Mammoth-specific gene mutations and compositions containing them

Gene-edited mammalian cells, particularly for elephants, address the shortage of tissues and cell lines for extinct and endangered species, enabling effective conservation and recovery efforts.

JP2026511898APending Publication Date: 2026-04-14COLOSSAL BIOSCIENCES INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025557333
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-04-06
Filing Date
2024-04-05
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

There is a shortage of tissues and cell lines for extinct and endangered species, hindering conservation efforts and recovery processes, and existing technologies lack effective biological tools for genome editing and tissue culture in non-human cells.

Method used

Development of gene-edited and reprogrammed mammalian cells, including specific nucleotide sequences and vectors, to create recombinant host cells and transgenic animals, particularly focusing on elephant cells, to preserve and restore endangered and extinct species.

Benefits of technology

Provides a means to preserve endangered and extinct species through biobanking of tissues and cell lines, supporting conservation and ecosystem recovery by addressing the lack of suitable biological tools for genome editing and tissue culture.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026511898000001_ABST
    Figure 2026511898000001_ABST
Patent Text Reader

Abstract

This specification provides isolated nucleic acids, vectors, recombinant cells, and genetically modified animals capable of expressing at least one or more mammoth genes. Recombinant cells and genetically modified animals containing one or more mammoth-specific deletions of upstream regulatory regions of identified transcription start sites are also provided.
Need to check novelty before this filing date? Find Prior Art

Description

Cross-reference of related applications

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 494,762, filed on April 6, 2023, the disclosure of which is incorporated herein by reference in its entirety. [Technical Field]

[0002] This disclosure generally relates to gene-edited and / or reprogrammed mammalian cells and their use.

[0003] [Referencing electronically submitted sequence listings] This application includes an electronically filed sequence listing. The contents of the electronic sequence listing (069296.9WO1 Sequence Listing.xml; size: 1,857,418 bytes; created March 29, 2024) are incorporated herein by reference in their entirety. [Background technology]

[0004] Currently, there is an unmet need for elephant tissue culture, genome editing of non-human cells, and the development of biological tools to support animal conservation and extinct species recovery efforts. Synthetic biology and gene editing can improve the treatment of wildlife diseases and correct ecosystem imbalances caused by climate change, pollution, human consumption, hunting, anthropogenic disturbances, resource depletion, deforestation, and extinction events. The creation and biobanking of tissues and cell lines from endangered and extinct species can preserve them for future research and help in the recovery of endangered and extinct species. However, there is currently a shortage of tissues and cell lines to be used in the extinction recovery process of extinct animals. [Overview of the project]

[0005] Provided herein are: G protein-coupled receptor 98 (GPR98) (SEQ ID NO: 1), microtubule actin crosslinking factor 1 (MACF1) (SEQ ID NO: 2), adenosine deaminase RNA-specific B2 (ADARB2) (SEQ ID NO: 3), centrosome protein 290 (CEP290) (SEQ ID NO: 4), keratin 4 (KRT4) (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCK-related protein 5 (NCKAP5) (SEQ ID NO: 7), laminin subunit β4 (LAMB4) (SEQ ID NO: 8), Niemann-Pick C1-like protein 1 (NPC1L1) (SEQ ID NO: 9), adhesion G protein Cryo-coupled receptor D2 (ADGRD2) (SEQ ID NO: 10), Ninjurin 1 (NINJ1) (SEQ ID NO: 11), AHNAK nucleoprotein 2 (AHNAK2) (SEQ ID NO: 12), Cation channel sperm-associated accessory subunit β (CATSPERB) (SEQ ID NO: 13), Pecanex-like 4 (PCNXL4) (SEQ ID NO: 14), Spectrin repeat-containing nuclear envelope protein 2 (SYNE2) (SEQ ID NO: 15), NLR family pyrine domain-containing 12 (NLRP12) (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WD repeat Region 90 (WDR90) (SEQ ID NO: 18), Breast Cancer 2 (BRCA2) (SEQ ID NO: 19), Protein Kinase, DNA Activation Catalytic Subunit (PRKDC) (SEQ ID NO: 20), Vacuolar Protein Sorting 13 Homolog B (VPS13B) (SEQ ID NO: 21), Prosaposin (PSAP) (SEQ ID NO: 22), SEC31 Homolog B (SEC31B) (SEQ ID NO: 23), Keratin 28 (KRT28) (SEQ ID NO: 24), Keratin 35 (KRT35) (SEQ ID NO: 25), Keratin 40 (KRT40) (SEQ ID NO: 26), Myosin Heavy Chain 4 (MYH4) ( SEQ ID NO: 27), TRP phosphoinositide interaction regulator (PIRT) (SEQ ID NO: 28), polycystin 1-like 2 (PKD1L2) (SEQ ID NO: 29), retinitis pigmentosa 1-like protein (RP1L1) (SEQ ID NO: 30), X chromosome open reading frame 58 (CXorf58) (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), thyroid hormone receptor-related protein 3 (THRAP3) (SEQ ID NO: 34), centromere protein C1 (CENPC1) (SEQ ID NO: 35),This is an isolated nucleic acid sequence containing a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to at least one of the following: dentinogenesis and dentin sialophosphoprotein (DSPP) (SEQ ID NO: 36), fibroblast growth factor 5 (FGF5) (SEQ ID NO: 37), sperm-associated cation channel co-γ subunit (CATSPERG) (SEQ ID NO: 38), myosin heavy chain 1 (MYH1) (SEQ ID NO: 39), myosin heavy chain 13 (MYH13) (SEQ ID NO: 40), ATR interacting protein (ATRIP) (SEQ ID NO: 41), and transglutaminase 3 (TGM3) (SEQ ID NO: 42).

[0006] In certain embodiments, the nucleotide sequences are GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADGRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 2) 1) Includes at least one of PSAP (sequence number 22), SEC31B (sequence number 23), KRT28 (sequence number 24), KRT35 (sequence number 25), KRT40 (sequence number 26), MYH4 (sequence number 27), PIRT (sequence number 28), PKD1L2 (sequence number 29), RP1L1 (sequence number 30), CXorf58 (sequence number 31), LOC126068772 (sequence number 32), LOC126069872 (sequence number 33), THRAP3 (sequence number 34), CENPC1 (sequence number 35), DSPP (sequence number 36), FGF5 (sequence number 37), CATSPERG (sequence number 38), MYH1 (sequence number 39), MYH13 (sequence number 40), ATRIP (sequence number 41), and TGM3 (sequence number 42).

[0007] Also provided are isolated vectors containing the isolated nucleic acid sequences described herein.

[0008] Also, GPR98 (sequence number 1), MACF1 (sequence number 2), ADARB2 (sequence number 3), CEP290 (sequence number 4), KRT4 (sequence number 5), LOC126076011 (sequence number 6), NCKAP5 (sequence number 7), LAMB4 (sequence number 8), NPC1L1 (sequence number 9), ADGRD2 (sequence number 10), NINJ1 (sequence number 11), AHNAK2 (sequence number 12), CATSPERB (sequence number 10) 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT4 Recombinant host cells are also provided that contain nucleotide sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to at least one of the following: 0 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO: 39), MYH13 (SEQ ID NO: 40), ATRIP (SEQ ID NO: 41), and TGM3 (SEQ ID NO: 42). In a particular embodiment, the recombinant host cell may include GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADGRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PS It contains at least one nucleotide sequence from among AP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO: 39), MYH13 (SEQ ID NO: 40), ATRIP (SEQ ID NO: 41), and TGM3 (SEQ ID NO: 42).

[0009] Also provided are recombinant host cells comprising at least one of the isolated nucleic acid sequences described herein. In certain embodiments, the recombinant host cell comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42 of the isolated nucleic acids described herein.

[0010] Also provided herein are LOC126071805, WASH complex subunit 4 (WASHC4), LOC126075532, LOC126075533, α-fetoprotein (AFP), LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, L OC126080369, LOC126080369, LOC126080733, distal-less homeobox 6 (DLX6), extracellular matrix protein 2 (ECM2), LOC126085059, LOC126085481, LOC126086151, LOC126086152, LOC126086293, LOC126058 Recombinant host cells containing deletions of at least one nucleotide sequence upstream of the transcription start site of LOC126069912, LOC126058390, LOC126058396, Forkheadbox H1 (FOXH1), LOC126060018, LOC126060570, Coiled-Coil Domain-Containing 15 (CCDC15), INO80 Complex Subunit B (INO80B), LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, Acyl-CoA Wax Alcohol Acyltransferase 1 (AWAT1), Transmembrane Protein 187 (TMEM187), and LOC126069912. The deleted nucleotide sequence includes (a) SEQ ID NO: 43 upstream of LOC126071805, (b) SEQ ID NO: 44 upstream of WASHC4, (c) SEQ ID NO: 45 upstream of LOC126075532, (d) SEQ ID NO: 46 upstream of LOC126075533, (e) SEQ ID NO: 47 upstream of AFP, (f) SEQ ID NO: 48 upstream of LOC126079103, (g) SEQ ID NO: 49 upstream of LOC126079327, (h) SEQ ID NO: 50 upstream of LOC126079327, and (i) LOC Upstream of 126080333, it includes sequence number 51; (j) Upstream of LOC126080367, it includes sequence number 52; (k) Upstream of LOC126080369, it includes sequence number 53; (l) Upstream of LOC126080369, it includes sequence number 54; (m) Upstream of LOC126080733, it includes sequence number 55; (n) Upstream of DLX6, it includes sequence number 56; (o) Upstream of ECM2, it includes sequence number 57; (p) Upstream of LOC126085059, it includes sequence number 58; (q) Upstream of LOC126085481, it includes sequence number 59; ( r) Upstream of LOC126086151, it includes sequence number 60; (s) Upstream of LOC126086152, it includes sequence number 61; (t) Upstream of LOC126086293, it includes sequence number 62; (u) Upstream of LOC126058227, it includes sequence number 63; (v) Upstream of LOC126058390, it includes sequence number 64; (w) Upstream of LOC126058396, it includes sequence number 65; (x) Upstream of FOXH1, it includes sequence number 66; (y) Upstream of LOC126060018, it includes sequence number 67; (z) Upstream of LOC126060570 Upstream of (aa)CCDC15, it includes sequence number 68; upstream of (bb)INO80B, it includes sequence number 70; upstream of (cc)LOC126062579, it includes sequence number 71; upstream of (dd)LOC126063153, it includes sequence number 72; upstream of (ee)LOC126063990, it includes sequence number 73; upstream of (ff)LOC126063991, it includes sequence number 74; upstream of (gg)LOC126066513, it includes sequence number 75; upstream of (hh)LOC126066877, it includes sequence number 76.(ii) Upstream of AWAT1, it includes sequence number 77; (jj) Upstream of TMEM187, it includes sequence number 78; and (kk) Upstream of LOC126069912, it includes sequence number 79.

[0011] In certain embodiments, recombinant host cells containing isolated nucleic acids described herein include LOC126071805, WASHC4, LOC126075532, LOC126075533, AFP, LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, LOC126080369, LOC126080369, LOC126080733, DLX6, ECM2, LOC126085059, LOC126085481, LOC126086151, LOC126 The following further include deletions of at least one nucleotide sequence upstream of the transcription start site of 086152, LOC126086293, LOC126058227, LOC126058390, LOC126058396, FOXH1, LOC126060018, LOC126060570, CCDC15, INO80B, LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, AWAT1, TMEM187, and LOC126069912. The deleted nucleotide sequence includes (a) SEQ ID NO: 43 upstream of LOC126071805, (b) SEQ ID NO: 44 upstream of WASHC4, (c) SEQ ID NO: 45 upstream of LOC126075532, (d) SEQ ID NO: 46 upstream of LOC126075533, (e) SEQ ID NO: 47 upstream of AFP, (f) SEQ ID NO: 48 upstream of LOC126079103, (g) SEQ ID NO: 49 upstream of LOC126079327, (h) SEQ ID NO: 50 upstream of LOC126079327, and (i) LOC Upstream of 126080333, it includes sequence number 51; (j) Upstream of LOC126080367, it includes sequence number 52; (k) Upstream of LOC126080369, it includes sequence number 53; (l) Upstream of LOC126080369, it includes sequence number 54; (m) Upstream of LOC126080733, it includes sequence number 55; (n) Upstream of DLX6, it includes sequence number 56; (o) Upstream of ECM2, it includes sequence number 57; (p) Upstream of LOC126085059, it includes sequence number 58; (q) Upstream of LOC126085481, it includes sequence number 59; ( r) Upstream of LOC126086151, it includes sequence number 60; (s) Upstream of LOC126086152, it includes sequence number 61; (t) Upstream of LOC126086293, it includes sequence number 62; (u) Upstream of LOC126058227, it includes sequence number 63; (v) Upstream of LOC126058390, it includes sequence number 64; (w) Upstream of LOC126058396, it includes sequence number 65; (x) Upstream of FOXH1, it includes sequence number 66; (y) Upstream of LOC126060018, it includes sequence number 67; (z) Upstream of LOC126060570 Upstream of (aa)CCDC15, it includes sequence number 68; upstream of (bb)INO80B, it includes sequence number 70; upstream of (cc)LOC126062579, it includes sequence number 71; upstream of (dd)LOC126063153, it includes sequence number 72; upstream of (ee)LOC126063990, it includes sequence number 73; upstream of (ff)LOC126063991, it includes sequence number 74; upstream of (gg)LOC126066513, it includes sequence number 75; upstream of (hh)LOC126066877, it includes sequence number 76.(ii) Upstream of AWAT1, it includes sequence number 77; (jj) Upstream of TMEM187, it includes sequence number 78; and (kk) Upstream of LOC126069912, it includes sequence number 79.

[0012] In certain embodiments, the recombinant host cell is a stem cell. The stem cell can be selected from, for example, induced stem cells, embryonic stem (ES) cells, or mesenchymal stem cells (MSCs). In certain embodiments, the recombinant host cell is a reprogrammed cell. In certain embodiments, the recombinant host cell is a fibroblast or a mesenchymal cell. In certain embodiments, the recombinant host cell is selected from the group consisting of nerve cells, chondrocytes, osteocytes, muscle cells, adipocytes, and epidermal cells.

[0013] In a particular embodiment, recombinant host cells are It does not express at least one endogenous homolog of GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADGRD2, NINJ1, AHANAK2, CATSPERB, PCNXL4, SYNE2, NLRP12, LOC126086768, WDR90, BRCA2, PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35, KRT40, MYH4, PIRT, PKD1L2, RP1L1, CXorf58, LOC126068772, LOC126069872, THRAP3, CENPC1, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP, and TGM3. Recombinant host cells are GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADGRD2, NINJ1, AHNAK2, CATSPERB, PCNXL4, SYNE2, N LRP12, LOC126086768, WDR90, BRCA2, PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35, KRT40, MYH4, PIRT, PKD1L2, RP1L1, CXorf58, LOC Endogenous homologs of 126068772, LOC126069872, THRAP3, CENPC1, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP, and TGM3 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42 may not be expressed.

[0014] In certain embodiments, the recombinant host cell is an elephant cell. The elephant cell can be selected from, for example, Asian elephant cell (Elephas maximus), African elephant cell (Loxodonta africana), African forest elephant cell (Loxodonta cyclotis), and Bornean elephant cell (Elephas maximus borneensis).

[0015] Transgenic animals containing recombinant host cells as described herein are also provided. In certain embodiments, the transgenic animals are Asian elephants (Elephas maximus), African elephants (Loxodonta africana), African forest elephants (Loxodonta cyclotis), or Bornean elephants (Elephas maximus borneensis).

[0016] Transgenic animals containing at least one woolly mammoth (Mammuthus primigenius) gene variant are also provided. At least one woolly mammoth (Mammuthus primigenius) gene variant is, for example, GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADGRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 15), Selected from the group consisting of (SEQ ID NO. 21), PSAP (SEQ ID NO. 22), SEC31B (SEQ ID NO. 23), KRT28 (SEQ ID NO. 24), KRT35 (SEQ ID NO. 25), KRT40 (SEQ ID NO. 26), MYH4 (SEQ ID NO. 27), PIRT (SEQ ID NO. 28), PKD1L2 (SEQ ID NO. 29), RP1L1 (SEQ ID NO. 30), CXorf58 (SEQ ID NO. 31), LOC126068772 (SEQ ID NO. 32), LOC126069872 (SEQ ID NO. 33), THRAP3 (SEQ ID NO. 34), CENPC1 (SEQ ID NO. 35), DSPP (SEQ ID NO. 36), FGF5 (SEQ ID NO. 37), CATSPERG (SEQ ID NO. 38), MYH1 (SEQ ID NO. 39), MYH13 (SEQ ID NO. 40), ATRIP (SEQ ID NO. 41), and TGM3 (SEQ ID NO. 42).

