Compositions, sets, and methods for target analysis
OligoFISSEQ with JEB barcodes addresses the limitations of current genome visualization methods by enabling simultaneous, high-resolution spatial mapping of the entire human genome using barcoded oligopaints, improving our understanding of genome organization and function.
Patent Information
- Application Number
- JP2022530694
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2019-11-26
- Filing Date
- 2020-11-24
- Publication Date
- 2026-06-10
- Estimated Expiration
- 2040-11-24
AI Technical Summary
Current genome visualization methods face challenges in throughput and sequential labeling schemes, limiting the ability to detect a large number of targets and achieve high resolution for the entire genome, especially with conventional microscopes that can only detect 4-5 colors at a time.
The use of Just Enough Barcode (JEB) oligonucleotide tags, such as barcoded oligopaints, in fluorescence in-situ sequencing (OligoFISSEQ), allows for simultaneous targeting, localization, and visualization of numerous genomic targets, enabling high-resolution spatial mapping of the entire human genome.
OligoFISSEQ achieves high-resolution spatial maps of the genome by increasing the number of detectable barcode bits and reducing the number of oligonucleotide tags required, enabling detailed 3D mapping of all human genes in single cells.
Smart Images

Figure 0007872730000005 
Figure 0007872730000006 
Figure 0007872730000007
Abstract
Description
[Technical Field]
[0001] Cross-reference of related applications This application asserts the benefits under Section 119 of U.S. Patent Act for Provisional Application No. 62 / 940,638, filed on 26 November 2019, which is incorporated herein by reference in its entirety.
[0002] Subsidies from the U.S. government This invention was developed with the support of U.S. government grant HG008525, approved by the National Institutes of Health. The U.S. government has certain rights with respect to this invention.
[0003] Sequence List This application includes a sequence listing, which has been submitted in ASCII format via EFS-Web and is incorporated herein by reference in its entirety. The ASCII file was created on 23 November 2020, is named 002806-095230WOPT_SL.txt, and has a file size of 5,053 bytes.
[0004] Technical field The techniques described herein relate to compositions, sets, and methods for analyzing, detecting, and / or visualizing target molecules. [Background technology]
[0005] background Replication, inheritance, and developmentally regulated gene expression are all genome-wide processes that occur simultaneously across all chromosomes. In fact, disruptions in this genome-wide coordination can lead to genomic damage, chromosome breaks and loss, aneuploidy, large-scale ectopic gene expression, and disease. Therefore, there is a growing demand for technologies with the potential to query the entire genome. Among these diverse methods, those providing information on the spatial organization of the genome are particularly useful, given the growing evidence that the three-dimensional (3D) arrangement of chromosomes is strongly correlated with genome function and stability. Proximity-based capture methods such as Hi-C, assays using other conformational capture techniques, and genome structure mapping (GAM) can report the frequency of interactions between genomic regions and / or within the same nuclear subsection. These genome-wide methods reveal the hierarchical structure of the entire genome, from cis-enhancer interactions to the partitioning of active and inactive chromatin within and between chromosomes.
[0006] However, methods for mapping the genome in situ are limited. Spatial genomics, which localizes genomic loci within a 3D nucleus, is an emerging field that addresses the fact that the spatial localization of DNA plays a crucial role in how that DNA is expressed, repaired, replicated, and functions. Current genome visualization methods face challenges not only in throughput but also in sequential labeling schemes and target detection through signal generation. Because spatial genomics is limited by the ability of conventional microscopes to detect 4-5 colors at a time, most techniques rely on sequential visualization of targets. Such methods scale linearly and are not practical for visualizing all of the approximately 25,000 human genes. To provide spatial information as well as cover the entire genome, a labeling method is needed that can detect a larger number of targets and has higher resolution. [Overview of the project]
[0007] overview The techniques described herein relate to compositions and sets of oligonucleotides for analyzing, detecting, and / or visualizing target molecules, as well as corresponding methods. In some aspects of any given setting, the identity of at least one oligonucleotide tag (e.g., barcoded oligopaint) conjugated to at least one target molecule is determined using a set of read molecules. Such oligonucleotide tags and read molecule sets each contain a limited number of barcode regions and barcode hybridized regions. Compared to other methods (e.g., SOLiD chemistry), these read molecule sets and sequencing methods, referred herein as "Just Enough Barcode" (JEB) or "Exact Barcode," are simplified, discard unwanted oligonucleotides, and produce a higher level of sequencing signal. Furthermore, the sets and methods described herein demonstrate at least two advantages over other compositions and methods: (1) reducing the number of oligonucleotide tags (e.g., oligopaint) required to generate a sufficient signal from the target, and (2) increasing the number of detectable barcode bits, and therefore increasing the number of uniquely identifiable targets. Ultimately, the sets and methods described herein enable imaging of the entire human genome.
