Alpha-hemolysin composition and method for immunity against Staphylococcus aureus
Modified α-hemolysin polypeptides with H35L, R66C, and E70C substitutions induce effective germinal center and follicular helper T cell responses, addressing the limitations of existing vaccines and providing long-lasting immunity against Staphylococcus aureus infections.
Patent Information
- Application Number
- JP2025560343
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-04-17
- Filing Date
- 2024-04-17
- Publication Date
- 2026-05-26
AI Technical Summary
Current vaccine efforts for Staphylococcus aureus have failed to induce a known correlation with human protective immunity, and existing immune responses may be detrimental, necessitating a novel approach rooted in a deeper understanding of human immunity to this pathogen.
Development of modified α-hemolysin (Hla) polypeptides with specific amino acid substitutions (H35L, R66C, and E70C) to induce enhanced germinal center and follicular helper T cell responses, providing long-lasting immunity against Staphylococcus aureus infections.
The modified Hla polypeptides effectively activate germinal center and follicular helper T cell responses, leading to robust immune defense against Staphylococcus aureus, reducing the severity of skin and soft tissue infections and other invasive diseases.
Smart Images

Figure 2026516691000001_ABST
Abstract
Description
[Technical Field]
[0001] The present invention relates to compositions and methods for the treatment of Staphylococcus aureus.
[0002] Sequence listing reference This application includes a sequence listing submitted electronically via the Patent Center in computer-readable XML format and incorporated herein by reference in its entirety in accordance with 37 CFR § 1.52(e)(5). The above XML file, created on 11 April 2024, is named "047563-792748(020578).xml" and is 51.6 kilobytes in size.
[0003] Gratitude for government support This invention was made with government support under AI167137, awarded by the National Institutes of Health. The United States Government has certain powers in this invention. [Background technology]
[0004] Staphylococcus aureus infections cause more than one million deaths worldwide each year, afflicting individuals throughout their lives and disproportionately impacting low- and middle-income populations. The organism Staphylococcus aureus is both a commensal bacterium of human skin and a major cause of infection. Soft tissue infections (SSTIs) remain the most common form of Staphylococcus aureus disease, with an incidence of >100 cases per 100,000 people, costing >$4 billion annually in the United States. SSTIs can lead to disseminated disease and exacerbate the health burden related to antibiotic resistance.
[0005] Vaccine-based prevention of Staphylococcus aureus infection is essential for public health, yet previous efforts to develop an effective vaccine have failed. While each candidate vaccine that reached human clinical trials was highly immunogenic, the immune response induced was not a known correlation with human protective immunity against Staphylococcus aureus infection. Furthermore, recent studies have indicated that existing immune responses to Staphylococcus aureus may be detrimental to vaccine efficacy. A novel approach to vaccine development is needed, rooted in a deeper understanding of human immunity to this pathogen and acknowledging the global need for a solution. [Overview of the project]
[0006] This specification discloses modified α-hemolysin (Hla) polypeptides or derivatives or fragments thereof, comprising the amino acid substitutions H35L, R66C, and E70C (HlaHRE) to the amino acid sequence described in SEQ ID NO: 1. The modified Hla polypeptides may include the amino acid sequence described in SEQ ID NO: 11, or a sequence that is at least about 80% identical thereto, or a fragment thereof. The modified Hla polypeptides may include the amino acid sequence described in any one of SEQ ID NOs. 12 to 35, or a fragment thereof, or an amino acid sequence that is at least about 80% identical thereto.
[0007] This specification discloses polynucleotides comprising nucleic acid sequences encoding modified Hla polypeptides. The modified Hla polypeptides may include the amino acid sequence or fragment thereof described in SEQ ID NO: 11, or an amino acid sequence that is at least approximately 80% identical thereto. The polynucleotide sequences may be isolated polynucleotide sequences, plasmids, expression vectors, cosmids, or viral vectors. The polynucleotide sequences may be contained in viruses or virus-like particles (VLPs).
[0008] Host cells containing polynucleotide sequences are also disclosed. Non-limiting examples of host cells include Chinese hamster ovary (CHO) cells, HEK293 cells, human cervical cancer cells (Hela), canine kidney cells (MDCK), human hepatocytes (HepG2), baby hamster kidney cells (BHK), monkey kidney cells (CV1), Vero cells, CEM cells, 721.221 cells, H9 cells, Jurkat cells, Raji cells, W138 cells, COS-7 cells, 293 cells, HepG2 cells, 3T3 cells, and RIN cells.
[0009] This specification discloses immunogenic compositions comprising a modified Hla polypeptide or its derivatives or fragments, or a polynucleotide sequence encoding an Hla polypeptide, and at least one pharmaceutically acceptable excipient. The immunogenic compositions may further comprise a pharmaceutically acceptable adjuvant. Non-limiting examples of suitable adjuvants include alum, AddaS03 (AS03-like), MPLA and alum (AS04-like), Fruend's, CpG-ODN1585, and any combination thereof. The immunogenic compositions may further comprise at least one additional activator.
[0010] This specification further discloses a method for inducing an immune response to a bacterial pathogen in a subject requiring such response, the method comprising administering a modified Hla polypeptide to the subject. Also disclosed are the use of modified Hla polypeptides in the manufacture of pharmaceuticals for inducing an immune response to a bacterial pathogen, and the use of modified Hla polypeptides for inducing an immune response to a bacterial pathogen. The bacterial pathogen may be Staphylococcus aureus. Administering a modified Hla polypeptide to a subject may result in an enhanced germinal center (GC) response or a follicular helper T (TFH) response, or a reduction in the severity of skin and soft tissue infections, invasive Staphylococcus aureus disease, sepsis, and carrier status, compared to administering an immunogenic composition containing a modified Hla polypeptide having only the H35L substitution to the amino acid sequence described in SEQ ID NO: 1.
[0011] In one embodiment, the subject may be a mammal. In one embodiment, the subject may be a human. The subject may be of any age. In one embodiment, the subject may be a child under the age of 3 years, or under 2 years, or under 1 year, or under 12 months, or 11 months, or 10 months, 9 months, or 8 months, or 6 months, or 5 months, or 4 months, or 3 months, or 2 months, or 1 month, or under 4 weeks, or 3 weeks, or 2 weeks, or 1 week. The subject may be a pregnant woman. The method may further include at least one, at least two, at least three or more further administrations of the immunogenic composition. The method may include administering at least one further immunogenic antigen. Further non-limiting examples of immunogenic antigens include Opp3a, DltD, HtsA, LtaS, IsdA, IsdB, IsdC, SdrC, SdrD, SdrE, SdrF, SdrG, SdrH, SrtA, SpA, Sbi, FmtB, beta-hemolysin, fibronectin-binding protein A (FnbA), fibronectin-binding protein B (FnbB), coagulase, Fig, Map, Pantone-Valentine leucocidine (Pvl), alpha toxin and its variants, gamma toxin (hlg) and its variants, Ica, immunodominant ABC transporter, Mg2+ transporter, Ni-ABC transporter, RAP, autolysin, laminin receptor, IsaA / PisA, IsaB / PisB, SPOIIIE, SsaA, EbpS, Sas This includes A, SasF, SasH, EFB(FIB), SBI, Npase, EBP, bone sialobinding protein II, aureolisin precursor (AUR) / Sepp1, CNA and its fragments, such as M55, TSST-1, mecA, poly-N-acetylglucosamine (PNAG / dPNAG) extracellular polysaccharide, GehD, EbhA, EbhB, SSP-1, SSP-2, HBP, vitronectin-binding protein, HarA, EsxA, EsxB, enterotoxin A, enterotoxin B, enterotoxin C1, and novel autolysins. Administration can be via intravenous, intramuscular, subcutaneous, oral, or intraperitoneal routes.
[0012] The patent or application file includes at least one color drawing. A copy of the patent or application with the color drawing will be provided by the Patent and Trademark Office upon request and payment of the required fees. The aspects of this disclosure are illustrated below by example: [Brief explanation of the drawing]
[0013] [Figure 1] Figure 1 provides a structural representation of the ADAM10 ectodomain (PDB 6BE6), showing the structural orientation of each domain: metalloproteinase (magenta), disintegrin (cyan), and cysteine-rich (green) relative to the cell membrane. The transmembrane and cytoplasmic tail domains are illustrated in gray. [Figure 2] Figures 2A and 2B provide analyses of Hla-targeted vaccine candidate antigens. Figure 2A provides an analysis of age-specific serological anti-Hla titers, revealing a gradual increase in the 50% effective concentration (EC50) over the first five years of life. The 75th and 25th (black) percentiles and the 50th (red) percentile are indicated. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, calculated using one-way ANOVA and Tukey's test for multiple comparisons. Figure 2B provides an analysis of serum functional Hla neutralizing activity in a rabbit erythrocyte protection assay, confirming that infants and children under two years of age exhibit immaturity in response compared to older children. The 75th and 25th (black) percentiles and the 50th (red) percentile are indicated. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, based on one-way ANOVA and Tukey's test for multiple comparisons. [Figure 3]Figures 3A-3D provide analysis of Hla targeting candidate antigens. Figure 3A shows the positions of mutant residues in the full-length vaccine antigens HlaH35L (purple), HlaD45A / Y118F (orange), and HlaR66C / E70C (blue). Structural representations of monomeric Hla antigen (left, PDB4 YHD) and monomer isolated from heptameric toxin (right, PDB 7AHL). Figure 3B provides a panel of peptide antigens: Hla50 (SEQ ID NO: 36); HlaP1: a synthetic antigen (SEQ ID NO: 37) that retains five replicas of the IEDB predicted T cell epitope within the first 50 amino acids of Hla; and HlaP2: a synthetic antigen (SEQ ID NO: 38) that retains three distinct predicted T cell antigen peptides derived from Hla. Figure 3C provides vaccine efficacy data for preventing abscesses for each antigen. Each antigen was delivered to multiple groups of mice, and vaccine efficacy was examined compared to a control group with Freund's adjuvant alone. Figure 3D provides data on skin abscess area (left) and skin necrosis area (right) after subcutaneous delivery of 1 × 10⁸ CFU of Staphylococcus aureus USA300 / LAC strain to mice immunized with each Hla variant vaccine (9-10 mice per group). Figure 3D provides data showing protection against rRBC lysis induced by candidate vaccine antigens HlaH35L (HlaH, purple), HlaD45A / Y118F, and HlaR66C / E70C after incorporating completely detoxifying histidine 35 to leucine mutations (HlaH35L / D45A / Y118F and HlaH35L / R66C / E70C, HlaHDY, and HlaHRE, respectively). [Figure 4]Figures 4A-4H provide analysis of candidate antigens for Hla-targeted vaccines. Figure 4A provides subset analysis of OT-II CD4+ T cells collected from influx region lymph nodes of mice immunized with adjuvant alone (sham) or candidate Hla vaccines HlaH35L, HlaD45A / Y118F, and HlaR66C / E70C. Tissue collection was performed 7 days after subcutaneous infection with 1 × 10⁸ CFU of wild-type Staphylococcus aureus USA300 / LAC strain, and p<0.05 was obtained by nonparametric one-way ANOVA with Bonferroni-Dunn correction. Figure 4B shows the correlation between protection against rRBC lysis and serological anti-Hla titer (Log EC50) when treated with 2nM Hla in mice immunized with HlaH35L (purple), HlaD45A / Y118F (orange), and HlaR66C / E70C (blue). Figure 4C compares rRBC-binding vaccine antigen Hla variants with wild-type Hla. Figure 4D shows the lysis curve analysis of HlaH, HlaHDY, and HlaHRE compared to wild-type Hla. Figure 4E shows the SDS-PAGE analysis of 35S-methionine-labeled Hla, HlaH, HlaHDY, and HlaHRE generated by in vitro transcription-translation coupling. Figure 4F shows the analysis of the heptamer assembly and stability of Hla, HlaH, HlaHDY, and HlaHRE, evaluated after incubation of the radiolabeled toxin with rRBCs at room temperature for 1 hour, followed by incubation at 37°C, 62°C, or 80°C for 10 minutes. Figure 4G shows the analysis of the HlaHRE heptamer capacity under conditions of increasing radiolabeled toxin concentration. The radiolabeled toxin was incubated with rRBCs at room temperature for 1 hour, followed by incubation at 37°C. Relative concentration units of monomeric and heptameric toxins were quantified using ImageJ software. Phosphor imaging detection of the labeled toxin was performed after SDS-PAGE separation; in Figures 4E-4G, toxin monomers (arrows) and oligomers (Hla7) are indicated. Figure 4H shows the disulfide bonds identified in the antigen HlaHRE by mass spectrometry (mass spectrometry peptide sequence provided in SEQ ID NO: 47).The disulfide bond (SS) peptide linkage between Cys66 and Cys70 within the HlaHRE protein was identified by LC-MS / MS analysis and verified by manual alignment using y-ion or b-ion matching. [Figure 5]Figures 5A–5E demonstrate that neonatal vaccination provides protection against Staphylococcus aureus skin and soft tissue infections. Figure 5A is a schematic diagram showing the timeline of neonatal vaccination and SSTI modeling. Figure 5B provides a graph showing the area of skin abscesses (left) after reinfection of immunized mice (9–10 mice per group) with 1 × 10⁸ CFUs of Staphylococcus aureus. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, the statistical significance of HlaHRE compared to each vaccine condition specified by color is particularly noted, and a graph showing the area of skin necrosis (right) after reinfection of immunized mice (9–10 mice per group) with 1 × 10⁸ CFUs of Staphylococcus aureus is provided. *The statistical significance of HlaHRE compared to each vaccine condition specified by color (p<0.05, **p<0.01, ***p<0.001, ****p<0.0001) is particularly noted. Figure 5C provides a graph showing the area of skin abscesses (left) after reinfection of immunized mice (9-10 mice per group) with 1 × 10⁸ CFUs of Staphylococcus aureus. *The statistical significance of HlaHRE compared to each vaccine condition specified by color (p<0.05, **p<0.01, ***p<0.001, ****p<0.0001) is particularly noted, as well as a graph showing the area of skin necrosis (right) after reinfection of immunized mice (9-10 mice per group) with 1 × 10⁸ CFUs of Staphylococcus aureus. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. The statistical significance of HlaHRE compared to each vaccine condition specified by color is particularly noted. Figure 5D shows the serum dilutions from mice in Figures 5B and C that provide 50% protection (IC50) against rRBC lysis when exposed to 0.8 pM recombinant Hla. Figure 5E shows the correlation between serum dilutions that provide 50% protection against Hla-mediated (0.8 pM) rRBC lysis and anti-Hla titers from immunized mice. Figures 5F-5H show that the HlaHRE vaccine amplifies protective immunity against Staphylococcus aureus infection independently of vaccine adjuvants. Mice received a priming vaccine at 48 hours after birth and a booster vaccine at weaning, then were infected with a primary infection at 5-6 weeks of age, followed by reinfection on the contralateral flank at 21 days as shown.Figure 5F shows data of skin abscess (left) and skin necrosis (right) areas after reinfection of mice immunized with AddaS03 and Hla polypeptide via subcutaneous delivery of 1 × 10⁸ CFUs of Staphylococcus aureus USA300 / LAC strain. Mice were immunized with each of the following Hla variant vaccines: HlaH (purple), HlaHDY (orange), HlaHRE (blue), or adjuvant-only control (black). Figure 5G shows data of skin abscess (left) and skin necrosis (right) areas after reinfection of mice immunized with MPLA + alum and Hla polypeptide via subcutaneous delivery of 1 × 10⁸ CFUs of Staphylococcus aureus USA300 / LAC strain. Mice were immunized with each of the following Hla variant vaccines: HlaH (purple), HlaHDY (orange), HlaHRE (blue), or adjuvant-only control (black). Figure 5H provides data on the area of skin abscesses (left) and skin necrosis (right) after reinfection of mice immunized with CpG-ODN1585 and Hla polypeptide via subcutaneous delivery of 1 × 10⁸ CFUs of Staphylococcus aureus USA300 / LAC strain. Mice were immunized with each of the following Hla variant vaccines: HlaH (purple), HlaHDY (orange), HlaHRE (blue), or adjuvant-only control (black). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, statistical significance of HlaHRE compared to each vaccine condition specified by color in the legend, calculated by two-way ANOVA and Tukey's test for multiple comparisons. [Figure 6]Figures 6A–6K show that HlaHRE amplifies host TFH and confers enhanced protective immunity. Figure 6A shows serum dilutions from immunized mice that provide 50% protection against rRBC lysis (IC50) when exposed to 0.8 pM recombinant Hla (serum collected 1 or 3 weeks after boost). Figure 6B shows an analysis of serum-mediated neutralization of Hla binding to rRBCs, comparing immunized sera collected from mice 1 week after boost vaccination. Figure 6C provides a concentration-measuring analysis of Hla oligomer formation on rRBCs, comparing immunized sera from mice in Figures 6A and 6B. Figure 6D provides an analysis of inguinal germinal center cells 1 week after mouse immunization with either HlaH vaccine or HlaHRE vaccine, comparing the median fluorescence intensity (MFI) of GL7+Fas+B on CD4+ T cells. Figure 6E provides an analysis of inguinal germinal center cells one week after mouse immunization with either the HlaH vaccine or the HlaHRE vaccine, comparing the median fluorescence intensity (MFI) of Ki67+GL7+Fas+ B cells on CD4+ T cells. Figure 6F provides an analysis of inguinal germinal center cells one week after mouse immunization with either the HlaH vaccine or the HlaHRE vaccine, comparing the median fluorescence intensity (MFI) of CD4+ T cells on CD4+ T cells. Figure 6H provides an analysis of inguinal germinal center cells one week after mouse immunization with either the HlaH vaccine or the HlaHRE vaccine, comparing the median fluorescence intensity (MFI) of CXCR5 on CD4+ T cells. Figure 6I provides photographs showing macroscopic findings of skin lesions in multiple groups of mice two days after secondary infection with Staphylococcus aureus. Figure 6J provides an analysis of the CXCR5hiBcl6+ TFH cell compartment in mice. Figure 6K provides an analysis of the CXCR5hiBcl6+ TFH cell compartment in mice subjected to primary infection with wild-type (WT) Staphylococcus aureus, a Δhla isogenic mutant, or a Δhla mutant (Δhla::phla) complemented by a plasmid enabling restoration of Hla expression. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Figures 6L-M show that maternal antibody protection is attenuated 16 weeks after vaccination with HlaHRE.Figure 6L provides flow cytometry data of TFH cell populations marked CXCR5+ICOS+PD1+, generated in response to reinfection of immune mice with 1 × 10⁸ Staphylococcus aureus cells. Figure 6M provides flow cytometry data of TFH populations generated after infection of mice with 1 × 10⁸ Staphylococcus aureus USA300 / LAC cells or their Δhla isogenic variants. [Figure 7]Figures 7A–7G demonstrate that the HlaHRE vaccine remains effective both after maternal vaccination against Staphylococcus aureus SSTI infection and before exposure. Figure 7A is a schematic diagram showing the timeline of neonatal vaccination and SSTI modeling. Figure 7B provides a graph showing the area of skin abscesses (left) and skin necrosis (right) in mice (4–8 mice per group) after primary infection with 1 × 10⁸ CFUs of Staphylococcus aureus. Mice were born from mother mice that received either alum or alum-HlaHRE vaccine; the offspring mice were either unimmunized (black and blue, respectively), alum-immunized (gray), or alum-HlaHRE-immunized (green). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, the statistical significance of maternal immunization with alum compared to each vaccine condition specified by color is specifically noted. Figure 7C shows serum dilutions from the mice in Figure 7B that provide 50% protection (IC50) against rRBC lysis when exposed to 0.8 pM recombinant Hla. Figure 7D is a pre-exposure schematic diagram showing the timeline of primary infection, immunization schedule, and secondary infection in young mice. Figure 7E provides a graph showing the area of skin abscesses (left) and skin necrosis (right) in mice (13-14 mice per group) after secondary infection with 1 × 10⁸ CFU of Staphylococcus aureus. Figure 7F shows serum dilutions from the mice in Figure 7E that provide 50% protection (IC50) against rRBC lysis when exposed to 0.8 pM recombinant Hla. Figure 7G provides serum dilutions that provide 50% protection against rRBC lysis (IC50) when exposed to 0.8 pM recombinant Hla under the conditions of alum (black) or alum-HlaHRE (blue) (designated as φ) without subsequent active immunization of offspring, or with maternal immunization with alum or alum-HlaHRE followed by subsequent active immunization of offspring with alum-HlaHRE (gray and green, respectively). Maternal antibody lifetime was analyzed from pre-infection serum collected at 6, 8, 10, and 16 weeks. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001, calculated by one-way ANOVA and Tukey's test for multiple comparisons. [Figure 8]Figures 8A–8E demonstrate the efficacy of HlaHRE vaccination in separate biological settings. Figure 8A provides a graph showing the area of skin abscesses (left) and skin necrosis (right) after infection in female mice (6–8 mice per group) immunized with 1 × 10⁸ CFUs of Staphylococcus aureus. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Figure 8B provides serum dilutions from the mice in Figure 8A that provide 50% protection (IC50) against rRBC lysis when exposed to 0.8 pM recombinant Hla. Figure 8C is a schematic diagram of the juvenile vaccination schedule and SSTI infection. Figure 8D provides a graph showing the area of skin abscesses (left) and skin necrosis (right) after infection in juvenile mice (10 mice per group) immunized with 1 × 10⁸ CFUs of Staphylococcus aureus. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Figure 8E provides serum dilutions from mice in Figure 8D that provide 50% protection (IC50) against rRBC lysis when exposed to 0.8 pM recombinant Hla. [Figure 9] Figures 9A–9D demonstrate that the HlaHRE vaccine remains effective against Staphylococcus aureus SSTI infection and that adjuvant formulations exhibit different TFH responses. Figure 9A provides a graph showing the area of skin abscesses (left) and skin necrosis (right) in mice (4–8 mice per group) after infection with 1 × 10⁸ CFUs of Staphylococcus aureus. *p<0.05, **p<0.01, the statistical significance of the histidine-tagged vaccine compared to the untagged HlaHRE vaccine is particularly noted. Figure 9B shows the serum dilutions from the mice in Figure 9A that provide 50% protection (IC50) against rRBC lysis when exposed to 0.8 pM recombinant Hla. Figure 9C is a graph showing the inverse correlation between TFH cell recovery rate and clinical abscess size from mice after Staphylococcus aureus SSTI infection. Figure 9D is a graph showing the direct correlation between anti-Hla neutralization IC50 and TFH response from mice after Staphylococcus aureus SSTI infection. [Modes for carrying out the invention]
[0014] The drawings in this specification do not limit the concepts of the present invention to specific embodiments disclosed and described herein. The drawings are not necessarily to scale and instead focus on clearly illustrating the principles of certain embodiments of the concepts of the present invention.