[0017] In certain embodiments, the transgenic animals are further LOC126071805, WASHC4, LOC126075532, LOC126075533, AFP, LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, LOC126080369, LOC126080369, LOC126080733, DLX6, ECM2, LOC126085059, LOC126085481, LOC126086151, LOC12608615 2, LOC126086293, LOC126058227, LOC126058390, LOC126058396, FOXH1, LOC126060018, LOC126060570, CCDC15, INO80B, LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, AWAT1, TMEM187, and LOC126069912 include deletion of at least one nucleotide sequence upstream of the transcription start site. The deleted nucleotide sequence includes (a) SEQ ID NO: 43 upstream of LOC126071805, (b) SEQ ID NO: 44 upstream of WASHC4, (c) SEQ ID NO: 45 upstream of LOC126075532, (d) SEQ ID NO: 46 upstream of LOC126075533, (e) SEQ ID NO: 47 upstream of AFP, (f) SEQ ID NO: 48 upstream of LOC126079103, (g) SEQ ID NO: 49 upstream of LOC126079327, (h) SEQ ID NO: 50 upstream of LOC126079327, and (i) LOC Upstream of 126080333, it includes sequence number 51; (j) Upstream of LOC126080367, it includes sequence number 52; (k) Upstream of LOC126080369, it includes sequence number 53; (l) Upstream of LOC126080369, it includes sequence number 54; (m) Upstream of LOC126080733, it includes sequence number 55; (n) Upstream of DLX6, it includes sequence number 56; (o) Upstream of ECM2, it includes sequence number 57; (p) Upstream of LOC126085059, it includes sequence number 58; (q) Upstream of LOC126085481, it includes sequence number 59; ( r) Upstream of LOC126086151, it includes sequence number 60; (s) Upstream of LOC126086152, it includes sequence number 61; (t) Upstream of LOC126086293, it includes sequence number 62; (u) Upstream of LOC126058227, it includes sequence number 63; (v) Upstream of LOC126058390, it includes sequence number 64; (w) Upstream of LOC126058396, it includes sequence number 65; (x) Upstream of FOXH1, it includes sequence number 66; (y) Upstream of LOC126060018, it includes sequence number 67; (z) Upstream of LOC126060570 Upstream of (aa)CCDC15, it includes sequence number 68; upstream of (bb)INO80B, it includes sequence number 70; upstream of (cc)LOC126062579, it includes sequence number 71; upstream of (dd)LOC126063153, it includes sequence number 72; upstream of (ee)LOC126063990, it includes sequence number 73; upstream of (ff)LOC126063991, it includes sequence number 74; upstream of (gg)LOC126066513, it includes sequence number 75; upstream of (hh)LOC126066877, it includes sequence number 76.(ii) It contains SEQ ID NO: 77 upstream of AWAT1, (jj) it contains SEQ ID NO: 78 upstream of TMEM187, and (kk) it contains SEQ ID NO: 79 upstream of LOC126069912.,

[0018] In certain embodiments, the transgenic animal is an Asian elephant (Elephas maximus), an African elephant (Loxodonta africana), an African forest elephant (Loxodonta cyclotis), or a Borneo elephant (Elephas maximus borneensis).

Brief Description of the Drawings

[0019] The foregoing summary, as well as the following detailed description of the preferred embodiments of the present application, will be better understood when read in conjunction with the accompanying drawings. However, it should be understood that the present application is not limited to the exact embodiments shown in the drawings.

[0020] Figures 1A - 1D show the results of gene editing experiments regarding NCKAP5 and NINJ1 substitutions. Figure 1A is a graph showing the first enrichment of NCKAP5 and NINJ1 substitutions. Figure 1B is a chart showing the first enrichment of NCKAP5 and NINJ1 substitutions. Figure 1C is a graph showing the second enrichment of NCKAP5 and NINJ1 substitutions. Figure 1D is a chart showing the second enrichment of NCKAP5 and NINJ1 substitutions. The ICE score is the target knockout score, and KI is the knock-in efficiency of the correct mammoth variant.

[0021] [Detailed Description of the Invention] Throughout this specification and in the background art, various publications, articles, and patents are cited or referenced, each of which is incorporated herein by reference in its entirety. Discussions relating to documents, acts, materials, apparatus, articles, etc., contained herein are intended to illustrate the background of the invention. Such discussions do not constitute any part or all of the prior art relating to the disclosed or claimed invention.

[0022] For the purpose of clarifying, and not limiting, the detailed description of the present invention is divided into subsections that describe or illustrate specific features, embodiments, or uses of the invention.

[0023] definition Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which the invention pertains. Otherwise, certain terms used herein have the meanings set forth in the specification.

[0024] When used herein and in the appended claims, the singular forms “a,” “an,” and “the” should be noted to include multiple references unless the context clearly indicates otherwise.

[0025] Unless otherwise specified, numerical values ​​such as concentrations or concentration ranges described herein should be understood in all cases to be modified by the term “approximately.” Therefore, numerical values ​​typically include ±10% of the listed value. For example, a concentration of 1 mg / mL includes 0.9 mg / mL to 1.1 mg / mL. Similarly, a concentration range of 1% to 10% (w / v) includes 0.9% (w / v) to 11% (w / v). Where used herein, the use of numerical ranges explicitly includes all possible subranges, all individual numerical values ​​within that range (including integers and decimal values ​​within such ranges), unless the context clearly indicates otherwise.

[0026] Unless otherwise indicated, the term “at least” preceding a series of elements is understood to refer to all elements within the series. Those skilled in the art will be able to recognize or confirm many equivalents to the specific embodiments of the invention described herein using only ordinary experiments. Such equivalents are intended to be encompassed by the invention.

[0027] As used herein, the terms “comprises,” “comprising,” “includes,” “including,” “has,” “having,” “contains,” or “containing,” or other variations thereof, are understood to mean the inclusion of a given integer or group of integers, but not the exclusion of other integers or groups of integers, and are intended to be non-exclusive or open-ended. For example, a composition, mixture, process, method, article, or apparatus containing a list of elements is not necessarily limited to those elements alone and may include other elements not expressly enumerated or specific to such composition, mixture, process, method, article, or apparatus. Furthermore, unless expressly stated otherwise, “or” refers to an inclusive “or” and not an exclusive “or.” For example, condition A or B is satisfied by one of the following: A is true (or exists) and B is false (or does not exist), A is false (or does not exist) and B is true (or exists), and both A and B are true (or exist).

[0028] As used herein, the connecting term “and / or” between multiple enumerated elements is understood to encompass both individual and combined options. For example, when two elements are joined by “and / or,” the first option refers to the applicability of the first element without the second element. The second option refers to the applicability of the second element without the first element. The third option refers to the applicability when the first and second elements are applied together. Any one of these options is understood to be included in its meaning and therefore satisfy the requirements of the term “and / or” as used herein. The simultaneous applicability of two or more of the options is also understood to be included in its meaning and therefore satisfy the requirements of the term “and / or.”

[0029] As used herein, the terms "consists of," or variations such as "consist of" or "consisting of," when used throughout the specification and claims, indicate the inclusion of any enumerated integer or group of integers, but that no further integers or groups of integers may be added to the specified method, structure, or composition.

[0030] As used herein, the terms “consists essentially of,” or variations such as “consist essentially of” or “consisting essentially of,” when used throughout the specification and claims, indicate the inclusion of any enumerated integer or group of integers, and the inclusion of any selection of any enumerated integer or group of integers that does not substantially alter the basic or novel properties of the identified method, structure or composition. See MPEP §2111.03.

[0031] The terms "right," "left," "down," and "up" indicate direction in the referenced drawing.

[0032] Furthermore, the terms “about,” “approximately,” “generally,” “substantially,” and similar terms used herein when referring to the dimensions or characteristics of preferred components of an invention are intended to indicate to those skilled in the art that the described dimensions / characteristics are not strict boundaries or parameters and do not exclude slight variations from those that are functionally the same or similar. At the very least, such references involving numerical parameters include variations that do not change to the lowest digit when using mathematical and industrial principles accepted in the art (e.g., rounding, measurement or other systematic errors, manufacturing tolerances, etc.).

[0033] The terms “identical” or “percent “identical” refer to two or more nucleic acid or polypeptide sequences that, in the context of two or more nucleic acid or polypeptide sequences, are identical or have an identical percentage of amino acid residues or nucleotides when compared and aligned for maximum match, as measured using one of the following sequence comparison algorithms or by visual inspection.

[0034] In sequence comparison, typically one sequence acts as a reference sequence, against which the test sequence is compared. When using a sequence comparison algorithm, the test sequence and reference sequence are input into a computer, subsequence coordinates are specified as needed, and sequence algorithm program parameters are specified. The sequence comparison algorithm then calculates the degree of sequence identity of the test sequence to the reference sequence based on the specified program parameters.

[0035] Optimal sequence alignment for comparison can be achieved using, for example, Smith & Waterman's local homology algorithm (Adv. Appl. Math.2:482(1981)), Needleman & Wunsch's same-sex sequence alignment algorithm (J. Mol.Biol.48:443(1970)), Pearson & Lipman's similarity search method (Proc.Nat'l.Acad.Sci.USA 85:2444(1988)), computer implementations of these algorithms (Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI, GAP, BESTFIT, FASTA, and TFASTA), or visual inspection (for an overview, see Current Protocols in Molecular Biology, FMAusubel et al., eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc., (1995)). This can be done by (see Supplement) (Ausubel).

[0036] Examples of algorithms suitable for determining the ratio of sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1990) J. Mol. Biol. 215: 403-410 and Altschul et al. (1997) Nucleic Acids Res. 25: 3389-3402. Software for performing BLAST analysis is publicly available through the National Center for Biotechnology Information. This algorithm first identifies short words of length W in the query sequence and identifies high-scoring sequence pairs (HSPs) if they match or satisfy a positive threshold score T when aligned with words of the same length in the database sequence. T is called the neighbor word score threshold (Altschul et al., previously cited). These initial neighbor word hits act as seeds to initiate a search for longer HSPs that contain them. Next, the word hits are stretched in both directions along each sequence, as long as the cumulative sequence alignment score can increase.

[0037] The cumulative score is calculated for nucleotide sequences using parameters M (reward score for matching residue pairs; always > 0) and N (penalty score for mismatched residues; always < 0). For amino acid sequences, the cumulative score is calculated using a scoring matrix. Word hit extension in each direction is stopped if: the cumulative sequence alignment score falls by X from its maximum achieved value; the cumulative score becomes 0 or less due to the accumulation of one or more negative-scoring residue sequence alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of sequence alignment. The BLASTN program (for nucleotide sequences) uses, by default, word length (W) 11, predicted value (E) 10, M=5, N=-4, and comparison of both strands. For amino acid sequences, the BLASTP program uses a word length (W) of 3, an estimated value (E) of 10, and a BLOSUM62 scoring matrix by default (Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)).

[0038] In addition to calculating the degree of sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the minimum sum probability (P(N)), which provides an indicator of the probability that a match between two nucleotide or amino acid sequences occurs by chance. For example, if the minimum sum probability in a comparison of a test nucleic acid to a reference sequence is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001, the nucleic acid is considered similar to the reference sequence.

[0039] A further indicator that two nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross-reactive with the polypeptide encoded by the second nucleic acid, as described below. Therefore, for example, if the two peptides differ only by conservative substitutions, the polypeptide is typically substantially identical to the second polypeptide. Another indicator that two nucleic acid sequences are substantially identical is that the two molecules hybridize with each other under stringent conditions.

[0040] In this specification, the term “polynucleotide” is synonymous with “nucleic acid molecule,” “nucleotide,” or “nucleic acid,” and refers to any polyribonucleotide or polydeoxyribonucleotide that may be unmodified RNA or DNA, or modified RNA or DNA. “Polynucleotides” include, but are not limited to, single-stranded and double-stranded DNA, DNA which is a mixture of single-stranded and double-stranded regions, single-stranded and double-stranded RNA, RNA which is a mixture of single-stranded and double-stranded regions, and hybrid molecules containing DNA and RNA which may be single-stranded, or more typically double-stranded, or a mixture of single-stranded and double-stranded regions. Furthermore, “polynucleotide” refers to RNA or DNA, or a triple-stranded region containing both RNA and DNA. The term polynucleotide also includes DNA or RNA containing one or more modified bases, and DNA or RNA whose backbone has been modified for stability or other reasons. “Modified” bases include, for example, special bases such as tritylated bases and inosine. Because DNA and RNA can undergo various modifications, "polynucleotides" include not only chemically, enzymatically, or metabolically modified polynucleotides commonly found in nature, but also chemical forms of DNA and RNA characteristic of viruses and cells. "Polynucleotides" also include relatively short nucleic acid chains (often called oligonucleotides).

[0041] As used herein, the term “vector” refers to a replicon into which another nucleic acid segment can be operablely inserted to result in the replication or expression of that segment.

[0042] As used herein, the term “host cell” refers to a cell containing the nucleic acid molecules of this disclosure, such as an isolated vector containing the isolated nucleic acid of the present invention. “Host cell” may be any type of cell, such as a primary cell, a cell in a culture, or a cell derived from a cell line. In one embodiment, “host cell” is a cell transfected with the nucleic acid molecules of the present invention. In another embodiment, “host cell” is a descendant or potential descendant of such a transfected cell. The descendants of the cell may or may not be identical to the parent cell, for example, due to mutations or environmental influences that may occur in later generations, or due to the incorporation of the nucleic acid molecules into the host cell genome. The host cell may be, for example, any type of prokaryotic, eukaryotic, or archaeal cell. In some cases, the host cell may be a bacterial cell. In some cases, the host cell may be a mammalian cell.

[0043] As used herein, the term “expression” refers to the biosynthesis of a gene product. This term encompasses the transcription of a gene into RNA. This term also encompasses the translation of RNA into one or more polypeptides, and further encompasses all naturally occurring post-transcriptional and post-translational modifications.

[0044] As used herein, the terms “peptide,” “polypeptide,” or “protein” may refer to a molecule composed of amino acids that is recognized as a protein by those skilled in the art. Conventional one- or three-letter codes for amino acid residues are used herein. The terms “peptide,” “polypeptide,” and “protein” may be used interchangeably herein to refer to a polymer of amino acids of any length. The polymer may be linear or branched, may contain modified amino acids, and may be interrupted by non-amino acids. The term also encompasses naturally or artificially modified amino acid polymers, including any other operations or modifications such as disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or conjugation with a labeling component. The definition also includes polypeptides, for example, one or more analogs of amino acids (including non-natural amino acids), as well as other modifications known in the art.

[0045] The peptide sequences described herein follow the general convention of having the N-terminal region of the peptide on the left and the C-terminal region on the right. Although the isomer forms of amino acids are known, amino acids are represented in their L-form unless otherwise specified.

[0046] The terms “heteronucleotide” or “heteronucleotide” refer to a nucleic acid or polypeptide whose sequence is not identical to the sequence of another nucleic acid or polypeptide found naturally in the same host cell or host. As used herein, “heteronucleotide” or “heteronucleotide” may be heterogeneous to bacterial cells and / or mammalian hosts.

[0047] As used herein, the terms “transform” or “transform” refer to the introduction of a nucleic acid fragment into a host cell (e.g., a host bacterial cell) resulting in genetically stable inheritance. A host cell containing a transformed nucleic acid fragment is called a “recombinant,” “transgenic,” or “transformed” organism.

[0048] As used herein, the term “isolated” means that a biological component (e.g., nucleic acid, peptide, or protein) is substantially separated from, produced separately from, or purified from other biological components of an organism in which it is naturally present (i.e., other chromosomes and extrachromosomal DNA and RNA, as well as proteins). Thus, “isolated” nucleic acids, peptides, and proteins include nucleic acids and proteins purified by standard purification methods. “Isolated” nucleic acids, peptides, and proteins are still isolated if the composition is not part of the natural environment of the nucleic acid, peptide, or protein, even if it is part of a composition. The term also includes nucleic acids, peptides, and proteins prepared by recombinant expression in host cells, as well as chemically synthesized nucleic acids.

[0049] As used herein, “gene” means a nucleic acid containing an open reading frame that encodes a polypeptide, including both exon sequences and (if applicable) intron sequences.

[0050] As used herein, “promoter” is an example of a transcriptional regulatory sequence, specifically a nucleic acid sequence commonly described as the proximal region of a gene located 5' to the start codon. Transcription of adjacent nucleic acid segments is initiated at the promoter region. The transcription rate of a repressive promoter decreases in response to an inhibitor. The transcription rate of an inducible promoter increases in response to an inducer. The transcription rate of a constitutive promoter is not particularly regulated, but may change under the influence of general metabolic conditions.

[0051] The term "gene product," as used herein, refers to any product encoded by a nucleic acid sequence. Therefore, a gene product may be, for example, a primary transcript, a mature transcript, a processed transcript, or a protein or peptide encoded by a transcript. Examples of gene products include mRNA, rRNA, hairpin RNA (e.g., microRNA, shRNA, siRNA, tRNA), and peptides and proteins, such as reporter proteins or therapeutic proteins.

[0052] As used herein, the term “stem cell” means a cell that is capable of self-renewal and can differentiate into at least one more differentiated phenotype or a less developmentally potent phenotype. The term “stem cell” encompasses stem cell lines, induced stem cells, non-human embryonic stem cells, pluripotent stem cells, multipotent stem cells, amniotic stem cells, placental stem cells, or adult stem cells. “Induced stem cells” are derived from non-pluripotent cells that have been induced into a less differentiated phenotype or a more developmentally potent phenotype by the introduction of one or more reprogramming factors or genes. As used herein, induced stem cells do not need to be pluripotent, but have the ability to differentiate into one or more more highly differentiated phenotypes under appropriate conditions. It should be understood that this ability was not present before the introduction of the reprogramming factor. Induced stem cells express at least one stem cell marker that was not expressed by the parental cell before the introduction of the reprogramming factor. In this context, the stem cell marker excludes factors introduced by reprogramming. Induced pluripotent stem cells, or iPS cells, have the ability to differentiate into cellular phenotypes derived from each of the germ layers: endoderm, mesoderm, and ectoderm, under appropriate conditions.

[0053] As used herein, the term “marker” is used to describe the characteristics and / or phenotype of a cell. Markers can be used to select cells containing desired characteristics and are varied by specific cells. A marker is a morphological, structural, functional, or biochemical (enzymatic) feature unique to a particular cell type, or a molecule expressed by that cell type. In one embodiment, such a marker is a protein. Such a protein may possess an epitope to antibodies or other binding molecules available in the art. However, a marker can consist of any molecule found inside or on a cell, including but not limited to proteins (peptides and polypeptides), lipids, polysaccharides, nucleic acids, and steroids. Examples of morphological features or traits include, but are not limited to, shape, size, and nucleus-to-cytoplasmic ratio. Examples of functional features or traits include, but are not limited to, the ability to adhere to a particular substrate, the ability to take up or reject a particular dye, the ability to migrate under specific conditions, and the ability to differentiate along a particular lineage. Markers can be detected by any method available to those skilled in the art. Markers may also be a lack of morphological features, or a lack of proteins, lipids, etc. The marker may be a combination of a set of unique features relating to the presence and / or absence of polypeptides, as well as other morphological or structural characteristics. In one embodiment, the marker is a cell surface marker.