[0008] This specification describes the application of JEB barcodes to genome imaging and next-generation sequencing to reveal the complexity and biological importance of the 3D arrangement of the genome. Using JEB barcodes in fluorescence in-situ sequencing, specifically with OligoFISSEQ, any number of barcoded oligopaint oligonucleotides hybridized to the genome can be simultaneously targeted, localized, and visualized. Using OligoFISSEQ, 36 loci across 6 chromosomes and 46 loci along the X chromosome were spatially mapped in hundreds of individual human cells, achieving a barcode recovery rate of >75% and generating high-resolution spatial maps and chromosome traces. Such data demonstrate the ability of OligoFISSEQ and JEB barcodes to map all human genes in 8 rounds of sequencing. Simultaneous visualization of the entire genome in situ is essential for investigating the mechanisms regulating the composition and function of the genome. By targeting and visualizing numerous genomic targets in single cells, detailed 3D maps can be created using JEB barcodes, thereby improving our understanding of the genome.
[0009] In one aspect, this specification describes at least two sets of readout molecules, each readout molecule comprising: (a) a 3'-side barcode hybridize region of a nucleotide or analogue containing a unique sequence distinct from the 3'-side sequences of all other readout molecules in the set; (b) a 5'-side non-barcode hybridize region of a nucleotide or analogue containing a sequence identical to the 5'-side sequences of all other readout molecules in the set; (c) a sulfur modification in place of the bridging oxygen of the phosphate backbone between the 5'-side and the 3'-side; and (d) an optically detectable label.
[0010] In some aspects of any given situation, the sign is a fluorescent sign.
[0011] In some embodiments of any aspect, the optically detectable label comprises, or further comprises, biotin, amine, metal, metal nanocluster, noble metal nanoparticle, anchor molecule, quantum dot, acridite, or DNA origami structure.
[0012] In some embodiments of any aspect, the label is located at the 5'-end of the readout molecule.
[0013] In some embodiments of any aspect, the set comprises four distinguishable labels.
[0014] In some embodiments of any aspect, the set comprises at least two distinguishable labels.
[0015] In some embodiments of any aspect, the set comprises at least three distinguishable labels.
[0016] In some embodiments of any aspect, the set comprises at least four distinguishable labels.
[0017] In some embodiments of any aspect, the readout molecule of each set comprising a first 3'-region comprises only the first distinguishable label.
[0018] In some embodiments of any aspect, the readout molecule of each set comprising any selected 3'-region comprises only the corresponding given distinguishable label.
[0019] In some embodiments of any aspect, the 3'-region is at least one nucleotide or its analog in length.
[0020] In some embodiments of any aspect, the 3'-region is five nucleotides or its analog in length.
[0021] In some embodiments of any aspect, the 5'-region comprises only universal nucleotide bases.
[0022] In some aspects of any given plane, the 5' region contains only deoxyinosine nucleotides.
[0023] In some aspects of any given plane, the 5' region is the length of at least one nucleotide or its analogue.
[0024] In some aspects of any given plane, the 5' region is the length of three nucleotides or their analogues.
[0025] In some aspects of any given situation, the at least two readout molecules include DNA and / or RNA.
[0026] In some aspects of any given situation, the at least two readout molecules consist of DNA and / or RNA, or are essentially composed of DNA and / or RNA.
[0027] In some aspects of any given situation, the at least two readout molecules include polypeptides.
[0028] In one aspect, this specification describes at least two sets of readout molecules, each readout molecule comprising: (a) a 3'-side barcode hybridize region of a nucleotide or analogue containing a unique sequence distinct from the 3'-side sequences of all other readout molecules in the set; (b) a 5'-side non-barcode hybridize region of a nucleotide or analogue; and (c) a sulfur modification in place of a bridging oxygen of the phosphate backbone between the 5'-side and the 3'-side.
[0029] In some aspects of any given configuration, the 5' non-barcode hybridization region of at least one readout molecule specifically hybridizes with an oligonucleotide.
[0030] In some aspects of any given plane, the oligonucleotide includes at least one detectable label.
