following chemical structure: [ka] [Aspect 61] The following chemical structure: [ka] Modified oligonucleotides or salts thereof relating to the above. [Aspect 62] The modified oligonucleotide according to aspect 61, wherein the modified oligonucleotide is a sodium salt or a potassium salt. [Aspect 63] Modified oligonucleotide relating to the following chemical structure: [ka] [Aspect 64] A pharmaceutical composition comprising an oligomeric compound according to any one of aspects 1 to 49, an oligomeric double-chain according to aspect 50, an antisense compound according to aspect 51, or a modified oligonucleotide according to any one of aspects 52 to 63, and a pharmaceutically acceptable diluent or carrier. [Aspect 65] The pharmaceutical composition according to aspect 64, comprising a pharmaceutically acceptable diluent, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate-buffered saline (PBS). [Aspect 66] The pharmaceutical composition according to aspect 65, wherein the pharmaceutical composition essentially consists of the oligomer compound or the modified oligonucleotide and aCSF. [Aspect 67] The pharmaceutical composition according to aspect 65, wherein the pharmaceutical composition essentially consists of the oligomer compound or the modified oligonucleotide and PBS. [Aspect 68] A pharmaceutical composition comprising a modified oligonucleotide according to any one of aspects 52 to 63 and a pharmaceutically acceptable diluent. [Aspect 69] The pharmaceutical composition according to aspect 68, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate-buffered saline (PBS). [Aspect 70] The pharmaceutical composition according to aspect 69, wherein the pharmaceutical composition essentially consists of the modified oligonucleotide and aCSF. [Aspect 71] The pharmaceutical composition according to aspect 69, wherein the pharmaceutical composition essentially consists of the modified oligonucleotide and PBS. [Aspect 72] A pharmaceutical composition comprising an oligomer compound according to any one of aspects 32 to 35 and a pharmaceutically acceptable diluent. [Aspect 73] The pharmaceutical composition according to aspect 72, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate-buffered saline (PBS). [Aspect 74] The pharmaceutical composition according to aspect 73, wherein the pharmaceutical composition essentially consists of the oligomer compound and aCSF. [Aspect 75] The pharmaceutical composition according to aspect 73, wherein the pharmaceutical composition essentially consists of the oligomer compound and PBS. [Aspect 76] A chiral enrichment of modified oligonucleotides according to any one of aspects 52 to 63, wherein the enrichment is concentrated with respect to modified oligonucleotides having a specific stereochemical configuration and containing at least one specific phosphorothioate nucleoside bond. [Aspect 77] The chiral enrichment population according to aspect 76, wherein the population is enriched with respect to modified oligonucleotides comprising at least one specific phosphorothioate nucleoside bond having a (Sp) configuration. [Aspect 78] The chiral enrichment population according to aspect 76, wherein the population is enriched with respect to modified oligonucleotides comprising at least one specific phosphorothioate nucleoside bond having a (Rp) configuration. [Aspect 79] The chiral enriched population according to aspect 76, wherein the population is enriched with respect to modified oligonucleotides having a specific, independently selected stereochemical configuration at each phosphorothioate nucleoside bond. [Aspect 80] The chiral enriched population according to Embodiment 79, wherein the population is enriched with respect to modified oligonucleotides having a (Sp) configuration at each phosphorothioate nucleoside bond, or with respect to modified oligonucleotides having a (Rp) configuration at each phosphorothioate nucleoside bond. [Aspect 81] The chiral enrichment population according to aspect 79, wherein the population is enriched with respect to modified oligonucleotides having a (Rp) configuration at one specific phosphorothioate nucleoside bond and a (Sp) configuration at each of the remaining phosphorothioate nucleoside bonds. [Aspect 82] The chiral enriched population according to aspect 79, wherein the population is enriched with respect to modified oligonucleotides having at least three consecutive phosphorothioate nucleoside bonds in an Sp, Sp, and Rp configuration in the 5' to 3' direction. [Aspect 83] A group of modified oligonucleotides according to any one of aspects 52 to 63, wherein all of the phosphorothioate nucleoside bonds of the modified oligonucleotide are sterically random. [Aspect 84] A chiral enrichment population of oligomer compounds according to any one of aspects 32 to 35, wherein the population is enriched with respect to oligomer compounds having a specific stereochemical configuration and containing at least one specific phosphorothioate nucleoside bond. [Aspect 85] The chiral enriched population according to aspect 84, wherein the population is enriched with respect to oligomeric compounds comprising at least one specific phosphorothioate nucleoside bond having a (Sp) configuration. [Aspect 86] The chiral enriched population according to aspect 84, wherein the population is enriched with respect to oligomeric compounds comprising at least one specific phosphorothioate nucleoside bond having a (Rp) configuration. [Aspect 87] The chiral enriched population according to aspect 84, wherein the population is enriched with respect to oligomeric compounds having a specific, independently selected stereochemical configuration at each phosphorothioate nucleoside bond. [Aspect 88] The chiral enriched population according to aspect 87, wherein the population is enriched with respect to oligomeric compounds having an (Sp) configuration at each phosphorothioate nucleoside bond, or with respect to modified oligonucleotides