[0054] The term "exogenous" refers to a substance present in cells that has been introduced by artificial means. As used herein, "exogenous" may refer to nucleic acids (e.g., nucleic acids encoding polypeptides) or polypeptides introduced by artificial means into a biological system, such as a cell or organism, where they are not normally found. Alternatively, "exogenous" may refer to nucleic acids or polypeptides introduced by artificial means into a biological system, such as a cell or organism, where they are normally found in relatively low amounts, and where it is desirable to increase the amount of nucleic acids or polypeptides in the cell or organism, for example, to produce ectopic expression or levels.

[0055] In this specification, the terms “reprogramming gene” or “reprogramming factor” refer to drugs or nucleic acid molecules that induce a reprogramming process in somatic cells, thereby re-expressing a less differentiated, more stem cell-like phenotype. Reprogramming factors may be nucleic acids, polypeptides, or small molecules that, when introduced into cells, promote the reprogrammed phenotype. Non-exclusive examples of reprogramming factors include Oct4 (octamer-binding transcription factor 4), SOX2 (sex-determining region Y) box 2, Klf4 (Kruppel-like factor 4), and c-Myc. These are the so-called “classical” or “standard” set of reprogramming factors, used, for example, to induce induced pluripotent stem cells. Additional factors that may be introduced as reprogramming factors in the process of reprogramming cells into a poorly differentiated or stem cell phenotype include, but are not limited to, small molecule chemicals such as LIN28 + Nanog, Esrrb, Pax5 shRNA, C / EBPa, p53 siRNA, UTF1, DNMT shRNA, Wnt3a, SV40 LT(T), hTERT, BIX-01294, BayK8644, RG108, AZA, dexamethasone, VPA, TSA, SAHA, PD0325901 + CHIR99021(2i), and A-83-01. In some embodiments, the reprogramming genes or factors are Oct4, Klf4, SOX2, and c-Myc.

[0056] As used herein, the terms “dedifferentiation,” “reverse differentiation,” or “reprogramming” refer to the process of generating cells that re-express a less differentiated phenotype than the cells from which they originate, and / or express at least one stem cell marker that was not expressed prior to the process. For example, terminally differentiated cells can be dedifferentiated into pluripotent cells. That is, dedifferentiation shifts cells backward along the differentiation spectrum from totipotent to fully differentiated cells. Typically, reversing the differentiation phenotype of a cell requires artificial manipulation of the cell, for example, by introducing or expressing exogenous polypeptide factors. Reprogramming is typically not observed under in vivo or in vitro natural conditions.

[0057] As used herein, “reprogrammed cells” are cells that have been exposed to one or more reprogramming factors and express a less differentiated phenotype than the cells from which they originated. Reprogrammed cells also possess the ability to self-replicate and express at least one stem cell marker that was not delivered to the cells as a reprogramming factor. Furthermore, reprogrammed cells have the ability to differentiate into more differentiated somatic cell types according to differentiation protocols described herein or known in the art.

[0058] As used herein, the term “somatic cell” means any cell other than germ cells, cells present in or obtained from a preimplantation embryo, or cells resulting from the in vitro proliferation of such cells. In other words, somatic cells refer to all cells that make up the body of an organism, excluding germ cells. Except for sperm and eggs, and the cells that form them (germ cells), all cell types in the mammalian body are somatic cells. Internal organs, skin, bone, blood, and connective tissue are all substantially composed of somatic cells. In some embodiments, somatic cells are “non-embryonic somatic cells,” meaning somatic cells that are not present in or obtained from an embryo, and do not result from the in vitro proliferation of such cells. In some embodiments, somatic cells are “adult somatic cells,” meaning cells present in or obtained from an organism other than an embryo or fetus, or cells resulting from the in vitro proliferation of such cells. [Nucleic acids, vectors, recombinant cells, and transgenic animals expressing woolly mammoth-specific mutants]

[0059] The woolly mammoth (Mammuthus primigenius) was a cold-hardy animal belonging to the elephant family that inhabited the vast mammoth steppes of the Northern Hemisphere during the last glacial period, but became extinct in most of its habitat about 10,000 years ago. The woolly mammoth is perhaps the most well-characterized prehistoric animal, thanks to prehistoric artwork and frozen specimens discovered in Siberia and Alaska. These well-preserved specimens offer a rare opportunity to functionally characterize the adaptive evolution of extinct animals. A series of adaptive evolutions are necessary to survive in extreme environments such as the cold regions of the Northern Hemisphere. Genetic and morphological analyses of woolly mammoth specimens have revealed several physiological adaptations to cold, including dense, long fur, increased adipose tissue, reduced ears and tail, and structural polymorphisms in hemoglobin. Studies of other cold-hardy mammals have identified numerous convergent adaptations via the same genes and pathways, as well as unique adaptations to common environmental stressors.

[0060] The isolated nucleic acids, vectors, recombinant cells, and transgenic animals described herein are based in part on the discovery that cells (e.g., Elephas maximus and Loxodonta africana cells) can be modified to contain and express alleles or homologs derived from woolly mammoths (e.g., Mammuthus primigenius). In particular, living cells can be gene-edited to mimic mammoth variants or alleles of elephant genes by transfection, transduction, or modification of existing elephant homologs. In some embodiments, the endogenous homolog of the mammoth gene is deleted or inactivated. Similar modifications for introducing woolly mammoth genes can be performed on living cells of other non-human relatives of elephants. Mammoth variants or alleles can modify the phenotype of gene-edited cells. The isolated nucleic acids, vectors, recombinant cells, and transgenic animals described herein provide synthetic substitutes for wildlife products, as well as novel tools for understanding genetic diversity and cell biology in endangered and extinct wildlife species.

[0061] In one embodiment, described herein is at least one exogenous nucleic acid sequence that encodes a woolly mammoth gene or includes modifications of an endogenous gene for expressing a woolly mammoth homolog or variant of an endogenous gene. Of particular interest are genes shared by all sequenced woolly mammoth genomes and not shared by any sequenced elephant genome (Asian or African). By selecting genes in this manner, the effects of individual variations within the group of sequenced woolly mammoth genomes, as well as variations in Asian and / or African elephant genomes, are minimized in order to focus on variant sequences that are entirely mammoth. With this in mind, as used herein, “woolly mammoth gene,” “woolly mammoth gene variant,” or “woolly mammoth homolog” is a gene that has a sequence encoded by all sequenced woolly mammoth genomes and encodes a polypeptide different from the homologous polypeptide encoded in all sequenced African and Asian elephant genomes. In this context, “different” means different by at least one amino acid compared to the homologous polypeptide encoded by African or Asian elephant. A non-coding sequence or regulatory nucleic acid sequence can be considered a “woolly mammoth sequence” if it contains at least 20 nucleotides of non-coding motifs that are present in all sequenced woolly mammoth genomes but not in any sequenced Asian elephant or African elephant genome. An Asian elephant or African elephant gene or sequence modified by human intervention to encode a woolly mammoth gene or gene variant sequence is a “woolly mammoth gene” or “gene variant” as used herein. Where only the fact that a woolly mammoth gene or gene variant is found to be encoded in a woolly mammoth genome, and where the woolly mammoth is extinct, the woolly mammoth gene or gene variant sequence is necessarily exogenous to viable cells.In other words, the woolly mammoth gene or gene variant sequence is "exogenous," whether the sequence is present in the cell through the introduction of an exogenous sequence or through gene editing of an endogenous sequence to encode the woolly mammoth gene or gene variant sequence.

[0062] Therefore, isolated nucleic acid sequences containing woolly mammoth (Mammuthus primigenius) gene variants are provided herein. The isolated nucleic acid sequences include, for example, G protein-coupled receptor 98 (GPR98) (SEQ ID NO: 1), microtubule actin crosslinking factor 1 (MACF1) (SEQ ID NO: 2), adenosine deaminase RNA-specific B2 (ADARB2) (SEQ ID NO: 3), centrosome protein 290 (CEP290) (SEQ ID NO: 4), keratin 4 (KRT4) (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCK-related protein 5 (NCKAP5) (SEQ ID NO: 7), laminin subunit β4 (LAMB4) (SEQ ID NO: 8), and Niemann-Pitt C1-like 1 (NPC1L1) (SEQ ID NO: 9), Adhesion G protein-coupled receptor D2 (ADGRD2) (SEQ ID NO: 10), Ninjurin 1 (NINJ1) (SEQ ID NO: 11), AHNAK nucleoprotein 2 (AHNAK2) (SEQ ID NO: 12), Cation channel sperm-associated auxiliary subunit β (CATSPERB) (SEQ ID NO: 13), Pecanex-like 4 (PCNXL4) (SEQ ID NO: 14), Spectrin repeat-containing nuclear envelope protein 2 (SYNE2) (SEQ ID NO: 15), NLR family pyrine domain-containing 12 (N LRP12) (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WD Repeat Region 90 (WDR90) (SEQ ID NO: 18), Breast Cancer 2 (BRCA2) (SEQ ID NO: 19), Protein Kinase, DNA Activation Catalytic Subunit (PRKDC) (SEQ ID NO: 20), Vacuolar Protein Sorting 13 Homolog B (VPS13B) (SEQ ID NO: 21), Prosaposin (PSAP) (SEQ ID NO: 22), SEC31 Homolog B (SEC31B) (SEQ ID NO: 23), Keratin 28 (KRT28) (SEQ ID NO: 24), Keratin 3 5 (KRT35) (SEQ ID NO: 25), Keratin 40 (KRT40) (SEQ ID NO: 26), Myosin Heavy Chain 4 (MYH4) (SEQ ID NO: 27), TRP Phosphoinositide Interaction Regulator (PIRT) (SEQ ID NO: 28), Polycystin 1-like 2 (PKD1L2) (SEQ ID NO: 29), Retinitis Pigmentosa 1-like Protein (RP1L1) (SEQ ID NO: 30), X chromosome open reading frame 58 (CXorf58) (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33),It may contain nucleotide sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with at least one of the following: thyroid hormone receptor-related protein 3 (THRAP3) (SEQ ID NO: 34), centromere protein C1 (CENPC1) (SEQ ID NO: 35), dentinogenesis and dentin sialophosphoprotein (DSPP) (SEQ ID NO: 36), fibroblast growth factor 5 (FGF5) (SEQ ID NO: 37), cation channel sperm-associated accessory subunit γ (CATSPERG) (SEQ ID NO: 38), myosin heavy chain 1 (MYH1) (SEQ ID NO: 39), myosin heavy chain 13 (MYH13) (SEQ ID NO: 40), ATR interacting protein (ATRIP) (SEQ ID NO: 41), and transglutaminase 3 (TGM3) (SEQ ID NO: 42).

[0063] In certain embodiments, the nucleotide sequences are GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADGRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 2) 1) Includes at least one of PSAP (sequence number 22), SEC31B (sequence number 23), KRT28 (sequence number 24), KRT35 (sequence number 25), KRT40 (sequence number 26), MYH4 (sequence number 27), PIRT (sequence number 28), PKD1L2 (sequence number 29), RP1L1 (sequence number 30), CXorf58 (sequence number 31), LOC126068772 (sequence number 32), LOC126069872 (sequence number 33), THRAP3 (sequence number 34), CENPC1 (sequence number 35), DSPP (sequence number 36), FGF5 (sequence number 37), CATSPERG (sequence number 38), MYH1 (sequence number 39), MYH13 (sequence number 40), ATRIP (sequence number 41), and TGM3 (sequence number 42).

[0064] In certain embodiments, the mammoth (Mammuthus primigenius) gene variant contains a nucleotide sequence having at least 80%, at least 85%, at least 90%, or at least 95% identity with a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-42 and combinations thereof. For example, the mammoth gene variant may include a nucleotide sequence having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-42 and combinations thereof.

[0065] In certain embodiments, the mammoth (Mammuthus primigenius) gene variant contains at least one change in the gene's nucleotide sequence. The change in the nucleotide sequence may be, for example, a substitution, insertion, deletion, or a combination thereof. The substitution, insertion, deletion, or combination thereof may be located, for example, in the gene's 5' untranslated region, intron, exon, 3' untranslated region, or a combination thereof. The substitution, insertion, deletion, or combination thereof may also be located, for example, in the gene's regulatory region.

[0066] Also provided are isolated vectors containing the isolated nucleic acid sequences described herein.

[0067] Furthermore, the present invention relates to GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADGRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), and VPS13B. (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO: 39), MYH13 (SEQ ID NO: 40), ATRIP (SEQ ID NO: 41), and The present invention provides recombinant host cells or transgenic animals containing nucleotide sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with respect to at least one TGM3 (SEQ ID NO: 42).In some embodiments, the recombinant host cell or transgenic animal is GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADGRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13B ( It includes at least one nucleotide sequence of SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO: 39), MYH13 (SEQ ID NO: 40), ATRIP (SEQ ID NO: 41), and TGM3 (SEQ ID NO: 42). In some embodiments, the recombinant host cell comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42 of the isolated nucleic acids described herein.

[0068] Also provided are recombinant host cells or transgenic animals comprising at least one of the isolated nucleic acid sequences described herein. In certain embodiments, the recombinant host cells or transgenic animals comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42 of the isolated nucleic acids described herein.

[0069] Furthermore, in this specification, LOC126071805, WASH complex subunit 4 (WASHC4), LOC126075532, LOC126075533, α-fetoprotein (AFP), LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, LOC12608 0369, LOC126080369, LOC126080733, distal-less homeobox 6 (DLX6), extracellular matrix protein 2 (ECM2), LOC126085059, LOC126085481, LOC126086151, LOC126086152, LOC126086293, LOC126058227, LOC1260 Recombinant host cells or transgenic animals are also provided that include deletions of at least one nucleotide sequence located upstream of the transcription start site of LOC126069912, LOC126060018, LOC126060570, Coiled Coil Domain-containing 15 (CCDC15), INO80 complex subunit B (INO80B), LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, Acyl-CoA wax alcohol acyltransferase 1 (AWAT1), transmembrane protein 187 (TMEM187), and LOC126069912. The deleted nucleotide sequence includes (a) SEQ ID NO: 43 upstream of LOC126071805, (b) SEQ ID NO: 44 upstream of WASHC4, (c) SEQ ID NO: 45 upstream of LOC126075532, (d) SEQ ID NO: 46 upstream of LOC126075533, (e) SEQ ID NO: 47 upstream of AFP, (f) SEQ ID NO: 48 upstream of LOC126079103, (g) SEQ ID NO: 49 upstream of LOC126079327, (h) SEQ ID NO: 50 upstream of LOC126079327, and (i) LOC Upstream of 126080333, it includes sequence number 51; (j) Upstream of LOC126080367, it includes sequence number 52; (k) Upstream of LOC126080369, it includes sequence number 53; (l) Upstream of LOC126080369, it includes sequence number 54; (m) Upstream of LOC126080733, it includes sequence number 55; (n) Upstream of DLX6, it includes sequence number 56; (o) Upstream of ECM2, it includes sequence number 57; (p) Upstream of LOC126085059, it includes sequence number 58; (q) Upstream of LOC126085481, it includes sequence number 59; ( r) Upstream of LOC126086151, it includes sequence number 60; (s) Upstream of LOC126086152, it includes sequence number 61; (t) Upstream of LOC126086293, it includes sequence number 62; (u) Upstream of LOC126058227, it includes sequence number 63; (v) Upstream of LOC126058390, it includes sequence number 64; (w) Upstream of LOC126058396, it includes sequence number 65; (x) Upstream of FOXH1, it includes sequence number 66; (y) Upstream of LOC126060018, it includes sequence number 67; (z) Upstream of LOC126060570 Upstream of (aa)CCDC15, it includes sequence number 68; upstream of (bb)INO80B, it includes sequence number 70; upstream of (cc)LOC126062579, it includes sequence number 71; upstream of (dd)LOC126063153, it includes sequence number 72; upstream of (ee)LOC126063990, it includes sequence number 73; upstream of (ff)LOC126063991, it includes sequence number 74; upstream of (gg)LOC126066513, it includes sequence number 75; upstream of (hh)LOC126066877, it includes sequence number 76.(ii) Upstream of AWAT1, it includes sequence number 77; (jj) Upstream of TMEM187, it includes sequence number 78; and (kk) Upstream of LOC126069912, it includes sequence number 79.

[0070] In some embodiments, recombinant host cells or transgenic animals containing the isolated nucleic acids described herein are further LOC126071805, WASHC4, LOC126075532, LOC126075533, AFP, LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, LOC126080369, LOC126080369, LOC126080733, DLX6, ECM2, LOC126085059, LOC126085481, LOC1260861 The further includes deletions of at least one nucleotide sequence located upstream of the transcription start sites of 51, LOC126086152, LOC126086293, LOC126058227, LOC126058390, LOC126058396, FOXH1, LOC126060018, LOC126060570, CCDC15, INO80B, LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, AWAT1, TMEM187, and LOC126069912. The deleted nucleotide sequence includes (a) SEQ ID NO: 43 upstream of LOC126071805, (b) SEQ ID NO: 44 upstream of WASHC4, (c) SEQ ID NO: 45 upstream of LOC126075532, (d) SEQ ID NO: 46 upstream of LOC126075533, (e) SEQ ID NO: 47 upstream of AFP, (f) SEQ ID NO: 48 upstream of LOC126079103, (g) SEQ ID NO: 49 upstream of LOC126079327, (h) SEQ ID NO: 50 upstream of LOC126079327, and (i) LOC Upstream of 126080333, it includes sequence number 51; (j) Upstream of LOC126080367, it includes sequence number 52; (k) Upstream of LOC126080369, it includes sequence number 53; (l) Upstream of LOC126080369, it includes sequence number 54; (m) Upstream of LOC126080733, it includes sequence number 55; (n) Upstream of DLX6, it includes sequence number 56; (o) Upstream of ECM2, it includes sequence number 57; (p) Upstream of LOC126085059, it includes sequence number 58; (q) Upstream of LOC126085481, it includes sequence number 59; ( r) Upstream of LOC126086151, it includes sequence number 60; (s) Upstream of LOC126086152, it includes sequence number 61; (t) Upstream of LOC126086293, it includes sequence number 62; (u) Upstream of LOC126058227, it includes sequence number 63; (v) Upstream of LOC126058390, it includes sequence number 64; (w) Upstream of LOC126058396, it includes sequence number 65; (x) Upstream of FOXH1, it includes sequence number 66; (y) Upstream of LOC126060018, it includes sequence number 67; (z) Upstream of LOC126060570 Upstream of (aa)CCDC15, it includes sequence number 68; upstream of (bb)INO80B, it includes sequence number 70; upstream of (cc)LOC126062579, it includes sequence number 71; upstream of (dd)LOC126063153, it includes sequence number 72; upstream of (ee)LOC126063990, it includes sequence number 73; upstream of (ff)LOC126063991, it includes sequence number 74; upstream of (gg)LOC126066513, it includes sequence number 75; upstream of (hh)LOC126066877, it includes sequence number 76.(ii) Upstream of AWAT1, it includes sequence number 77; (jj) Upstream of TMEM187, it includes sequence number 78; and (kk) Upstream of LOC126069912, it includes sequence number 79.