[0031] In some aspects of any given situation, an oligonucleotide specifically hybridizes with at least one other oligonucleotide.
[0032] In some aspects of any given situation, oligonucleotides are amplification primers.
[0033] In some aspects of any given situation, oligonucleotides are sequencing primers.
[0034] In some aspects of any given situation, oligonucleotides are imager chains for super-resolution microscopy.
[0035] In some aspects of any given plane, the 5' non-barcode hybridized region of at least one readout molecule is at least 5 nucleotides long.
[0036] In some aspects of any given plane, the 5' non-barcode hybridized region of at least one readout molecule is at least 10 nucleotides long.
[0037] In some aspects of any given configuration, the 5' non-barcode hybridized region contains the same sequence as the 5' region sequence of all other readout molecules in the set.
[0038] In some aspects of any given plane, at least one readout molecule includes an optically detectable label.
[0039] In some aspects of any given situation, the labeling of at least one readout molecule is a fluorescent label.
[0040] In some aspects of any given plane, the optically detectable label includes, or further includes, fluorophores, biotin, amines, metals, metal nanoclusters, noble metal nanoparticles, anchor molecules, quantum dots, acrydites, or DNA origami structures.
[0041] In one aspect, this specification describes a readout molecule comprising: (a) a 3'-side barcode hybridized region of a nucleotide or analogue containing a unique sequence distinct from the 3'-side sequences of all other readout molecules in the set of readout molecules; (b) a 5'-side non-barcode hybridized region of a nucleotide or analogue containing a sequence identical to the 5'-side sequences of all other readout molecules in the set; (c) a sulfur modification in place of the bridging oxygen of the phosphate backbone between the 5'-side and the 3'-side; (d) an optically detectable label; and (e) a nanoparticle.
[0042] In one aspect, this specification describes a readout molecule comprising: (a) a 3'-side barcode hybridized region of a nucleotide or analogue containing a unique sequence distinct from the 3'-side sequences of all other readout molecules in the set of readout molecules; (b) a 5'-side non-barcode hybridized region of a nucleotide or analogue containing a sequence identical to the 5'-side sequences of all other readout molecules in the set; (c) a sulfur modification in place of the bridging oxygen of the phosphate backbone between the 5'-side and the 3'-side; and (d) a metal nanoparticle.
[0043] In one aspect, this specification describes a readout molecule comprising (a) a 3'-side barcode hybridized region of a nucleotide or analogue; (b) a 5'-side non-barcode hybridized region of a nucleotide or analogue; (c) a sulfur modification in place of a bridging oxygen of the phosphate backbone between the 5' region and the 3' region; and (d) a metal nanoparticle.
[0044] In some aspects of any given plane, the readout molecule further includes an optically detectable label.
[0045] In one aspect, this specification describes at least two sets of readout molecules, each readout molecule comprising: (a) a 3'-side barcode hybridized region of a nucleotide or analogue containing a unique sequence distinct from the 3'-side sequences of all other readout molecules in the set; (b) a 5'-side non-barcode hybridized region of a nucleotide or analogue containing a sequence identical to the 5'-side sequences of all other readout molecules in the set; (c) a sulfur modification in place of the bridging oxygen of the phosphate backbone between the 5'-side and the 3'-side; and (d) an optically detectable label, wherein at least one readout molecule further comprises a nanoparticle.
[0046] In one aspect, this specification describes at least two sets of readout molecules, each readout molecule comprising: (a) a 3'-side barcode hybridized region of a nucleotide or analogue containing a unique sequence distinct from the 3'-side sequences of all other readout molecules in the set; (b) a 5'-side non-barcode hybridized region of a nucleotide or analogue containing a sequence identical to the 5'-side sequences of all other readout molecules in the set; and (c) a sulfur modification in place of a bridging oxygen of the phosphate backbone between the 5'-side and the 3'-side, wherein at least one readout molecule further comprises a nanoparticle.
[0047] In some aspects of any given plane, at least one readout molecule further includes an optically detectable label.
[0048] In some aspects of any given plane, the optically detectable marker includes a fluorophore.
[0049] In some aspects of any given plane, the nanoparticles are linked to at least two readout molecules of the set.
[0050] In some aspects of any given situation, the nanoparticles include metal nanoparticles.
[0051] In some aspects of any given situation, the metal nanoparticles are selected from the group consisting of Au, Ag, Ni, Co, Pt, Pd, Cu, Ti, and Al nanoparticles.
[0052] In some aspects of any given situation, the nanoparticles include gold nanoparticles.