[0015] The following embodiments for carrying out the inventions refer to the accompanying drawings illustrating various aspects of the disclosure. The drawings and description are intended to illustrate aspects of the disclosure in sufficient detail so that those skilled in the art can practice the disclosure. Other components may be used and modified without departing from the scope of the disclosure. Therefore, the following description should not be construed as restrictive.
[0016] This disclosure is partly based on the remarkable discovery that certain rationally designed modifications in the context of detoxified α-hemolysin (Hla) antigens previously characterized as having impaired pore formation ability can effectively activate germinal center (GC) cell responses and follicular helper T (TFH) cell responses, thereby achieving long-term immunity against Staphylococcus aureus. Several pore formation mutations in Hla have been previously characterized, and a detailed description of these mutants and the efficacy of antigenic Hla containing these mutations can be found in PCT / US2020 / 066463, the entirety of which is incorporated herein by reference. Through diligent experimentation and thoughtful design, this disclosure provides a substitutional mutation in the context of detoxified α-hemolysin (Hla) previously characterized as having a substitution at the H35 position, which results in robust immunological defense coupled with a significant improvement in the functional neutralization response. H35L It was highly unexpected that the two amino acid substitutions R66C and E70C in Hla would significantly alter the vaccine outcomes. These modifications (Hla H35L / R66C / E70C, hereafter referred to as Hla H35L / R66C / E70C) HREThe mutants (referred to as ) function better than those previously characterized as vaccines. The data presented herein demonstrate that these modifications impact the GC and TFH responses. The GC is a specialized ultrastructure that forms in secondary lymphoid tissue and is known to supply long-lived antibody-secreting plasma cells and memory B cells, thus inducing defense against reinfection. GC formation is critically dependent on TFH cells. In the GC, B cells undergo somatic mutations in the genes encoding their B cell receptors, and following favorable selection, this mutation can lead to the emergence of B cell clones that bind to antigens (e.g., Hla) with high affinity. In the context of Hla, high-affinity antibodies may neutralize the antigen.
[0017] Staphylococcal α-hemolysin (Hla or α-toxin) is one of the earliest members of the β-barrel toxin family responsible for bacterial membrane pore formation. Its structural gene, hla, is located on the chromosome of all Staphylococcus aureus strains studied and encodes a precursor polypeptide consisting of 319 amino acids. This polypeptide is secreted as a 293-residue water-soluble monomer (the amino acid sequence provided in SEQ ID NO: 1 – the mature Hla sequence). Studies of genetic variation in clinical isolates have indicated remarkable conservation of Hla across strains, both at the nucleotide and protein levels. Hla is thought to associate with surface receptors in susceptible host cells, thereby promoting its oligomerization into heptameric prepores and the insertion of a 2 nm pore-sized β-barrel structure into the plasma membrane. Hla pores are formed in lymphocytes, macrophages, alveolar epithelial cells, pulmonary endothelium, and erythrocytes; however, granulocytes and fibroblasts appear to be less susceptible to overt lysis. Droplet injection of purified Hla into rabbit or rat lung tissue induces vascular leakage and pulmonary hypertension, which has been attributed to the release of several signaling molecules, such as phosphatidylinositol, nitric oxide, prostanoids (PGE2, PGI2), and thromboxane A2. Consistent with the biochemical properties of Hla, mutations that suppress Hla expression in Staphylococcus aureus significantly attenuate the pathogenicity of the bacterium in mouse pneumonia models, skin infection models, and sepsis models.
[0018] Hla utilizes ADAM10 as a cell receptor to inflict cytolytic damage and initiate ADAM10-mediated invasion of target cells. While Hla is not necessary for the survival of Staphylococcus aureus, this toxin is essential for the pathogenesis of severe skin infections, pneumonia, sepsis, peritonitis, corneal infections, and central nervous system infections in animal models. Due to the tissue affinity of Hla, which is a result of the nearly universal cellular expression of ADAM10, this single toxin has become a very widely used pathogenic factor in the molecular pathogenesis of Staphylococcus aureus diseases and an outstanding vaccine candidate. However, for it to be effective as a vaccine, Hla must be detoxified so that it cannot form pores, because membrane pore formation is inherently damaging to host cells.
[0019] In some embodiments, the Disclosure provides compositions comprising a polypeptide having an amino acid sequence corresponding to an attenuated Hla polypeptide or an immunogenic variant, derivative, or fragment thereof, or a polynucleotide encoding such a polypeptide, as well as methods for producing and using such compositions to provide long-lasting protection against infection by Staphylococcus aureus and other related bacteria.
[0020] I. Composition Modified Hla polypeptides and derivatives In some embodiments, the disclosure includes modified α-hemolysin (Hla) polypeptides, derivatives, or fragments thereof, comprising a histidine amino acid substitution at position 35 relative to SEQ ID NO: 1, wherein position 35 is substituted with any other amino acid that results in suppression of functional pore formation by destabilizing the heptameric structure (provided in SEQ ID NO: 3, where X is any amino acid); and substituted with at least one amino acid substitution R66C or E70C relative to SEQ ID NO: 1. In one embodiment, the modified Hla polypeptide comprises the amino acid substitutions H35L, R66C, and E70C relative to SEQ ID NO: 1 (hereinafter referred to as Hla HRE (This is referred to as [modified Hla polypeptide]). For example, the modified Hla polypeptide includes the sequence described in Sequence ID No. 11, or a derivative or fragment thereof.
[0021] Modified Hla polypeptides may contain amino acid substitutions H35X and R66C, or H35X and E70C. Modified Hla polypeptides may contain amino acid substitutions H35L and R66C, or H35L and E70C. Modified Hla polypeptides may contain amino acid substitutions H35X, R66C, and E70C. Modified Hla polypeptides may contain amino acid substitutions H35L, R66C, and E70C. The modified Hla polypeptide may contain the amino acid sequence described in any one of SEQ ID NOs: 8-11, or a sequence that is at least about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical thereto, or a derivative or fragment thereof.
[0022] A modified Hla polypeptide may further include one or more modifications to the amino acid sequence described in SEQ ID NO: 11. Thus, a modified Hla polypeptide may include the amino acid sequence described in any one of SEQ ID NOs: 12-35, or a derivative or fragment thereof. In some embodiments, the present disclosure includes polypeptides, derivatives or fragments thereof, that have an amino acid sequence that is at least about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical to the amino acid sequence described in any one of SEQ ID NOs: 12-35.
[0023] Furthermore, derivatives or fragments of modified Hla polypeptides are also intended herein. The terms “derivative,” “mutant,” and “fragment,” when used herein in relation to a polypeptide, refer to a polypeptide related to the modified Hla polypeptide disclosed herein by any of the following: amino acid sequence, structure (e.g., secondary and / or tertiary), activity (e.g., enzymatic activity), and / or function. Derivatives, mutants, and fragments of the polypeptide may include one or more amino acid variations (e.g., mutations, insertions, and deletions), shortening, modification, or combinations thereof compared to the wild-type polypeptide. Individual residues may be deleted, or several consecutive amino acids may be deleted. Shortened proteins can be produced by introducing (by substitution or insertion) a stop codon into the coding nucleic acid sequence. Insertion mutants typically involve the addition of a substance at a non-terminal site in the polypeptide. This may include the insertion of one or more residues. Additions to the terminals can also be produced, which are called fusion proteins. Substitutional mutants or derivatives typically involve the exchange of one amino acid for another at one or more sites within a protein and can be designed to modulate one or more properties of a polypeptide, with or without loss of other disclosed functions or properties. The substitution may be conservative, i.e., one amino acid is replaced with one of similar shape and charge. Conservative substitutions are well known in the art and include, for example: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartic acid to glutamic acid; cysteine to serine; glutamine to asparagine; glutamic acid to aspartic acid; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and the substitution of valine to isoleucine or leucine.Alternatively, substitutions may be non-conservative, resulting in an impact on the function or activity of the polypeptide. Non-conservative changes typically involve substituting a residue with a chemically dissimilar one, such as a polar or charged amino acid with a nonpolar or uncharged amino acid, or vice versa.
[0024] The sizes of Hla proteins or polypeptides (wild-type or modified) are linear, with the following ranges being 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 pieces, 72 pieces, 73 pieces, 74 pieces, 75 pieces, 76 pieces, 77 pieces, 78 pieces, 79 pieces, 80 pieces, 81 pieces, 82 pieces, 83 pieces, 84 pieces, 85 pieces, 86 pieces, 87 pieces, 88 pieces, 89 pieces, 90 pieces, 91 pieces, 92 pieces, 93 pieces, 94 pieces, 95 pieces, 96 pieces, 97 pieces, 98 pieces, 99 pieces, 100 pieces, 105 pieces, 110 pieces, 115 pieces, 120 pieces, 125 pieces, 130 pieces, 135 pieces, 140 pieces, 145 pieces, 150 pieces, 155 pieces, 160 pieces, 165 pieces, 170 pieces , 175 pieces, 180 pieces, 185 pieces, 190 pieces, 195 pieces, 200 pieces, 205 pieces, 210 pieces, 215 pieces, 220 pieces, 225 pieces, 230 pieces, 235 pieces, 240 pieces, 245 pieces, 250 pieces, 255 pieces, 260 pieces, 265 pieces, 270 pieces, 275 pieces, 280 pieces, 285 pieces, 290 pieces, 300 pieces, 325 pieces, 350 pieces, 375 pieces, 400 pieces, 425 pieces, 450 pieces, 475 pieces, 500 pieces, 525 pieces, 550 pieces, 575 pieces, 600 pieces, 62 This may include 5, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 975, 1000, 1100, 1200, 1300, 1400, 1500, 1750, 2000, 2250, 2500 or more amino acids, and any range derivable therefrom, or derivatives thereof. It is also conceivable that polypeptides may be mutated by shortening, resulting in a polypeptide being shorter than its corresponding wild-type form, and that polypeptides may be altered by fusing or conjugating them with heterologous protein sequences having specific functions (e.g., for targeting or localization, for enhancing immunogenicity, for purification purposes, etc.). The modified Hla polypeptide fragments are 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 of the polypeptide disclosed herein.21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 5 2, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83 1, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235236 pieces, 237 pieces, 238 pieces, 239 pieces, 240 pieces, 241 pieces, 242 pieces, 235 pieces, 236 pieces, 237 pieces, 238 pieces, 239 pieces, 240 pieces, 241 pieces, 242 pieces, 243 pieces, 244 pieces, 245 pieces , 246 pieces, 247 pieces, 248 pieces, 249 pieces, 250 pieces, 251 pieces, 252 pieces, 253 pieces, 254 pieces, 255 pieces, 256 pieces, 257 pieces, 258 pieces, 259 pieces, 260 pieces, 261 pieces, 262 pieces, 263 It may contain 1, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293 or more consecutive amino acids. The modified Hla polypeptide according to this disclosure may be a single domain of Hla or multiple domains of Hla attached by a linker polypeptide.
[0025] The modified Hla polypeptides of this disclosure may further contain amino molecules or non-amino acids to form proteinaceous compositions. As used herein, “amino molecule” means any amino acid, amino acid derivative, or amino acid mimetic known in the art. In certain embodiments, the residues of the proteinaceous molecule are continuous, and the non-amino molecules do not interrupt the sequence of amino molecule residues at all. In other embodiments, the sequence may contain one or more non-amino molecule moieties. In certain embodiments, the sequence of residues of the proteinaceous molecule may be interrupted by one or more non-amino molecule moieties. Accordingly, the term “proteinaceous composition” encompasses amino molecule sequences containing at least one of the 20 common amino acids of naturally synthesized proteins, or at least one modified or unusual amino acid. Accordingly, the term “proteinaceous composition” encompasses amino molecule sequences containing at least one of the 20 common amino acids of naturally synthesized proteins, or at least one modified or unusual amino acid. Protein compositions can be prepared by any technique known to those skilled in the art, including (i) expression of proteins, polypeptides, or peptides by standard molecular biological techniques, (ii) isolation of protein compounds from natural or recombinant sources [e.g., Escherichia coli, insect cells, or yeast], or (iii) chemical synthesis of protein materials. Nucleotide sequences for various genes, as well as the sequences of proteins, polypeptides, and peptides, have been previously disclosed and can be found in recognized computerized databases. One such database is the Genbank and GenPept databases of the National Center for Biotechnology Information. The coding regions of these genes can be amplified and / or expressed using techniques disclosed herein or that would be known to those skilled in the art.
[0026] Hla amino acid sequence variants are intended, and these can be substitution, insertion, or deletion variants. Modifications in the polypeptides of this disclosure, compared to the wild type, result in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52 of the above polypeptides. , 53 pieces, 54 pieces, 55 pieces, 56 pieces, 57 pieces, 58 pieces, 59 pieces, 60 pieces, 61 pieces, 62 pieces, 63 pieces, 64 pieces, 65 pieces, 66 pieces, 67 pieces, 68 pieces, 69 pieces, 70 pieces, 71 pieces, 72 pieces, 73 pieces, 74 pieces, 75 pieces, 76 pieces, 77 pieces, 78 pieces, 79 pieces, 80 pieces, 81 pieces, 8 2 pieces, 83 pieces, 84 pieces, 85 pieces, 86 pieces, 87 pieces, 88 pieces, 89 pieces, 90 pieces, 91 pieces, 92 pieces, 93 pieces, 94 pieces, 95 pieces, 96 pieces, 97 pieces, 98 pieces, 99 pieces, 100 pieces, 100 pieces, 101 pieces, 102 pieces, 103 pieces, 104 pieces, 105 pieces, 106 pieces, 107 pieces, 10 8 pieces, 109 pieces, 110 pieces, 111 pieces, 112 pieces, 113 pieces, 114 pieces, 115 pieces, 116 pieces, 117 pieces, 118 pieces, 119 pieces, 1 20 pieces, 121 pieces, 122 pieces, 123 pieces, 124 pieces, 125 pieces, 126 pieces, 127 pieces, 128 pieces, 129 pieces, 130 pieces, 131 pieces, 132 pieces, 133 pieces, 134 pieces, 135 pieces, 136 pieces, 137 pieces, 138 pieces, 139 pieces, 140 pieces, 141 pieces, 142 pieces, 143 pieces , 144 pieces, 145 pieces, 146 pieces, 147 pieces, 148 pieces, 149 pieces, 150 pieces, 151 pieces, 152 pieces, 153 pieces, 154 pieces, 155 pieces, 156 pieces, 157 pieces, 158 pieces, 159 pieces, 160 pieces, 161 pieces, 162 pieces, 163 pieces, 164 pieces, 165 pieces, 166 pieces, 16 7 pieces, 168 pieces, 169 pieces, 170 pieces, 171 pieces, 172 pieces, 173 pieces, 174 pieces, 175 pieces, 176 pieces, 177 pieces, 178 pieces, 1 79 pieces, 180 pieces, 181 pieces, 182 pieces, 183 pieces, 184 pieces, 185 pieces, 186 pieces, 187 pieces, 188 pieces, 189 pieces, 190 pieces, 191 pieces, 192 pieces, 193 pieces, 194 pieces, 195 pieces, 196 pieces, 197 pieces, 198 pieces, 199 pieces, 200 pieces, 201 pieces, 202 pieces,203 pieces, 204 pieces, 205 pieces, 206 pieces, 207 pieces, 208 pieces, 209 pieces, 210 pieces, 211 pieces, 212 pieces, 213 pieces, 214 pieces, 215 pieces, 2 16 pieces, 217 pieces, 218 pieces, 219 pieces, 220 pieces, 221 pieces, 222 pieces, 223 pieces, 224 pieces, 225 pieces, 226 pieces, 227 pieces, 228 pieces, 229 pieces, 230 pieces, 231 pieces, 232 pieces, 233 pieces, 234 pieces, 235 pieces, 236 pieces, 237 pieces, 238 pieces, 239 pieces, 240 pieces, 241 pieces, 242 pieces, 235 pieces, 236 pieces, 237 pieces, 238 pieces, 239 pieces, 240 pieces, 241 pieces, 242 pieces, 243 pieces, 244 pieces, 245 pieces, 246 pieces, 247 pieces, 24 It can affect 8, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, or more discontinuous or consecutive amino acids. Hla polypeptides derived from any Staphylococcus species and strains are intended for use in the methods of this disclosure.
[0027] Mutants typically lack one or more residues from the native or wild-type protein. This could be a deletion of individual residues or a sequence of amino acids. A truncated protein can be produced by introducing a stop codon into the encoding nucleic acid sequence (by substitution or insertion). Insertion mutants usually involve the addition of substance at the non-terminal end of the polypeptide. This can include the insertion of one or more residues. Additions to the terminals can also produce what are called fusion proteins.
[0028] The proteins of this disclosure may be recombinant and may be synthesized in vivo or in vitro. Alternatively, the recombinant proteins (modified Hla polypeptides) of this disclosure may be isolated from bacteria. It is also conceivable that bacteria containing such variants may be used in the compositions and methods of this disclosure. As a result, it is not necessary for certain proteins to be isolated.
[0029] This disclosure also provides recombinant polynucleotides encoding the proteins, polypeptides, and peptides of this disclosure. The nucleic acid sequence of wild-type Hla is described in SEQ ID NO: 2, and nucleic acid sequences encoding any Hla variant or modified Hla polypeptide disclosed herein are also intended. Methods for generating polynucleotide sequences encoding the polypeptides of this disclosure are known in the art and are described further below herein.
[0030] Polynucleotides This specification discloses polynucleotide sequences comprising nucleic acid sequences encoding modified Hla polypeptides or derivatives or fragments thereof disclosed herein.
[0031] Polynucleotides may include amino acid sequences containing any one of the sequences described in SEQ ID NOs: 6-11, or fragments thereof or derivatives thereof, or nucleic acid sequences encoding amino acid sequences that are approximately 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or approximately 100% identical thereto.
[0032] As used in this application, the term “polynucleotide” refers to a nucleic acid molecule that is either recombinant or isolated without whole genome nucleic acid. The term “polynucleotide” includes oligonucleotides, recombinant vectors, such as plasmids, cosmids, phages, viruses, and virus-like particles (VLPs). This disclosure provides isolated nucleic acid segments and recombinant vectors which contain within their sequences any one of SEQ ID NOs. 6-35, or fragments thereof or derivatives thereof, or consecutive nucleic acid sequences encoding amino acid sequences that are approximately 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or approximately 100% identical to them. In certain embodiments, polynucleotides may further include regulatory sequences isolated substantially apart from their naturally occurring gene- or protein-coding sequences. Polynucleotides can be RNA, DNA, their analogues, or combinations thereof.
[0033] In this context, the terms “gene,” “polynucleotide,” or “nucleic acid” are used to refer to nucleic acids that encode proteins, polypeptides, or peptides (including any sequences required for proper transcription, post-translational modification, or localization). As will be understood by those skilled in the art, these terms encompass genomic sequences, expression cassettes, cDNA sequences, and smaller, manipulated nucleic acid segments that can express or be configured to express proteins, polypeptides, domains, peptides, fusion proteins, and mutants.A nucleic acid encoding all or part of a polypeptide may contain a sequence of nucleic acids of the following lengths that encode all or part of such polypeptide: 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250 , 260 pieces, 270 pieces, 280 pieces, 290 pieces, 300 pieces, 310 pieces, 320 pieces, 330 pieces, 340 pieces, 350 pieces, 360 pieces, 370 pieces, 380 pieces, 390 pieces, 400 pieces, 410 pieces, 420 pieces, 430 pieces, 440 pieces , 441 pieces, 450 pieces, 460 pieces, 470 pieces, 480 pieces, 490 pieces, 500 pieces, 510 pieces, 520 pieces, 530 pieces, 540 pieces, 550 pieces, 560 pieces, 570 pieces, 580 pieces, 590 pieces, 600 pieces, 610 pieces, 620 pieces, 630 pieces, 640 pieces, 650 pieces, 660 pieces, 670 pieces, 680 pieces, 690 pieces, 700 pieces, 710 pieces, 720 pieces, 730 pieces, 740 pieces, 750 pieces, 760 pieces, 770 pieces, 780 pieces, 790 pieces, 800 pieces, 810 pieces, 820 pieces, 830 pieces, 840 pieces, 850 pieces, 860 pieces, 870 pieces, 880 pieces, 890 pieces, 900 pieces, 910 pieces, 920 pieces, 930 pieces, 940 pieces, 950 pieces, 960 pieces, 970 pieces, 980 pieces, 990 pieces, 1000 pieces, 10¹⁰, 10²⁰, 10³⁰, 10⁴⁰, 10⁵⁰, 10⁶⁰, 10⁷⁰, 10⁹⁰, 10⁹⁰, 10⁹⁰, 11⁰⁰, 15⁰⁰, 20⁰⁰, 25⁰⁰, 30⁰⁰, 35⁰⁰, 40⁰⁰, 45⁰⁰, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 9000, 10000 or more nucleotides, nucleosides, or base pairs. It is also intended that a particular polypeptide from a given species may be encoded by nucleic acids containing native mutations, which have slightly different nucleic acid sequences but still encode the same or substantially similar proteins.
[0034] In some embodiments, the Disclosure provides isolated nucleic acid segments and recombinant vectors incorporating nucleic acid sequences encoding the modified Hla polypeptide of the Disclosure, or any variant or fragment thereof provided herein. Thus, an isolated nucleic acid segment or a vector containing a nucleic acid segment may encode, for example, a modified Hla polypeptide that includes an H35X substitution, an R66C substitution, or an E70C substitution where X is any suitable amino acid, and is immunogenic. In some embodiments, an isolated nucleic acid segment or a vector containing a nucleic acid segment may encode, for example, an Hla(H35L) polypeptide that includes an R66C substitution or an E70C substitution and is immunogenic.