[0071] In certain embodiments, the recombinant host cell or transgenic animal further comprises at least one woolly mammoth gene variant described in Table 1 of International Publication No. 2022 / 125940, which is incorporated herein by reference in its entirety. The woolly mammoth gene variants described in International Publication No. 2022 / 125940 are involved in a variety of biological processes, including but not limited to regulating cold sensitivity, regulating heat sensitivity, regulating intracellular pH, regulating axon formation and development, tRNA, metabolic processes, cell adhesion, tissue development and formation, microtubule-based migration of cells, negative regulation of biological processes, gene expression, and cellular macromolecular metabolic processes.

[0072] The mammoth gene variants described herein can be used in any combination for expression in any recombinant host cell or transgenic animal described herein. In some embodiments, at least one isolated nucleic acid contained in the recombinant host cell or transgenic animal encodes GPR98 (SEQ ID NO: 1). In some embodiments, two isolated nucleic acids contained in the recombinant host cell or transgenic animal encode GPR98 (SEQ ID NO: 1) and MACF1 (SEQ ID NO: 2). In some embodiments, three isolated nucleic acids contained in the recombinant host cell or transgenic animal encode GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), and ADARB2 (SEQ ID NO: 3). In some embodiments, four isolated nucleic acids contained in the recombinant host cell or transgenic animal encode GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), and CEP290 (SEQ ID NO: 4). In some embodiments, isolated nucleic acids of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42 of the woolly mammoth gene variants described herein are included in recombinant host cells to encode 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42 of the woolly mammoth gene variants described herein. In some embodiments, the recombinant host cells or transgenic animals described herein are further LOC126071805, WASHC4, LOC126075532, LOC126075533, AFP, LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, LOC126080369, LOC126080369, LOC126080733, DLX6, ECM2, LOC126085059, LOC126085481, LOC126086151, LOC The following further include deletions of at least one nucleotide sequence located upstream of the transcription start sites of C126086152, LOC126086293, LOC126058227, LOC126058390, LOC126058396, FOXH1, LOC126060018, LOC126060570, CCDC15, INO80B, LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, AWAT1, TMEM187, and LOC126069912.

[0073] In certain embodiments, the recombinant host cells are Asian elephant (Elephas maximus) cells, African elephant (Loxodonta africana) cells, African forest elephant (Loxodonta cyclotis) cells, or Bornean elephant (Elephas maximus borneensis) cells.

[0074] In certain embodiments, the transgenic animal is the Asian elephant (Elephas maximus), the African elephant (Loxodonta africana), the African forest elephant (Loxodonta cyclotis), or the Bornean elephant (Elephas maximus borneensis). [cell]

[0075] The woolly mammoth gene variants described herein can be expressed in any viable cells capable of receiving exogenous genetic material. The cells may be, for example, prokaryotic or eukaryotic cells. In some embodiments, the cells are eukaryotic cells. The cells may be reprogrammed cells, non-human oocytes, non-human embryonic cells, or non-human blastula cells. In some embodiments of any given model, the cells are fibroblasts. In some embodiments, the cells are selected from the group consisting of nerve cells, chondrocytes, osteocytes, muscle cells, osteocytes, adipocytes, and epidermal cells. In some embodiments, the cells are pre-differentiated into cells selected from the group consisting of nerve cells, chondrocytes, osteocytes, muscle cells, osteocytes, adipocytes, and epidermal cells.

[0076] The scientific literature provides guidance to those with the usual skills for isolating and preparing cells as necessary for use with the isolated nucleic acids and vectors described herein.

[0077] The cells described herein may be of any viable non-human source or biological origin. Typically, the biological origin is an animal or vertebrate such as wild animals, zoo animals, endangered animals, rodents, domestic animals, or birds. Examples of animals include, but are not limited to, elephants, hippos, hyraxes, manatees, bears, pandas, felines (e.g., tigers, lions, cheetahs, bobcats), canids (e.g., foxes, wolves), birds (e.g., ostriches, emus, penguins, pigeons), and fish (e.g., trout, catfish, salmon). In some embodiments, the cells described herein are of mammalian origin. Non-exclusive examples of organisms from which cells can be derived include elephants (e.g., Loxodonta africana, Elephas maximus, Loxodonta cyclotis, Elephas maximus borneensis); hyraxes (e.g., Dendrohyrax arboreus, Dendrohyrax dorsalis, Heterohyrax brucei, Procavia capensis); aardvarks (e.g., Oryceteropus afer); shrews (e.g., Suncus etruscus, Blarina brevicauda, ​​Neomys fodiens); and manatees (Trichechus inunguis, Trichechus manatus, Trichechus manatus latirostris, Trichechus manatus manatus, Trichechus senegalensis).

[0078] In certain embodiments, the cells useful in the methods and compositions described herein are elephant cells. In some embodiments, the cells are elephant fibroblasts. In some embodiments, the cells are elephant stem cells. In some embodiments, the cells described herein are elephant somatic cells that have been reprogrammed to have a stem cell-like morphology and / or express at least one stem cell marker described herein, or to have a stem cell-like phenotype.

[0079] The cells described herein may be derived from any tissue isolated from an organism by methods known in the art. For example, placental tissue may be isolated from a particular organism (e.g., an elephant) after birth and then processed for cell isolation and / or culture by methods known in the art. Additional exemplary cell types that may be used for the compositions and methods described herein include, but are not limited to, fibroblasts, skin cells, blood cells (e.g., leukocytes, monocytes, dendritic cells), stem cells, hematopoietic cells, hepatocytes, vascular cells, muscle cells, pancreatic cells, nerve cells, ocular or retinal cells, epithelial or endothelial cells, lung cells, cardiac cells, intestinal cells, diaphragmatic cells, renal (i.e., kidney) cells, bone marrow cells, or any one or more selected tissues or cells of an organism in which genetic modification or gene editing for expressing woolly mammoth genes is envisioned.

[0080] In certain embodiments, the isolated nucleic acids and vectors described herein are used in stem cells. Stem cells are cells that retain the ability to regenerate themselves through mitotic cell division and can differentiate into more specialized cell types. Three broad types of mammalian stem cells include embryonic stem (ES) cells found in blastocysts, induced pluripotent stem cells (iPSCs) reprogrammed from somatic cells, and adult stem cells found in adult tissues. Other sources of stem cells include, for example, amniotic or placental stem cells. Pluripotent stem cells can differentiate into cells derived from any of the three germ layers.

[0081] In certain embodiments, the recombinant host cell is a stem cell. The stem cell may be selected from, for example, induced stem cells, embryonic stem (ES) cells, or mesenchymal stem cells (MSCs). In certain embodiments, the recombinant host cell is a reprogrammed cell. In certain embodiments, the recombinant host cell is a fibroblast or a mesenchymal cell. In certain embodiments, the recombinant host cell is selected from the group consisting of nerve cells, chondrocytes, osteocytes, muscle cells, adipocytes, and epidermal cells.

[0082] In certain embodiments, the recombinant host cells include GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADGRD2, NINJ1, AHNAK2, CATSPERB, PCNXL4, SYNE2, NLRP12, LOC126086768, WDR90, BRCA2, PRKDC, VP It does not express at least one endogenous homolog of S13B, PSAP, SEC31B, KRT28, KRT35, KRT40, MYH4, PIRT, PKD1L2, RP1L1, CXorf58, LOC126068772, LOC126069872, THRAP3, CENPC1, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP, and TGM3. The recombinant host cells mentioned above include, for example, GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADGRD2, NINJ1, AHNAK2, CATSPERB, PCNXL4, SYNE2, NLRP12, LOC126086768, WDR90, BRCA2, PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35, KRT40, MYH4, PIRT, PKD1L2, RP1L1, and CXorf58. LOC126068772, LOC126069872, THRAP3, CENPC1, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP, and TGM3 may not express at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42 endogenous homologs.

[0083] In certain embodiments, the recombinant host cell is an elephant cell. The elephant cell can be selected from, for example, Asian elephant cell (Elephas maximus), African elephant cell (Loxodonta africana), African forest elephant cell (Loxodonta cyclotis), and Bornean elephant cell (Elephas maximus borneensis).

[0084] Transgenic animals containing recombinant host cells as described herein are also provided. In certain embodiments, the transgenic animals are Asian elephants (Elephas maximus), African elephants (Loxodonta africana), African forest elephants (Loxodonta cyclotis), and Bornean elephants (Elephas maximus borneensis). [Transgenic animals]

[0085] Furthermore, the present invention provides a transgenic animal comprising at least one woolly mammoth (Mammuthus primigenius) gene variant (gene mutant). The aforementioned at least one woolly mammoth (Mammuthus primigenius) gene variant (gene mutant) is, for example, GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADGRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13 The following can be selected from the group consisting of B (sequence number 21), PSAP (sequence number 22), SEC31B (sequence number 23), KRT28 (sequence number 24), KRT35 (sequence number 25), KRT40 (sequence number 26), MYH4 (sequence number 27), PIRT (sequence number 28), PKD1L2 (sequence number 29), RP1L1 (sequence number 30), CXorf58 (sequence number 31), LOC126068772 (sequence number 32), LOC126069872 (sequence number 33), THRAP3 (sequence number 34), CENPC1 (sequence number 35), DSPP (sequence number 36), FGF5 (sequence number 37), CATSPERG (sequence number 38), MYH1 (sequence number 39), MYH13 (sequence number 40), ATRIP (sequence number 41), and TGM3 (sequence number 42).

[0086] In certain embodiments, the transgenic animal includes a mammoth gene variant of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42.

[0087] In certain embodiments, the transgenic animal (genetically modified animal) is GPR98 (sequence listing number: 1), MACF1 (sequence number 2), ADARB2 (sequence number 3), CEP290 (sequence number 4), KRT4 (sequence number 5), LOC126076011 (sequence number 6), NCKAP5 (sequence number 7), LAMB4 (sequence number 8), NPC1L1 (sequence number 9), ADGRD2 (sequence number 10), NINJ1 (sequence number 11), AHN AK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (Distribution) Column number 25), KRT40 (sequence number 26), MYH4 (sequence number 27), PIRT (sequence number 28), PKD1L2 (sequence number 29), RP1L1 (sequence number 30), CXorf58 (sequence number 31), LOC126068772 (sequence number 32), LOC126069872 (sequence number 33), THRAP3 (sequence number 34), CENPC1 (sequence number 35), DSPP (sequence number 36), FGF5 (sequence number 37), CATSPERG (distribution They do not express at least one endogenous homolog of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42 of MYH1 (sequence number 38), MYH1 (sequence number 39), MYH13 (sequence number 40), ATRIP (sequence number 41), and TGM3 (sequence number 42).

[0088] In certain embodiments, the transgenic animals (genetically modified animals) may also include LOC126071805, WASHC4, LOC126075532, LOC126075533, AFP, LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, LOC126080369, LOC126080369, LOC126080733, DLX6, ECM2, LOC126085059, LOC126085481, LOC126086151, LOC12 The further includes deletions of at least one nucleotide sequence located upstream of the transcription start sites of 6086152, LOC126086293, LOC126058227, LOC126058390, LOC126058396, FOXH1, LOC126060018, LOC126060570, CCDC15, INO80B, LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, AWAT1, TMEM187, and LOC126069912. The deleted nucleotide sequence includes (a) SEQ ID NO: 43 upstream of LOC126071805, (b) SEQ ID NO: 44 upstream of WASHC4, (c) SEQ ID NO: 45 upstream of LOC126075532, (d) SEQ ID NO: 46 upstream of LOC126075533, (e) SEQ ID NO: 47 upstream of AFP, (f) SEQ ID NO: 48 upstream of LOC126079103, (g) SEQ ID NO: 49 upstream of LOC126079327, (h) SEQ ID NO: 50 upstream of LOC126079327, and (i) LOC Upstream of 126080333, it includes sequence number 51; (j) Upstream of LOC126080367, it includes sequence number 52; (k) Upstream of LOC126080369, it includes sequence number 53; (l) Upstream of LOC126080369, it includes sequence number 54; (m) Upstream of LOC126080733, it includes sequence number 55; (n) Upstream of DLX6, it includes sequence number 56; (o) Upstream of ECM2, it includes sequence number 57; (p) Upstream of LOC126085059, it includes sequence number 58; (q) Upstream of LOC126085481, it includes sequence number 59; ( r) Upstream of LOC126086151, it includes sequence number 60; (s) Upstream of LOC126086152, it includes sequence number 61; (t) Upstream of LOC126086293, it includes sequence number 62; (u) Upstream of LOC126058227, it includes sequence number 63; (v) Upstream of LOC126058390, it includes sequence number 64; (w) Upstream of LOC126058396, it includes sequence number 65; (x) Upstream of FOXH1, it includes sequence number 66; (y) Upstream of LOC126060018, it includes sequence number 67; (z) Upstream of LOC126060570 Upstream of (aa)CCDC15, it includes sequence number 68; upstream of (bb)INO80B, it includes sequence number 70; upstream of (cc)LOC126062579, it includes sequence number 71; upstream of (dd)LOC126063153, it includes sequence number 72; upstream of (ee)LOC126063990, it includes sequence number 73; upstream of (ff)LOC126063991, it includes sequence number 74; upstream of (gg)LOC126066513, it includes sequence number 75; upstream of (hh)LOC126066877, it includes sequence number 76.(ii) Upstream of AWAT1, it includes sequence number 77; (jj) Upstream of TMEM187, it includes sequence number 78; and (kk) Upstream of LOC126069912, it includes sequence number 79.

[0089] In certain embodiments, the transgenic animal is the Asian elephant (Elephas maximus), the African elephant (Loxodonta africana), the African forest elephant (Loxodonta cyclotis), or the Bornean elephant (Elephas maximus borneensis). [Method for introducing woolly mammoth gene variants or deletions of regulatory elements into cells]

[0090] In certain embodiments of any aspect thereof, the cell composition described herein expresses a polypeptide encoded by at least one isolated nucleic acid sequence having a mammoth gene variant nucleotide sequence (including, but not limited to, the exogenous mammoth gene variants listed above and in Table 1 of International Publication No. 2022 / 125940, which are incorporated herein by reference in their entirety).

[0091] The cells described herein may be transfected with, come into contact with, or be administered with, an exogenous woolly mammoth gene encoded by an isolated nucleic acid described herein, by methods known in the art.

[0092] In some embodiments, at least one nucleic acid sequence encoding a woolly mammoth gene is delivered via a vector.

[0093] A vector is a nucleic acid construct designed for delivery to a host cell or for the transfer of genetic material between different host cells. Where used herein, a vector may be viral or nonviral. The term “vector” encompasses any genetic element that, when associated with appropriate regulatory elements, can replicate and transfer genetic material into a cell. Vectors include, but are not limited to, cloning vectors, expression vectors, plasmids, phages, transposons, cosmids, artificial chromosomes, viruses, virions, and the like.

[0094] In some embodiments of any of these aspects, the vector is selected from the group consisting of plasmids, cosmids, and viral vectors.

[0095] An expression vector is a vector that induces the expression of RNA or polypeptides (e.g., mammoth polypeptides) from a nucleic acid sequence linked to a transcriptional regulatory sequence on the vector. The expressed sequence is often heterogeneous to the cell, though not always. For example, the mammoth gene introduced into a living cell is heterogeneous to the cell. Expression vectors may contain additional elements; for example, an expression vector may have two replication systems, allowing it to be maintained in two organisms: animal cells for expression and a prokaryotic host for cloning and amplification. "Expression" refers to cellular processes involved in the production of RNA and proteins, and, if applicable, the secretion of proteins, and includes, but is not limited to, transcription, transcriptional processing, translation, protein folding, modification, and processing, where applicable. "Expression products" include RNA transcribed from a gene and polypeptides obtained by the translation of mRNA transcribed from a gene.

[0096] In some embodiments, a vector can drive the expression of one or more sequences in mammalian cells; that is, the vector is a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 (Seed, 1987. Nature 329: 840) and pMT2PC (Kaufman, et al., 1987. EMBO J. 6: 187-195). When used in mammalian cells, the regulatory function of an expression vector is usually provided by one or more regulatory elements. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, Simianvirus 40, and other promoters disclosed herein and known in the art. For other expression systems suitable for both prokaryotic and eukaryotic cells, see, for example, Chapters 16 and 17 of Sambrook, et al., MOLECULAR CLONING: A LABORATORY MANUAL (2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989).