[0053] In some aspects of any given configuration, the nanoparticles include gold nanorods.
[0054] In some aspects of any given surface, the nanoparticles have a diameter of approximately 1.2 nm.
[0055] In some aspects of any given plane, the nanoparticles have a diameter of about 3 nm.
[0056] In some aspects of any given surface, the nanoparticles have a diameter of about 5 nm.
[0057] In some aspects of any given surface, the nanoparticles have a diameter of about 10 nm.
[0058] In some aspects of any given surface, the nanoparticles have a diameter of about 30 nm.
[0059] In some aspects of any given surface, the nanoparticles have a diameter of about 50 nm.
[0060] In some aspects of any given configuration, the nanoparticles are located at the 3' end of the readout molecule.
[0061] In some aspects of any given plane, the nanoparticles are located at least 20 nucleotides from the detectable label.
[0062] In some aspects of any given plane, the nanoparticles are located at least 30 nucleotides from the detectable label.
[0063] In one aspect, this specification describes the use of readout molecules or sets thereof described herein for (a) detection of at least one target molecule; (b) signal amplification; (c) branching reaction; (d) hybridization chain reaction (HCR); (e) signal amplification by exchange reaction (SABER); (f) rolling circle amplification (RCA); (g) in situ sequencing; (h) matrix adhesion; or (i) super-resolution microscopy.
[0064] In one aspect, this specification describes a method for detecting at least one target molecule in a sample, the method being as follows: (a) A step of contacting the sample with at least one oligonucleotide tag, each oligonucleotide tag comprising (i) a recognition domain that specifically binds to a target molecule to be detected, and (ii) a barcode region comprising at least one barcode bit; (b) the step of bringing the sample into contact with the set of readout molecules described herein; and (c) A step of detecting the relative order of optically detectable labels hybridized to at least one oligonucleotide tag, wherein the at least one oligonucleotide tag hybridizes to at least one target molecule, the relative order of the optically detectable labels enables identification of which oligonucleotide tag hybridizes to the target molecule at that location. Includes.
[0065] In some aspects of any given situation, the barcode area is unique to each oligonucleotide tag.
[0066] In some aspects of any given situation, the total number of unique barcode bits is less than the total number of possible unique barcode bits.
[0067] In some aspects of any given situation, the total number of unique barcode bits is less than 10% of the total number of possible unique barcode bits.
[0068] In some aspects of any given situation, the total number of unique barcode bits is less than 1% of the total number of possible unique barcode bits.
[0069] In some aspects of any given situation, the total number of unique barcode bits is at least two unique barcode bits.
[0070] In some aspects of any given situation, the total number of unique barcode bits is 10 or less.
[0071] In some aspects of any given situation, the barcode hybridized region is unique to each read molecule.
[0072] In some aspects of any given situation, the total number of unique barcode hybridize regions used in the set of read molecules is less than the total number of possible unique barcode hybridize regions.
[0073] In some aspects of any given situation, the total number of unique barcode hybridized regions in the set of read molecules is less than 10% of the total number of possible unique barcode hybridized regions.
[0074] In some aspects of any given situation, the total number of unique barcode hybridized regions in the set of read molecules is less than 1% of the total number of possible unique barcode hybridized regions.
[0075] In some aspects of any given situation, the total number of unique barcode hybridized regions in the set of read molecules includes at least two unique barcode hybridized regions.
[0076] In some aspects of any given situation, the total number of unique barcode hybridized regions in the set of read molecules includes 10 or fewer unique barcode hybridized regions.
[0077] In some aspects of any given configuration, the street further includes a primer binding region for annealing of the sequencing primer.
[0078] In some aspects of any given situation, the detection step is carried out by a sequencing method.
[0079] In some aspects of any given situation, the sequencing method includes sequencing by linkage, sequencing by synthesis, sequencing by hybridization, and / or sequencing by cyclic reversible polymerization hybridization chain reactions.
[0080] In some aspects of any given situation, sequencing by ligation includes enzyme-based ligation.
[0081] In some aspects of any given situation, sequencing by coupling includes chemical coupling, copper coupling, copper-free click reaction, amine-EDC-based coupling, or thiol-maleimide Michael addition.
[0082] In some aspects of any given situation, the specific hybridization of the read molecule to the street is determined by the identity between the barcode region and the barcode hybridized region.
[0083] In some aspects of any given plane, the optically detectable marker is a fluorophore.