[0035] The term “recombinant” may be used in conjunction with a polypeptide or a specific polypeptide name, but it refers as a polypeptide as a whole that has been manipulated in vitro or is a polypeptide produced from a nucleic acid molecule that is a replication product of such a molecule. In other embodiments, the disclosure relates to isolated nucleic acid segments and recombinant vectors incorporating nucleic acid sequences encoding modified Hla polypeptides that can be used to produce an immune response in a subject. In various embodiments, the nucleic acids of the disclosure can be used in gene vaccines.
[0036] The nucleic acid segments used in this disclosure can be combined with other nucleic acid sequences, such as promoters, polyadenylation signals, further restriction enzyme sites, multicloning sites, and other coding segments, regardless of the length of the coding sequence itself, and as a result, their overall length may vary considerably. Therefore, nucleic acid fragments of almost any length can be used, but in this case, it is intended that their overall length is preferably limited by ease of preparation and intended use in recombinant nucleic acid protocols. In some cases, the nucleic acid sequence can encode a polypeptide sequence having further heterologous coding sequences to enable, for example, the purification, transport, secretion, or post-translational modification of the polypeptide, or to enable therapeutic effects such as targeting or efficacy. As discussed above, tags or other heterologous polypeptides can be attached to the sequence encoding the modified polypeptide, where “heterologous” means a polypeptide that is not the same as the modified polypeptide.
[0037] In some embodiments, the nucleic acids used in this disclosure encode modified Hla polypeptides, derivatives, or fragments thereof disclosed herein. Such sequences may arise as a result of codon duplication and functional equivalence known to occur naturally within nucleic acid sequences and, consequently, within the encoded proteins. Alternatively, functionally equivalent proteins or peptides can also be produced through the application of recombinant DNA technology, in which case changes in protein structure can be manipulated based on considerations of the properties of the exchanged amino acids. Human-designed changes can be introduced, for example, through the application of site-directed mutagenesis techniques to introduce improvements in the antigenicity of proteins.
[0038] In some embodiments, the term “functionally equivalent codons” is used herein to refer to codons encoding the same amino acid, such as the six codons for arginine or serine, and similarly to codons encoding biologically equivalent amino acids. It will also be understood that amino acid sequences and nucleic acid sequences may, each including additional residues such as an additional N-terminal or C-terminal amino acid, or a 5' or 3' sequence, still remain essentially as described in one of the sequences disclosed herein, provided that the sequence meets the above criteria, including the maintenance of biological protein activity when protein expression is involved. The addition of terminal sequences applies particularly to nucleic acid sequences, which may include, for example, various non-coding sequences adjacent to either the 5' or 3' portion of the coding region.
[0039] The following is a consideration based on altering the amino acids in a protein to create equivalent, or even improved, second-generation molecules. For example, certain amino acids can be substituted for other amino acids in a protein structure without significantly losing their interactive binding ability to structures such as the antigen-binding region of an antibody or a binding site on a substrate molecule. Since the interactive capabilities and properties of a protein determine its biological functional activity, it is possible to induce specific amino acid substitutions in the amino acid sequence and its underlying DNA coding sequence, yet still produce proteins with similar properties. Thus, the inventors also intend to enable various changes to be made in the DNA sequence of a gene or nucleic acid without significantly losing its biological utility or activity.
[0040] In certain aspects, the Disclosure includes isolated polynucleotides, plasmids, viruses, virus-like particles (VLPs), viral vectors, cosmids, and phages that contain nucleic acid sequences encoding polypeptides, derivatives, or fragments thereof that are at least about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identical to any of Sequence IDs 6-35.
[0041] Nucleic acid sequences encoding the modified Hla polypeptides relating to this disclosure can be operably ligated to one or more regulatory sequences. "Operatably ligated" means juxtaposed sequences that may be related in a way that enables them to function in the manner they are intended. The operably ligated regulatory sequences to the encoding sequence are performed under conditions compatible with the regulatory sequences. As used herein, a regulatory sequence means a nucleic acid sequence that modulates the expression of an operably ligated nucleic acid sequence. A regulatory sequence is operably ligated to a nucleic acid sequence when it controls and modulates the transcription and, where appropriate, translation of the nucleic acid sequence. Thus, regulatory sequences may include appropriate promoters, enhancers, transcriptional terminators, start codons (i.e., ATGs) immediately preceding a protein-coding gene, intron splicing signals, and maintenance of the correct reading frame of a gene to enable accurate mRNA translation, as well as stop codons. The term "regulatory sequence" is intended to include, at a minimum, components whose presence can influence expression, and may also include further components whose presence is advantageous, such as leader sequences and fusion partner sequences. Expression regulatory sequences may include promoters.
[0042] In some embodiments, vectors containing nucleic acid sequences encoding modified Hla can be plasmids, cosmids, yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), viral vectors, or bacteriophages. The vectors can provide replication of the modified Hla polypeptide polynucleotide sequence, expression of the Hla polypeptide, or integration of the Hla nucleic acid into the chromosomes of host cells. The choice of vector depends on the desired purpose. Certain cloning vectors are useful for cloning, mutation, and manipulation of Hla nucleic acid. Other vectors are useful for Hla polypeptide expression, allowing for large-scale expression of the polypeptide for purification purposes, or for time-specific or tissue-specific expression of the Hla polypeptide. Vectors can also be selected based on host cells to facilitate expression in, for example, bacterial, mammalian, insect, fish (e.g., zebrafish), and / or amphibian cells. The selection of a suitable vector for a host cell will be apparent to those skilled in the art, and host cell types will be discussed below. Many vectors or vector systems are commercially available, such as the pET bacterial expression system (Invitrogen®, Carlsbad Calif.).
[0043] The vectors disclosed herein may be viral vectors or non-viral vectors. For example, as discussed above, the vectors of this disclosure may be viral vectors. There are several compositions and methods that can be used to deliver nucleic acids to cells either in vitro or in vivo. These methods and compositions can be broadly classified into two classes: virus-based delivery systems and non-viral-based delivery systems. For example, nucleic acids can be delivered through several direct delivery systems, such as electroporation, lipofection, calcium phosphate precipitation, plasmids, viral vectors, viral nucleic acids, phage nucleic acids, phages, cosmids, or through the transfer of genetic material into cells or carriers, such as cationic liposomes. Suitable means of transfection, including viral vectors, chemical transfectants, or physicomechanical methods such as electroporation and direct diffusion of DNA, are described, for example, by Wolff, JA, et al., Science, 247, 1465-1468, (1990); and Wolff, JA, Nature, 352, 815-818, (1991). Such methods are well known in the art and are readily adaptable for use with the compositions and methods described herein. In certain cases, the methods are modified to function specifically with macroDNA molecules. Furthermore, these methods can be used to target certain neurodegenerative diseases or disorders and cell populations by utilizing the target-directing properties of the carrier.
[0044] Vectors can contain a variety of components, including, but are not limited to, replication origins, one or more markers or select genes (e.g., GFP, neo), promoters, enhancers, terminators, polyadenylation sequences, repressors, or activators. Such elements are supplied into the vector so as to be operably ligated to the coding region of the nucleic acid encoding Flla, thereby facilitating expression in the host cell of interest. Cloning vectors and expression vectors may contain replication origins that enable the vector to replicate in the host cell. Vectors may also contain select markers, for example, to confer resistance to drugs or to complement growth failure. Examples of drug resistance markers include, but are not limited to, ampicillin, tetracycline, neomycin, or methotrexate. Examples of other marker genes may be fluorescent polypeptides, such as one of the members of the fluorescent family of proteins, e.g., GFP, YFP, BFP, RFP, etc. These markers may be contained on the same vector as the gene of interest, or they may be on separate vectors and transfected simultaneously with the vector containing the gene of interest.
[0045] The vector may contain a promoter suitable for Hla expression in mammalian cells, and this promoter can be operably linked to result in inductive or constitutive expression of the modified Hla polypeptide of this disclosure. Exemplary inductive promoters include, for example, the metallothionine promoter or the ecdysone-responsive promoter. Exemplary constitutive promoters include, for example, viral promoters derived from cytomegalovirus (CMV), Rous sarcoma virus (RSV), Simian virus 40 (SV40), aerosarcoma virus, the beta-actin promoter, and the heat shock promoter. The promoter may be selected based on its tissue specificity. A particular promoter may be expressed only in a specific tissue, and if it is desirable to express the target polypeptide only in selected tissues, one of these promoters can be used. The selection of promoters will be obvious to those skilled in the art with respect to the desired host cell system.
[0046] Vectors encoding modified Hla polypeptides can be viral vectors. Examples of viral vectors include retroviral vectors such as adenoviruses, adeno-associated viruses (AAVs), Simian virus 40 (SV40), cytomegalovirus (CMV), Moloney's mouse leukemia virus (MoMuLv), Roussarcoma virus (RSV), lentiviruses, herpesviruses, poxviruses, and vaccinia viruses. Viral vectors can be used to facilitate expression in target cells, for example, for the production of modified Hla polypeptides or for therapeutic use (e.g., to deliver modified Hla polypeptides to targets by expression from the vector). When used for therapeutic purposes, Hla-encoding vectors (e.g., viral vectors) may be administered directly to the patient via an appropriate route, or they may be administered using ex vivo strategies with target cells (autologous) or allogeneic cells, which are suitable for administration to patients being treated. In some embodiments, vectors encoding modified Hla polypeptides may be virus-like particles or VLPs. The term VLP, while commonly used in this art, refers to small particles containing specific proteins derived from the viral exoskeleton. These virus-like particles contain no viral genetic material whatsoever and pose no risk of infection.
[0047] As used herein, plasmid vectors or viral vectors are activators comprising a promoter that delivers a nucleic acid sequence capable of encoding one or more of the nucleic acids of the Disclosure, e.g., one or more of the peptides of the Disclosure, into a cell without degradation and brings about gene expression in the cell to which it is delivered. In some embodiments, the nucleic acid sequences disclosed herein are derived from any viral family that shares such viral properties that make them suitable for use as vectors. Retroviruses include mouse Maloney's leukemia virus, MMLV, and retroviruses that express the desirable properties of MMLV as a vector. Retroviral vectors can carry a larger genetic payload, i.e., a transgene or marker gene, than other viral vectors, and for this reason, they are commonly used vectors. However, retroviruses are not as useful in non-proliferating cells. Adenovirus vectors are relatively stable, easy to handle, have high titers, can be delivered in aerosol formulations, and can be transfected into non-dividing cells. Poxvirus vectors are large, have several sites for gene insertion, and poxviruses are heat-stable and can be stored at room temperature. Similarly to the above, viral vectors can be formulated into pharmaceutical compositions.
[0048] Retroviral vectors are generally described by Verma, IM, Retroviral vectors for gene transfer. In Microbiology, Amer. Soc. for Microbiology, pp. 229-232, Washington, (1985), which is incorporated herein by reference in its entirety. Examples of methods for using retroviral vectors for gene therapy are described in U.S. Patent Nos. 4,868,116 and 4,980,286; PCT applications WO90 / 02806 and WO89 / 07136; these teachings, with respect to teachings on methods for using retroviral vectors for gene therapy, are incorporated herein by reference in their entirety.
[0049] This disclosure provides adeno-associated virus (AAV) vectors comprising, essentially derived from, or consisting of nucleic acid sequences encoding the modified Hla polypeptides of this disclosure. If the AAV vector is essentially derived from nucleic acid sequences encoding the modified Hla polypeptides of this disclosure, it may include further components that do not materially affect the AAV vector (e.g., genetic elements such as poly(A) sequences or restriction enzyme sites that facilitate the in vitro manipulation of the vector). If the AAV vector consists of nucleic acid sequences encoding polypeptides, the AAV vector does not include any further components (i.e., components that are not endogenous to AAV and are not required to result in the expression of the nucleic acid sequence and thereby provide Hla).
[0050] Other useful systems include, for example, replicated and host-restricted non-replicated vaccinia virus vectors. In addition, the nucleic acid sequences of this disclosure can be delivered to target cells using non-nucleic acid-based systems. For example, the polynucleotides of this disclosure can be delivered via electroporation, lipofection, or calcium phosphate precipitation. The chosen delivery mechanism depends in part on the type of cells to be targeted and whether the delivery is performed, for example, in vivo or in vitro.
[0051] Suitable methods for nucleic acid delivery that result in the expression of the compositions of this disclosure are considered to include virtually any method by which nucleic acids (e.g., DNA, including viral and nonviral vectors) can be introduced into cells, tissues or organisms, as described herein or as would be known to those skilled in the art. Such methods include, but are not limited to, direct delivery of DNA, such as: injection (US Patents No. 5,994,624, 5,981,274, 5,945,100, 5,780,448, 5,736,524, 5,702,932, 5,656,610, 5,589,466 and 5,580,859, each incorporated herein by reference), including microinjection (Harland and Weintraub, 1985; US Patent No. 5,789,215); electroporation (US Patent No. 5,384,253, incorporated herein by reference); and calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, By methods such as 1987; Rippe et al., 1990; by using DEAE dextran followed by polyethylene glycol (Gopal, 1985); by direct ultrasonic loading (Fechheimer et al., 1987); by liposome-mediated transfection (Nicolau and Sene, 1982; Fraley et al., 1979; Nicolau et al., 1987; Wong et al., 1980; Kaneda et al., 1989; Kato et al., By means of (1991); by means of a particulate gun (PCT applications WO94 / 09699 and 95 / 06128; U.S. Patent No. 5,610,042; U.S. Patents No. 5,322,783, 5,563,055, 5,550,318, 5,538,877, and 5,538,880, each incorporated herein by reference); by means of stirring using silicon carbide fibers (Kaeppler et al.By means of (1990; U.S. Patents No. 5,302,523 and No. 5,464,765, respectively, incorporated herein by reference); by means of (1990; U.S. Patents No. 5,591,616 and No. 5,563,055, respectively, incorporated herein by reference); by means of (1990; U.S. Patents No. 5,591,616 and No. 5,563,055, respectively, incorporated herein by reference); by means of (1990; U.S. Patents No. 4,684,611 and No. 4,952,500, respectively, incorporated herein by reference); or by means of (1985) by means of (1990; U.S. Patents No. 5,302,523 and No. 5,464,765, respectively, incorporated herein by reference); by means of (1990; U.S. Patents No. 5,302,523 and No. 5,464,765, respectively, incorporated herein by reference); by means of (1990; U.S. Patents No. 5,591,616 and No. 5,563,05591,616 and No. 5,563,055, respectively, incorporated herein by reference); by means of (1990; U.S. Patents No. 5,3
[0052] Therefore, the polynucleotide composition may, in addition to the expression vector of the present disclosure, include lipids such as liposomes, for example, cationic liposomes (e.g., DOTMA, DOPE, DC-cholesterol) or anionic liposomes. The liposomes may further contain proteins that facilitate targeting of specific cells, if desired. The composition comprising the peptide and cationic liposomes may be administered via the blood or to a target organ. For more information on liposomes, see, for example, Brigham et al. Am. J. Resp. Cell. Mol. Biol. 1:95-100 (1989); Feigner et al. Proc. Natl. Acad. Sci USA 84:7413-7417 (1987); and U.S. Patent No. 4,897,355. Furthermore, the compound may be administered as a component of a microcapsule that can be targeted to a specific cell type, such as macrophages, or as a component of a microcapsule when the diffusion or delivery of the compound from the microcapsule is designed for a specific rate or dosage.
[0053] Host cells modified to express the modified Hla polypeptide of this disclosure are also intended. Such host cells can be modified to express the modified Hla polypeptide from either episomal nucleic acid or nucleic acid integrated into the genome. Such host cells can be generated by any suitable method, for example, by electroporation, transfection, or transformation using a vector encoding the modified Hla polypeptide of this disclosure. Host cells can be selected according to the desired application (e.g., mammalian cell expression) and can be modified to result in Hla expression according to methods well known in the art. Techniques for introducing a vector into host cells and subsequently culturing the host cells are well known in the art.
[0054] Host cells (e.g., mammalian host cells) suitable for replication and expression of Hla-containing vectors are provided, which can be stably or transiently transfected and / or stably or transiently express the modified Hla polypeptide of the Disclosure. Such Hla-expressing mammalian cells find applications, for example, in the production of modified Hla polypeptides. Hla production in mammalian cells can enable post-translational modification of Hla and / or post-translational modification of Hla to heterologous amino acids to which Hla can fused [e.g., glycosylation, cleavage of signal peptides (if present)]. In addition, mammalian cell lines can be selected for use in replicating, packaging, and producing high-titer viral particles containing the modified Hla polypeptide of the Disclosure of interest or the nucleic acid encoding the modified Hla polypeptide of the Disclosure of the Disclosure. Such Hla-containing viruses can then be used to enable the delivery of the Hla-encoding nucleic acid and Hla polypeptide to targets that require them.
[0055] Exemplary host cells include bacteria, yeast, mammalian cells (e.g., human cells or cell lines), and insect cells. Examples of bacterial host cells include Escherichia coli and other bacteria, which can be used for cloning, manipulating, and producing Hla nucleic acids, or for producing Hla polypeptides. Examples of mammalian cells, but not limited to these, include Chinese hamster ovary (CHO) cells, HEK293 cells, human cervical cancer cells (Hela), canine kidney cells (MDCK), human hepatocytes (HepG2), baby hamster kidney cells (BHK), and monkey kidney cells (CV1), as well as Vero, CEM, 721.221, H9, Jurkat, Raji, W138, COS-7, 293, HepG2, 3T3, and RIN cells.
[0056] Immunogenic compositions and / or pharmaceutical compositions In some embodiments, the Disclosure also includes immunogenic compositions and pharmaceutical compositions comprising a modified Hla polypeptide or a polynucleotide encoding a modified Hla polypeptide as disclosed herein, and at least one pharmaceutically acceptable excipient.
[0057] pharmaceutically acceptable excipients may be adjuvants, diluents, binders, fillers, buffers, pH adjusters, disintegrants, dispersants, preservatives, lubricants, taste masking agents, flavorings, or coloring agents. The amount and type of excipients used to form the pharmaceutical composition may be selected in accordance with known principles of pharmacy. In each of the embodiments described herein, the compositions of this disclosure may, as appropriate, contain one or more additional drugs or therapeutic agents in addition to Hla. Thus, in addition to the therapies described herein, other therapies known to be effective in treating diseases, disorders, or conditions may also be provided.
[0058] In one embodiment, the pharmaceutically acceptable excipient is an adjuvant. Any functional adjuvant that enhances the immunogenicity of the composition may be added to the immunogenic composition and / or pharmaceutical composition. Non-limiting examples of adjuvants for use with modified Hla polypeptides or polynucleotides of this disclosure include alum, monophosphoryl lipid A (MPL), AddaS03 (AS03-like), MPLA + alum (ASO4-like), CpG-ODN1585, ADJUPHOS®, aluminum hydroxide, Advax, MF9, IL-1, IL-2, IL-4, IL-7, IL-12, γ-interferon, GMCSP, BCG, MDP compounds such as thur-MDP and nor-MDP, CGP (MTP-PE), and lipid A, or any combination thereof.
[0059] In one embodiment, the excipient can be a diluent. The diluent may be compressible (i.e., plastically deformable) or abrasion-fragile. Not limited examples of suitable compressible diluents include microcrystalline cellulose (MCC), cellulose derivatives, cellulose powder, cellulose esters (i.e., mixed esters of acetate and butyrate), ethylcellulose, methylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, corn starch, phosphorylated corn starch, pregelatinized corn starch, rice starch, potato starch, tapioca starch, starch-lactose, starch-calcium carbonate, sodium starch glycolate, glucose, fructose, lactose, lactose monohydrate, sucrose, xylose, lactitol, mannitol, maltitol, sorbitol, xylitol, maltodextrin, and trehalose. Non-limiting examples of suitable wear-brittle diluents include discalcium phosphate (anhydrous or dihydrate), tribasic calcium phosphate, calcium carbonate, and magnesium carbonate.
[0060] In some embodiments, excipients can be binders. Suitable binders include, but are not limited to, starch, pregelatinized starch, gelatin, polyvinylpyrrolidone, cellulose, methylcellulose, sodium carboxymethylcellulose, ethylcellulose, polyacrylamide, polyvinyloxoazolidone, polyvinyl alcohol, C12-C18 fatty acid alcohols, polyethylene glycol, polyols, saccharides, oligosaccharides, polypeptides, oligopeptides, and combinations thereof.
[0061] In some embodiments, the excipients may be fillers. Suitable fillers include, but are not limited to, carbohydrates, inorganic compounds, and polyvinylpyrrolidone. In non-limiting examples, fillers may be both dibasic and tribasic calcium sulfate, starch, calcium carbonate, magnesium carbonate, microcrystalline cellulose, dicalcium phosphate, magnesium carbonate, magnesium oxide, calcium silicate, talc, modified starch, lactose, sucrose, mannitol, or sorbitol.
[0062] In some embodiments, the excipient can be a buffer. Typical examples of suitable buffers, but not limited to them, include phosphates, carbonates, citrates, Tris buffer, and buffered saline salts (e.g., Tris-buffered saline or phosphate-buffered saline).
[0063] In some embodiments, the excipient may be a pH adjuster. In non-limiting examples, the pH adjuster may be sodium carbonate, sodium bicarbonate, sodium citrate, citric acid, or phosphoric acid.
[0064] In some embodiments, the excipient can be a disintegrant. The disintegrant may be non-foaming or foaming. Suitable examples of non-foaming disintegrants, but not limited to them, include starches, e.g., corn starch, potato starch, their gelatinized and modified starches, sweeteners, clays, e.g., bentonite, microcrystalline cellulose, alginates, sodium starch glycolate, gums, e.g., agar, guar, carob, karaya, pectin, and tragacanth. Non-limiting examples of suitable foaming disintegrants include sodium bicarbonate in combination with citric acid and sodium bicarbonate in combination with tartaric acid.
[0065] In some embodiments, the excipient may be a dispersant or a dispersion enhancer. Suitable dispersants include, but are not limited to, starch, alginic acid, polyvinylpyrrolidone, guar gum, kaolin, bentonite, purified wood cellulose, sodium starch glycolate, isoamorphous silicate, and microcrystalline cellulose.