[0097] Methods for inhibiting or editing the expression of endogenous genes

[0098] In some embodiments of any aspect, the cells described herein do not express the endogenous homolog of at least one mammoth gene variant described herein. In another embodiment of any aspect, the cells are edited to inhibit the expression of the endogenous homolog of at least one mammoth gene variant. In another embodiment of any aspect, the cells are edited to incorporate substitutions by modifying regulatory and / or coding regions so that the endogenous homolog resembles at least one mammoth gene variant.

[0099] In another embodiment of any of the above, a non-mammoth homolog of the exogenous nucleic acid sequence is deleted or inactivated.

[0100] In this specification, when delivering one or more mammoth gene variants to a host cell, it is assumed that modifying one or more endogenous non-mammoth homologs of the genes to cause dysfunction of the endogenous genes may be advantageous. Furthermore, in this specification, when delivering two or more mammoth genes to a host cell, it is assumed that one or both of the endogenous host cell genes will be modified. Therefore, in this context, the host cell may contain at least one dysfunctional endogenous homolog to the corresponding mammoth gene.

[0101] In elephant cells, one or more elephant homologous genes of a mammoth gene to be expressed are modified, deleted, or inhibited so that only one or more mammoth genes are expressed by the cell. This can be achieved, for example, by standard gene editing of the target sequence. Alternatively, instead of simply inactivating the endogenous gene, it may be possible to completely replace the endogenous gene by, for example, homologous recombination or selective editing of non-mammoth homologous genes, thereby encoding and expressing a mammoth mutant gene sequence.

[0102] Target sequences can be determined by methods known in the art. For example, mammoth nucleic acid sequences can be compared to host organism nucleic acid sequences using sequence alignment tools. Examples include NCBI Basic Local Alignment Sequence Tool (BLAST), OrthoMaM, Ensembl, and / or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for sequence alignment, including any algorithms necessary to achieve maximum alignment over the entire length of the sequences to be compared.

[0103] Methods for inhibiting gene function in host cells are known in the art. Non-limiting examples of gene knockdown, inhibition, and modification include, for example, gene editing enzymes, activator-like effector nucleases (TALENS), and inhibitory nucleic acids. Exemplary embodiments of the types of inhibitory nucleic acids include, for example, siRNA, shRNA, miRNA, and / or miRNA, which are known in the art. Those skilled in the art can design and test inhibitors targeting the endogenous homologs of the thylacine gene variants described herein.

[0104] Methods for preparing and delivering gene editing systems are described, for example, in International Publication No. 2015 / 013583, U.S. Patent No. 10,640,789, U.S. Patent Publication No. 2019 / 0367948, U.S. Patent Publication No. 2017 / 0266320, U.S. Patent Publication No. 2018 / 0171361, U.S. Patent Publication No. 2016 / 0175462, and U.S. Patent Publication No. 2018 / 0195089, the contents of each of these, in their entirety, are incorporated herein by reference. Embodiments

[0105] The present invention also provides the following non-limiting embodiments.

[0106] Embodiment 1 is, G protein-coupled receptor 98 (GPR98) (SEQ ID NO: 1), microtubule actin crosslinking factor 1 (MACF1) (SEQ ID NO: 2), adenosine deaminase RNA-specific B2 (ADARB2) (SEQ ID NO: 3), centrosome protein 290 (CEP290) (SEQ ID NO: 4), keratin 4 (KRT4) (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCK-related protein 5 (NCKAP5) (SEQ ID NO: 7), laminin subunit β4 (LAMB4) (SEQ ID NO: 8), Niemann-Pick C1-like protein 1 (NPC1L1) (SEQ ID NO: 9), Adhesion G protein-coupled receptor D2 (ADGRD2) (SEQ ID NO: 10), Ninjurin 1 (NINJ1) (SEQ ID NO: 11), AHNAK nucleoprotein 2 (AHNAK2) (SEQ ID NO: 12), Cation channel sperm-associated accessory subunit β (CATSPERB) (SEQ ID NO: 13), Pecanex-like 4 (PCNXL4) (SEQ ID NO: 14), Spectrin repeat-containing nuclear envelope protein 2 (SYNE2) (SEQ ID NO: 15), NLR family pyrine domain-containing 12 (NLRP12) (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WD repeat region 90 (WDR90) (SEQ ID NO: 18), Breast cancer 2 (BRCA2) (SEQ ID NO: 19), Protein kinase, DNA activation catalyst subunit (PRKDC) (SEQ ID NO: 20), Vacuolar protein sorting 13 homolog B (VPS13B) (SEQ ID NO: 21), Prosaposin (PSAP) (SEQ ID NO: 22), SEC31 homolog B (SEC31B) (SEQ ID NO: 23), Keratin 28 (KRT28) (SEQ ID NO: 24), Keratin 35 (KRT35) (SEQ ID NO: 25), Keratin 40 (KRT40) (Sequence ID: 20) Number 26), Myosin Heavy Chain 4 (MYH4) (SEQ ID NO: 27), TRP Interaction Regulator (PIRT) (SEQ ID NO: 28), Polycystin I-like 2 (PKD1L2) (SEQ ID NO: 29), Retinitis Pigmentosa I-like Protein (RP1L1) (SEQ ID NO: 30), X Chromosome Open Reading Frame 58 (CXorf58) (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), Thyroid Hormone Receptor-Related Protein 3 (THRAP3) (SEQ ID NO: 34), Centromere Protein CThe isolated nucleic acid sequence comprises a nucleotide sequence encoding an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to at least one of the following: 1 (CENPC1) (SEQ ID NO: 35), dentinogenesis and dentin sialophosphoprotein (DSPP) (SEQ ID NO: 36), fibroblast growth factor 5 (FGF5) (SEQ ID NO: 37), cation channel sperm-associated accessory subunit γ (CATSPERG) (SEQ ID NO: 38), myosin heavy chain 1 (MYH1) (SEQ ID NO: 39), myosin heavy chain 13 (MYH13) (SEQ ID NO: 40), ATR interacting protein (ATRIP) (SEQ ID NO: 41), and transglutaminase 3 (TGM3) (SEQ ID NO: 42).

[0107] Embodiment 2 has a nucleotide sequence, GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADGRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 22) The isolated nucleic acid sequence described in Embodiment 1 encodes at least one amino acid from among (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO: 39), MYH13 (SEQ ID NO: 40), ATRIP (SEQ ID NO: 41), and TGM3 (SEQ ID NO: 42).

[0108] Embodiment 3 is an isolated vector containing the isolated nucleic acid sequence of Embodiment 1 or 2.

[0109] Embodiment 4 is a recombinant host cell containing at least one isolated nucleic acid sequence of Embodiment 1 or 2.

[0110] Embodiment 5 is, GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADGRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 10) 13) PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT Recombinant host cells containing a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with at least one of the following: 40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO: 39), MYH13 (SEQ ID NO: 40), ATRIP (SEQ ID NO: 41), and TGM3 (SEQ ID NO: 42).

[0111] Embodiment 6 describes a host cell that GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), Centrosole Protein 290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), Niemann-Pick C1-like 1 (SEQ ID NO: 9), Adhesion G Protein-Coupled Receptor D2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK Nucleoprotein 2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), Pecanex-like 4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), Vacuolar Protein Sorting 13 Homolog B (SEQ ID NO: 21), Prosaposin (SEQ ID NO: 22), SE The recombinant host cell according to Embodiment 5 comprises a nucleotide sequence having at least one of the following: C31 homolog B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), TRP interaction regulator (SEQ ID NO: 28), polycystin 1-like 2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), X chromosome open reading frame 58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO: 39), MYH13 (SEQ ID NO: 40), ATRIP (SEQ ID NO: 41), and TGM3 (SEQ ID NO: 42).

[0112] Embodiment 7 is a recombinant host cell according to any one of Embodiments 4 to 6, wherein the recombinant host cell comprises an isolated nucleic acid according to claim 1 or 2 of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42.

[0113] Embodiment 8 is, LOC126071805, WASH complex subunit 4 (WASHC4), LOC126075532, LOC126075533, α-fetoprotein (AFP), LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, LOC12608036 9, LOC126080369, LOC126080733, distal-less homeobox 6 (DLX6), extracellular matrix protein 2 (ECM2), LOC126085059, LOC126085481, LOC126086151, LOC126086152, LOC126086293, LOC126058227, LOC126058390, LOC126058396, Forkheadbox H1 (FOXH1), LOC126060018, LOC126060570, Coiled-Coil Domain-Containing Protein 15 (CCDC15), INO80 Complex Subunit B (INO80B), LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, Acyl-CoA Wax Alcohol Acyltransferase 1 (AWAT1), Transmembrane Protein 187 (TMEM187), and LOC126069912 contain at least one deletion of the upstream nucleotide sequence of the transcription start site. (a) The deleted nucleotide sequence upstream of LOC126071805 includes SEQ ID NO: 43, (b) The deletion nucleotide sequence upstream of WASHC4 includes SEQ ID NO: 44, (c) The deleted nucleotide sequence upstream of LOC126075532 includes SEQ ID NO: 45, (d) The deletion nucleotide sequence upstream of LOC126075533 includes SEQ ID NO: 46, (e) The deletion nucleotide sequence upstream of AFP includes SEQ ID NO: 47, (f) The deleted nucleotide sequence upstream of LOC126079103 includes SEQ ID NO: 48, (g) The deleted nucleotide sequence upstream of LOC126079327 includes SEQ ID NO: 49, (h) The deleted nucleotide sequence upstream of LOC126079327 includes SEQ ID NO: 50, (i) The deleted nucleotide sequence upstream of LOC126080333 includes SEQ ID NO: 51, (j) The deleted nucleotide sequence upstream of LOC126080367 includes SEQ ID NO: 52, The aforementioned deleted nucleotide sequence upstream of (k)LOC126080369 includes SEQ ID NO: 53, (l) The deleted nucleotide sequence upstream of LOC126080369 includes SEQ ID NO: 54, The aforementioned deleted nucleotide sequence upstream of (m)LOC126080733 includes SEQ ID NO: 55, The deletion nucleotide sequence upstream of (n)DLX6 includes SEQ ID NO: 56, (o) The deleted nucleotide sequence upstream of ECM2 includes SEQ ID NO: 57, The aforementioned deleted nucleotide sequence upstream of (p)LOC126085059 includes SEQ ID NO: 58, (q) The deleted nucleotide sequence upstream of LOC126085481 includes SEQ ID NO: 59, The deleted nucleotide sequence upstream of (r)LOC126086151 includes SEQ ID NO: 60, The deleted nucleotide sequence upstream of (s)LOC126086152 includes SEQ ID NO: 61, The aforementioned deleted nucleotide sequence upstream of (t)LOC126086293 includes SEQ ID NO: 62, The aforementioned deleted nucleotide sequence upstream of (u)LOC126058227 includes SEQ ID NO: 63, (v) The deleted nucleotide sequence upstream of LOC126058390 includes SEQ ID NO: 64, The aforementioned deleted nucleotide sequence upstream of (w)LOC126058396 includes SEQ ID NO: 65, (x) The deleted nucleotide sequence upstream of FOXH1 includes SEQ ID NO: 66, The aforementioned deleted nucleotide sequence upstream of (y)LOC126060018 includes SEQ ID NO: 67, The aforementioned deleted nucleotide sequence upstream of (z)LOC126060570 includes SEQ ID NO: 68, (aa) The deleted nucleotide sequence upstream of CCDC15 includes SEQ ID NO: 69, (bb) The aforementioned deleted nucleotide sequence upstream of INO80B includes SEQ ID NO 70, The aforementioned deleted nucleotide sequence upstream of (cc)LOC126062579 includes SEQ ID NO: 71, The aforementioned deleted nucleotide sequence upstream of (dd)LOC126063153 includes SEQ ID NO: 72. The aforementioned deleted nucleotide sequence upstream of (ee)LOC126063990 includes SEQ ID NO: 73, The aforementioned deleted nucleotide sequence upstream of (ff)LOC126063991 includes SEQ ID NO: 74, The aforementioned deleted nucleotide sequence upstream of (gg)LOC126066513 includes SEQ ID NO: 75. The aforementioned deleted nucleotide sequence upstream of (hh)LOC126066877 includes SEQ ID NO: 76, (ii) The deletion nucleotide sequence upstream of AWAT1 includes SEQ ID NO: 77, The aforementioned deletion nucleotide sequence upstream of (jj)TMEM187 includes SEQ ID NO: 78, The aforementioned deleted nucleotide sequence upstream of (kk)LOC126069912 includes SEQ ID NO: 79. Recombinant host cells

[0114] Embodiment 9 is a recombinant host cell of Embodiment 7, Furthermore, LOC126071805, WASHC4, LOC126075532, LOC126075533, AFP, LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, LOC126080369, LOC126080369, LOC126080733, DLX6, ECM2, LOC126085059, LOC126085481, LOC126086151, LOC126086152, LOC12608 The following include a deletion of at least one nucleotide sequence upstream of the transcription start site of 6293, LOC126058227, LOC126058390, LOC126058396, FOXH1, LOC126060018, LOC126060570, CCDC15, INO80B, LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, AWAT1, TMEM187, and LOC126069912, (a) The deleted nucleotide sequence upstream of LOC126071805 includes SEQ ID NO: 43, (b) The deletion nucleotide sequence upstream of WASHC4 includes SEQ ID NO: 44, (c) The deleted nucleotide sequence upstream of LOC126075532 includes SEQ ID NO: 45, (d) The deletion nucleotide sequence upstream of LOC126075533 includes SEQ ID NO: 46, (e) The deletion nucleotide sequence upstream of AFP includes SEQ ID NO: 47, (f) The deleted nucleotide sequence upstream of LOC126079103 includes SEQ ID NO: 48, (g) The deleted nucleotide sequence upstream of LOC126079327 includes SEQ ID NO: 49, (h) The deleted nucleotide sequence upstream of LOC126079327 includes SEQ ID NO: 50, (i) The deleted nucleotide sequence upstream of LOC126080333 includes SEQ ID NO: 51, (j) The deleted nucleotide sequence upstream of LOC126080367 includes SEQ ID NO: 52, The aforementioned deleted nucleotide sequence upstream of (k)LOC126080369 includes SEQ ID NO: 53, (l) The deleted nucleotide sequence upstream of LOC126080369 includes SEQ ID NO: 54, The aforementioned deleted nucleotide sequence upstream of (m)LOC126080733 includes SEQ ID NO: 55, The deletion nucleotide sequence upstream of (n)DLX6 includes SEQ ID NO: 56, (o) The deleted nucleotide sequence upstream of ECM2 includes SEQ ID NO: 57, The aforementioned deleted nucleotide sequence upstream of (p)LOC126085059 includes SEQ ID NO: 58, (q) The deleted nucleotide sequence upstream of LOC126085481 includes SEQ ID NO: 59, The deleted nucleotide sequence upstream of (r)LOC126086151 includes SEQ ID NO: 60, The deleted nucleotide sequence upstream of (s)LOC126086152 includes SEQ ID NO: 61, The aforementioned deleted nucleotide sequence upstream of (t)LOC126086293 includes SEQ ID NO: 62, The aforementioned deleted nucleotide sequence upstream of (u)LOC126058227 includes SEQ ID NO: 63, (v) The deleted nucleotide sequence upstream of LOC126058390 includes SEQ ID NO: 64, The aforementioned deleted nucleotide sequence upstream of (w)LOC126058396 includes SEQ ID NO: 65, (x) The deleted nucleotide sequence upstream of FOXH1 includes SEQ ID NO: 66, The aforementioned deleted nucleotide sequence upstream of (y)LOC126060018 includes SEQ ID NO: 67, The aforementioned deleted nucleotide sequence upstream of (z)LOC126060570 includes SEQ ID NO: 68, (aa) The deleted nucleotide sequence upstream of CCDC15 includes SEQ ID NO: 69, (bb) The aforementioned deleted nucleotide sequence upstream of INO80B includes SEQ ID NO 70, The aforementioned deleted nucleotide sequence upstream of (cc)LOC126062579 includes SEQ ID NO: 71, The aforementioned deleted nucleotide sequence upstream of (dd)LOC126063153 includes SEQ ID NO: 72. The aforementioned deleted nucleotide sequence upstream of (ee)LOC126063990 includes SEQ ID NO: 73, The aforementioned deleted nucleotide sequence upstream of (ff)LOC126063991 includes SEQ ID NO: 74, The aforementioned deleted nucleotide sequence upstream of (gg)LOC126066513 includes SEQ ID NO: 75. The aforementioned deleted nucleotide sequence upstream of (hh)LOC126066877 includes SEQ ID NO: 76, (ii) The deletion nucleotide sequence upstream of AWAT1 includes SEQ ID NO: 77, The aforementioned deletion nucleotide sequence upstream of (jj)TMEM187 includes SEQ ID NO: 78, The aforementioned deleted nucleotide sequence upstream of (kk)LOC126069912 includes SEQ ID NO: 79. Recombinant host cells.

[0115] Embodiment 10 is a recombinant host cell according to any one of Embodiments 4 to 9, wherein the recombinant host cell is a stem cell.

[0116] Embodiment 11 is a recombinant host cell according to Embodiment 10, wherein the stem cells are selected from induced stem cells, embryonic stem (ES) cells, or mesenchymal stem cells (MSCs).

[0117] Embodiment 12 is a recombinant host cell according to any one of Embodiments 4 to 9, wherein the recombinant host cell is a reprogrammed cell.

[0118] Embodiment 13 is a recombinant host cell according to any one of Embodiments 4 to 9, wherein the recombinant host cell is a fibroblast or a mesenchymal cell.

[0119] Embodiment 14 is a recombinant host cell according to any one of Embodiments 4 to 9, wherein the recombinant host cell is selected from the group consisting of nerve cells, chondrocytes, osteocytes, muscle cells, adipocytes, and epidermal cells.