[0084] In some aspects of any given situation, the detection process is carried out by fluorescence microscopy.
[0085] In some aspects of any given plane, optically detectable labels further include biotin, amines, metals, metal nanoclusters, noble metal nanoparticles, anchor molecules, quantum dots, acrydites, or DNA origami structures.
[0086] In some aspects of any given situation, the detection process is carried out with at least single-cell resolution.
[0087] In some aspects of any given situation, the detection process is performed with at least single-nuclear resolution.
[0088] In some aspects of any given scenario, at least two target molecules are detected simultaneously.
[0089] In some aspects of any given scenario, at least three target molecules are detected simultaneously.
[0090] In some aspects of any given scenario, at least 10 target molecules are detected simultaneously.
[0091] In some aspects of any given scenario, at least 20 target molecules are detected simultaneously.
[0092] In some aspects of any given setting, the target molecule includes nucleic acids, polypeptides, cell surface molecules, or inorganic substances.
[0093] In some aspects of any given situation, the target molecule includes DNA and / or RNA.
[0094] In some aspects of any given situation, the target molecule includes a polypeptide.
[0095] In some aspects of any given scenario, the target molecule is covalently or noncovalently linked to nucleic acids, polypeptides, cell surface molecules, or inorganic substances.
[0096] In some aspects of any given situation, the sample is a cell, cell culture, or tissue sample.
[0097] In some aspects of any given situation, the sample includes organoids.
[0098] In one aspect, this specification describes an enhanced method for detecting at least one target molecule in a sample, the method being as follows: (a) A step of contacting the sample with at least one oligonucleotide tag, each oligonucleotide tag comprising (i) a recognition domain that specifically binds to a target molecule to be detected, and (ii) a barcode region comprising at least one barcode bit; (b) the step of bringing the sample into contact with the readout molecules or sets thereof as described herein; and (c) A step of detecting the relative order of optically detectable labels hybridized to at least one oligonucleotide tag, wherein the at least one oligonucleotide tag hybridizes to at least one target molecule, the relative order of the optically detectable labels enables identification of which oligonucleotide tag hybridizes to the target molecule at that location. Includes.
[0099] In some aspects of any given plane, the signal of an optically detectable label of at least one readout molecule containing nanoparticles is increased by at least 1.5 times compared to the signal of an optically detectable label of the same readout molecule without nanoparticles.
[0100] In some aspects of any given plane, the signal of an optically detectable label of at least one readout molecule containing nanoparticles is increased by at least three times compared to the signal of an optically detectable label of the same readout molecule without nanoparticles.
[0101] In some aspects of any given plane, the signal of an optically detectable label of at least one readout molecule containing nanoparticles is increased by at least 10 times compared to the signal of an optically detectable label of the same readout molecule without nanoparticles.
[0102] In some aspects of any given plane, the signal of an optically detectable label of at least one readout molecule containing nanoparticles is increased by at least 50 times compared to the signal of an optically detectable label of the same readout molecule without nanoparticles.
[0103] In some aspects of any given situation, the sample contains human cell nuclei.
[0104] In some aspects of any given situation, the sample contains nuclei derived from cells of any organism.
[0105] In some aspects of any given phase, the sample includes a metaphase chromosome spread.
[0106] In some aspects of any given scenario, metaphase chromosomes are obtained from cultured cell nuclei.
[0107] In some aspects of any given scenario, metaphase chromosomes are obtained from nuclei extracted from tissue sections, organoids, or biopsy specimens.
[0108] In some aspects of any given situation, detectable labels are detected using electron microscopy, fluorescence microscopy, dark-field microscopy, or any combination thereof.
[0109] In one aspect, this specification describes a method for karyotyping a biological sample, which is as follows: (a) A step of contacting the sample with at least one oligonucleotide tag specific to at least one chromosome, wherein each oligonucleotide tag comprises (i) a recognition domain that specifically binds to a target molecule to be detected, and (ii) a barcode region comprising at least one barcode bit; (b) The step of bringing the sample into contact with the set of readout molecules described herein; (c) A step of detecting the relative order of optically detectable labels hybridized to at least one oligonucleotide tag, wherein the at least one oligonucleotide tag hybridizes to at least one target molecule, thereby enabling identification of which oligonucleotide tag hybridizes to the target molecule at that location; and (d) The step of determining the identity of at least one chromosome according to the identity of at least one oligonucleotide tag specific to the at least one chromosome. Includes.