[0066] In some embodiments, excipients can be preservatives. Not limited examples of suitable preservatives include antioxidants, such as BHA, BHT, vitamin A, vitamin C, vitamin E, or retinyl palmitate, citric acid, or sodium citrate; chelating agents, such as EDTA or EGTA; and antimicrobial agents, such as parabens, chlorobutanol, or phenol.
[0067] In some embodiments, the excipient can be a lubricant. Not limited examples of suitable lubricants include minerals, such as talc or silica; and fats, such as vegetable stearin, magnesium stearate, or stearic acid.
[0068] In some embodiments, the excipients may be taste masking agents. Taste masking agents include cellulose ethers; polyethylene glycol; polyvinyl alcohol; copolymers of polyvinyl alcohol and polyethylene glycol; monoglycerides or triglycerides; acrylic polymers; mixtures of acrylic polymers and cellulose ethers; cellulose phthalate acetate; and combinations thereof.
[0069] In some embodiments, the excipient may be a flavoring agent. The flavoring agent may be selected from synthetic flavor oils and flavor aromatic compounds, as well as / or natural oils and extracts derived from plants, leaves, flowers, fruits, and combinations thereof.
[0070] In some embodiments, the excipients may be colorants. Suitable coloring additives include, but are not limited to, food, drug and cosmetic dyes (FD&C), drug and cosmetic dyes (D&C), or topical drug and cosmetic dyes (Ext.D&C).
[0071] The weight fraction of excipients or combinations of excipients in a composition may be approximately 99% or less, approximately 97% or less, approximately 95% or less, approximately 90% or less, approximately 85% or less, approximately 80% or less, approximately 75% or less, approximately 70% or less, approximately 65% or less, approximately 60% or less, approximately 55% or less, approximately 50% or less, approximately 45% or less, approximately 40% or less, approximately 35% or less, approximately 30% or less, approximately 25% or less, approximately 20% or less, approximately 15% or less, approximately 10% or less, approximately 5% or less, approximately 2% or approximately 1% or less, based on the total weight of the composition.
[0072] The compositions described herein can be formulated in any conventional manner using one or more pharmaceutically acceptable carriers or excipients, for example, as described in Remington's Pharmaceutical Sciences (AR Gennaro, Ed.), 21st edition, ISBN: 0781746736 (2005), which is incorporated herein in whole by reference. Such formulations would contain a therapeutically effective amount of the biologically active agent described herein, which may exist in a purified form, together with an appropriate amount of carrier that enables a form for proper administration to the subject.
[0073] The term "formulation" refers to the preparation of a drug in a form suitable for administration to a target, such as a human. Therefore, a "formulation" may include pharmaceutically acceptable excipients, including diluents or carriers.
[0074] The term “pharmaceutically acceptable” as used herein may describe substances or ingredients that do not cause an unacceptable loss of pharmacological activity or unacceptable adverse side effects. Examples of pharmaceutically acceptable ingredients may include those listed in the United States Pharmacopeia (USP 29) and National Formulary (NF 24), United States Pharmacopeial Convention, Inc, Rockville, Maryland, 2005 (“USP / NF”) or more recent editions, as well as those listed in the FDA’s continuously updated Inactive Ingredient Search online database. Other useful ingredients not listed in USP / NF, etc., may also be used.
[0075] The term “pharmaceutically acceptable excipients,” as used herein, may include any solvent, dispersion medium, coating agent, antimicrobial and antifungal agent, isotonic agent, or absorption retarder. The use of such media and activators for pharmaceutically active substances is well known in the art [see, for the whole, Remington's Pharmaceutical Sciences (AR Gennaro, Ed.), 21st edition, ISBN: 0781746736 (2005)]. Their use in therapeutic compositions is intended unless any conventional medium or activator is incompatible with the active ingredient. Supplementary active ingredients may also be incorporated into the composition.
[0076] A “stable” formulation or composition may refer to a composition that is sufficiently stable to allow storage at a favorable temperature, for example, between approximately 0°C and approximately 60°C, for a commercially reasonable period of time, for example, for at least approximately 1 day, at least approximately 1 week, at least approximately 1 month, at least approximately 3 months, at least approximately 6 months, at least approximately 1 year, or at least approximately 2 years.
[0077] The formulation must be suitable for the mode of administration. Useful agonists in conjunction with this disclosure can be formulated by known methods for administration to a subject using several routes, which include, but are not limited to, parenteral, pulmonary, oral, topical, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, ocular, buccal, and rectal. Individual agonists can also be administered in combination with one or more further agonists, or together with other biologically active or biologically inactive agonists. Such biologically active or inactive agonists may be in fluidic or mechanical communication with the agonist, or may be bound to the agonist by ionic, covalent, van der Waals, hydrophobic, hydrophilic, or other physical forces.
[0078] Controlled-release (or sustained-release) preparations can be formulated to prolong the activity of an agonist and reduce the frequency of administration. Controlled-release preparations can also be used to influence the onset time or other properties of the action, such as the blood level of the agonist, and consequently, the occurrence of side effects. Controlled-release preparations can be designed to initially release a certain amount of the agonist to produce the desired therapeutic effect, and then gradually and continuously release other amounts of the agonist to maintain the level of therapeutic effect over a long period. To maintain a nearly constant level of the agonist in the body, the agonist can be released from the dosage form at a rate that replenishes the amount of the agonist being metabolized or excreted from the body. Controlled release of an agonist can be stimulated by various inducers, such as changes in pH, changes in temperature, enzymes, water, or other physiological conditions or molecules.
[0079] Administration (i) Dosage form The composition can be formulated into various dosage forms and administered by several different means that will deliver a therapeutically effective amount of the active ingredient. Such compositions may be administered orally (e.g., by inhalation), parenterally, or topically in dosage unit formulations containing, optionally, conventional, non-toxic, pharmaceutically acceptable carriers, adjuvants, and media. Topical administration may also involve transdermal administration, such as the use of transdermal patches or iontophoresis devices. The term parenterally as used herein includes techniques of subcutaneous, intravenous, intramuscular, intra-articular, or intrasternal injection or infusion. Formulations of the drug are discussed, for example, in Gennaro, AR, Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. (18th ed, 1995), and Liberman, HA and Lachman, L, Eds., Pharmaceutical Dosage Forms, Marcel Dekker Inc., New York, NY (1980). In specific embodiments, the composition may be a nutritional supplement, or it may be a cosmetic.
[0080] Solid dosage forms for oral administration include capsules, tablets, caplets, pills, powders, pellets, and granules. In such solid dosage forms, the active ingredient is usually combined with one or more pharmaceutically acceptable excipients, examples of which are detailed above. Oral preparations can also be administered as aqueous suspensions, elixirs, or syrups. In these cases, the active ingredient can be combined with various sweeteners or flavorings, colorants, emulsifiers and / or suspending agents if desired, and diluents, such as water, ethanol, glycerin, and combinations thereof. For administration by inhalation, the compound is delivered in the form of an aerosol spray from a pressurized container or dispenser containing a suitable propellant, such as a gas like carbon dioxide, or from a nebulizer.
[0081] For parenteral administration (including cutaneous, subcutaneous, intraocular, intradermal, intravenous, intramuscular, intra-articular, and intraperitoneal), the preparation may be an aqueous solution or an oily solution. The aqueous solution may contain sterile diluents, e.g., water, physiological saline, pharmaceutically acceptable polyols, e.g., glycerol, propylene glycol, or other synthetic solvents; antimicrobial and / or antifungal agents, e.g., benzyl alcohol, methylparaben, chlorobutanol, phenol, and thimerosal; antioxidants, e.g., ascorbic acid or sodium bisulfite; chelating agents, e.g., ethylenediaminetetraacetic acid; buffers, e.g., acetate, citrate, or phosphate; and / or osmotic regulators, e.g., sodium chloride, dextrose, or polyalcohols, e.g., mannitol or sorbitol. The pH of the aqueous solution may be adjusted using an acid or base, e.g., hydrochloric acid or sodium hydroxide. The oily solution or suspension may further contain sesame oil, peanut oil, olive oil, or mineral oil. The composition may be provided in unit-dose or multi-dose containers, such as sealed ampoules and vials, and may be stored in a freeze-dried state requiring only the addition of a carried sterile liquid, such as water for injection, immediately before use. Immediate injection solutions and suspensions may also be prepared from sterile powders, granules, and tablets.
[0082] For topical administration (e.g., transdermal or transmucosal), the preparation generally contains a suitable penetrating agent for the penetration barrier. Pharmaceutical compositions prepared for topical administration can be formulated as ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, sprays, aerosols, or oils. In some embodiments, the pharmaceutical composition is applied as a topical ointment or cream. When formulated in an ointment, the active ingredient can be used with either a paraffinic base or a water-miscible ointment base. Alternatively, the active ingredient can be formulated into a cream with an oil-in-water or water-in-oil base. Pharmaceutical compositions prepared for topical administration to the eye include eye drops in which the active ingredient is dissolved or suspended in a suitable carrier, particularly an aqueous solvent. Pharmaceutical compositions prepared for topical administration in the mouth include lozenges, troches, and mouthwashes. Transmucosal administration can be performed through the use of nasal sprays, aerosol sprays, tablets, or suppositories, and transdermal administration can be performed via ointments, plasters, gels, patches, or creams that are generally known in the art.
[0083] In some embodiments, compositions comprising modified Hla polypeptides or modified Hla polynucleotides or their variants can be encapsulated in a suitable medium to assist in the delivery of compounds to target cells, to enhance the stability of the composition, or to minimize the potential toxicity of the composition. As those skilled in the art will understand, a variety of mediums are suitable for delivering the compositions of this disclosure. Non-limiting examples of suitable structured fluid delivery systems include nanoparticles, liposomes, microemulsions, micelles, dendrimers, and other phospholipid-containing systems. Methods for incorporating compositions into delivery media are known in the art.
[0084] In some embodiments, liposome delivery media can be utilized. Depending on the embodiment, liposomes are suitable for the delivery of modified Hla polypeptides or modified Hla polynucleotides due to their structural and chemical properties. Generally speaking, liposomes are spherical vesicles comprising a phospholipid bilayer membrane. The lipid bilayer of a liposome fuses with other bilayers (e.g., the cell membrane), thereby enabling the delivery of the liposome's contents to the cell. In this way, compositions containing Hla or its variants can be selectively delivered to cells by encapsulation within liposomes that fuse with the membrane of the targeted cell.
[0085] Liposomes can be composed of diverse types of phospholipids with varying hydrocarbon chain lengths. Phospholipids generally contain two fatty acids linked to one of various polar groups via a glycerol phosphate. Suitable phospholipids include phosphatidic acid (PA), phosphatidylserine (PS), phosphatidylinositol (PI), phosphatidylglycerol (PG), diphosphatidylglycerol (DPG), phosphatidylcholine (PC), and phosphatidylethanolamine (PE). The fatty acid chains constituting phospholipids can range in length from approximately 6 to 26 carbon atoms, and the lipid chains can be saturated or unsaturated. Appropriate fatty acid chains include (common names are shown in parentheses) n-dodecanoate (laurate), n-tetradecanoate (myristate), n-hexadecanoate (palmitate), n-octadecanoate (stearate), n-eicosanoate (arachidate), n-docosanoate (behenate), n-tetracosanoate (lignocerate), cis-9-hexadecenoate (palmitreate), cis-9-octadecanoate (oleate), cis,cis-9,12-octadecanedienoate (linoleate), all-cis-9,12,15-octadecatrienoate (linolenate), and all-cis-5,8,11,14-eicosatetraenoate (arachidonate). The two fatty acid chains of a phospholipid may be identical or different. Acceptable phospholipids include dioleoyl PS, dioleoyl PC, distearoyl PS, distearoyl PC, dimyristoyl PS, dimyristoyl PC, dipalmitoyl PG, stearoyl, oleoyl PS, palmitoyl, and linolenyl PS, among others.
[0086] Phospholipids can originate from any natural source and can themselves constitute a mixture of phospholipids. For example, egg yolk is rich in PC, PG, and PE; soybeans contain PC, PE, PI, and PA; and animal brain or spinal cord is rich in PS. Phospholipids can also originate from synthetic sources. Mixtures of phospholipids with diverse ratios of individual phospholipids can be used. Mixtures of different phospholipids can result in liposome compositions with beneficial activity or stability of active properties. The above phospholipids can be mixed in optimal proportions with cationic lipids such as N-(1-(2,3-dioleolyoxy)propyl)-N,N,N-trimethylammonium chloride, 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate, 3,3'-deheptyloxacarbocyanine iodide, 1,1'-dedodecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate, 1,1'-dioleyl-3,3,3',3'-tetramethylindocarbocyanine methanesulfonate, N-4-(delinoleylaminostyryl)-N-methylpyridinium iodide, or 1,1,-dilinoleyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate.
[0087] Liposomes may contain sphingolipids, which are a structural counterpart of glycerol and phosphoglycerides, or cholesterol, a major component of animal cell membranes. Liposomes may also contain pegylated lipids, which are lipids covalently linked to a polyethylene glycol (PEG) polymer. PEG can range in size from approximately 500 to approximately 10,000 daltons.
[0088] Liposomes may further contain a suitable solvent. The solvent may be an organic solvent or an inorganic solvent. Suitable solvents, but are not limited to, include dimethyl sulfoxide (DMSO), methylpyrrolidone, N-methylpyrrolidone, acetonitrile, alcohol, dimethylformamide, tetrahydrofuran, or combinations thereof.
[0089] Liposomes carrying one or more of the following: tricyclic antipsychotics, vasodilators, antibiotics / preservatives, arylpiperazines, or derivatives thereof, can be prepared by any known method for preparing liposomes for drug delivery, the disclosures of which are detailed, for example, in U.S. Patents 4,241,046; 4,394,448; 4,529,561; 4,755,388; 4,828,837; 4,925,661; 4,954,345; 4,957,735; 5,043,164; 5,064,655; 5,077,211; and 5,264,618, which are incorporated herein by reference in their entirety. For example, liposomes can be prepared by sonicating lipids in an aqueous solution, solvent injection, lipid hydration, reverse evaporation, or freeze-drying by repeated freeze-thaw cycles. In a preferred embodiment, liposomes are formed by sonication. Liposomes may be multilayered, having many layers like an onion, or monolayered. Liposomes may be large or small. Continued high-shear sonication tends to form smaller monolayered liposomes.
[0090] As will be apparent to those skilled in the art, all parameters governing liposome formation may vary. These parameters include, but are not limited to, temperature, pH, the concentration of one or more protein toxicity reducers or derivatives thereof, the concentration and composition of lipids, the concentration of polyvalent cations, the mixing rate, and the presence and concentration of solvents.
[0091] In some embodiments, the compositions of this disclosure can be delivered to cells as microemulsions. Microemulsions are generally clear, thermodynamically stable solutions comprising an aqueous solution, a surfactant, and an "oil," where the "oil" is a supercritical fluid phase. The surfactant remains at the oil-water interface. A variety of surfactants are suitable for use in microemulsion formulations, including those described herein or otherwise known in the art. Aqueous microdomains suitable for use in this disclosure will have characteristic structural dimensions as a whole ranging from about 5 nm to about 100 nm. Aggregates of this size are poor in visible light scattering, and therefore such solutions are optically transparent. As will be understood by those skilled in the art, microemulsions can and will have a number of different microscopic structures, including spherical, rod-shaped, or disc-shaped aggregates. In one embodiment, the structure may be a micelle, which is the simplest microemulsion structure, being a spherical or cylindrical object as a whole. A micelle is like an oil droplet in water, and an inverse micelle is like a water droplet in oil. In an alternative embodiment, the microemulsion structure is a lamellar plate, which contains continuous layers of water and oil separated by layers of surfactant. The “oil” in the microemulsion optimally contains phospholipids. Any of the above phospholipids are suitable for embodiments targeting microemulsions for liposomes. One or more of tricyclic antipsychotics, vasodilators, antibiotics / preservatives, arylpiperazines, or derivatives thereof can be encapsulated in a microemulsion by any method commonly known in the art.
[0092] In some embodiments, Hla can be delivered in the form of dendritic polymers or dendrimers. Generally speaking, a dendrimer is a branched, tree-like molecule, in this case a linked chain of molecules where each branch, after a certain length, branches into two new branches (molecules). This branching continues until the branches (molecules) are so densely packed that the canopy forms a sphere. Generally, the properties of a dendrimer are determined by the functional groups on its surface. For example, hydrophilic end groups such as carboxyl groups would typically create water-soluble dendrimers. Alternatively, phospholipids can be incorporated into the surface of the dendrimer to facilitate absorption across the skin. Any of the phospholipids detailed for use in liposome embodiments are suitable for use in dendrimeric embodiments. Dendrimers can be prepared using any method well known in the art, and the compositions of this disclosure can be encapsulated therein. For example, dendrimers can be produced by a repeating sequence of reaction steps, in which case each further repeat yields a higher-order dendrimer. As a result, the dendrimers have a regular, highly branched 3D structure and are in a nearly uniform size and shape. Furthermore, the final size of the dendrimer is usually controlled by the number of iterations used in the synthesis process. A variety of dendrimer sizes are suitable for use in this disclosure. Overall, the dendrimer sizes can range from about 1 nm to about 100 nm.
[0093] Overall, a safe and effective amount of a modified Hla composition is, for example, an amount that is expected to produce the desired effect in a subject while minimizing undesirable side effects. In various embodiments, the effective amounts of Hla described herein can substantially induce an immune response in a subject.
[0094] The amounts of the compositions described herein, which can be combined with pharmaceutically acceptable carriers to produce single dosage forms, will vary depending on the host being treated and the specific mode of administration. Those skilled in the art will understand that the unit content of the activator contained in individual doses of each dosage form does not need to constitute a therapeutically effective dose in itself, since the required therapeutically effective dose may be achieved by administering several individual doses.
[0095] The toxicity and therapeutic efficacy of the compositions described herein are determined by LD50. 50 (Lethal doses reaching 50% of the population) and ED 50 The dose effective for treatment in 50% of the population can be determined by standard medical procedures in cell culture or experimental animals. The dose ratio between toxic and therapeutic effects is the LD 50 / ED 50 This is a treatment index that can be expressed as a ratio, and in this field, it is generally understood that a larger treatment index indicates optimality.
[0096] In some embodiments, the total polypeptide present is between approximately 0.001 mg and approximately 10 mg per ml. Therefore, the protein concentration in the composition can be at least approximately or at most approximately 0.001, 0.010, 0.050, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0 pg / ml, mg / ml, or higher (or any range that can be derived within that range). Of these, approximately, at least approximately, or at most approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, and 100% can be Hla polypeptides disclosed herein.
[0097] This disclosure is intended to influence prophylactic therapy for the development of diseases or conditions associated with infection by Staphylococcus pathogens by administering modified Hla polypeptides or peptides.
[0098] This disclosure describes polypeptides, peptides, and proteins for use in various embodiments of this disclosure. For example, a particular polypeptide may be assayed for its ability to induce an immune response. In specific embodiments, all or part of the proteins of this disclosure may be synthesized in solution or on a solid support according to conventional techniques. Various automated synthesizers are commercially available and can be used according to known protocols. See, for example, Stewart and Young, (1984); Tam et al., (1983); Merrifield, (1986); and Barany and Merrifield (1979), each incorporated herein by reference. Alternatively, recombinant DNA techniques may be used, in which the nucleotide sequences encoding the peptides of this disclosure are inserted into an expression vector, which is then transformed or transfected into suitable host cells and cultured under conditions suitable for expression. One embodiment of this disclosure involves the use of gene transfer into cells, including microorganisms, for the production and / or delivery of proteins. A gene for the protein of interest can be transferred into a suitable host cell, which is then cultured under suitable conditions. Nucleic acids encoding substantially any polypeptide described herein can be used. The generation of recombinant expression vectors and the elements contained in such vectors are discussed herein. Alternatively, the protein produced may be an endogenous protein normally synthesized by the cell used for protein production.
[0099] Another aspect of the present disclosure uses an autologous B lymphocyte cell line, which is transfected with an immunogenic composition, more specifically, a viral vector expressing a protein having immunogenic activity.
[0100] Other examples of mammalian host cell lines, though not limited to them, include Vero and HeLa cells, other B and T cell lines such as CEM, 721.221, H9, Jurkat, and Raji, as well as cell lines of Chinese hamster ovary, W138, BHK, COS-7, 293, HepG2, 3T3, RIN, and MDCK. In addition, host cell lines that modulate the expression of the inserted sequence or modify and process the gene product in a desired manner can also be selected. Such modification (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for protein function. Different host cells have characteristic and specific mechanisms toward post-translational processing and modification of proteins. Appropriate cell lines or host systems can be selected to ensure the correct modification and processing of the expressed foreign protein.
[0101] Several selection systems can be used, including, but not limited to, the genes for HSV thymidine kinase, hypoxanthine-guanine, phosphoribosyltransferase, and adenine phosphoribosyltransferase in TK cells, HGPRT cells, or APRT cells, respectively. Anti-metabolite resistance can also be used as a basis for selection: DHFR, which confers resistance to trimethoprim and methotrexate; GPT, which confers resistance to mycophenolic acid; NEO, which confers resistance to aminoglycoside G418; and HYGR, which confers resistance to hygromycin.
[0102] Animal cells can be grown in vitro in two ways: as non-shelter-dependent cells that grow in suspension for most of the culture, or as shelter-dependent cells that require attachment to a solid substrate for growth (i.e., a monolayer type of cell proliferation).
[0103] Non-anchor-dependent or suspension culture of serially established cell lines is the most widely used method for large-scale production of cells and cell products. However, suspension-cultured cells have limitations, such as tumorigenic potential and lower protein production compared to adherent cells.
[0104] This disclosure includes methods for preventing or improving staphylococcal infections. Accordingly, this disclosure envisions vaccines for use in both active and passive immunization mechanisms. Immunogenic compositions proposed to be suitable for use as vaccines can most readily be prepared directly from immunogenic Hla polypeptides prepared in the manner disclosed herein. Preferably, the antigen material is thoroughly dialyzed to remove undesirable low molecular weight molecules and / or lyophilized for easier formulation into a desired medium. This disclosure includes compositions that can be used to induce an immune response to polypeptides or peptides derived from the modified Hla peptides of this disclosure, thereby protecting against staphylococcal infections and the development of conditions or diseases caused by such. In certain embodiments, the compositions are formulated to be administered to a mucosal surface, e.g., an aerosol formulation.