having an (Rp) configuration at each phosphorothioate nucleoside bond. [Aspect 89] The chiral enriched population according to aspect 87, wherein the population is enriched with respect to oligomeric compounds having a (Rp) configuration at one specific phosphorothioate nucleoside bond and a (Sp) configuration at each of the remaining phosphorothioate nucleoside bonds. [Aspect 90] The chiral enriched population according to aspect 87, wherein the population is enriched with respect to oligomeric compounds having at least three consecutive phosphorothioate nucleoside bonds in an Sp, Sp, and Rp configuration in the 5' to 3' direction. [Aspect 91] A group of oligomer compounds according to any one of aspects 32 to 35, wherein all of the phosphorothioate nucleoside bonds of the modified oligonucleotide are sterically random. [Aspect 92] A pharmaceutical composition comprising a chiral concentrated population according to any one of aspects 76 to 82 or 84 to 90, or a population according to aspect 83, or a population according to aspect 91, and a pharmaceutically acceptable diluent. [Aspect 93] The pharmaceutical composition according to aspect 92, wherein the pharmaceutically acceptable diluent is artificial CSF (aCSF) or phosphate-buffered saline (PBS). [Aspect 94] The pharmaceutical composition according to aspect 93, wherein the pharmaceutical composition essentially consists of the oligomer compound or the modified oligonucleotide and artificial CSF (aCSF). [Aspect 95] The pharmaceutical composition according to aspect 93, wherein the pharmaceutical composition essentially consists of the oligomer compound or the modified oligonucleotide and PBS. [Aspect 96] A method comprising administering to an animal the pharmaceutical composition described in any of aspects 64-75 or 92-95. [Aspect 97] A method for treating a disease or disorder related to PLP1, comprising administering a therapeutically effective amount of a pharmaceutical composition according to any one of embodiments 64-75 or 92-95 to a subject who has or is at risk of developing a disease related to PLP1, thereby treating the disease or disorder related to PLP1. [Aspect 98] A method for reducing PLP1 protein in CSF of a subject having or at risk of developing a disease or disorder related to PLP1, the method comprising reducing PLP1 protein in CSF by a therapeutically effective amount of the pharmaceutical composition described in any of aspects 64-75 or 92-95. [Aspect 99] The method according to aspect 97 or 98, wherein the disease or disorder related to PLP1 is a neurodegenerative disease. [Aspect 100] The method according to any one of aspects 97 to 99, wherein the disease or disorder associated with PLP1 is leukodystrophy. [Aspect 101] The method according to aspect 100, wherein the leukodystrophy is PMD. [Aspect 102] The method according to aspect 101, wherein the PMD is any of severe PMD, standard PMD, or transitional PMD. [Aspect 103] The method according to aspect 101, wherein the PMD is caused by overexpression of the PLP1 protein. [Aspect 104] The method according to aspect 101, wherein the PMD is caused by multiple copies of the PLP1 gene. [Aspect 105] The method according to aspect 101, wherein the PMD is caused by the expression of a replicated copy of the PLP1 gene. [Aspect 106] The method according to any one of aspects 100 to 105, wherein at least one symptom or characteristic of the leukodystrophy is improved. [Aspect 107] The method according to aspect 97 or 98, wherein the disease or disorder associated with PLP1 is SPG2. [Aspect 108] The method according to aspect 107, wherein at least one symptom or characteristic of SPG2 is improved. [Aspect 109] The method according to aspect 106 or 108, wherein the symptom or characteristic is any of hypotonia, nystagmus, optic nerve atrophy, dyspnea, motor delay, cognitive impairment, speech impairment, spasticity, ataxia, seizures, choroidal motion, and death. [Aspect 110] The method according to any one of aspects 96 to 109, wherein administration of the modified oligonucleotide reduces hypotonia, nystagmus, optic nerve atrophy, dyspnea, motor delay, cognitive impairment, speech impairment, spasticity, ataxia, seizures, or choroidal motion in a subject, or delays death. [Aspect 111] The method according to any one of aspects 96 to 110, wherein the pharmaceutical composition is administered to the central nervous system or systemically. [Aspect 112] The method according to aspect 111, wherein the pharmaceutical composition is administered to the central nervous system or systemically. [Aspect 113] The method according to any one of aspects 96 to 110, wherein the pharmaceutical composition is administered intrathecally, systemically, subcutaneously, or intramuscularly. [Aspect 114] A method for reducing PLP1 RNA in cells, comprising contacting the cells with an oligomeric compound according to any one of aspects 1 to 49, an oligomeric double-strand according to aspect 50, an antisense compound according to aspect 51, or a modified oligonucleotide according to any one of aspects 52 to 63, thereby reducing PLP1 RNA in the cells. [Aspect 115] A method for reducing intracellular PLP1 protein, comprising contacting the cells with an oligomeric compound according to any one of aspects 1 to 49, an oligomeric double-chain according to aspect 50, an antisense compound according to aspect 51, or a modified oligonucleotide according to any one of aspects 52 to 63, thereby reducing PLP1 protein in the cells. [Aspect 116] The method according to aspect 114 or aspect 115, wherein the cells are oligodendrocytes or oligodendrocyte precursor cells. [Aspect 117] The method according to aspect 114 or aspect 115, wherein the cells are Schwann cells or Schwann cell progenitor cells. [Aspect 118] The method according to any one of aspects 114 to 117, wherein the cells are present in an animal. [Aspect 119] The method accord...

Claims

[Claim 1] The invention described in the specification.