[0120] Embodiment 15 is a recombinant host cell according to any one of Embodiments 4 to 14, wherein the recombinant host cell is GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADGRD2, NINJ1, AHNAK2, CATSPERB, PCNXL4, SYNE2, NLRP12, LOC126086768, WDR90, BRCA 2. It does not express at least one endogenous homolog of PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35, KRT40, MYH4, PIRT, PKD1L2, RP1L1, CXorf58, LOC126068772, LOC126069872, THRAP3, CENPC1, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP, and TGM3.

[0121] Embodiment 16 is a recombinant host cell of Embodiment 15, wherein the recombinant host cell is GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADGRD2, NINJ1, AHNAK2, CATSPERB, PCNXL4, SYNE2, NLRP12, LOC126086768, WDR90, BRCA2, PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35, KRT40, MYH4, PIRT, PKD1L2, RP It does not express at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42 endogenous homologs from among 1L1, CXorf58, LOC126068772, LOC126069872, THRAP3, CENPC1, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP, and TGM3.

[0122] Embodiment 17 is a recombinant host cell from any one of Embodiments 3 to 16, where the recombinant host cell is an elephant cell.

[0123] Embodiment 18 is a recombinant host cell of Embodiment 17, where the elephant cell is selected from Asian elephant cell (Elephas maximus), African elephant cell (Loxodonta africana), African forest elephant cell (Loxodonta cyclotis), and Bornean elephant cell (Elephas maximus borneensis).

[0124] Embodiment 19 is a transgenic animal comprising a recombinant host cell as described in any one of Embodiments 3 to 18.

[0125] Embodiment 20 is the transgenic animal of Embodiment 19, wherein the transgenic animal is the Asian elephant (Elephas maximus), the African elephant (Loxodonta africana), the African forest elephant (Loxodonta cyclotis), and the Bornean elephant (Elephas maximus borneensis).

[0126] Embodiment 21 is a transgenic animal containing at least one woolly mammoth (Mammuthus primigenius) gene variant.

[0127] Embodiment 22 is a transgenic animal of Embodiment 21, wherein at least one woolly mammoth (Mammuthus primigenius) gene variant is GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADGRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13) ), PCNXL4 (sequence number 14), SYNE2 (sequence number 15), NLRP12 (sequence number 16), LOC126086768 (sequence number 17), WDR90 (sequence number 18), BRCA2 (sequence number 19), PRKDC (sequence number 20), VPS13B (sequence number 21), PSAP (sequence number 22), SEC31B (sequence number 23), KRT28 (sequence number 24), KRT35 (sequence number 25), KRT40 (distribution The nucleotide sequence contains an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with at least one of the following: (sequence number 26), MYH4 (sequence number 27), PIRT (sequence number 28), PKD1L2 (sequence number 29), RP1L1 (sequence number 30), CXorf58 (sequence number 31), LOC126068772 (sequence number 32), LOC126069872 (sequence number 33), THRAP3 (sequence number 34), CENPC1 (sequence number 35), DSPP (sequence number 36), FGF5 (sequence number 37), CATSPERG (sequence number 38), MYH1 (sequence number 39), MYH13 (sequence number 40), ATRIP (sequence number 41), and TGM3 (sequence number 42).

[0128] Embodiment 23 is a transgenic animal of Embodiment 22, wherein at least one woolly mammoth (Mammuthus primigenius) gene variant is GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADGRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 19) 22) It includes at least one of the following: SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO: 39), MYH13 (SEQ ID NO: 40), ATRIP (SEQ ID NO: 41), and TGM3 (SEQ ID NO: 42).

[0129] Embodiment 24 is a transgenic animal according to any one of Embodiments 21 to 23, comprising a woolly mammoth (Mammuthus primigenius) gene variant of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42.

[0130] Embodiment 25 is a transgenic animal described in any one of Embodiments 21 to 24, wherein the transgenic animal is Furthermore, LOC126071805, WASH complex subunit 4 (WASHC4), LOC126075532, LOC126075533, α-fetoprotein (AFP), LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, LOC126080369, LOC126080369, LOC126080733, distally deficient homeobox 6 (DLX6), extracellular matrix protein 2 (ECM2), LOC126085059, LOC126085481, LOC126086151, LOC126086152, LOC126086 293, LOC126058227, LOC126058390, LOC126058396, Forkheadbox H1 (FOXH1), LOC126060018, LOC126060570, Coiled-Coil Domain-Containing 15 (CCDC15), INO80 Complex Subunit B (INO80B), LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, Acyl-CoA Wax Alcohol Acyltransferase 1 (AWAT1), Transmembrane Protein 187 (TMEM187), and LOC126069912, It includes at least one deletion of the nucleotide sequence upstream of the transcription start site, (a) The deleted nucleotide sequence upstream of LOC126071805 includes SEQ ID NO: 43, (b) The deletion nucleotide sequence upstream of WASHC4 includes SEQ ID NO: 44, (c) The deleted nucleotide sequence upstream of LOC126075532 includes SEQ ID NO: 45, (d) The deletion nucleotide sequence upstream of LOC126075533 includes SEQ ID NO: 46, (e) The deletion nucleotide sequence upstream of AFP includes SEQ ID NO: 47, (f) The deleted nucleotide sequence upstream of LOC126079103 includes SEQ ID NO: 48, (g) The deleted nucleotide sequence upstream of LOC126079327 includes SEQ ID NO: 49, (h) The deleted nucleotide sequence upstream of LOC126079327 includes SEQ ID NO: 50, (i) The deleted nucleotide sequence upstream of LOC126080333 includes SEQ ID NO: 51, (j) The deleted nucleotide sequence upstream of LOC126080367 includes SEQ ID NO: 52, The aforementioned deleted nucleotide sequence upstream of (k)LOC126080369 includes SEQ ID NO: 53, (l) The deleted nucleotide sequence upstream of LOC126080369 includes SEQ ID NO: 54, The aforementioned deleted nucleotide sequence upstream of (m)LOC126080733 includes SEQ ID NO: 55, The deletion nucleotide sequence upstream of (n)DLX6 includes SEQ ID NO: 56, (o) The deleted nucleotide sequence upstream of ECM2 includes SEQ ID NO: 57, The aforementioned deleted nucleotide sequence upstream of (p)LOC126085059 includes SEQ ID NO: 58, (q) The deleted nucleotide sequence upstream of LOC126085481 includes SEQ ID NO: 59, The deleted nucleotide sequence upstream of (r)LOC126086151 includes SEQ ID NO: 60, The deleted nucleotide sequence upstream of (s)LOC126086152 includes SEQ ID NO: 61, The aforementioned deleted nucleotide sequence upstream of (t)LOC126086293 includes SEQ ID NO: 62, The aforementioned deleted nucleotide sequence upstream of (u)LOC126058227 includes SEQ ID NO: 63, (v) The deleted nucleotide sequence upstream of LOC126058390 includes SEQ ID NO: 64, The aforementioned deleted nucleotide sequence upstream of (w)LOC126058396 includes SEQ ID NO: 65, (x) The deleted nucleotide sequence upstream of FOXH1 includes SEQ ID NO: 66, The aforementioned deleted nucleotide sequence upstream of (y)LOC126060018 includes SEQ ID NO: 67, The aforementioned deleted nucleotide sequence upstream of (z)LOC126060570 includes SEQ ID NO: 68, (aa) The deleted nucleotide sequence upstream of CCDC15 includes SEQ ID NO: 69, (bb) The aforementioned deleted nucleotide sequence upstream of INO80B includes SEQ ID NO 70, The aforementioned deleted nucleotide sequence upstream of (cc)LOC126062579 includes SEQ ID NO: 71, The aforementioned deleted nucleotide sequence upstream of (dd)LOC126063153 includes SEQ ID NO: 72. The aforementioned deleted nucleotide sequence upstream of (ee)LOC126063990 includes SEQ ID NO: 73, The aforementioned deleted nucleotide sequence upstream of (ff)LOC126063991 includes SEQ ID NO: 74, The aforementioned deleted nucleotide sequence upstream of (gg)LOC126066513 includes SEQ ID NO: 75. The aforementioned deleted nucleotide sequence upstream of (hh)LOC126066877 includes SEQ ID NO: 76, (ii) The deletion nucleotide sequence upstream of AWAT1 includes SEQ ID NO: 77, The aforementioned deletion nucleotide sequence upstream of (jj)TMEM187 includes SEQ ID NO: 78, The aforementioned deleted nucleotide sequence upstream of (kk)LOC126069912 includes sequence number 79.

[0131] Embodiment 26 is a genetically modified animal of any one of Embodiments 21 to 25, The aforementioned genetically modified animals are It does not express at least one endogenous homolog of GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADGRD2, NINJ1, AHANAK2, CATSPERB, PCNXL4, SYNE2, NLRP12, LOC126086768, WDR90, BRCA2, PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35, KRT40, MYH4, PIRT, PKD1L2, RP1L1, CXorf58, LOC126068772, LOC126069872, THRAP3, CENPC1, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP, and TGM3.

[0132] Embodiment 27 is, GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADGRD2, NINJ1, AHNAK2, CATSPERB, PCNXL4, SYNE2, NLRP12 , LOC126086768, WDR90, BRCA2, PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35, KRT40, MYH4, PIRT, PKD1L2, RP1L1, CXorf58, LOC126068772 This is a transgenic animal of Embodiment 26 that does not express the endogenous homologs of LOC126069872, THRAP3, CENPC1, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP, and TGM3 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42.

[0133] Embodiment 28 is a transgenic animal according to any one of Embodiments 21 to 27, wherein the transgenic animal is an elephant.

[0134] Embodiment 29 is a transgenic animal of Embodiment 28, wherein the elephant is selected from the Asian elephant (Elephas maximus), African elephant (Loxodonta africana), African forest elephant (Loxodonta cyclotis), and Bornean elephant (Elephas maximus borneensis). [Examples]

[0135] Example 1: Identification of Mammoth Mutations

[0136] Using the mEleMax1 reference genome, we identified variants of 46 mammoths, 12 Asian elephants, and 27 African elephants. Reads were trimmed using AdapterRemoval (Reference 1) or fastp, trimming low-quality (qual<25) ends and removing reads smaller than 35 bp. Contaminants were detected by Kraken with a confidence level of 0.8 using a pre-compiled Kraken database (minikraken2_v2_8GB_201904). Unclassifiable trimmed reads were aligned to the reference genome using BWA Aln (seed 16,500, maximum edit distance 0.01, maximum gap open 2). Duplicate reads were optionally marked using PaleoMIX (Reference 2) (mammoth sample) and Picard MarkDuplicates (elephant sample). Binary alignment maps (BAMs) generated from multiple runs on the same sample were merged using samtools (Reference 3). Alignment quality was assessed using QualiMap (Reference 4), DamageProfiler (Reference 5), and MultiQC (Reference 6). Germ cell mutations were detected using Samtools / Bcftools (Reference 3) and GATK4 (Reference 7). Genotyping of GVCF files was determined using GLnexus (Reference 8). The impact of mutations was determined using SNPEff (Reference 9). Samples from Asian and African elephants, as well as mutations observed throughout repetitive sequences and CpG island regions in Asian elephants, were excluded.

[0137] A fixed variant of mammoth was identified and confirmed to meet the following conditions: (i) it is homozygous in all mammoths in which a genotype with a read depth greater than 5 was identified; (ii) it is not observed in Asian elephants or African elephants; and (iii) it is not present in repeat regions or CpG island regions.

[0138] The mEleMax1 siftDB was created. Missense mutations were annotated using the siftDB, and their impact was predicted. Genes were ranked based on the sum of the Sift scores of missense mutations detected in at least five mammoths.

[0139] Using SegAlign, a pairwise whole-genome alignment was generated between the Asian elephant reference genome mEleMax1 and the UCSC human reference genome Hg38 (Reference 10). Using this pairwise alignment, the genomic coordinates of multiple publicly available datasets were transformed using CrossMap Region (Reference 11). The TF cluster (transcription factor ChIP-Seq cluster in Hg38 for ENCODE3) was downloaded from UCSC. (ChIP-Seq cluster of 340 transcription factors in 129 cell types) was downloaded (References 12-14). Data on NCBI RefSeq functional elements and ENCODE cCREs (candidate cis regulatory elements) in Hg38 and Mm10 were also downloaded from UCSC (References 14, 15). These procedures were repeated for the mouse genome Mm10. As a result, a dataset of putative regulatory elements in the Asian elephant genome derived from experimental data in humans and mice was obtained. Next, cross-analysis was performed using BEDTools to identify the putative regulatory regions that overlap with fixed mammoth mutants (Reference 16). Subsequently, the mEleMax1 gene closest to each putative regulatory region was identified using BEDTools closest (Reference 16). These regulatory regions were filtered based on proximity to the nearest gene, specifically within 2kb.

[0140] Data analysis identified a list of protein-coding gene variants in the mammoth genome that are not present in the comparison elephant genome. The protein-coding mammoth gene variants are shown in Table 1.

[0141] Table 1: Protein-coding gene mutations [Table 1-1] [Table 1-2]

[0142] Furthermore, a series of regulatory factor mutations (i.e., deletions) were identified in the mammoth genome that are not present in the elephant genome used for comparison. These regulatory factor mutations are shown in Table 2.

[0143] Table 2: Regulatory factor mutations [Table 2-1] [Table 2-2]

[0144] Example 2: Targeted editing of FGF5

[0145] FGF5 encodes a protein within the FGF family involved in embryonic development, cell proliferation, and tissue repair, among other biological functions. This gene is closely associated with its inhibitory effect on hair elongation by promoting the transition from the growth phase to the regression phase in the hair follicle cycle.

[0146] FGF5 is closely associated with hair development, particularly at the junction of the growth-regression hair follicle cycle. Mutations resulting in a truncated form of this protein, caused by a single nucleotide deletion and subsequent premature stop codon formation, have been associated with a characteristically long hair phenotype in several species. This appears to affect only specific hair types (i.e., rabbit down hair and human facial hair). This truncated protein has not been specifically associated with adverse developmental phenotypes.

[0147] FGF5 can be knocked out in target cells using CRISPR (e.g., CRISPR-Cas9 or CRISPR-Cas12). The CRISPR (e.g., CRISPR-Cas9 or CRISPR-Cas12) system may include a target guide with the following sequence: TGAGGAAAGAAGCAGGAGGG (SEQ ID NO: 80). Asian elephant (Elephas maximus) cells are edited to introduce an indel into the FGF5 gene.

[0148] Disruption of FGF5 is involved in various biological processes, including embryonic development, cell proliferation, morphogenesis, tissue repair, tumor growth, and invasion. This gene has been identified as an oncogene that confers transformational ability when introduced into mammalian cells. Targeted disruption of homologs of this gene in mice results in a phenotype of abnormally long hair, suggesting its function as a hair elongation inhibitor. Alternative splicing transcripts encoding different isoforms have been identified. For example, gene editing using methods such as CRISPR (e.g., CRISPR-Cas9 or CRISPR-Cas12)-based knockout mechanisms at SNP sites observed in mammoth-elephant genome comparisons is expected to lead to the generation of shortened FGF5 mutants. The phenotypic response to this gene disruption is predicted to be organisms with significantly elongated hair due to a reduction in the system's ability to promote the transition from the growth phase to the regression phase in hair follicles.

[0149] Example 3: Verification of the efficiency of NINJ1 and NCKAP5 gene substitution and attB site integration using RNP and single-chain ODN.

[0150] Transfection reagents

[0151] The following reagents were thawed on ice as needed: (a) Editor: Alt-RTM Sp Cas9 nuclease V3 protein (1 mg / ml), Alt-RTM As Cas12a (1 mg / ml), or plasmid editor; (b) gRNA: 100 mM sgRNA (Synthego; Redwood City, California) dissolved in 15 ml of nuclease-free water; (c) Donor: Homology repair (HDR) donor plasmid or linear double-stranded DNA (PCR purified); (d) Alt-RTM HDR-Enhancer V2; (e) Pifislin-α (P53 inhibitor). The RNP buffer and transfection cuvette were arranged as follows: (a) Nucleofector™ solution for primary P3 cells (LONZA™ P3 Primary Cell 4D-NUCLEOFECTOR™ X Kit L (Lonza kit; Lonza; Basel, Switzerland)); (b) Supplement 1 buffer (Lonza); and (c) 100 μL Nucleo Cuvette™ (Lonza).

[0152] Preparation of transfection reagents

[0153] The formation of Cas9 ribonucleoprotein (RNP) by hybridization of edited protein and sgRNA was carried out by mixing equal volumes of Alt-RTM Sp Cas9 nuclease V3 protein (1 mg / ml), 100 mM sgRNA, and nuclease-free water and allowing the mixture to react for at least 10 minutes. Since edited proteins exhibit different affinities to different sgRNA sequences, each sgRNA or crRNA was hybridized independently.

[0154] Each reagent was prepared in a standard volume of 2.5 ml. However, for NCKAP5, 3.33 ml and 1.67 ml were used for each RNP to compensate for efficiency differences between RNPs. P3 / S1 buffer was prepared (P3 82%, S1 18%). Cells were directly resuspended using this buffer immediately before transfection. 2.5 mg of HDR donor plasmid prepared by the midiprep method was used. P3 / S1 buffer was prepared (P3 82%, S1 18%). Cells were resuspended using this buffer immediately before transfection. 100 μl of P3 / S1 buffer was used per reaction.

[0155] Plasmid-based editor reaction

[0156] The formula for calculating the plasmid volume to be added to the editor reaction is as follows: Plasmid volume (ml) = Required plasmid amount (ng) / Plasmid concentration (ng / ml). Plasmid-based editing reaction reagents do not require incubation, and the donor was mixed with the editor and gRNA before cell addition.

[0157] transfection reaction

[0158] The cells were healthy, proliferating, and nearly confluent prior to transfection. At least 500,000 cells, ideally over 1,000,000 cells, were used for each transfection reaction. FACS was used to enrich cells with substitutions.