[0105] Alternatively, other viable and important options for protein / peptide-based vaccines involve the introduction of antigen-encoding nucleic acids, as DNA or mRNA vaccines. In this regard, recent reports have described the construction of recombinant vaccinia viruses expressing either 10 minimal adjacent CTL epitopes, or combinations of B cells, CTL epitopes, and several pathogen-derived TH epitopes, as well as the favorable results of using such constructs to immunize mice toward priming a protective immune response. Thus, there is ample evidence in the literature regarding the favorable results of using peptides, peptide-pulsed APCs, and peptide-encoding constructs toward efficient in vivo priming of a protective immune response. The use of nucleic acid sequences as vaccines is exemplified in U.S. Patents 5,958,895 and 5,620,896.
[0106] The preparation of vaccines containing polypeptide or peptide sequences as active ingredients is generally well understood in the art. Typically, such vaccines are prepared as injectable preparations in the form of either a liquid solution or a suspension; however, a solid form suitable for dissolution or suspension before injection may also be prepared.
[0107] The preparation may be emulsified. The active immunogenic component is often mixed with excipients that are pharmaceutically acceptable and compatible with the active component. Suitable excipients include, for example, water, saline, dextrose, glycerol, or ethanol, and combinations thereof. In addition, the vaccine may, if necessary, contain some amount of auxiliary substances such as wetting or emulsifying agents, pH buffers, or adjuvants that enhance the efficacy of the vaccine. In specific embodiments, the vaccine is formulated using a combination of substances.
[0108] Vaccines can conventionally be administered parenterally, mucous membranes, intranasally, by inhalation, and / or by injection, for example, subcutaneously or intramuscularly. Further formulations suitable for other modes of administration include suppositories and, in some cases, oral formulations.
[0109] In the case of suppositories, conventional binders and carriers may include, for example, polyalkalene glycols or triglycerides: such suppositories can be formed from a mixture containing the active ingredient in the range of about 0.5% to about 10%, preferably about 1% to about 2%. Oral formulations may include commonly used excipients such as pharmaceutical-grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, and magnesium carbonate. These compositions may take the form of solutions, suspensions, tablets, pills, capsules, sustained-release formulations, or powders and may contain about 10% to about 95%, preferably about 25% to about 70%, of the active ingredient.
[0110] Polypeptides and the DNA constructs encoding them can be formulated into vaccines in neutral or salt forms. pharmaceutically acceptable salts include acid addition salts (formed with the free amino group of the peptide) and those formed with inorganic acids such as hydrochloric acid or phosphoric acid, or organic acids such as acetic acid, oxalic acid, tartaric acid, and mandelic acid. Salts formed with the free carboxyl group may also be derived from inorganic bases such as sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide, or ferric hydroxide, and organic bases such as isopropylamine, trimethylamine, 2-ethylaminoethanol, histidine, and procaine.
[0111] Vaccines are typically administered in a form suitable for the formulation and in a therapeutically effective and immunogenic dose. The dosage depends on the target being treated, including the individual's immune system's ability to synthesize antibodies and the desired level of protection. The appropriate amount of active ingredient required for administration is at the discretion of the physician. However, the appropriate dosage range is on the order of several hundred micrograms of active ingredient per vaccine dose. While there is a variety of regimens suitable for initial administration and booster shots, a typical regimen involves an initial dose followed by subsequent vaccinations or other administrations.
[0112] The mode of application can be broadly varied. Any conventional method of vaccine administration is applicable. These may include oral application on a physiologically acceptable solid base or in a physiologically acceptable dispersion, parenteral administration, mucosal administration, intranasal administration, inhalation, and injection. The vaccine dosage will depend on the route of administration and will vary according to the size and health condition of the subject.
[0113] A given composition may vary in terms of its immunogenicity. Therefore, it is often necessary to boost the host immune system, which can also be done by coupling a peptide or polypeptide to a carrier. Exemplary and preferred carriers are keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins such as ovalbumin, mouse serum albumin, or rabbit serum albumin can also be used as carriers. Means for conjugating polypeptides to carrier proteins are well known in the art and include glutaraldehyde, m-maleimidobenzoyl-N-hydroxysuccinimide, carbodiimide, and bis-biazotized benzidine.
[0114] The immunogenicity of polypeptide or peptide compositions can be enhanced by using nonspecific activators of the immune response, known as adjuvants. Suitable adjuvants include all acceptable immunostimulatory compounds, such as cytokines, toxins, or synthetic compositions. Several adjuvants can be used to enhance the antibody response to the modified Hla peptides of this disclosure. Adjuvants can (1) capture an antigen in the body and cause sustained release; (2) attract cells involved in the immune response to the site of administration; (3) induce proliferation or activation of immune system cells; or (4) improve the diffusion of the antigen through the body of the subject.
[0115] Adjuvants include, but are not limited to, oil-in-water emulsions, water-in-oil emulsions, inorganic salts, polynucleotides, and natural substances. Specific adjuvants that can be used include alum, monophosphoryl lipid A (MPL), AddaS03 (AS03-like), MPLA + alum (AS04-like), CpG-ODN1585, ADJUPHOS®, aluminum hydroxide, Advax, MF9, or any combination thereof. Other adjuvants that can be used include IL-1, IL-2, IL-4, IL-7, IL-12, γ-interferon, GMCSP, BCG, aluminum hydroxide or other aluminum compounds, MDP compounds such as thur-MDP and nor-MDP, CGP (MTP-PE), and lipid A. RIBI contains three components extracted from bacteria—MPL, trehalose dimycolate (TDM), and cell wall skeleton (CWS)—in a 2% squalene / Tween80 emulsion. MHC antigens can be further used. Other adjuvants or methods are exemplified in U.S. Patents 6,814,971, 5,084,269, and 6,656,462, each of which is incorporated herein by reference.
[0116] Various methods for obtaining adjuvants that affect vaccines include using activators such as aluminum hydroxide or aluminum phosphate (alum), which are typically used as a phosphate-buffered saline solution of about 0.05 to 0.1%, mixing with a synthetic polymer of sugars [Carbopol®], which is used as a solution of about 0.25%, and agglutinating proteins in the vaccine by heat treatment at a temperature in the range of about 70°C to 101°C for a period of 30 seconds to 2 minutes. Adjuvant effects can also be produced using agglutination by reactivation with pepsin-treated (Fab) antibodies against albumin, a mixture with bacterial cells [e.g., C. parvum], endotoxins or lipopolysaccharide components of Gram-negative bacteria, emulsions in physiologically acceptable oily media [e.g., mannido monooleate (Aracel A)], or emulsions with a 20% perfluorocarbon solution [Fluosol-DA®], which is used as a block substitute.
[0117] Exemplary, and often preferred, adjuvants include complete Freund's adjuvant [a nonspecific activator of the immune response containing dead Mycobacterium tuberculosis], incomplete Freund's adjuvant, alum, AddaS03 (AS03-like), MPLA and alum (AS04-like), CpG-ODN1585, or any combination thereof. In addition to adjuvants, it may be desirable to co-administer biomodulators (BRMs) to enhance the immune response. BRMs have been shown to upmodulate T-cell immunity or downmodulate suppressor cell activity. Such BRMs include, but are not limited to, cimetidine (CIM; 1200 mg / d) (Smith / Kline, PA); low-dose cyclophosphamide (CYP; 300 mg / m2) (Johnson / Mead, NJ); and cytokines such as gamma interferon, IL-2, or IL-12, or genes encoding proteins.
[0118] In certain embodiments, this disclosure relates to compositions comprising one or more lipids associated with nucleic acids or polypeptides / peptides. Lipids are substances that are insoluble in water and extractable with organic solvents. Compounds other than those specifically described herein will be understood as lipids to those skilled in the art and are encompassed by the compositions and methods of this disclosure. Lipid components and non-lipids can adhere to each other either covalently or non-covalently.
[0119] Nucleic acid molecules or polypeptides / peptides associated with lipids can be dispersed in a lipid-containing solution, dissolved with lipids, emulsified with lipids, mixed with lipids, combined with lipids, covalently bonded to lipids, contained as a suspension in lipids, or otherwise associated with lipids. The lipid or lipid-Hla associated compositions of this disclosure are not limited to any particular structure. For example, they can be simply dispersed in a solution, potentially forming aggregates that are not uniform in either size or shape. In another example, they can exist in a bilayer structure, as micelles, or in a "broken-down" structure. In another non-limiting example, lipofectamine (Gibco BRL)-poxvirus or Superfect (Qiagen)-poxvirus complexes are also considered.
[0120] In a particular embodiment, the composition is approximately 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, and 30%. Approximately 31%, approximately 32%, approximately 33%, approximately 34%, approximately 35%, approximately 36%, approximately 37%, approximately 38%, approximately 39%, approximately 40%, approximately 41%, approximately 42%, approximately 43%, approximately 44%, approximately 45%, approximately 46%, approximately 47%, approximately 48%, approximately 49%, approximately 50%, approximately 51%, approximately 52%, approximately 53%, approximately 54%, approximately 55%, approximately 56%, approximately 57%, approximately 58%, approximately 59%, approximately 60%, approximately 61%, It may include specific lipids, lipid types, or non-lipid components, such as adjuvants, antigens, peptides, polypeptides, sugars, nucleic acids, or other materials disclosed herein or that would be known to those skilled in the art, in any range between these amounts: approximately 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or any range between these amounts. In non-limiting examples, a composition may contain about 10% to about 20% neutral lipids, about 33% to about 34% cerebrosides, and about 1% cholesterol. In another non-limiting example, a liposome may contain about 4% to about 12% terpenes, in which case about 1% of the micelle is lycopene in particular, leaving about 3% to about 11% of the liposome to contain other terpenes; and may also contain about 10% to about 35% phosphatidylcholine, and about 1% non-lipid components. Thus, it is intended that the compositions of the present disclosure may contain any combination or percentage range of lipids, lipid types, or other components.
[0121] The compositions and related methods of this disclosure, in particular the administration of the modified Hla polypeptides or Hla polynucleotides of this disclosure to patients / subjects, may also be used in combination with the administration of conventional therapies. These include, but are not limited to, the administration of antibiotics such as streptomycin, ciprofloxacin, doxycycline, gentamicin, chloramphenicol, trimethoprim, sulfamethoxazole, ampicillin, tetracycline, oxacillin, vancomycin, or various combinations of antibiotics. In addition, the administration of the modified Hla polypeptides or Hla polynucleotides or anti-Hla antibodies of this disclosure to patients / subjects may also be used in combination with the administration of antipathogenic agents such as RIP.
[0122] In one embodiment, the Hla composition is intended to be used in conjunction with antibacterial and / or antipathogenic therapy. Alternatively, the therapy may precede or follow treatment with the other agonist by intervals ranging from minutes to weeks. In embodiments in which the other agonist and / or protein or polynucleotide is administered separately, it is generally expected that no significant time elapses between each delivery, and as a result, the advantageous combined effect of the agonist and the composition of this disclosure can still be exerted on the target. In such examples, it is intended that both modalities may be administered within about 12 to 24 hours of each other, more preferably within about 6 to 12 hours of each other. In some situations, it may be desirable to significantly extend the time interval between administrations, however, in this case, days (2, 3, 4, 5, 6, or 7 days) to weeks (1, 2, 3, 4, 5, 6, 7, or 8 weeks) may elapse between each administration.
[0123] Various combinations can be used, for example, let antibiotic therapy be "A", and immunogenic molecules or antibodies, such as Hla antigens, given as part of an immune or passive immune therapy regimen be "B": A / B / AB / A / BB / B / AA / A / BA / B / BB / A / AA / B / B / BB / A / B / BB / B / B / AB / B / A / BA / A / B / BA / B / A / BA / B / B / AB / B / A / AB / A / AB / AB / A / A / BA / A / A / BB / A / A / AA / B / A / AA / A / B / A.
[0124] In some embodiments, the pharmaceutical composition is administered to a subject. Different embodiments of the Disclosure involve administering an effective amount of the composition to a subject. In some embodiments of the Disclosure, a modified Hla polypeptide or polynucleotide can be administered to a patient to protect against infection by one or more Staphylococcal pathogens. Alternatively, a nucleic acid sequence encoding one or more such polypeptides or peptides, or an expression vector containing the same, may be administered to a subject as prophylactic treatment. Additionally, such compounds may be administered in combination with antibiotics and / or antipathogenic agents. Such compositions are generally dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium.
[0125] The active compounds of this disclosure can be formulated for parenteral administration, for example, for injection via intravenous, intramuscular, subcutaneous, or even intraperitoneal routes. The preparation of aqueous compositions containing one or more compositions of this disclosure will be known to those skilled in the art in light of this disclosure. Typically, such compositions can be prepared as either liquid solutions or suspensions for injection; solid forms suitable for use in preparing solutions or suspensions can also be prepared by adding liquid before injection; and the preparations can also be emulsified.
[0126] Solutions of the active compound, either as a free base or a pharmacologically acceptable salt, can be prepared in water appropriately mixed with a surfactant such as hydroxypropyl cellulose. Dispersions can similarly be prepared in glycerol, liquid polyethylene glycol, and mixtures thereof, as well as in oil. Under normal storage and use conditions, these preparations contain preservatives to prevent microbial growth.
[0127] Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations such as sesame oil, peanut oil, or aqueous propylene glycol; and sterile powders for the immediate preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and fluid enough to be easily injected. The form must be stable under manufacturing and storage conditions and resistant to microbial contamination, such as bacteria and fungi.
[0128] The composition may be formulated in a neutral form or in a salt form. Medicinally acceptable salts include acid addition salts (formed with free amino groups of proteins) and those formed with inorganic acids such as hydrochloric acid or phosphoric acid, or organic acids such as acetic acid, oxalic acid, tartaric acid, and mandelic acid. Salts formed with free carboxyl groups may also be derived from inorganic bases such as sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide, or ferric hydroxide, and organic bases such as isopropylamine, trimethylamine, histidine, and procaine.
[0129] The carrier may also be a dispersion medium, such as a solvent containing water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating agent such as lecithin, by maintaining the required particle size in the case of a dispersion, and by the use of a surfactant. Prevention of microbial action can be achieved by various antimicrobial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and thimerosal. In many cases, it is preferable to include isotonic agents, such as sugars or sodium chloride. Extending the absorption of the injectable composition can be achieved by using absorption-delaying agents, such as aluminum monostearate and gelatin, in the composition.
[0130] Sterile injectable solutions are prepared by incorporating the required amount of the active compound in a suitable solvent along with the various other components listed above, and subsequently sterilizing by filtration, if necessary. Generally, dispersions are prepared by incorporating various sterile active ingredients into a sterile medium containing a base dispersion medium and the other required components from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, preferred methods of preparation are vacuum drying and freeze-drying techniques, by which powders of the active ingredient plus any further desired components are obtained from the pre-filtered solution.
[0131] The effective amount of a therapeutic or prophylactic composition is determined based on the intended target. The terms “unit dose” or “dosage” refer to physically distinct units suitable for use in the subject, each unit containing a predetermined amount of the composition calculated to produce the desired response in relation to its administration, i.e., the appropriate route and regimen. The amount administered according to both the number of treatments and the unit dose depends on the desired protection.
[0132] Further formulations of pharmaceutical delivery systems may be found, for example, in Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. (1975), and Liberman, HA and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, NY (1980). The latest edition of Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton Pa., 16Ed ISBN: 0-912734-04-3, which is incorporated herein by reference in its entirety, provides an overview of formulation techniques generally known to those skilled in the art. Medicinally acceptable carriers suitable for maintaining the optimal stability, shelf life, efficacy, and function of the delivery system will be apparent to those skilled in the art.
[0163] Controlled-release (or sustained-release) preparations can be formulated to extend the activity of the agonist and reduce the frequency of dosing. Controlled-release preparations can also be used to influence the onset time of action or other characteristics, such as the blood level of the agonist, and consequently, the occurrence of side effects. A controlled-release preparation can be designed to initially release a certain amount of the agonist to produce the desired therapeutic effect, and then gradually and continuously release other amounts of the agonist to maintain a level of therapeutic effect over a longer period. To maintain a nearly constant level of the agonist in the body, the agonist can be released from the dosage form at a rate that replenishes the amount of the agonist being metabolized or excreted from the body. Controlled release of an agonist can be stimulated by various inducers, such as changes in pH, temperature, enzymes, water, or other physiological conditions or molecules.
[0133] The compositions described herein can also be used in combination with other therapeutic modalities further described below. Thus, in addition to the therapies described herein, other therapies known to be effective in treating diseases, disorders, or conditions can also be provided.
[0134] II. Method In some embodiments, the Disclosure provides a method for inducing an immune response to a bacterial pathogen, the method comprising administering a polypeptide, polynucleotide, immunogenic composition, or pharmaceutical composition described herein to a subject requiring such administration. The Disclosure also provides compositions for use in inducing an immune response, and the use of such compositions in the manufacture of pharmaceuticals for inducing an immune response.
[0135] This disclosure provides the importance of mediating immunity to bacterial pathogens (e.g., Staphylococcus aureus) by inducing germinal center (GC) and follicular helper T (TFH) responses in subjects requiring it. In some embodiments, this disclosure provides the importance of mediating immunity to bacterial pathogens in the early stages of life, e.g., intrauterine to within approximately 3 years. In some embodiments, this disclosure provides the importance of mediating immunity to bacterial pathogens prior to the first infection by the pathogen. In some embodiments, this disclosure provides a method for inducing an immune response in subjects requiring it, wherein the method involves amino acid substitutions H35L, R66C and E70C (Hla) to the amino acid sequence described in SEQ ID NO: 1. HREThe method comprises administering a modified α-hemolysin (Hla) polypeptide or a derivative or fragment thereof to a subject in need of it. A modified Hla polypeptide according to claim 1, comprising the amino acid sequence described in SEQ ID NO: 11, or a sequence that is at least about 80% identical thereto, or a fragment thereof. The method of the present disclosure may include administering to a subject in need of it a polypeptide comprising the amino acid sequence described in any one of SEQ ID NOs: 6 to 11, or a derivative or fragment thereof, or a polynucleotide encoding a polypeptide disclosed in SEQ ID NOs: 6 to 11, or a derivative or fragment thereof, or an immunogenic composition comprising them.
[0136] As described herein, the method as a whole includes active immunization (administration) of infants at birth or within three years thereafter in their lifetime, followed by booster immunization during the initial vaccination process in early childhood and childhood. For example, the method disclosed herein includes a method for mitigating or preventing Staphylococcus aureus infection in a subject, and the method as a whole includes administering the composition described herein to a subject at birth or shortly thereafter. In some embodiments, the period at birth or immediately thereafter may include, but is not limited to, a period of about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 minutes or more after birth. In some embodiments, the period immediately after birth may include, but is not limited to, a period of approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 hours or more after birth. In some embodiments, the period immediately after birth may include a period of approximately 1, 2, 3, 4, 5, 6, 7 days or more after birth. In some embodiments, the period immediately after birth may include a period of approximately 1, 2, 3, 4, 5, 6, 7, or 8 weeks or more after birth. In some embodiments, active immunity in infants is within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 months after birth. The methods of this disclosure may include active immunity of a subject, in which case the subject may be a child, adolescent, or adult by administration of the composition described herein. In some embodiments, the immunogenic composition can be administered to subjects at any age, for example, under 3 years old, between approximately 3 and 10 years old, between approximately 20 and 30 years old, between approximately 30 and 40 years old, between approximately 40 and 50 years old, between approximately 50 and 60 years old, between approximately 60 and 70 years old, between approximately 70 and 80 years old, between approximately 80 and 90 years old, between approximately 90 and 100 years old, or beyond.
[0137] The method further comprises administering the composition disclosed herein to a subject one or more times after the initial dose. In some embodiments, the one or more further doses include administration within approximately 1, 2, 3, 4, 5, 6, 7 days or more after the initial dose. In some embodiments, the one or more further doses include administration within approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months or more after the initial dose. In some embodiments, the one or more further doses include administration within approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 years or more after the initial dose.
[0138] In other embodiments, the method provides maternal immunity for neonatal protection, coupled with immunity during the initial vaccination process in early childhood. For example, the method disclosed herein includes a method for reducing or preventing Staphylococcus aureus infection in a subject, which, as a whole, involves administering the composition disclosed herein to the mother of the subject while the subject is in utero. In utero is a Latin term literally meaning "inside the womb" or "inside the uterus." In some embodiments, the method induces transplacental transfer of anti-Hla neutralizing antibodies. In some embodiments, the mother is administered the composition during the second or third trimester of pregnancy. Therefore, the composition can be administered to the mother within approximately 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 weeks of pregnancy. The method further includes administering the composition disclosed herein to the subject once or multiple times at birth or immediately after birth, following the initial administration to the mother while the subject was in the womb.
[0139] In some embodiments, the compositions of the present disclosure may be administered by any one of the following routes: oral, intranasal, intravenous, intramuscular, subcutaneous, or even intraperitoneal.
[0140] In some embodiments, the compositions of the present disclosure include Opp3a, DltD, HtsA, LtaS, IsdA, IsdB, IsdC, SdrC, SdrD, SdrE, SdrF, SdrG, SdrH, SrtA, SpA, Sbi, FmtB, beta-hemolysin, fibronectin-binding protein A (FnbA), fibronectin-binding protein B (FnbB), coagulase, Fig, Map, Pantone-Valentine leucocidine (Pvl), alpha toxin and its variants, gamma toxin (hlg) and its variants, ica, immunodominant ABC transporter, Mg2+ transporter, Ni ABC transporter, RAP, autolysin, laminin receptor, IsaA / PisA, IsaB / PisB, SPOIIIE, SsaA, EbpS, Sas It can be administered together with at least one further immunogenic antigen selected from the group consisting of antigens selected from the group consisting of A, SasF, SasH, EFB(FIB), SBI, Npase, EBP, bone sialobinding protein II, aureolisin precursor (AUR) / Sepp1, CNA and its fragments, e.g., M55, TSST-1, mecA, poly-N-acetylglucosamine (PNAG / dPNAG) extracellular polysaccharide, GehD, EbhA, EbhB, SSP-1, SSP-2, HBP, vitronectin-binding protein, HarA, EsxA, EsxB, enterotoxin A, enterotoxin B, enterotoxin C1, and novel autolysins.