[0110] In some aspects of any given plane, the sample is brought into contact with at least one oligonucleotide tag specific to the p arm of at least one chromosome.
[0111] In some aspects of any given plane, the sample is brought into contact with at least one oligonucleotide tag specific to the q arm of at least one chromosome.
[0112] In some aspects of any given plane, the sample is brought into contact with at least one oligonucleotide tag specific to the p arm of at least one chromosome, and at least one oligonucleotide tag specific to the q arm of the at least one chromosome.
[0113] In some aspects of any given setting, the sample is brought into contact with at least two oligonucleotide tags specific to the p-arm or q-arm of at least one chromosome.
[0114] In some aspects of any given setting, the sample is brought into contact with at least three oligonucleotide tags specific to the p-arm or q-arm of at least one chromosome.
[0115] In some aspects of any given setting, the sample is brought into contact with up to six oligonucleotide tags specific to each chromosome arm.
[0116] In some aspects of any given configuration, the sample is brought into contact with at least 10 oligonucleotide tags specific to each chromosome arm.
[0117] In some aspects of any given setting, the sample is brought into contact with at most 20 oligonucleotide tags specific to each chromosome arm.
[0118] In some aspects of any given situation, the sample contains human cell nuclei.
[0119] In some aspects of any given situation, the sample contains nuclei derived from cells of any organism.
[0120] In some aspects of any given phase, the sample includes a metaphase chromosome spread.
[0121] In some aspects of any given scenario, metaphase chromosomes are obtained from cultured cell nuclei.
[0122] In some aspects of any given scenario, metaphase chromosomes are obtained from nuclei extracted from tissue sections, organoids, or biopsy specimens.
[0123] In one aspect, this specification describes a method for generating a high-resolution image of at least one target molecule in a sample, the method being as follows: (a) the step of imaging the at least one target molecule using a high-resolution imaging technique for at least one round; and (b) A step of determining the identity of the at least one imaged target molecule, the following: (i) A step of contacting the sample with at least one oligonucleotide tag, each oligonucleotide tag comprising (A) a recognition domain that specifically binds to a target molecule to be detected, and (B) a barcode region comprising at least one barcode bit; (ii) the step of bringing the sample into contact with the set of readout molecules described herein; and (iii) A step of detecting the relative order of optically detectable labels hybridized to the at least one oligonucleotide tag, wherein the at least one oligonucleotide tag hybridizes to the at least one target molecule, and the relative order of the optically detectable labels allows for the identification of which oligonucleotide tag hybridizes to the target molecule at that location. Process Includes.
[0124] In some aspects of any given setting, the method includes the step of imaging at least two target molecules.
[0125] In some aspects of any given setting, the method includes the step of imaging at least 12 target molecules.
[0126] In some aspects of any given setting, the method includes the step of imaging at least 66 target molecules.
[0127] In some aspects of any given setting, the method includes the step of imaging at least 258 target molecules.
[0128] In some aspects of any given setting, the method includes the step of imaging at least 500 target molecules.
[0129] In some aspects of any given setting, the method includes the step of imaging at least 5,000 target molecules.
[0130] In some aspects of any given plane, all target molecules are imaged at once.
[0131] In some aspects of any given orientation, at least half of the target molecules are imaged simultaneously.
[0132] In some aspects of any given situation, the method includes at least two rounds of high-resolution imaging.
[0133] In some aspects of any given situation, the method includes at least three rounds of high-resolution imaging.
[0134] In some aspects of any given situation, the method includes at least five rounds of high-resolution imaging.
[0135] In some aspects of any given situation, the method includes a high-resolution imaging technique of at least 20 rounds.
[0136] In some aspects of any given situation, high-resolution imaging techniques are selected from the group consisting of oligo-stochastic optical reconstruction microscopy (OligoSTORM), structured illumination microscopy (SIM), stimulated release suppression (STED) microscopy, and oligo DNA point accumulation in nanoscale topology (DNA-PAINT).
[0137] In some aspects of any given situation, high-resolution imaging techniques include oligostochastic optical reconstruction microscopy (OligoSTORM).
[0138] In some aspects of any given plane, detecting the relative order of optically detectable labels hybridized to at least one oligonucleotide tag involves contacting the sample with a set of readout molecules at least two times.
[0139] In some aspects of any given plane, detecting the relative order of optically detectable labels hybridized to at least one oligonucleotide tag involves contacting the sample with a set of readout molecules for at least three rounds.