[0159] To prepare the cells for transfection, the culture medium was aspirated from the cells using a 2 ml serological pipette connected to a vacuum pressure and a sterile non-filter tip. The cells were washed with 1×PBS, and the dish was shaken back and forth to ensure complete coverage. Then, 1×PBS was aspirated from the cells, and the cells were washed again with 1×PBS. 0.25% trypsin was added directly to the cells, and the culture dish was shaken back and forth to ensure complete distribution. The cells were then transferred to 37 cells. oThe cells were incubated in trypsin for 2-3 minutes with shaking in 1C and 5% CO2, and complete release was confirmed using a microscope. The cells were neutralized with an equal volume of 1:1 medium and dispensed into tubes for centrifugation. The cells were centrifuged at 300×g for 10 minutes. A T25 flask was filled with 5 ml of 1:1 medium, 1 ml of pifithrin-α, and 7.14 ml of Alt-R TM Preparation was carried out by adding HDR-Enhancer V2. The supernatant was removed from the centrifuged cells, and the cells were resuspended in 1 ml of 1:1 medium. 10 ml of the resuspended cells were added to 10 ml of trypan blue for each sample, and the cells were counted by adding 10 ml to a cell counter. The remaining cells were centrifuged at 300 × g for 10 minutes, the supernatant was removed, and the cells were resuspended in P3 / S1 buffer. Guide / editor / H2O master mix and HDR donor were added to the P3 / S1 suspended cells to a total volume of 100 ml. 100 ml was added to a large 100 ml cuvette, and the cells were transfected using a Lonza nucleofector. The transfected cells were transferred to a T25 flask, and another 100 ml of 1:1 medium was added from the flask to the cuvette, and the remaining cells were transferred to the flask. The flask was incubated for 24 hours, and the medium was changed using only 1:1 medium.

[0160] Preparation of 1:1 standard growth medium

[0161] Combine the following ingredients, filter-sterilize, and prepare 1 liter of "1:1 medium": 300 ml Ham's F12 (Thermo Fisher Scientific, Waltham, MA), 200 ml HI FBS (Thermo Fisher), 5 ml 2 mM GlutaMAX (Thermo Fisher), 5 ml 100X NEAA (Thermo Fisher), 5 ml 100X Anti / Anti (Thermo Fisher), 50 ml 100 ng / ml bFGF (StemCell Technologies, Vancouver, BC, Canada), 50 ml 100 mg / ml EGF (StemCell Technologies), 1 ml 55 mM BME (Thermo Fisher), 5 ml 50 mg / ml ascorbic acid (Sigma-Aldrich, Burlington, MA), 500 ml EGM-2 Bullet Kit medium (Lonza, Walkersville, MD), and EGM-2 Bullet Kit Supplement (Lonza).

[0162] Cell population enriched by FACS

[0163] FACS was performed to enrich the cell population for stable fluorescent protein (e.g., GFP) expression. Transient expression typically occurs within 7 days post-transfection, while fluorescent protein expression beyond 8 days post-transfection typically indicates a stable construct. For FACS enrichment, plates were configured to receive the sorted cell samples by adding a 1:1 mixture of medium and filtered FBS medium. Cell pellets were generated as described above. Samples were stored on ice and transported directly to the FACS facility along with the tissue culture plates. Cells were sorted into the plates. The sorted plates were returned directly to the incubator for culture. The following day, the cells were examined to confirm adhesion and proliferation of the cell population. Pass rates and filters used were recorded. For 96-well and 384-well plates, medium changes were not required for the first 5 days post-transfection. On day 5, and every 2-3 days until the cells were passaged or the wells were full, 1:1 medium was added directly to the wells without changing the medium, giving the cells more time in FBS-rich medium before gradually removing them from the medium.

[0164] Sequence validation

[0165] Pelletized cells in quantities less than 1,000,000 and more than 20,000 according to the steps provided above for optimal cell lysis. Remove the supernatant and sterilize the cells at -20°C. o The sample was frozen in C, and thawing / DNA extraction was continued.

[0166] For lysis and DNA extraction, a lysis stock buffer was prepared by combining a proteolytic agent (Life Sciences, Gene Art Genomic Cleavage Kit) and Quick Extract DNA extraction solution in a ratio of 1 ml / 25 ml each. The lysis buffer was added to a tube containing a dried and thawed cell pellet. The cell pellet was vortexed for 10-15 seconds. The contents were transferred to a tube, and 65 oIt was placed in a heat block or thermal cycler of C for 6 minutes. The tube was vortexed for 10 - 15 seconds and then placed in a heat block of 98 o C for 2 minutes. The sample was lysed and a lysate of 5 ml or less was used for subsequent PCR reactions.

[0167] Genotyping of substitutions by PCR

[0168] Primers for the first round of PCR were designed using one primer outside the homology arm and a second primer that binds to the genomic / donor locus before the reporter insertion position. Primers for nested PCR at each end of the substitution were designed so that all variants and cleavage sites could be used in the PCR reaction and sequenced by Sanger sequencing in the second round of PCR. Q5 polymerase was recommended for improving sequence quality and long-distance PCR amplification. High-concentration and high-quality DNA was preferred. For the PCR1 reaction mixture, 20 μl of a reaction mixture containing the following was mixed: (a) 10 μl of Q5® High-Fidelity DNA Polymerase (2X); (b) 0.2 μl of forward primer and 0.2 μl of reverse primer (10 mM); (c) 1 μl of each cell lysate; (d) filled to 20 μl with nuclease-free water. For each unique edited amplicon, a positive control was prepared. A negative control without cell lysate was also prepared in the same way. For the PCR1 reaction, the following conditions were used in a thermal cycler: 105 o C cover temperature; 20 μl volume: 1×98 o C for 2 minutes; 20×: 98 o C for 10 seconds, primer-specific annealing temperature for 30 seconds, 72 o C about 30 seconds per kilobase of DNA; 1×72 o C 30 seconds per kilobase; 4 o C infinite hold. The PCR products were visualized on a gel.

[0169] For the PCR 2 reaction mixture, 30 ml of reaction mixture containing the following was prepared: (a) 15 ml of Q5® high fidelity DNA polymerase (2×); 0.3 ml of forward primer and 0.3 ml of reverse primer (10 mM); (c) 1 ml of Round 1 PCR product; (d) filled to 30 ml with nuclease-free water. A positive control was prepared for each unique edited amplicon. A template-free negative control with a Round 1 PCR product without added DNA was also prepared. For the PCR 2 reaction, the following conditions were used in a thermal cycler: 105 o Cover C (for 30ml capacity); 1 x 98 o C for 2 minutes; 20x: 98 o 10 seconds at C, 15 seconds at primer-specific annealing temperature, and 72 o DNA in C for approximately 30 seconds per kilobase; 1 x 4 o Infinite retention in C; PCR products were stored for Sanger sequencing.

[0170] Gel validation was performed on PCR products from Round 1 and 10× PCR reactions. Samples were subjected to Sanger sequencing. All samples with a CRL not exceeding 50 or a QS not exceeding 30 were recorded. Sequences were aligned to target sequences, and files were visually inspected to confirm they matched expected positions and to check for any other potential issues in quality or coverage. Synthego ICE analysis was performed using online-available templates and procedures.

[0171] Clonal isolation and cryopreservation

[0172] Based on sequence validation, the presence of the desired edit and the proportion of the population possessing that edit were verified to determine whether further enrichment was necessary. For samples verified to have the desired edit without requiring further enrichment, the steps for clonal isolation and enrichment of populations and genotyping described above were repeated. For samples verified to have the desired edit and not requiring further enrichment, the samples were grown and cryopreserved as modified cell lines.

[0173] Edit checkpoints, clonal proliferation, and WGS-based on / off targeting

[0174] Modified cell lines were grown and used for repeated applications. After more than 5 validated edits, at least 1 × 10⁶ cells were used. 6 Individual cells were assigned to WGS analysis to determine on / off targeting. For WGS sample preparation, cells were centrifuged at 300 × g and the supernatant was removed. The cell pellet was then flash-frozen in liquid nitrogen and stored under liquid nitrogen conditions.

[0175] conclusion

[0176] Genetic substitutions of the NINJ1 and NCKAP5 genes were performed sequentially in the same cell line, and the indels (insertions, deletions) and knock-in scores for the first and second enrichments of these cell lines are shown in Figures 1A-1D. This method successfully generated cell lines with approximately 20% of all intended mammoth-specific substitutions across the NINJ1 and NCKAP5 genes, based on the genotyping of the parental strain.

[0177] Those skilled in the art will understand that modifications can be made to the embodiments described above without departing from the broad concept of the present invention. Therefore, it will be understood that the present invention is not limited to the specific embodiments disclosed, but is intended to encompass modifications within the spirit and scope of the invention as defined herein. [References] (Reference 1) Schubert, M., Lindgreen, S. & Orlando, L. AdapterRemoval v2: rapid adapter trimming, identification, and read merging. BMC Res. Notes 9, 88 (2016). (Reference 2) Schubert, M. et al. Characterization of ancient and modern genomes by SNP detection and phylogenomic and metagenomic analysis using PALEOMIX. Nat. Protoc. 9, 1056-1082 (2014). (Reference 3) Li, H. et al. The Sequence Alignment / Map format and SAMtools. Bioinformatics 25, 2078-2079 (2009). (Reference 4) Garcia-Alcalde, F. et al. Qualimap: evaluating next-generation sequencing alignment data. Bioinformatics 28, 2678-2679 (2012). (Reference 5) Jonsson, H., Ginolhac, A., Schubert, M., Johnson, P. L. F. & Orlando, L. mapDamage2.0: fast approximate Bayesian estimates of ancient DNA damage parameters. Bioinformatics 29, 1682-1684 (2013). (Reference 6) Ewels, P., Magnusson, M., Lundin, S. & Kaeller, M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics 32, 3047-3048 (2016). (Reference 7) McKenna, A. et al. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 20, 1297-1303 (2010). (Reference 8) Lin, M. F. et al. GLnexus: joint variant calling for large cohort sequencing. http: / / biorxiv.org / lookup / doi / 10.1101 / 343970 (2018) doi:10.1101 / 343970. (Reference 9) Cingolani, P. et al. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff. Fly (Austin) 6, 80-92 (2012). (Reference 10) Goenka, S. D., Turakhia, Y., Paten, B. & Horowitz, M. SegAlign: A Scalable GPU-Based Whole Genome Aligner. in SC20: International Conference for High Performance Computing, Networking, Storage and Analysis 1-13 (IEEE, 2020). doi:10.1109 / SC41405.2020.00043. (Reference 11) Zhao, H. et al. CrossMap: a versatile tool for coordinate conversion between genome assemblies. Bioinformatics 30, 1006-1007 (2014). (Reference 12) ENCODE Project Consortium. An integrated encyclopedia of DNA elements in the human genome. Nature 489, 57-74 (2012). (Reference 13) Luo, Y. et al. New developments on the Encyclopedia of DNA Elements (ENCODE) data portal. Nucleic Acids Res. 48, D882-D889 (2020). (Reference 14) The ENCODE Project Consortium et al. Expanded encyclopaedias of DNA elements in the human and mouse genomes. Nature 583, 699-710 (2020). (Reference 15) Pruitt, KD et al. RefSeq: an update on mammalian reference sequences. Nucleic Acids Res. 42, D756-763 (2014). (Reference 16) Quinlan, AR & Hall, IM BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841-842 (2010).

Claims

1. G protein-coupled receptor 98 (GPR98) (SEQ ID NO: 1), microtubule actin crosslinking factor 1 (MACF1) (SEQ ID NO: 2), adenosine deaminase RNA-specific B2 (ADARB2) (SEQ ID NO: 3), centrosome protein 290 (CEP290) (SEQ ID NO: 4), keratin 4 (KRT4) (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCK-related protein 5 (NCKAP5) (SEQ ID NO: 7), laminin subunit β4 (LAMB4) (SEQ ID NO: 8), Niemann-Pick disease C1-like 1 (NPC1L1) (SEQ ID NO: 9), adhesion G protein Cryo-coupled receptor D2 (ADGRD2) (SEQ ID NO: 10), Ninjurin 1 (NINJ1) (SEQ ID NO: 11), AHNAK nucleoprotein 2 (AHNAK2) (SEQ ID NO: 12), Cation channel sperm-associated accessory subunit β (CATSPERB) (SEQ ID NO: 13), Pecanex-like 4 (PCNXL4) (SEQ ID NO: 14), Spectrin repeat-containing nuclear envelope protein 2 (SYNE2) (SEQ ID NO: 15), NLR family pyrine domain-containing 12 (NLRP12) (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WD repeat Region 90 (WDR90) (SEQ ID NO: 18), Breast Cancer 2 (BRCA2) (SEQ ID NO: 19), Protein Kinase, DNA Activation Catalytic Subunit (PRKDC) (SEQ ID NO: 20), Vacuolar Protein Sorting 13 Homolog B (VPS13B) (SEQ ID NO: 21), Prosaposin (PSAP) (SEQ ID NO: 22), SEC31 Homolog B (SEC31B) (SEQ ID NO: 23), Keratin 28 (KRT28) (SEQ ID NO: 24), Keratin 35 (KRT35) (SEQ ID NO: 25), Keratin 40 (KRT40) (SEQ ID NO: 26), Myosin Heavy Chain 4 (MYH4) ( SEQ ID NO: 27), TRP phosphoinositide interaction regulator (PIRT) (SEQ ID NO: 28), polycystin 1-like 2 (PKD1L2) (SEQ ID NO: 29), retinitis pigmentosa 1-like protein (RP1L1) (SEQ ID NO: 30), X chromosome open reading frame 58 (CXorf58) (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), thyroid hormone receptor-related protein 3 (THRAP3) (SEQ ID NO: 34), centromere protein C1 (CENPC1) (SEQ ID NO: 35),Isolated nucleic acid sequences comprising nucleotide sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to at least one of the following: dentinogenesis and dentin sialophosphoprotein (DSPP) (SEQ ID NO: 36), fibroblast growth factor 5 (FGF5) (SEQ ID NO: 37), sperm-associated cation channel accessory subunit (CATSPERG) (SEQ ID NO: 38), myosin heavy chain 1 (MYH1) (SEQ ID NO: 39), myosin heavy chain 13 (MYH13) (SEQ ID NO: 40), ATR interacting protein (ATRIP) (SEQ ID NO: 41), and transglutaminase 3 (TGM3) (SEQ ID NO: 42).

2. An isolated nucleic acid sequence according to claim 1, wherein the nucleotide sequence is GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADGRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 16) 21) An isolated nucleic acid sequence containing at least one of the following: PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO: 39), MYH13 (SEQ ID NO: 40), ATRIP (SEQ ID NO: 41), and TGM3 (SEQ ID NO: 42).

3. An isolated vector comprising the isolated nucleic acid sequence described in claim 1 or 2.

4. Recombinant host cell comprising at least one isolated nucleic acid sequence according to claim 1 or 2.

5. GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADGRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 10) 13) PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT Recombinant host cells containing a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to at least one of the following: 40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO: 39), MYH13 (SEQ ID NO: 40), ATRIP (SEQ ID NO: 41), and TGM3 (SEQ ID NO: 42).

6. Recombinant host cell according to claim 5, wherein the host cell is GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADGRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (distributed Recombinant host cells comprising a nucleotide sequence having at least one of the following: SEC31B (sequence number 23), KRT28 (sequence number 24), KRT35 (sequence number 25), KRT40 (sequence number 26), MYH4 (sequence number 27), PIRT (sequence number 28), PKD1L2 (sequence number 29), RP1L1 (sequence number 30), CXorf58 (sequence number 31), LOC126068772 (sequence number 32), LOC126069872 (sequence number 33), THRAP3 (sequence number 34), CENPC1 (sequence number 35), DSPP (sequence number 36), FGF5 (sequence number 37), CATSPERG (sequence number 38), MYH1 (sequence number 39), MYH13 (sequence number 40), ATRIP (sequence number 41), and TGM3 (sequence number 42).

7. Recombinant host cell according to any one of claims 4 to 6, comprising 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42 isolated nucleic acids as described in claim 1 or 2.