[0141] As discussed above, this disclosure relates to inducing an immune response in a subject to the modified Hla polypeptide or its variants or fragments. In one embodiment, the immune response can protect or treat a subject that has, is suspected of having, or is at risk of developing, an infection or related disease. In some embodiments, the method includes inducing an immune response in a subject prior to its first exposure to Staphylococcus aureus. In non-limiting examples, the immune response may be induced in the subject in utero and / or at birth, or within three years postnatally or thereafter.
[0142] In certain aspects of this disclosure, the compositions disclosed herein generate an immune response in a subject, thereby conferring protective immunity to the subject. Protective immunity refers to the body's ability to initiate a specific immune response that protects a subject from developing a particular disease or condition in which an agonist against which an immune response exists is involved. In exemplary embodiments, administration of the compositions disclosed herein produces a GC response and a TFH response. An immunogenically effective amount is an amount that can confer protective immunity to a subject.
[0143] As used herein, the terms “immune response” or its equivalent, “immunological response,” refer to the development of a humoral (antibody-mediated), cellular (antigen-specific T cell-mediated or their secretion-mediated), or both humoral and cellular response directed in a recipient patient to the proteins, peptides, or polypeptides of this disclosure. Such a response may be an active response induced by the administration of an immunogen, or a passive response induced by the administration of an antibody, antibody-containing material, or primed T cells. A cellular immune response is induced by the presentation of a polypeptide epitope associated with a class I or class II MHC molecule to activate antigen-specific CD4(+) T helper cells and / or CD8(+) cytotoxic T cells. The response may also involve the activation of monocytes, macrophages, NK cells, basophils, dendritic cells, astrocytes, microglia, eosinophils, or other components of innate immunity. In some embodiments, immune response refers to the generation of a GC response.
[0144] The presence of a cell-mediated immunological response can be determined by a proliferation assay [CD4(+) T cells] or a CTL (cytotoxic T lymphocyte) assay. The relative contributions of humoral and cellular responses to the protective or therapeutic effect of an immunogen can be identified by separately isolating IgG and T cells from immunized syngenes and measuring their protective or therapeutic effects in a second target.
[0145] The methods of this disclosure include the treatment of diseases or conditions caused by Staphylococcus pathogens, as well as the prevention or mitigation of infections to prevent or minimize the degree of exposure to the pathogens.
[0146] In some embodiments, treatment is administered in the presence of an adjuvant or carrier, with or substantially without other Staphylococcal antigens and / or proteins. Furthermore, in some examples, treatment includes the administration of other agents commonly used against bacterial infections, such as one or more antibiotics.
[0147] Administration of the modified Hla polypeptides or Hla polynucleotides or their variants as disclosed herein may be performed as a single event or over a course of treatment. For example, one or more of the modified Hla polypeptides or Hla polynucleotides as disclosed herein may be administered daily, weekly, bi-weekly, or monthly. In the treatment of acute conditions, the course of treatment is typically at least several days. In certain conditions, treatment may extend from several days to several weeks. For example, treatment may extend for one week, two weeks, or more than three weeks. In more chronic conditions, treatment may extend from several weeks to several months or even more than a year. The composition may be administered in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more doses, and / or the composition may be administered every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 hours, or every 1, 2, 3, 4, 5, 6, 7 days, or every 1, 2, 3, 4, 5 weeks, or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 months, or in any range or combination thereof that can be derived.
[0148] Without further detail, those skilled in the art will be able to make the most of this disclosure based on the above description. Therefore, the following specific embodiments should be construed as illustrative only and not in any way limit the remaining parts of this disclosure. All publications referenced herein are incorporated for the purposes and subject matter of this disclosure as referred herein by reference.
[0149] Various modifications can be made to the materials and methods described above without departing from the scope of this disclosure, so all matters contained in the above description and the examples provided below should be interpreted as illustrative and not as restrictive.
[0150] III. Definition The expressions and terms used herein are for illustrative purposes only and should not be considered limiting. For example, the use of singular terms, such as “one (a),” is not intended to limit the number of items. Similarly, the use of relational terms, such as, but not limited to, “top,” “bottom,” “left,” “right,” “upper,” “lower,” “down,” “up,” and “side,” is used for clarity in specific references to the drawings and is not intended to limit the scope of the concepts of the invention or the scope of the appended claims.
[0151] Any term relating to degree, for example, but not limited to, should be understood as including an exact configuration or a similar but not exact configuration, as used herein and in the appended claims. For example, “substantially flat surface” means an exact flat surface or a similar but not exact surface. Similarly, when the terms “about” or “approximate” are used herein and in the appended claims, should be understood as including the stated value or a value that is three times greater or one-third of the stated value. For example, about 3 mm includes all values from 1 mm to 9 mm, and approximately 50 degrees includes all values from 16.6 degrees to 150 degrees. For example, the above terms may refer to ±5% or less, for example ±2% or less, for example ±1% or less, for example ±0.5% or less, for example ±0.2% or less, for example ±0.1% or less, for example ±0.05% or less.
[0152] A range may be expressed herein as a range from a particular value marked with “approximately” and / or from another particular value marked with “approximately.” Where such a range is expressed, further aspects include a range from one particular value and / or from another particular value. Similarly, where a value is expressed as an approximation by using the antecedent “approximately,” that particular value is understood to form further aspects. Furthermore, each endpoint of a range is understood to be significant either in relation to the other endpoint or independently of the other endpoint. It is also understood that there are several values disclosed herein, and each value is also disclosed herein not only as the value itself but also as the particular value marked with “approximately.” For example, if the value “10” is disclosed, “approximately 10” is also disclosed. Each unit between two particular units is also understood to be disclosed. For example, if 10 and 15 are disclosed, 11, 12, 13 and 14 are also disclosed.
[0153] References in the claims of the specification and conclusion to parts by weight of a particular element or component in a composition indicate the weight relationship between the element or component and any other element or component in the composition or article in which the parts by weight are represented. Thus, in a compound containing 2 parts by weight of component X and 5 parts by weight of component Y, X and Y exist in a weight ratio of 2:5, and such a ratio exists regardless of whether further components are contained in the compound.
[0154] The terms “or” and “and / or” as used herein should be interpreted as encompassing or meaning any one or any combination thereof. Thus, “A, B or C” or “A, B and / or C” means any of the following: “A,” “B” or “C”; “A and B”; “A and C”; “B and C”; “A, B and C.” Exceptions to this definition arise only if the combination of elements, functions, processes or actions is in any way inherently mutually exclusive.
[0155] Unless otherwise defined, all technical and scientific terms used herein have meanings that are generally understood by those skilled in the art in the field to which this disclosure belongs. The following references provide general definitions to those skilled in the art for many of the terms used herein, which are incorporated herein by reference: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). When used herein, the following terms have the meanings attributed to them below unless otherwise noted.
[0156] The expressions and terms used herein are for illustrative purposes only and should not be considered limiting. When referring to elements or preferred embodiments of the disclosure, the articles “a,” “an,” “the,” and “said” are intended to indicate that there is one or more elements. The terms “comprising,” “including,” and “having” are comprehensive and are intended to indicate that there may be additional elements beyond those listed. Wherever the terms “comprising” or “including” are used, the disclosure also expressly intends to include and encompasses a further embodiment of the elements of the disclosure “consisting of,” but the “consisting of” embodiment should be understood to mean that there are no additional elements beyond those listed.
[0157] Where used herein, the terms “optional” or “optionally” mean that the events or circumstances described thereafter may or may not occur, and that the above descriptions include examples of when such events or circumstances occur and examples of when such events or circumstances do not occur. In one embodiment, the method of the Disclosure may include one or more further steps, such as repeating the administration step or changing the administration step.
[0158] Furthermore, because this disclosure can take many different forms, it is intended to be considered as an example of the principles of this disclosure, and is not intended to limit this disclosure to the specific forms shown and described. Any one of the features of this disclosure may be used separately or in combination with any other feature. In this specification, references to “forms,” “multiple forms,” and / or similar terms mean that the referred features and / or multiple features are included in at least one form of this specification. In this specification, separate references to “forms,” “multiple forms,” and / or similar terms do not necessarily refer to the same forms and are not mutually exclusive unless otherwise specifically stated and / or as would be readily apparent to a person skilled in the art from this specification. For example, a feature, structure, process, procedure, or act described in one form may, but not necessarily, be included in other forms. Thus, this disclosure may include a variety of combinations and / or combinations of the forms described herein. In addition, not all forms of this disclosure are essential to the practice of this disclosure as described herein. Similarly, other systems, methods, features, and advantages of the present disclosure will be apparent to those skilled in the art upon consideration of the figures and descriptions thereof. All such further systems, methods, features, and advantages are included herein, within the scope of the present disclosure, and are encompassed by the claims.
[0159] The terms “nucleic acid” or “polynucleotide” refer to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and polymers thereof, either in single-stranded or double-stranded form. Unless otherwise specified, the above terms encompass nucleic acids containing known analogs of native nucleotides that have similar binding properties to a reference nucleic acid and are metabolized in a similar manner to naturally occurring nucleotides. Unless otherwise noted, a particular nucleic acid sequence implicitly includes its conservatively modified variants (e.g., degenerate codon substitutions), alleles, orthologues, SNPs, and complementary sequences, as well as sequences explicitly indicated. Specifically, degenerate codon substitutions can be made by generating sequences in which the third position of one or more selected (or all) codons is substituted with a mixed base and / or a deoxyinosine residue; see, for example, Batzer et al., Nucleic Acid Res. 19:5081 (1991), the disclosure of which is incorporated herein in its entirety.
[0160] The terms “peptide,” “polypeptide,” and “protein” are used interchangeably and refer to compounds composed of amino acid residues covalently linked by peptide bonds. A protein or peptide will necessarily contain at least two amino acids, and there is no limit to the maximum number of amino acids that can constitute a protein or peptide sequence. Polypeptides include any peptide or protein containing two or more amino acids linked to each other by peptide bonds. As used herein, the above terms refer to both short chains, which are also commonly referred to in the art as peptides, oligopeptides, and oligomers, for example, and longer chains, which are commonly referred to in the art as proteins, of which many types exist. “Polypeptides” include, among many others, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins, and so on. Polypeptides include native peptides, recombinant peptides, or combinations thereof.
[0161] In the context of this application, proteins are represented by amino acid sequences, and accordingly, nucleic acid molecules or polynucleotides are represented by nucleic acid sequences. Sequence identity and similarity: Throughout this application, whenever a particular amino acid sequence number (e.g., sequence number Y) is referenced, that sequence may be replaced by a polypeptide represented by an amino acid sequence having at least 60% sequence identity or similarity to sequence number Y. Another preferred level of sequence identity or similarity is 65%. Another preferred level of sequence identity or similarity is 70%. Another preferred level of sequence identity or similarity is 75%. Another preferred level of sequence identity or similarity is 80%. Another preferred level of sequence identity or similarity is 85%. Another preferred level of sequence identity or similarity is 90%. Another preferred level of sequence identity or similarity is 95%. Another preferred level of sequence identity or similarity is 98%. Another preferred level of sequence identity or similarity is 99%.
[0162] Each amino acid sequence described herein, in a more preferred embodiment, is, by the percentage of its identity or similarity to a given amino acid sequence, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, and at least 75% of the given nucleotide or amino acid sequence. Each has 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity or similarity, respectively. The terms “homology” and “sequence identity” are used interchangeably herein. Sequence identity is described herein as a relationship between two or more amino acid (polypeptide or protein) sequences, or between two or more nucleic acid (polynucleotide) sequences, determined by comparing sequences. In a preferred embodiment, sequence identity is calculated based on the full lengths of two given sequence numbers or on parts thereof. The part of this preferably means at least 50%, 60%, 70%, 80%, 90%, or 100% of the sequence numbers of both sequences. In the art, "identity" also refers to the degree of sequence relationship between amino acid sequences or nucleic acid sequences, depending on the context, determined by the matching of strings of such sequences. The degree of sequence identity between two sequences can be determined by comparing the two sequences using computer programs commonly used for this purpose, such as global or local alignment algorithms.Non-restrictive examples include BLASTp, BLASTn, Clustal W, MAFFT, Clustal Omega, AlignMe, Praline, GAP, BESTFIT, or other suitable methods or algorithms. Needleman and Wunsch's global alignment algorithm can be used to align two sequences over their entire length or a portion of them (where a portion can mean at least 50%, 60%, 70%, 80%, or 90% of the sequence length), thereby maximizing the number of matches and minimizing the number of gaps. Default settings can be used, and the preferred programs are Needle for pairwise alignment (in one embodiment, EMBOSS Needle 6.6.0.0, gap open penalty: 10, gap extent penalty: 0.5, end gap penalty: false, end gap open penalty: 10, end gap extent penalty: 0.5 are used) and MAFFT for multiple sequence alignment (in one embodiment, MAFFT v7 default value: BLOSUM62[bl62], gap open: 1.53, gap extension: 0.123, order: align, number of phylogenetic tree reconstructions: 2, guided phylogenetic tree output: ON[true], maximum iterations: 2, run FFTS: none are used).
[0163] The "similarity" between two amino acid sequences is determined by comparing the amino acid sequence of one polypeptide and its conserved amino acid substitutions with the sequence of the second polypeptide. Similar algorithms used to determine sequence identity can be used to determine sequence similarity. Where appropriate, those skilled in the art may also consider so-called conserved amino acid substitutions when determining the degree of amino acid similarity. As used herein, "conservative" amino acid substitution refers to the interchangeability of residues having similar side chains.
[0164] For example, the group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; the group of amino acids having aliphatic hydroxyl side chains is serine and threonine; the group of amino acids having amide-containing side chains is asparagine and glutamine; the group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; the group of amino acids having basic side chains is lysine, arginine, and histidine; and the group of amino acids having sulfur-containing side chains is cysteine and methionine. Preferred conserved amino acid substituent groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Substitutional variants of the amino acid sequences disclosed herein are those in which at least one residue in the sequence of this disclosure is removed and a different residue is inserted in its place. Preferably, the amino acid changes are conserved. The preferred conservation substitutions for each of the naturally occurring amino acids are as follows: Ala to Ser; Arg to Lys; Asn to Gln or His; Asp to Glu; Cys to Ser or Ala; Gln to Asn; Glu to Asp; Gly to Pro; His to Asn or Gln; Ile to Leu or Val; Leu to Ile or Val; Lys to Arg; Gln or Glu; Met to Leu or Ile; Phe to Met, Leu or Tyr; Ser to Thr; Thr to Ser; Trp to Tyr; Tyr to Trp or Phe; and Val to Ile or Leu.
[0165] As used herein, “operably linked” means that the expression of a gene is under the control of a regulatory element to which this gene is spatially connected. In some cases, the regulatory element is a promoter, and as used in this context, the expression of a gene is under the control of a promoter to which this gene is spatially connected. The regulatory element (e.g., a promoter) may be located 5' (upstream) or 3' (downstream) of the gene under its control. The distance between the regulatory element (e.g., a promoter) and the gene may be approximately the same as the distance between the regulatory element (e.g., a promoter) and the gene it controls in the gene from which the regulatory element (e.g., a promoter) originates. As is known in the art, variations in this distance can be acceptable without loss of function (i.e., without loss of promoter function).
[0166] As used herein, “regulatory element” refers to any sequence element that positively or negatively regulates the expression of a operably linked sequence. “Regulatory elements” include, but are not limited to, promoters, enhancers, leaders, transcription start sites (TSS), linkers, 5' and 3' untranslated regions (UTR), introns, polyadenylation signals, and stop regions or sequences that are appropriate, necessary, or preferred for regulating or enabling the expression of a gene or transcriptionable DNA sequence in a cell. Further such regulatory elements may be appropriate and used to enhance or optimize the expression of a gene or transcriptionable DNA sequence. Regulatory sequences may be, for example, inducible, non-inducible, constitutive, cell cycle regulating, and metabolic regulating. Regulatory sequences may be promoters. As used herein, the term “promoter” refers to a DNA sequence that includes and associates an RNA polymerase binding site, a transcription start site, and / or a TATA box, and that assists or promotes the transcription and expression of a transcriptionable polynucleotide sequence and / or gene (or transgene). Promoters may be synthetically constructed, modified, or derived from known or naturally occurring promoter sequences or other promoter sequences. Promoters may also include chimeric promoters containing combinations of two or more heterologous sequences.
[0167] A "fragment" or "part" of an amino acid sequence is an amino acid sequence whose length is reduced compared to a reference amino acid (for example, reduced by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250 or more amino acids), as well as an amino acid sequence identical to the above reference amino acid sequence. It can be understood that this means an amino acid sequence containing, essentially consisting of, or consisting of nearly identical (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical) consecutive amino acid sequences. Such amino acid fragments or portions according to this disclosure may, where appropriate, be included in a larger amino acid sequence of which it is a component.
[0168] As used herein, “isolated” means a biological component (e.g., nucleic acid molecules, nucleic acid sequences, proteins, or viruses) that has been substantially separated or purified from other biological components (e.g., DNA and RNA on and outside other chromosomes, proteins, and / or intracellular organelles). “Isolated” nucleic acids, proteins, and / or viruses include nucleic acids, proteins, and viruses purified by standard purification methods. The above term also includes nucleic acids, proteins, and viruses prepared by recombinant expression in host cells, as well as chemically synthesized nucleic acids or proteins. The term “isolated” (or “purified”) does not require absolute purity; rather, it is intended as a relative term. Thus, for example, an isolated or purified nucleic acid, protein, virus, or other active compound is one that has been isolated whole or partially from associated nucleic acids, proteins, and other contaminants. In one embodiment, the term “substantially purified” means a nucleic acid, protein, virus, or other active compound that has been isolated from cells, cell culture media, or other crude preparations and has been subjected to fractionation to remove various components of the initial preparation, such as proteins, cell debris, and other components. In one embodiment, the isolated protein or nucleic acid, or cells containing such, are, in some examples, of at least 50% purity, e.g., at least 75%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 100% purity. The isolated nucleic acid molecule may contain one or more naturally occurring sequences, recombinant sequences, or combinations thereof. The isolated nucleic acid molecule may contain one or more genes, transcriptional regulatory sequences, translational regulatory sequences, coding sequences, non-coding sequences, plasmids, vectors, or viral vectors. The isolated nucleic acid molecule may also contain one or more modified nucleotides. [Examples]
[0169] The following embodiments are included to demonstrate preferred embodiments of the Disclosure. Those skilled in the art will understand that the techniques disclosed in the following embodiments are techniques discovered by the inventors to function well in the practice of the Disclosure, and therefore, the disclosed techniques may be considered to constitute a preferred form of that practice. However, those skilled in the art will understand that many modifications can be made to the specific embodiments disclosed in light of the Disclosure without departing from the spirit and scope of the Disclosure, and similar or comparable results can still be obtained.
[0170] In some aspects, this disclosure is the result of extensive intellectual and experimental efforts to identify optimized, non-toxic Hla variant immunogens that can induce sustained protective immunity against SSTIs when vaccines are delivered in the neonatal period. Staphylococcus aureus α-toxin (Hla) is a highly conserved pore-forming toxin that contributes to the pathogenesis of each of the main symptoms of staphylococcal diseases. Expressed by virtually all clinical isolates, Hla utilizes A disintegrin and metalloproteinase 10 (ADAM10) as cell receptors to inflict damage on host cells. ADAM10 is a type I transmembrane protein widely expressed in human cells (Figure 1). Characterized by its N-terminal metalloproteinase domain, ADAM10 contributes to cell and tissue development, homeostasis, and response to injury in response to proteolytic cleavage of ADAM10 substrates in a cell-type-specific manner. When an Hla monomer binds to ADAM10, the assembly of a heptameric toxin pore is initiated. Pore formation on the host cell membrane leads to upregulation of ADAM10 catalytic activity and simultaneous cleavage of native ADAM10 substrates, including E-cadherin, VE-cadherin, and platelet glycoprotein VI. These cleavage events, along with cell damage caused by Hla pore formation, ultimately result in tissue-specific invasion exhibited in Staphylococcus aureus diseases.
[0171] Among the pathogenic factors of Staphylococcus aureus, Hla is unique in its ability to impair antigen-specific T cell responses and consequently promote recurrent infections. The data provided herein indicate that anti-Hla antibody titers are elevated in pediatric subjects exhibiting protection against recurrent infections, thus defining a correlational element of human protective immunity. This finding suggests that inducing a high level of neutralizing anti-Hla antibody response early in life is a strategic target for vaccine development. Therefore, we designed a vaccine development approach to identify optimized, non-toxic Hla variant immunogens that can induce sustained protective immunity against SSTIs when vaccines are delivered in the neonatal period. Such development efforts focused on understanding the Hla-ADAM10 interaction and the dramatic conformational changes that Hla undergoes to form heptameric pores.
[0172] [Example 1] Analysis of age-specific serological anti-HLA titers. Exposure to Staphylococcus aureus occurs within the first few weeks to months of life. In pediatric populations, Staphylococcus aureus skin and soft tissue infections (SSTIs) are associated with disease recurrence in up to 50% of children. Children exhibiting protection against recurrent disease have elevated anti-Hla antibody titers, which presupposes a correlational element of human protective immunity. This finding suggests that inducing a high neutralizing antibody response to Hla early in life is a strategic target for vaccine-mediated protection against Staphylococcus aureus. Infants aged <1 year have been shown to retain lower anti-Hla serological titers and neutralizing ability than individuals aged >2 years. To further elucidate the effect of age on the generation of anti-Hla responses in infant and pediatric populations, we evaluated a group of 343 subjects ranging in age from <1 year to 18 years.