[0140] In some aspects of any given plane, detecting the relative order of optically detectable labels hybridized to at least one oligonucleotide tag involves contacting the sample with a set of readout molecules for at least five rounds.
[0141] In some aspects of any given plane, detecting the relative order of optically detectable labels hybridized to at least one oligonucleotide tag involves contacting the sample with a set of readout molecules for at least 10 rounds.
[0142] In some aspects of any given plane, detecting the relative order of optically detectable labels hybridized to at least one oligonucleotide tag involves contacting the sample with a set of readout molecules for at least 20 rounds.
[0143] In some aspects of any given plane, at least one target molecule contains a 1 kb nucleic acid.
[0144] In some aspects of any given configuration, at least one target molecule contains a 15 kb nucleic acid.
[0145] In some aspects of any given situation, at least one target molecule contains a 50 kb nucleic acid.
[0146] In some aspects of any given configuration, at least one target molecule contains a 100 kb nucleic acid.
[0147] In some aspects of any given situation, at least one target molecule contains 1 Mb of nucleic acid.
[0148] In some aspects of any given situation, at least one target molecule includes a chromosome.
[0149] In some aspects of any given situation, at least one target molecule includes a genome. [Brief explanation of the drawing]
[0150] [Figure 1A]Figures 1A–1F are a series of schematic diagrams and images illustrating a complete OligoFISSEQ procedure. Figure 1A shows a schematic diagram of the oligopaint oligo used in OligoFISSEQ. The linked-based target query (LIT) primer site and barcode, as well as the synthetic-based target query (SIT) primer site and barcode, were used as hybridization-based target query (HIT) bridge junction sites. Figure 1B is a schematic diagram illustrating the OligoFISSEQ workflow. Figure 1C is a schematic diagram illustrating the LIT workflow. The LIT primer is phosphorylated (gray "P"). The first two nucleotides (nt) of each 8-mer (i.e., 8nt-length nucleic acid) correspond to specific fluorophores, "N" represents a mixture of A, C, T, or G, and "Z" represents a universal base. The 8-mer hybridizes to a portion of the barcode region (e.g., SEQ ID NO: 5, ACTGTGAATCGC). Figure 1D is a schematic diagram illustrating the SIT workflow. Figure 1E is a schematic diagram showing the HIT workflow. Figure 1F shows representative images of four rounds of OligoFISSEQ LIT, OligoFISSEQ SIT, and OligoFISSEQ HIT using the Chr19-20K library against PGP1f. Each image represents the labeling of each round of OligoFISSEQ. Images are from the z-projection of maximum intensity from multiple z-slices. Images are from the barcode-specific fluorescence channel. The first round SIT is a combination of two channels, purple and green fluorescence (i.e., resulting in a white signal). The barcode detection rate per cell, along with the standard deviation, is shown for LIT, SIT, and HIT of the Chr19-20K library. The barcode detection rates per cell from four technical replicates were HIT = 79, LIT = 85, and SIT = 66. Scale bar = 10 μm. [Figure 1B] Refer to the explanation in Figure 1A. [Figure 1C] Refer to the explanation in Figure 1A. [Figure 1D] Refer to the explanation in Figure 1A. [Figure 1E]Refer to the explanation in Figure 1A. [Figure 1F] Refer to the explanation in Figure 1A. [Figure 2A] Figures 2A–2D are a series of schematic diagrams and images showing OligoFISSEQ-LIT of the 36plex-5K library. Figure 2A is a schematic diagram showing the target layout of the 36plex-5K library. Chromosome numbers are indicated with different labels. This schematic diagram does not follow a uniform scale. Figure 2B is a series of images showing that 36plex-5K labels specific chromosomes. The top image shows a metaphase chromosome spread from a normal human male lymphoblast hybridized with the 36plex-5K library. The bottom image shows a PGP1f cell hybridized with the 36plex-5K library. The labels correspond to the chromosome codes in the schematic diagram of Figure 2A. Oligopaint targeting the region on Chr 19 (Chr19-20K) was also stained in the metaphase spread (e.g., bright signal). Images are maximal z projections. All images have a scale bar = 10 μm. Figure 2C shows images of PGP1f nuclei (male) from sequencing of a 36-plex-5K library of OligoFISSEQ-LIT cells, excluding the main street and back street, across four rounds. The images are from