8. Recombinant host cells, LOC126071805, WASH complex subunit 4 (WASHC4), LOC126075532, LOC126075533, α-fetoprotein (AFP), LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, LOC126080369, LOC126080369, LOC126080733, distal-less homeobox 6 (DLX6), extracellular matrix protein 2 (ECM2), LOC126085059, LOC126085481, LOC126086151, LOC126086152, LOC1260862 93, LOC126058227, LOC126058390, LOC126058396, Forkheadbox H1 (FOXH1), LOC126060018, LOC126060570, Coiled-Coil Domain-Containing Protein 15 (CCDC15), INO80 Complex Subunit B (INO80B), LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, Acyl-CoA Wax Alcohol Acyltransferase 1 (AWAT1), Transmembrane Protein 187 (TMEM187), and LOC126069912 It includes at least one deletion of the nucleotide sequence upstream of the transcription start site, (a) The deleted nucleotide sequence upstream of LOC126071805 includes SEQ ID NO: 43, (b) The deletion nucleotide sequence upstream of WASHC4 includes SEQ ID NO: 44, (c) The deleted nucleotide sequence upstream of LOC126075532 includes SEQ ID NO: 45, (d) The deletion nucleotide sequence upstream of LOC126075533 includes SEQ ID NO: 46, (e) The deletion nucleotide sequence upstream of AFP includes SEQ ID NO: 47, (f) The deleted nucleotide sequence upstream of LOC126079103 includes SEQ ID NO: 48, (g) The deleted nucleotide sequence upstream of LOC126079327 includes SEQ ID NO: 49, (h) The deleted nucleotide sequence upstream of LOC126079327 includes SEQ ID NO: 50, (i) The deleted nucleotide sequence upstream of LOC126080333 includes SEQ ID NO: 51, (j) The deleted nucleotide sequence upstream of LOC126080367 includes SEQ ID NO: 52, The aforementioned deleted nucleotide sequence upstream of (k)LOC126080369 includes SEQ ID NO: 53, (l) The deleted nucleotide sequence upstream of LOC126080369 includes SEQ ID NO: 54, The aforementioned deleted nucleotide sequence upstream of (m)LOC126080733 includes SEQ ID NO: 55, The deletion nucleotide sequence upstream of (n)DLX6 includes SEQ ID NO: 56, (o) The deleted nucleotide sequence upstream of ECM2 includes SEQ ID NO: 57, The aforementioned deleted nucleotide sequence upstream of (p)LOC126085059 includes SEQ ID NO: 58, (q) The deleted nucleotide sequence upstream of LOC126085481 includes SEQ ID NO: 59, The deleted nucleotide sequence upstream of (r)LOC126086151 includes SEQ ID NO: 60, The deleted nucleotide sequence upstream of (s)LOC126086152 includes SEQ ID NO: 61, The aforementioned deleted nucleotide sequence upstream of (t)LOC126086293 includes SEQ ID NO: 62, The aforementioned deleted nucleotide sequence upstream of (u)LOC126058227 includes SEQ ID NO: 63, (v) The deleted nucleotide sequence upstream of LOC126058390 includes SEQ ID NO: 64, The aforementioned deleted nucleotide sequence upstream of (w)LOC126058396 includes SEQ ID NO: 65, (x) The deleted nucleotide sequence upstream of FOXH1 includes SEQ ID NO: 66, The aforementioned deleted nucleotide sequence upstream of (y)LOC126060018 includes SEQ ID NO: 67, The aforementioned deleted nucleotide sequence upstream of (z)LOC126060570 includes SEQ ID NO: 68, (aa) The deleted nucleotide sequence upstream of CCDC15 includes SEQ ID NO: 69, (bb) The aforementioned deleted nucleotide sequence upstream of INO80B includes SEQ ID NO 70, The aforementioned deleted nucleotide sequence upstream of (cc)LOC126062579 includes SEQ ID NO: 71, The aforementioned deleted nucleotide sequence upstream of (dd)LOC126063153 includes SEQ ID NO:

72. The aforementioned deleted nucleotide sequence upstream of (ee)LOC126063990 includes SEQ ID NO: 73, The aforementioned deleted nucleotide sequence upstream of (ff)LOC126063991 includes SEQ ID NO: 74, The aforementioned deleted nucleotide sequence upstream of (gg)LOC126066513 includes SEQ ID NO:

75. The aforementioned deleted nucleotide sequence upstream of (hh)LOC126066877 includes SEQ ID NO: 76, (ii) The deletion nucleotide sequence upstream of AWAT1 includes SEQ ID NO: 77, The aforementioned deletion nucleotide sequence upstream of (jj)TMEM187 includes SEQ ID NO: 78, The aforementioned deleted nucleotide sequence upstream of (kk)LOC126069912 includes SEQ ID NO:

79. Recombinant host cells

9. Recombinant host cell according to claim 7, LOC126071805, WASHC4, LOC126075532, LOC126075533, AFP, LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367 , LOC126080369, LOC126080369, LOC126080733, DLX6, ECM2, LOC126085059, LOC126085481, LOC126086151, LOC126086152, LOC126086293 The following further include deletions of at least one nucleotide sequence upstream of the transcription start site of LOC126058227, LOC126058390, LOC126058396, FOXH1, LOC126060018, LOC126060570, CCDC15, INO80B, LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, AWAT1, TMEM187, and LOC126069912. (a) The deleted nucleotide sequence upstream of LOC126071805 contains SEQ ID NO: 43, (b) The deleted nucleotide sequence upstream of WASHC includes SEQ ID NO: 44, (c) The deleted nucleotide sequence upstream of LOC126075532 contains SEQ ID NO: 45, (d) The deleted nucleotide sequence upstream of LOC126075533 contains SEQ ID NO: 46, (e) The deleted nucleotide sequence upstream of AFP includes SEQ ID NO: 47, (f) The deleted nucleotide sequence upstream of LOC126079103 contains SEQ ID NO: 48, (g) The deleted nucleotide sequence upstream of LOC126079327 contains SEQ ID NO: 49, (h) The deleted nucleotide sequence upstream of LOC126079327 contains SEQ ID NO: 50, (i) The deleted nucleotide sequence upstream of LOC126080333 contains SEQ ID NO: 51, (j) The deleted nucleotide sequence upstream of LOC126080367 contains SEQ ID NO: 52, The deleted nucleotide sequence upstream of (k)LOC126080369 contains SEQ ID NO: 53, (l) The deleted nucleotide sequence upstream of LOC126080369 contains SEQ ID NO: 54, The deleted nucleotide sequence upstream of (m)LOC126080733 contains SEQ ID NO:

55. The deleted nucleotide sequence upstream of (n)DLX6 contains SEQ ID NO:

56. (o) The deleted nucleotide sequence upstream of ECM2 includes SEQ ID NO: 57, The deleted nucleotide sequence upstream of (p)LOC126085059 contains SEQ ID NO:

58. (q) The deleted nucleotide sequence upstream of LOC126085481 contains SEQ ID NO: 59, The deleted nucleotide sequence upstream of (r)LOC126086151 contains SEQ ID NO: 60, The deleted nucleotide sequence upstream of (s)LOC126086152 contains SEQ ID NO:

61. The deleted nucleotide sequence upstream of (t)LOC126086293 contains SEQ ID NO:

62. The deleted nucleotide sequence upstream of (u)LOC126058227 contains SEQ ID NO:

63. (v) The deleted nucleotide sequence upstream of LOC126058390 contains SEQ ID NO: 64, The deleted nucleotide sequence upstream of (w)LOC126058396 contains SEQ ID NO:

65. (x) The deleted nucleotide sequence upstream of FOXH1 includes SEQ ID NO: 66, The deleted nucleotide sequence upstream of (y)LOC126060018 contains SEQ ID NO: 67, The deleted nucleotide sequence upstream of (z)LOC126060570 contains SEQ ID NO:

68. (aa) The deleted nucleotide sequence upstream of CCDC15 includes SEQ ID NO: 69, (bb) The deleted nucleotide sequence upstream of INO80B contains SEQ ID NO 70, (cc) The deleted nucleotide sequence upstream of LOC126062579 contains SEQ ID NO: 71, (dd) The deleted nucleotide sequence upstream of LOC126063153 contains SEQ ID NO: 72, (ee) The deleted nucleotide sequence upstream of LOC126063990 contains SEQ ID NO: 73, (ff) The deleted nucleotide sequence upstream of LOC126063991 contains SEQ ID NO: 74, The deleted nucleotide sequence upstream of (gg) LOC126066513 contains SEQ ID NO:

75. (hh) The deleted nucleotide sequence upstream of LOC126066877 contains SEQ ID NO: 76, (ii) The deleted nucleotide sequence upstream of AWAT1 includes SEQ ID NO: 77, (jj) The deleted nucleotide sequence upstream of TMEM187 includes sequence number 78, The deleted nucleotide sequence upstream of (kk) LOC126069912 contains sequence number 79.

10. A recombinant host cell according to any one of claims 4 to 9, which is a stem cell.

11. Recombinant host cell according to claim 10, wherein the stem cell is a recombinant host cell selected from induced stem cells, embryonic stem (ES) cells, or mesenchymal stem cells (MSCs).

12. Recombinant host cell according to any one of claims 4 to 9, wherein the recombinant host cell is a reprogrammed cell.

13. Recombinant host cell according to any one of claims 4 to 9, wherein the recombinant host cell is a fibroblast or a mesenchymal cell.

14. Recombinant host cells according to any one of claims 4 to 9, wherein the recombinant host cells are selected from the group consisting of nerve cells, chondrocytes, osteocytes, muscle cells, adipocytes, and epidermal cells.

15. GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADGRD2, NINJ1, AHNAK2, CAT SPERB, PCNXL4, SYNE2, NLRP12, LOC126086768, WDR90, BRCA2, PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35 Recombinant host cells according to any one of claims 4 to 14, which do not express at least one endogenous homolog from among KRT40, MYH4, PIRT, PKD1L2, RP1L1, CXorf58, LOC126068772, LOC126069872, THRAP3, CENPC1, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP, and TGM3.

16. GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADGRD2, NINJ1, AHNAK2, CATSPERB, PCNXL4, SYNE2, NLRP1 2, LOC126086768, WDR90, BRCA2, PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35, KRT40, MYH4, PIRT, PKD1L2, RP1L1, CXorf58, LOC12606877 Recombinant host cells according to claim 15, which do not express endogenous homologs of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42 of LOC126069872, THRAP3, CENPC1, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP, and TGM3.

17. The recombinant host cell is an elephant cell, as described in any one of claims 3 to 16.

18. The recombinant host cell according to claim 17 is selected from Asian elephant cells (Elephas maximus), African elephant cells (Loxodonta africana), African forest elephant cells (Loxodonta cyclotis), and Bornean elephant cells (Elephas maximus borneensis).

19. A genetically modified animal comprising a recombinant host cell according to any one of claims 3 to 18.

20. A genetically modified animal according to claim 19, wherein the genetically modified animal is an Asian elephant (Elephas maximus), an African elephant (Loxodonta africana), an African forest elephant (Loxodonta cyclotis), and a Bornean elephant (Elephas maximus borneensis).

21. A genetically modified animal containing at least one woolly mammoth (Mammuthus primigenius) gene variant.

22. A genetically modified animal according to claim 21, The aforementioned at least one woolly mammoth (Mammuthus primigenius) gene mutant, G protein-coupled receptor 98 (GPR98) (SEQ ID NO: 1), microtubule actin crosslinking factor 1 (MACF1) (SEQ ID NO: 2), adenosine deaminase RNA-specific B2 (ADARB2) (SEQ ID NO: 3), centrosome protein 290 (CEP290) (SEQ ID NO: 4), keratin 4 (KRT4) (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCK-related protein 5 (NCKAP5) (SEQ ID NO: 7), laminin subunit β4 (LAMB4) (SEQ ID NO: 8), Niemann-Pick C1-like 1 (NPC1L1) (SEQ ID NO: 9), adhesion G Protein-coupled receptor D2 (ADGRD2) (SEQ ID NO: 10), Ninjurin 1 (NINJ1) (SEQ ID NO: 11), AHNAK nucleoprotein 2 (AHNAK2) (SEQ ID NO: 12), Cation channel sperm-associated accessory subunit β (CATSPERB) (SEQ ID NO: 13), Pecanex-like 4 (PCNXL4) (SEQ ID NO: 14), Spectrin repeat-containing nuclear envelope protein 2 (SYNE2) (SEQ ID NO: 15), NLR family pyrine domain-containing 12 (NLRP12) (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17) WD repeat region 90 (WDR90) (SEQ ID NO: 18), Breast cancer 2 (BRCA2) (SEQ ID NO: 19), Protein kinase, DNA activation catalyst subunit (PRKDC) (SEQ ID NO: 20), Vacuolar protein sorting 13 homolog B (VPS13B) (SEQ ID NO: 21), Prosaposin (PSAP) (SEQ ID NO: 22), SEC31 homolog B (SEC31B) (SEQ ID NO: 23), Keratin 28 (KRT28) (SEQ ID NO: 24), Keratin 35 (KRT35) (SEQ ID NO: 25), Keratin 40 (KRT40) (SEQ ID NO: 26), Myosin heavy chain 4(MYH4)(SEQ ID NO: 27), TRP phosphoinositide interaction regulator (PIRT)(SEQ ID NO: 28), polycystin 1-like 2 (PKD1L2)(SEQ ID NO: 29), retinitis pigmentosa 1-like protein (RP1L1)(SEQ ID NO: 30), chromosome X read frame 58 (CXorf58)(SEQ ID NO: 31), LOC126068772(SEQ ID NO: 32), LOC126069872(SEQ ID NO: 33), thyroid hormone receptor-related protein 3 (THRAP3)(SEQ ID NO: 34), centromere protein C1 (CENPC1)(SEQ ID NO: 35),Dentin formation and dentin sialophosphoprotein (DSPP) (SEQ ID NO: 36), fibroblast growth factor 5 (FGF5) (SEQ ID NO: 37), cation channel sperm-associated accessory subunit γ (CATSPERG) (SEQ ID NO: 38), myosin heavy chain 1 (MYH1) (SEQ ID NO: 39), myosin heavy chain 13 (MYH13) (SEQ ID NO: 40), ATR interacting protein (ATRIP) (SEQ ID NO: 41), and transglutaminase 3 (TGM3) (SEQ ID NO: 42), A genetically modified animal comprising a nucleotide sequence encoding an amino acid sequence having at least one identity with at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%.

23. A genetically modified animal according to claim 22, The aforementioned at least one woolly mammoth (Mammuthus primigenius) gene mutant, GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADGRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), P SAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO: 39), MYH13 (SEQ ID NO: 40), ATRIP (SEQ ID NO: 41), and TGM3 (SEQ ID NO: 42) A genetically modified animal containing at least one of the following:

24. A genetically modified animal according to any one of claims 21 to 23, wherein the genetically modified animal comprises a woolly mammoth (Mammuthus primigenius) gene mutant of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42.

25. A genetically modified animal according to any one of claims 21 to 24, The aforementioned genetically modified animals are LOC126071805, WASH complex subunit 4 (WASHC4), LOC126075532, LOC126075533, α-fetoprotein (AFP), LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, LOC12 6080369, LOC126080369, LOC126080733, distal-less homeobox 6 (DLX6), extracellular matrix protein 2 (ECM2), LOC126085059, LOC126085481, LOC126086151, LOC126086152, LOC126086293, LOC12605 Further comprising deletions of at least one nucleotide sequence upstream of the transcription start site of LOC126069912, LOC126058390, LOC126058396, forkheadbox H1 (FOXH1), LOC126060018, LOC126060570, coiled-coil region containing 15 (CCDC15), INO80 complex subunit B (INO80B), LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, acyl-CoA wax alcohol acyltransferase 1 (AWAT1), transmembrane protein 187 (TMEM187), and LOC126069912, (a) The deletion sequence upstream of LOC126071805 includes sequence number 43, (b) The deletion sequence upstream of WASHC4 includes sequence number 44, (c) The deletion sequence upstream of LOC126075532 includes sequence number 45, (d) The deletion sequence upstream of LOC126075533 includes sequence number 46, (e) The deletion sequence upstream of AFP includes sequence number 47, (f) The deletion sequence upstream of LOC126079103 includes sequence number 48, (g) The deletion sequence upstream of LOC126079327 includes sequence number 49, (h) The deletion sequence upstream of LOC126079327 includes sequence number 50, (i) The deletion sequence upstream of LOC126080333 includes sequence number 51, (j) The deletion sequence upstream of LOC126080367 includes sequence number 52, (k)The deletion sequence upstream of LOC126080369 includes sequence number 53, (l) The deletion sequence upstream of LOC126080369 includes sequence number 54, The aforementioned deletion sequence upstream of (m)LOC126080733 includes sequence number 55. (n) The deletion sequence upstream of DLX6 includes sequence number 56, (o) The deletion sequence upstream of ECM2 includes sequence number 57, The aforementioned deletion sequence upstream of (p)LOC126085059 includes sequence number 58, (q) The deletion sequence upstream of LOC126085481 includes sequence number 59, The deletion sequence upstream of (r)LOC126086151 includes sequence number 60, The deletion sequence upstream of (s)LOC126086152 includes sequence number 61, The deletion sequence upstream of (t)LOC126086293 includes sequence number 62, The aforementioned deletion sequence upstream of (u)LOC126058227 includes sequence number 63, (v) The deletion sequence upstream of LOC126058390 includes sequence number 64, The aforementioned deletion sequence upstream of (w)LOC126058396 includes sequence number 65, (x)FOXH1 includes the upstream deletion sequence sequence number 66, The deletion sequence upstream of (y)LOC126060018 includes sequence number 67, The deletion sequence upstream of (z)LOC126060570 includes sequence number 68, (aa) The deletion sequence upstream of CCDC15 includes sequence number 69, (bb) The deletion sequence upstream of INO80B includes sequence number 70, The aforementioned deletion sequence upstream of (cc) LOC126062579 includes sequence number 71, (dd) The deletion sequence upstream of LOC126063153 includes sequence number 72, (ee) The deletion sequence upstream of LOC126063990 includes sequence number 73, (ff) The deletion sequence upstream of LOC126063991 includes sequence number 74, The deletion sequence upstream of (gg) LOC126066513 includes sequence number 75, (hh) The deletion sequence upstream of LOC126066877 includes sequence number 76, (ii) The deletion sequence upstream of AWAT1 includes sequence number 77, (jj) The deletion sequence upstream of TMEM187 includes sequence number 78, (kk) The aforementioned deletion sequence upstream of LOC126069912 includes sequence number 79, Genetically modified animals.

26. GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADGRD2, NINJ1, AHNAK2, CAT SPERB, PCNXL4, SYNE2, NLRP12, LOC126086768, WDR90, BRCA2, PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35 A genetically modified animal according to any one of claims 21 to 25, which does not express at least one endogenous homolog from among KRT40, MYH4, PIRT, PKD1L2, RP1L1, CXorf58, LOC126068772, LOC126069872, THRAP3, CENPC1, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP, and TGM3.

27. GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADGRD2, NINJ1, AHNAK2, CATSPERB, PCNXL4, SYNE2, NLRP1 2, LOC126086768, WDR90, BRCA2, PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35, KRT40, MYH4, PIRT, PKD1L2, RP1L1, CXorf58, LOC12606877 The genetically modified animal according to claim 26, which does not express an endogenous homolog of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42 of LOC126069872, THRAP3, CENPC1, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP, and TGM3.

28. The genetically modified animal according to any one of claims 21 to 27, wherein the genetically modified animal is an elephant.

29. The genetically modified animal according to claim 28, wherein the elephant is selected from the Asian elephant (Elephas maximus), the African elephant (Loxodonta africana), the African forest elephant (Loxodonta cyclotis), and the Bornean elephant (Elephas maximus borneensis).