[0173] [Table 1]
[0174] Analysis of age - specific serological anti - Hla titers revealed that the half - maximal effective concentration (EC 50 ) increased gradually over the first 5 years of life, and that the titers in children less than 2 years old were most clearly different from those in older children (Figure 2A). Analysis of the serum Hla neutralizing activity in a rabbit red blood cell (rRBC) protection assay confirmed that subjects <2 years old exhibited response immaturity (Figure 2B). Colonizing exposure to Staphylococcus aureus has been documented to occur during the first days and weeks of life. In fact, the mortality rate due to Staphylococcus aureus infection over the first 4 years of life is comparable to that seen in older adults1. Taken together, what these data suggest is that both Staphylococcus aureus disease and modification of the host response to this pathogen are risks that occur early in life.
[0175] [Example 2] Development of modified non - toxic HLA variants A vaccine development approach was designed to induce immunity against Staphylococcus aureus infection through neonatal vaccination. We hypothesized that subsequent conformational changes that induce Hla - ADAM10 interaction and pore formation might affect vaccine efficacy. A series of modified Hla antigens were designed based in part on predicted immunogenic properties derived from a combination of conventional knowledge and T - cell epitope prediction algorithms, based on the structural determinants and correlative elements of toxin function. Six distinct antigens were generated and evaluated, starting with three full - length Hla variant antigens appended with a 6× - histidine tag to facilitate affinity purification (Figure 3A): Hla H35L has been extensively studied as a toxoid vaccine that binds to ADAM10 but cannot form stable pores; Hla D45A / Y118F has been predicted to prevent the unfolding of the b - barrel stem domain; Hla R66C / E70CIt has been predicted that it impairs ADAM10 binding. A panel of peptide antigens (Figure 3B): Hla50, which holds a five-tandem array of the first 50 amino acids of Hla that induce protective immunity in animal models; HlaP1, a synthetic antigen that holds a five-tandem array of T cell epitopes Hla36-50 predicted in the immunoepitope database; and HlaP2, a synthetic antigen that holds three distinct predicted T cell epitopes derived from Hla (Hla36-50, Hla51-65, and Hla161-175). Each antigen was screened by delivery to multiple groups of mice to examine the efficacy of the vaccine compared to Freund's adjuvant controls. Staphylococcus aureus (1 × 10⁻⁶) 8 In subcutaneous challenge screening using colony-forming units, Hla H35L Hla D45A / Y118F Hla R66C / E70C Mice receiving each vaccine showed protection against abscess formation and skin necrosis (Figure 3C). In contrast, mice receiving the peptide vaccine exhibited lesions similar to or larger than those observed in Siamese-vaccinated mice.
[0176] To further investigate the vaccine characteristics of the three full-length antigens, Hla D45A / Y118F Furthermore, by modifying HlaR66C / E70C and introducing the H35L mutation, complete detoxification was ensured, which was verified by a rabbit erythrocyte lysis assay (Figure 3D, HlaH35L is denoted as HlaH, and HlaH35L / D45A / Y118F is denoted as Hla). HDY It states that HlaH35L / R66C / E70C is Hla HRE (He wrote this.)
[0177] [Example 3] Characterization of modified non-toxic HLA mutants As an initial functional immunological screening, each candidate antigen was delivered to mice in a prime-boost regimen formulated with Freund's adjuvant. Each candidate antigen enhanced the antigen-specific memory T cell response to infection, as demonstrated by utilizing the ovalbumin-specific OT-II T cell line and ovalbumin-expressing Staphylococcus aureus strains (Figure 4A). To evaluate the B cell response to immunity, serum toxin neutralization ability was determined in a rabbit erythrocyte (rRBC) lysis protection assay, and the 50% anti-Hla titer (EC50) in serum from vaccinated mice was quantified. The vaccine-induced antibody response varied in an antigen-specific manner, and Hla HRE This induced a high degree of toxin neutralization (Figure 4B). This finding suggests that nearly identical antigens based on their primary sequences can exhibit distinct biological properties that alter antigenicity and the host immune response.
[0178] To further characterize the biochemical properties of the candidate antigens, ADAM10 binding was evaluated using a high-sensitivity rRBC binding assay. H Compared to wild-type Hla, it showed conservation of binding, but Hla HDY Regarding binding, there is a decrease and Hla HRE Regarding binding, there was almost complete disappearance (Figure 4C). Analysis of the melting curves of each antigen revealed that Hla HDY The variants are Hla, HlaH, and Hla HRE It became clear that this is structurally distinct (Figure 4D), and this indicates that Hla HDY SDS-PAGE analysis confirmed that the mutants formed oligomeric toxins (Hla7) in solution without exposure to the cell membrane (Figure 4E), while wild-type Hla and other mutants existed only as monomers (Hla1). The biological characteristics of these Hla mutants in rRBCs were investigated. Oligomers formed by wild-type Hla were observed to exhibit temperature stability up to 65°C (Figure 4F left), suggesting that Hla mutants were unable to form temperature-stable oligomers. H Functional defects in the mutants were clearly identified (Figure 4F left). Hla HDYWhile it retains oligomer formation ability on the cell membrane in proportion to its binding ability (Figure 4F right), on the other hand, limited monomer binding and oligomer formation are found in Hla HRE This was evident in the mutant (Figure 4F right). Hla on the rRBC surface. HRE To evaluate the oligomer formation efficiency of Hla, H Hla concentration is gradually increased until an equivalent amount of monomer toxin rRBC binding is obtained as observed. HRE The following was tested (Figure 4G). By quantifying the concentration of oligomers: monomer ratios, Hla HRE Regarding Hla, compared to the 1.9:1 ratio... H It was revealed that the ratio is 3.6:1, and this means that Hla HRE In addition to the binding defects observed in the antigen, functional oligomer formation defects were also shown. Since Hla enables heptameric membrane pore formation through a sequence of ordered intramolecular movements upon binding, based on the incorporation of two cysteine residues that may enable disulfide bond formation, Hla HRE A relative defect in the formation of functional oligomers may mean that the three-dimensional structure of such antigens is more broadly restricted. HRE To determine whether the antigen has a disulfide bond between C66 and E70, the antigen was subjected to mass spectrometry-based analysis, and this analysis revealed that the purified Hla HRE It was revealed that the majority of these molecules actually incorporate intramolecular disulfide bonds (Figure 4H).
[0179] [Example 4] Characterization of vaccine efficacy using candidate antigens The protective efficacy of each antigen was evaluated in a prime-boost neonatal vaccination model (Figure 5A), and the results showed that neonates and infants represent a targetable population for vaccines that should enhance the anti-Hla antibody response in humans (Figures 2A and 2B). Several immunological challenges arise in vaccine design for the neonatal population. The neonatal immune response is characterized by delayed germinal center (GC) formation and a resulting decrease in the quantity and quality of affinity-mature antibody responses. Furthermore, the increased frequency of FoxP3+ regulatory T (TREG) cells in neonates, coupled with the presence of maternal antibodies that can modulate the availability and presentation of vaccine antigens, amplifies the challenges of vaccine formulation for such populations. Initial investigations were conducted for each candidate antigen formulated with four adjuvants: alum, AddaS03 (AS03-like), MPLA+alum (AS04-like), and CpG-ODN1585. These arrays for adjuvants were selected for initial research due to their distinct immunostimulatory properties, as a broad-based approach to vaccine formulations would allow the inventors to specifically evaluate the relevance of antigenic mutations. To rigorously investigate vaccine protection, high-inoculation Staphylococcus aureus (1 × 10⁻⁶) was performed. 8 Primary SSTI was induced in 5-6 week old mice using CFUs of Hla (Figure 5A) under the condition that a secondary challenge was performed on the contralateral flank 21 days after the initial infection. When formulated with alum, all antigens induced protection against primary abscess formation (Figure 5B left) and skin necrosis (Figure 5B right). In the event of recurrent infection, Hla HRE This induced a high level of protection against abscess formation and skin necrosis (Figure 5C), while Hla H Vaccines and HLA HDY The vaccine provided limited protection. Without reboosting, the vaccine-mediated protection decreased, Hla HRE Compared to what was observed for (94.4±2.6%~76.5±8.3%), Hla H (76.9±9.3%~28.4±11%) and Hla HDYThis was particularly pronounced for (76.1±13%~11.5±4.6%). HRE In the vaccine candidates, enhancement of protective immunity was observed during the secondary infection process regardless of the adjuvant used [Figure 5F, AddaS03(a), MPLA+Alum(b), CpG-ODN1585(c)]. Analysis of serum anti-Hla neutralizing antibody titers from each group of mice vaccinated prior to primary infection showed that, regardless of the adjuvant, Hla neutralization was enhanced. HRE A significant effect was observed in mice that had received the antigen (Figure 5D).
[0180] Correlation analysis of serological anti-Hla antibody responses and toxin neutralizing activity from each group of immunized mice reflects the importance of vaccine antigens as the primary determinant of vaccine-mediated protection, Hla HRE The vaccine is HLA H Compared to the vaccine, each adjuvant group induced an improved antitoxin-neutralizing antibody response (Figure 5E, Figure 3e; alum, 92.3x; AddaS03, 23.8x; MPLA + alum, 84.2x; CpG-ODN1585, 14.6x).
[0181] [Example 5] HLA in mice HRE Characterization of defensive effectiveness Hla HRE The degree of immunological protection provided by this antigen, coupled with an improved functional antitoxin neutralization response, suggests that this antigen is related to Hla H The goal is to more effectively induce affinity maturation as a result of the GC response. The GC response requires dynamic interactions between antigen-presenting cells in the influx area lymph nodes (dLNs) and between B cells and T cells. Activation of antigen-specific T cells is necessary to initiate the dLN response to vaccination, while differentiated follicular helper T cells (T) FH ) cells are essential for affinity-based positive selection of GC B cells. Upregulation of CXCR5 in a subset of activated T cells within the interfollicular region of dLN leads to the localization of T cells to nascent GCs and T FH Upregulation of Bcl6, a transcription factor that determines cell lineage, becomes possible.FH The essential role of the compartment is evident in Bcl6 knockout mice, which lack GC and are therefore unable to produce a mature antibody response. The nature of the GC response is related to Hla H Antigen and HLA HRE To evaluate whether the mice could differentiate antigens, we tested the kinetics of the development of the anti-HLA neutralizing response to vaccination. By limiting the blood volume and tissue of neonatal mice, 5-week-old mice were subjected to prime-boost vaccine delivery using each antigen with alum as an adjuvant. As early as one week after boosting, HLA H Compared to the response of Hla HRE A significant improvement in the Hla neutralizing antibody response was induced (Figure 6A). The induced antibody response was expected to fully mature 3 weeks after boosting. H Antigen and HLA HRE An increase in neutralizing antibody titers was observed for both antigens, however, the HlaH-induced response was Hla HRE The scale of these induced responses remained lower than that of the induced responses (Figure 6A). The functional characteristics of these induced antibodies were evaluated by assessing the blockade of radiolabeled Hla binding (Figure 6B) and oligomerization (Figure 6C) in rabbit erythrocytes. In both tests, Hla HRE The induced antibody exhibited enhanced performance compared to the HlaH-induced antibody.
[0182] Expanding this study, Hla H or Hla HRE Cellular responses within the iliac lymph node response in the vaccine inflow area were directly evaluated 7 days after prime-boost vaccination using either of the two vaccines. No differences were observed in either the total population of CD19+ GC B cells marked by GL7 / Fas co-expression (Figure 6D) or proliferative (Ki67+) CD19+GL7+Fas+ B cells (Figure 6E). Similarly, no significant differences were observed in the dLN total CD4+ T cell compartment between the two vaccines (Figure 6F). In contrast, Hla HREIn immunized mice, elevated median CXCR5 fluorescence intensity was observed in bulk CD4+ populations (Figure 6G) and Ki67+CD4+ cells (Figure 6H). CXCR5 expression enables these cells to migrate to the nascent germinal center during the early T1 stage. FH Since it is necessary for differentiation, what this discovery suggests is that Hla HRE The antigen is pre-T FH The goal is to amplify the response.
[0183] Hla HRE Vaccine-mediated protection against infection FH We hypothesized that this could induce an amplification of the response. We examined the CXCR5+ compartment in the dLN of vaccinated mice 7 days after secondary Staphylococcus aureus SSTI. Following infection, clinical lesions were observed in Siamese-vaccinated mice and Hla H Although still pronounced in vaccinated mice, Hla HRE In vaccine recipients, the infection was localized (Figure 6I). FH Since the population is relatively rare in dLN, the inventors first analyzed pooled dLN using mass cytometry, and as a result, gated on CXCR5+ cells co-expressing ICOS and PD1, which led to Hla H Compared to that of vaccinated mice, Hla HRE Vaccinated mice showed an increase in the CD4+CXCR5+ICOS+PD1+ compartment (Figure 6L). To enhance the specificity of this analysis, we utilized a flow cytometry approach to detect CXCR5hiCD4+ T cells co-expressing Bcl6 in individual dLNs collected following Staphylococcus aureus infection. Siamese vaccinated mice and Hla H Compared to vaccinated mice, Hla HRE Animals receiving the treatment are CD4+CXCR5hi Bcl6+T FH The group expanded (Figure 6J).
[0184] Next, Hla HREWe investigated whether the beneficial effects of vaccination reflect the role of Hla in modulating the T cell compartment. Previous studies have revealed that Hla dampens antigen-specific T cell responses, but such studies do not include an assessment of the functional specificity of the response. Multiple groups of mice were infected with wild-type Staphylococcus aureus or its isogenic Dhla mutant, and the dLNs were subjected to mass cytometry 7 days after primary infection. Deletion of Hla was associated with an increase in the 5+ ICOS + PD1 + T FH population (Figure 6M). Analysis of individual mice infected with WT Staphylococcus aureus, Dhla, and the Dhla mutant complemented with a plasmid enabling restoration of Hla expression (Dhla::phla) revealed that Hla expression had a negative impact on the hi Bcl6 + T FH population (Figure 6K).
[0185] In the field of Staphylococcus aureus, there is a growing recognition that vaccine failure may be partly due to the delivery of vaccines to non-naïve hosts that retain existing immune responses that will be amplified by vaccination. Hla HRE Regarding the protective efficacy of vaccines, we evaluated it in two clinical contexts where existing immunity is relevant: in the passive transfer of maternal antibodies that may modulate the bioavailability and / or antigenicity of vaccine antigens, and in the setting of prior Staphylococcus aureus infection. First, we conducted a test to examine whether mother mice immunized with Hla HRE could confer protection against Staphylococcus aureus infection to their offspring (Figure 7A). Hla HREPups from immunized dams exhibited protection against skin abscesses and skin necrosis (Fig. 7B, blue) compared to pups from sham-immunized dams (black), reflecting a neutralizing anti-Hla response (Fig. 7C). To assess whether passive transfer of maternal antibodies impaired the protective response to subsequent neonatal vaccination, we examined whether circulating anti-Hla antibodies in the offspring adversely affected the clinical outcome of active vaccination. Pups from sham-immunized (gray) dams and Hla HRE -immunized (green) dams were vaccinated with Hla HRE and subsequently challenged with Staphylococcus aureus. Both groups demonstrated protection against Staphylococcus aureus challenge, as observed in pups born to dams receiving passive immunity from maternal immunization (blue), suggesting that prior maternal immunity did not adversely affect the functional outcome of active immunity. Understanding that passively transferred antibodies persist in mouse offspring for approximately 15 weeks of life, we extended these maternal-infant studies by assessing the duration of the serological response in the offspring. Mice from each vaccine group were sampled at 6, 8, 10, and 16 weeks of life and evaluated for serum Hla neutralization properties. Robust passive transfer of anti-Hla neutralizing function was observed, consistent with the protection observed following maternal immunization (Fig. 7G blue). Active immunity in pups following maternal Hla HRE immunization (green) was indistinguishable from active immunity (gray) observed in Hla HRE -vaccinated pups born to sham-vaccinated dams with alum alone, indicating that exposure to maternal anti-Hla antibodies did not cause loss of function of the Hla HRE vaccine response. As expected based on the known kinetics of the vaccine response, a progressive decline in neutralizing antibody titers occurred in all groups over the 10- to 16-week period. When mice from each group were rechallenged with Staphylococcus aureus, we found that Hla HRE vaccine, regardless of presence or absence, Hla HREIn mice that had received active immunization, an anti-HLA serological recall response was observed.
[0186] Previous Staphylococcus aureus infection Hla HRE To extend this study toward directly evaluating whether the protective efficacy of vaccination was modulated, multiple groups of naive mice were subjected to Staphylococcus aureus SSTI at 5 weeks of age, followed by Hla with either alum alone or alum adjuvant. HRE A prime-boost vaccine regimen was implemented using the vaccine (Figure 7D). HRE This resulted in almost complete protection against infection in the contralateral flank two weeks after the boost (Figure 7E), which reflects a neutralizing anti-Hla response (Figure 7F). In summary, this finding suggests that Hla HRE One potential advantage of vaccination with antigenic variants is that it may not be affected by the harmful impact of existing immunity on vaccine outcomes.
[0187] Hla HRE To understand the versatility of the vaccine, its protective efficacy was evaluated in a series of distinct biological settings. Staphylococcus aureus skin infections are typically modeled in male mice, both for the epidermal structure of the skin which facilitates histopathological analysis, and for the degree of lesion variability resulting from the enhanced androgen-mediated pathogenicity of Staphylococcus aureus. First, Hla was used to protect female mice from severe SSTI following neonatal vaccination. HRE The vaccine's effectiveness was demonstrated (Figure 8A), which was consistent with the induction of an anti-Hla neutralizing antibody response (Figure 8B). Secondly, the protective effectiveness was evaluated in young mice that were not exposed to vaccination as neonates. Multiple groups of 3-week-old naive mice were evaluated for Hla neutralization with alum alone or alum adjuvant. HRE They received priming immunity by either of the following, followed by a boost 14 days later (Figure 8C). When subjected to a primary Staphylococcus aureus infection, Hla HREVaccinated mice exhibited protection from infection (Figure 8D), which similarly reflects a productive neutralizing anti-Hla antibody response (Figure 8E).
[0188] Successful vaccine design, evaluation, and implementation in human populations require both antigen optimization and knowledge of the mechanisms by which separate adjuvants amplify the desired host immune response. First, Hla HRE We ensured that the unlabeled variant of the antigen was functional. (Labeled Hla) HRE (HIS-Hla HRE Neonatal vaccination using both the labeled and unlabeled portions induced significant protection against Staphylococcus aureus skin infections (Figure 9A). A minor improvement in the clinical efficacy of the unlabeled variant was observed in the early stages of infection, but neutralization IC was not achieved. 50 The results were nearly identical for both antigens (Figure 9B). As provided in Example 4, Hla HRE Adjuvant-specific differences observed in the efficacy of vaccine-mediated protection (Aram, AddaS03, MPLA+Aram and CpG-ODN1585) were observed in dLN. FH It reflected the degree of response. FH An inverse correlation was observed between cell recovery rate and clinical abscess size (Figure 9C). Consistent with this finding, IC 50 and T FH A direct correlation was observed between the responses (Figure 9D). In summary, this finding suggests that Hla HRE T as an immune correlation element of vaccine protective efficacy FH The importance of the response has been emphasized, and it has been suggested that the degree of this response can be modulated by the vaccine formulation.
[0189] [Example 6] Consideration This finding leverages the observation that the anti-Hla response is a clear correlated element of human protective immunity against Staphylococcus aureus in pediatric populations. Through population-level analysis characterizing the development of the anti-Hla response in childhood, specific opportune moments in the first two years of life were identified to amplify this functional response. A novel candidate Hla antigen, Hla, is distinguished by its ability to induce a potent toxin neutralizing response when delivered in the context of preclinical vaccination of neonatal mice. HRE Hla was developed. HRE Analysis of the protective immunity mechanism induced by Hla revealed that HRE T as a functional correlation element of vaccine-mediated protection FH The importance of this is that prior exposure to Hla (which is almost universal in adults based on serological findings) is related to Hla HRE This suggests that it is not an a priori limitation for favorable outcomes regarding the induction of a protective immune response to vaccination.
[0190] Vaccine development targeting Staphylococcus aureus has been hampered by a lack of understanding of the T-cell response to this pathogen. As a result, vaccines have not been designed to induce T-cell specific correlated elements of immune defense. HLA neutralization is essential for defense against antigen-specific T-cell responses during infection, and therefore, by this, HLA HRE This provides a presumptive mechanism for the observed clinical efficacy of the vaccine. Detoxified Hla variants (including HlaH35L and HlaH35L / H48A) have been previously considered or are currently being evaluated for vaccine development. The studies disclosed herein illustrate how specific Hla antigen types affect the degree of the neutralizing antibody response, revealing that some Hla variants may produce only moderate vaccine protection. This difference in response may be overcome by delivering higher antigen quantities or alternatively through booster regimens, while Hla may play a role in amplifying the host immune response. HREThe efficacy of the antigen may be advantageous in enabling antigen reduction, and in settings such as neonates and the elderly, where vaccine-induced responses may be limited by the inherent characteristics of host immunity.
[0191] Currently, Hla HRE The antigen was detected as a result of the initial vaccine delivery. FH The precise molecular mechanisms that amplify the response and affinity maturation of anti-Hla antibodies are not fully understood. Antigen specificity and the duration of antigen availability to GC B cells are the primary determinants of the GC response. H Compared to the increase observed during immunization, Hla HRE The observed increase in CXCR5 expression on CD4+ T cells after delivery suggests that Hla HRE This is because this cytokine more effectively stimulates the IL-21 response in dLN, which is because this cytokine T FH Because it is essential for differentiation. H Compared to Hla HRE It was completely unexpected that these two amino acid substitutions would so drastically alter the outcome of vaccination. To fully elucidate the biological differences underlying the observed antigen specificity, detailed analyses of antigen transport kinetics, intracellular uptake, and the duration of antigen availability in GC will be necessary. H and Hla HRE Since these are functionally distinguished by their ADAM10 binding ability, it would be interesting to understand whether the cellular transport of the Hla-ADAM10 complex modulates antigen distribution and processing in both professional and non-professional antigen-presenting cells.
[0192] Hla as an antigen HRE Since its unique properties are observed when formulated with multiple distinct adjuvants, the findings of this disclosure enable several opportunities to enhance the development of Staphylococcus aureus vaccines. First, the findings of this disclosure compel us to focus on the vaccine antigen itself in order to optimize the outcomes of vaccination.HRE However, whether its use is being considered in the context of unit price or in the presence of other vaccine antigens, its biological properties are expected to amplify the response of induced Hla neutralizing antibodies. Secondly, what this study points out is that T FH The response can serve as a second immunological correlative of vaccine-mediated protection, which can be evaluated and potentially targeted in human populations through adjuvant selection, although this adjuvant selection varies depending on the target population of the vaccine. Finally, this study further highlights the importance of Hla neutralization by Staphylococcus aureus vaccine. As a toxin that hinders the development of T cell-mediated immunity against Staphylococcus aureus, Hla neutralization is expected not only to protect against Hla-mediated cell damage in the disease, but perhaps more importantly, to ensure that the T cell compartment remains viable and ready to support the generation of diverse immune responses against the pathogen. Therefore, Hla neutralization in the early stages of life is important. HRE By delivering a vaccine containing Hla, lifelong protection against early Staphylococcus aureus infection can be achieved, while simultaneously enabling the success of Staphylococcus aureus vaccines developed for later administration to protect against disease-specific pathogenic factors. Thus, Hla HRE Vaccines can provide novel opportunities to advance the development of population-level Staphylococcus aureus vaccines.
[0193] [Example 7] method Participant population, sample, and data collection This study was approved by the University of Chicago Institutional Review Board. Written informed consent was obtained from all participants. Participants were children under 18 years of age who were receiving sedation or imaging at Comer Children's Hospital. At enrollment, the study staff collected swab samples from each participant's anterior nostril, axilla, and inguinal folds and assessed the colonization status of Staphylococcus aureus via a culture-based method. Participants or their parents / legal guardians were asked to complete questionnaires regarding the participant's background, current and past medical history, and any history of Staphylococcus aureus infection or known skin / soft tissue infection in the participant or household members. Finally, serum samples were obtained from each participant. Samples were anonymized and stored in a secure storage facility at -80°C.
[0194] ELISA and antibody neutralization assays Human serum analysis. NUNC MAXISORP™ 384-well plate (Fisher Scientific) with 1 μg / ml Hla in PBS. H35L The plates were coated and incubated overnight at 4°C. The plates were blocked with 0.1% bovine serum albumin (BSA) in PBS at room temperature for 2 hours. Patient serum samples were diluted 1:10, then 2-fold to a total of 24 dilutions, and transferred to 384 MAXISORP® plates at room temperature for 1 hour. The plates were washed three times with PBS / 0.05% Tween-20 and incubated with goat anti-human HRP conjugate antibody (Southern Biotech) at a 1:20,000 dilution at room temperature for 1 hour. The plates were washed three times and chromogenically developed with QUANTABLU® fluorescent peroxidase substrate kit at room temperature for 30 minutes, stopping the reaction with QUANTABLU® stop solution. Fluorescence detection was measured using a TECAN INFINITE M200 PRO plate reader at excitation 320 nm and emission 400 nm. For the neutralization assay, patient serum samples were diluted 1:10 with 0.1% BSA / PBS and incubated with purified toxin at room temperature for 1 hour. After incubation, washed rRBCs 5×10⁶ were used.7 The cells were added and incubated in a platform shaker at room temperature for 1 hour. The final concentration of the toxin for the assay was 2 nM. The cells were pelleted, and nonlinear regression curves of log(inhibitor) versus response - variable gradient curves were generated using GraphPad Prism software with the absorbance readings (450 nm) of the supernatant.
[0195] Juvenile mouse serum analysis. Serum was diluted 1:25, then 4-fold serially to a total of eight dilutions. Anti-Hla titer was determined by ELISA as described above, and the absorbance readings (450 nm) from the ELISA were used to create four-parameter log(dose) response curves using Prism software. For the neutralization assay, serum was diluted 1:100, then 2-fold to a total of eight dilutions. The diluted serum was incubated with 2 nM purified toxin at room temperature for 15 minutes, then 5 × 10⁻⁶ 7 The cells were added and incubated at room temperature for 1 hour. The cells and debris were pelleted, and nonlinear regression curves of log(inhibitor) versus response were generated using GraphPad Prism software, based on the absorbance readings of the supernatant (450 nm, TECAN INFINITE M200 Pro). Both the ELISA assay and the neutralization assay were repeated three times.
[0196] Newborn mouse serum analysis. 384-well MAXISORP™ plate (Thermo Fisher) with 1 μg / mL Hla H35LThe plates were coated with 50 μL and incubated overnight at 4°C. After blocking the plates with 0.1% BSA in PBS at room temperature for 2 hours, they were incubated with 15 μL of neonatal pre-infection serum at room temperature for 1 hour. The plates were washed three times with PBS / 0.05% Tween-20 and then incubated with 15 μL of goat anti-mouse IgG-HRP antibody (Southern Biotech) at a 1:20,000 dilution at room temperature for 1 hour. The plates were washed three times, chromogenically developed with 20 μL of TMB substrate kit (Thermo Scientific Pierce PI34021) at room temperature for 15 minutes, and the reaction was stopped with 20 μL of 4N sulfuric acid (Fisher Scientific). Absorbance values were read at 450 nm using a Tecan Infinite M200 Pro plate reader. For the neutralization assay, neonatal pre-infection serum was 2-fold diluted to a total of 16 dilutions and incubated with 0.8 pM purified Hla at room temperature for 1 hour. After incubation, 10 μL of toxin / serum mixture was placed on 1 × 10⁶ washed rabbit red blood cells. 7 The solution was added to each cell and incubated in a 384-well v-bottom plate (Thomas Scientific) at room temperature for 1 hour. Cells and debris were pelleted, and nonlinear regression curves of log(inhibitor) versus response were created using GraphPad Prism software with absorbance readings of the supernatant (450 nm, Tecan Infinite M200 Pro).
[0197] Serum analysis of adult mice immunized with high-dose immunotherapy. Serum was collected one, two, and three weeks after vaccination with 20 μg of prime and booster. The serum was diluted 1:4 with PBS and the assay was performed as described above.
[0198] Plasmid construction and Hla antigen purification The toxin mutant was cloned into a pET24b expression vector containing a C-terminal polyhistidine tag. H35L As stated, it was generated previously. 5 Hla D45A / Y118FThis was generated via site-directed mutagenesis using template DNA derived from a pET24b construct containing previously generated wild-type Hla cDNA. The following oligonucleotides were used: D45A sense - 5' GTATTTTATAGTTTTATCGATGCTAAAAATCACAATAAAA 3' (SEQ ID NO: 39); D45A antisense - 5' TTTTATTGTGATTTTTAGCATCGATAAAACTATAAAATAC 3' (SEQ ID NO: 40); Y118F sense - 5' GTATATGAGTACTTTAACTTTTGGATTCAACGGTAATGTTA 3' (SEQ ID NO: 41); Y118F antisense - 5' TAACATTACCGTTGAATCCAAAAGTTAAAGTACTCATATAC 3' (SEQ ID NO: 42). HlaR66C / E70C was previously generated as a GST fusion protein in pGEX6P1 at the Bubeck Wardenburg Laboratory. To generate polyhistidine-tagged proteins, template DNA from a pGEX6P1 construct containing R66C / E70CcDNA was used, along with primers for restriction enzyme sites, to clone it into the pET24b vector using XbaI and XhoI (NewEngland Biolabs).
[0199] The following primers were used: sense - 5' CGGCGGCTCGAGATTTGTCATTTCTTCTTT 3' (SEQ ID NO: 43), antisense - 5' CGGCGGTCTAGAAGGAGGATATATATAGCAGATTCTGATATAATATT 3' (SEQ ID NO: 44).
[0200] Site-directed mutagenesis was used to induce the H35L mutation in Hla D45 / Y118F Construct and HLA R66C / E70CThe constructs were incorporated using the following primers: sense - 5' CTTATGATAAAGAAAATGGCATGCTCAAAAAAGTATTTTATAGTTTTATCGATG 3' (SEQ ID NO: 45); antisense - 5' CATCGATAAAACTATAAAATACTTTTTTGAGCATGCCATTTTCTTTATCATAAG 3' (SEQ ID NO: 46). The mutagenic reaction products were digested with DpnI (New England Biolabs) and transformed into E. coli DH5α on selective agar. Sequence determination (Azenta Life Sciences) was performed for validation of each construct. Subsequently, the confirmed clones were transformed into E. coli BL21 for recombinant protein expression and purification.
[0201] Hla peptide sequence 50 Hla P1 and Hla P2 Each construct was generated by SynBio Technologies, and the constructs were transformed into BL21 for protein expression and purification. Recombinant toxin mutants were purified using the standard protocol described above, LPS was extracted, and evaluated by 10% SDS-PAGE followed by Coomassie blue staining.
[0202] Hla antigen characterization assay Hemolysis assay. Hemolysis of rabbit erythrocytes (rRBCs) was assayed by incubating rRBCs (Hemostat Labs) with purified toxin variants ranging from 0.08 to 10 μg / mL at room temperature for 1 hour. Following incubation, cells were pelleted by centrifugation, and the absorbance of the supernatant at 450 nm was measured using a Tecan Infinite M200 Pro plate reader. The percentage of rRBC hemolysis was calculated relative to a 1% Triton X-100 maximum lysis control. The assay was repeated three times, on separate days for reproducibility.
[0203] Radiolabeled toxin binding and oligomer formation assay. Hla is subjected to T7 RNA polymerase, rifampicin, and [ 35 The toxin was synthesized by in vitro transcription and translation in E. coli S30 extract (Promega) supplemented with [S]methionine. For the binding assay, 125 μL of 12.5% rabbit erythrocytes (rRBCs) in K-PBSA / βME (20 mM potassium phosphate [monobasic], 150 mM NaCl pH 7.4, 1 mg / ml bovine serum albumin, 1 mM β-mercaptoethanol) was incubated with 10 μL of radiolabeled Hla mixture at room temperature for 5 minutes. The cells were pelleted, washed twice with ice-cold PBS, resuspended in 200 μL of PBS, and added to scintillation solution (Research Products International, Econo-Safe). Radioactivity from the cell-binding toxin was quantified using a Beckman LS6000 scintillation counter. For the oligomer formation assay, rRBCs were used as described above, but incubated with 10 μL of radiolabeled Hla mixture (approximately 1 nM) at room temperature for 1 hour. Following incubation, cells were pelleted, washed with 500 μl of K-PBSA / βME, and then resuspended in 90 μl of 1×Laemmli buffer. The sample was divided into fixed 30 μl portions and incubated at 37°C, 62°C, and 80°C for 10 minutes. The sample was then loaded onto a 10% sodium dodecyl sulfate (SDS)-PAGE gel for electrophoresis. The gel was dried, and the results were visualized using a GE Healthcare Typhoon Trio Imager. HRETo analyze the oligomerization ability, rRBCs were treated with 10 μl of radiolabeled Hla mixture at progressively increasing concentrations (1× = approximately 1 nM; 2× = approximately 2 nM and 5× = approximately 5 nM) as described above, incubated at 37°C, and then separated by SDS-PAGE and prepared as described above. For the binding assay and oligomerization assay using serum from vaccinated mice, each serum sample was diluted 1:5 with PBS, then incubated with 10 μl of radiolabeled Hla at room temperature for 10 minutes, and then rabbit erythrocytes were added. The assay was performed as described above. The binding assay was repeated three times, on separate days for reproducibility. The oligomerization assay was performed in a single repeat, on separate days for reproducibility.
[0204] Hla HREProteomics disulfide bond analysis. Purified protein samples were digested with 250 ng of trypsin at 37°C during an overnight incubation. The resulting peptides were desalted using a C18 column, and the eluate was dried under a SpeedVac vacuum concentrator. The peptides were analyzed by LC-MS / MS using a Vanquish Neo UHPLC system integrated with an ORBITRAP ECLIPSE® Tribrid Mass Spectrometer with a FAIMS Pro Duo interface (Thermo Fisher Scientific). The samples were loaded into a Neo trap cartridge integrated with an analytical column (75 μm ID × 50 cm PEPMAP® Neo C18, 2 μm). The samples were separated over 120 minutes using a linear gradient of solvent A (water with 0.1% formic acid) and solvent B (ACN with 0.1% formic acid). For MS acquisition, the FAIMS was switched between CV -35V and -65V with a cycle time of 1.5 seconds per CV. The MS1 spectrum was acquired at a resolution of 60,000 over a scan range from 380 to 1400 m / z, with the normalized AGC target set to standard mode and the maximum injection time set to auto mode. The precursor was filtered using monoisotopic peak determination set to peptide, charge states 3-8, and dynamic exclusion with a tolerance of ±10 ppm for 60 seconds. For MS2 analysis, the isolated ions were fragmented at 25% and 30% by auxiliary high-energy collision dissociation (HCD) and acquired at a resolution of 30,000 with an orbitrap. AGC and maximum IT were 200% and 70 ms, respectively.
[0205] The acquired MS / MS data were searched using MeroX 2.0 software for the identification of disulfide crosslinks to the target protein sequence. Disulfide bonds were selected as crosslinking agents, and the maximum number of miscleavages was set to 4. The precursor mass tolerance was set to 20 ppm, and the fragmentation mass tolerance to 50 ppm. The search results were validated with 5% FDR and precision scoring settings.
[0206] Thermal shift assay. The stability of each toxin variant was measured by quantifying the melting temperature (50% denaturation point) of each toxin variant compared to the wild-type toxin. Each well contained a 1:20 dilution of 5 μM protein and 5×SYPRO® Orange stock (Thermo Fisher S6650) in 20 mM Tris pH 7.5 and 150 mM NaCl buffer. The plates were heated in a STEPONEPLUS® Real-Time PCR System (Thermo Fisher) from 20°C to 90°C in 0.3°C increments. The excitation and emission wavelengths were 490 nm and 575 nm, respectively.
[0207] bacterial strain Staphylococcus aureus strain USA300 / LAC and the isogenic USA300 / LAC Δhla mutant were grown overnight at 37°C with shaking for 14-16 hours in trypsin-containing soy broth (Bacto TSB, Fisher Scientific). These strains were then subcultured the following day at a ratio of 1:100 in TSB and prepared as described above for infection modeling.
[0208] Animal Modeling Vaccine preparation and immunization. The vaccine antigens were as follows: LPS extracted and prepared with ALHYDROGEL® (InvivoGen), a 1:1 antigen with AddaS03 (InvivoGen, 10253-42-02), an AS04-like preparation with ALHYDROGEL® (InvivoGen, vac-alu-250) 500 μg / mL and MPLA-SM VacciGrade (InvivoGen, vac-mpla) 50 μg / mL added to the antigen, or a CpG-ODN1585 preparation with CpG-ODN1585 (InvivoGen) 2 μg added to the antigen. For immunization of young and adult mice, 20 micrograms of each antigen were delivered via intramuscular (IM) injection to a cohort of 3-week-old C57BL / 6J male or female mice on days 0 and 14. For immunization of neonatal mice, 2 μg of each antigen was delivered via IM to littermates of C57BL / 6 mice between phases 1 and 3, totaling 10 μl, and a boost was delivered on phase 21 (weaning day).
[0209] Modeling of skin and soft tissue infections. All animal experiments were reviewed, approved, and supervised by the Institutional Animal Care and Use Committee (IACUC) at Washington University in St. Louis. To determine antibody titers, serum was collected from 5 mice per group one week after boost immunization and prior to Staphylococcus aureus challenge. 5-6 week old C57BL / 6 male mice were anesthetized via intraperitoneal injection of ketamine (20 mg / kg) and xylazine (5 mg / kg), followed by 1 × 10⁶ Staphylococcus aureus strain USA300 / LAC in 50 μL of PBS. 8 A subcutaneous challenge was performed on the right flank in the CFU. Lesion abscess area and skin necrosis area (mm²) 2 The values were measured at 24-hour intervals for 10 days. Mice developed a secondary infection in the left flank 21–28 days after the onset of the primary infection. For all tests, the size of the abscess and skin necrosis was determined according to the formula A = (π / 2) (length mm) (width mm).
[0210] Cell-based immunoassays Mass cytometry analysis. As shown, 10 days after either primary or secondary infection, inguinal inflow lymph nodes (dLNs) were collected from the ipsilateral side of mice infected with Staphylococcus aureus and processed to obtain single-cell suspensions. At least three dLNs were pooled together from independent mice under each condition. Cell count (3 × 10⁶ cells per sample) 6 Cells were subjected to cisplatin labeling, followed by staining of the target cell surface marker and intracellular antigen using the antibody reagents shown in Table 2.
[0211] [Table 2]
[0212] Cell fixation and permeabilization for intracellular staining were performed using EBIOSCIENCE® permeabilization buffer and FoxP3 transcription factor staining buffer set, according to the manufacturer's protocol. Stained cells were washed, barcoded by sample, pooled, and analyzed using a Fluidigm CyTOF2 HELIOS® mass cytometer by the Bursky Center for Human Immunology and Immunotherapy Programs at Washington University. Debarcoded samples were analyzed using Cytobank software (Beckman Coulter).
[0213] statistical analysis Statistical analyses of serological tests and all in vitro assays were performed using GraphPad Prism software with Tukey's multiple comparison test, Dunn's multiple comparison test, or independent t-tests, along with one-way ANOVA and p<0.05. Statistical significance in skin infection tests was assessed using GraphPad Prism software with Tukey's multiple comparison test and two-way ANOVA, along with p<0.05.
[0214] Sequence List Table 3-1 Table 3-2 Table 3-3 Table 3-4 Table 3-5 Table 3-6
Claims
1. Amino acid substitutions H35L, R66C, and E70C (Hla) are applied to the amino acid sequence described in SEQ ID NO:
1. HRE A modified α-hemolysin (Hla) polypeptide, or a derivative or fragment thereof, containing ).
2. A modified Hla polypeptide according to claim 1, comprising the amino acid sequence described in Sequence ID No. 11, or a sequence that is at least about 80% identical thereto, or a fragment thereof.
3. A polynucleotide comprising a nucleic acid sequence encoding the modified Hla polypeptide described in claim 1.
4. The polynucleotide sequence according to claim 3, wherein the modified Hla polypeptide comprises the amino acid sequence or a fragment thereof described in SEQ ID NO: 11, or an amino acid sequence that is at least about 80% identical thereto.
5. The polynucleotide sequence according to claim 3, which is an isolated polynucleotide sequence, plasmid, expression vector, cosmid, viral vector, virus, or virus-like particle (VLP).
6. A host cell comprising the polynucleotide sequence described in claim 3.
7. The host cell according to claim 6, which is one of the following: Chinese hamster (CHO) cells, HEK293 cells, human cervical cancer cells (Hela), canine kidney cells (MDCK), human hepatocytes (HepG2), baby hamster kidney cells (BHK), monkey kidney cells (CV1), Vero cells, CEM cells, 721.221 cells, H9 cells, Jurkat cells, Raji cells, W138 cells, COS-7 cells, 293 cells, HepG2 cells, 3T3 cells, or RIN cells.
8. An immunogenic composition comprising a modified Hla polypeptide or a derivative or fragment thereof as described in claim 1, or a polynucleotide sequence encoding the Hla polypeptide, and at least one pharmaceutically acceptable excipient.
9. The immunogenic composition according to claim 8, further comprising a pharmaceutically acceptable adjuvant.
10. The immunogenic composition according to claim 9, wherein the adjuvant is selected from alum, AddaS03 (AS03-like), MPLA and alum (AS04-like), Freund's, CpG-ODN1585, and any combination thereof.
11. The immunogenic composition according to claim 8, further comprising at least one further activator.
12. A method for inducing an immune response to a bacterial pathogen in a subject requiring such response, comprising administering the modified Hla polypeptide described in claim 1 to the subject.
13. The method according to claim 12, wherein administering the modified Hla polypeptide to the subject results in an enhancement of germinal center (GC) response or follicular helper T (TFH) response, or reduces the severity of skin and soft tissue infections, invasive Staphylococcus aureus disease, sepsis, and carrier status, compared to administering an immunogenic composition comprising a modified Hla polypeptide having only an H35L substitution to the amino acid sequence described in SEQ ID NO:
1.
14. The immunogenic composition according to claim 12, wherein the subject is a mammal.
15. The immunogenic composition according to claim 14, wherein the subject is a human.
16. The immunogenic composition according to claim 15, wherein the subject is a child who is under 3 years of age, under 2 years of age, under 1 year of age, or under 12 months, or 11 months, or 10 months, 9 months, or 8 months, 6 months, 5 months, 4 months, 3 months, 2 months, or 1 month, or under 4 weeks, or 3 weeks, 2 weeks, or 1 week.
17. The immunogenic composition according to claim 15, wherein the human is a pregnant woman.
18. The method according to claim 12, wherein the bacterial pathogen is Staphylococcus aureus.
19. The method according to claim 12, further comprising at least one, at least two, at least three or more further administrations of the immunogenic composition.
20. The method according to claim 12, further comprising administering at least one further immunogenic antigen.
21. The at least one further immunogenic antigen is Opp3a, DltD, HtsA, LtaS, IsdA, IsdB, IsdC, SdrC, SdrD, SdrE, SdrF, SdrG, SdrH, SrtA, SpA, Sbi, FmtB, beta-hemolysin, fibronectin-binding protein A (FnbA), fibronectin-binding protein B (FnbB), coagulase, Fig, Map, pantone-Valentine leucocidine (Pvl), alpha toxin and its variants, gamma toxin (hlg) and its variants, Ica, immunodominant ABC transporter, Mg 2+ Transporter, Ni-ABC transporter, RAP, autolysin, laminin receptor, IsaA / PisA, IsaB / PisB, SPOIIIE, SsaA, EbpS, Sas The method according to claim 20, selected from the group consisting of A, SasF, SasH, EFB (FIB), SBI, Npase, EBP, bone sialobinding protein II, aureolisin precursor (AUR) / Sepp1, CNA, and its fragments, e.g., M55, TSST-1, mecA, poly-N-acetylglucosamine (PNAG / dPNAG) extracellular polysaccharide, GehD, EbhA, EbhB, SSP-1, SSP-2, HBP, vitronectin-binding protein, HarA, EsxA, EsxB, enterotoxin A, enterotoxin B, enterotoxin C1, and novel autolysins.
22. The method according to claim 12, wherein the administration is by intravenous, intramuscular, subcutaneous, oral, or intraperitoneal route.