the analyzed, merged maximum z projection with five labels. Figure 2D is a 3D view of the real field of view (FOV) containing three cells sequenced by four rounds of O-LIT. The largest cell in the FOV corresponds to the cell in Figure 2C. Each round is shown on the z-axis, with the first round being closest to the nuclear DAPI outline (black). The maximum z projection of the sequencing signal was taken from each round, copied (two images in total for better visualization), and superimposed vertically to form the image. [Figure 2B] Refer to the explanation in Figure 2A. [Figure 2C] Refer to the explanation in Figure 2A. [Figure 2D] Refer to the explanation in Figure 2A. [Figure 3A]Figures 3A–3F are a series of images, schematics, and graphs illustrating the 36plex-5K full-pixel analysis pipeline. Figure 3A is a schematic diagram showing the full-pixel automated analysis pipeline. Different light and dark areas correspond to different chromosomal targets. Close-up images (e.g., panel 2) show the Chr2 homologs (6 targets) that have been decoded, mapped, and traced. Figure 3B is a bar graph showing 36plex-5K main-street-back-street (MSBS) target detection after hierarchical 2. 80.2±7.3% of targets were detected in 638 cells from 13 copies. The chromosomes in the schematic (cartoon) on the x-axis represent the target chromosomes. Note that 3qR3 and 5pR3 targets are not included because they have the same barcode. Figure 3C is an image showing chromosome tracing of the nuclear panel (from Figures 2A–2D) using targets decoded after hierarchical 2. 64 / 66 (97%) of 36plex-5K targets were detected. The image is from the first round of LIT, with target identity overlaid. Various lines indicate chromosome traces between detected targets. Figure 3D is a 3D view of the nuclei from Figures 3B-3C. Chromosome targets are colored as shown. Black spheres are undetected targets. Figure 3E is an image showing the single-cell pairwise spatial distance matrix after hierarchical 2 detection of the nuclei from Figures 3B-3C. Targets are shown on the x-axis, separated by each homolog. Undetected targets are shown by gray lines. Figure 3F is an image showing 36plex-5K population pairwise spatial distance measurements. It shows the average pairwise spatial distance from the cell population (n = 638 cells) after hierarchical 1 detection. Measurements from homologous targets were summed. [Figure 3B] Refer to the explanation in Figure 3A. [Figure 3C] Refer to the explanation in Figure 3A. [Figure 3D] Refer to the explanation in Figure 3A. [Figure 3E-1] Refer to the explanation in Figure 3A. [Figure 3E-2] Refer to the explanation in Figure 3A. [Figure 3F] Refer to the explanation in Figure 3A. [Figure 4A]Figures 4A–4D are a series of images, schematics, and graphs illustrating OligoFISSEQ-eLIT. Figure 4A shows a schematic diagram of the Just Enough Barcode (JEB) technology used in OligoFISSEQ-Exact Barcode Concatenation-Based Target Query (eLIT). The JEB-labeled 8-mers are shown in detail in gray boxes. The 3' end of each 8-mer is perfectly complementary to the 5nt eLIT barcode bit. The "I" at the 5' end may be deoxyinosine ("universal base"). As shown in Figure 4A, JEB oligos may include (5' to 3'): nnnTGACT (SEQ ID NO: 6), nnnAGACC (SEQ ID NO: 7), nnnGACCA (SEQ ID NO: 8), and / or nnnGAGCG (SEQ ID NO: 9), where "n" represents a universal nucleotide base (e.g., deoxyinosine), and the oligo may further include sulfur modifications in place of the bridging oxygen of the phosphate backbone between nucleotides 3 and 4. JEB oligos reduce the pool of labeled 8mers to 4. Figure 4B shows a schematic diagram of OligoFISSEQ-eLIT using JEB. JEB oligos (see, e.g., Figure 4A) share complete complementarity (5nt) with the eLIT barcode bits. Figure 4B shows a JEB oligo (e.g., SEQ ID NO: 8 or 7) hybridizing with a portion of the barcode region (e.g., SEQ ID NO: 10, TGGTCGGTCTAGTCA). Figure 4C shows a series of images of a 36plex-1K library sequenced in 5 rounds of OligoFISSEQ-eLIT PGP1f cells. The upper image shows the trimmed real field of view of cells after sequencing of the first round. The lower panel is a close-up of nuclei (squares in the upper image) sequenced by 5 rounds of the "toto hive" detecting all targets using labeled secondary oligos (T). Extranuclear spots are tetraspec beads for positional reference. The images show the analyzed maximum z projection. Scale bar = 10 μm. Figure 4D is a bar graph showing the target detection efficiency of the 36plex-1K library after hierarchical detection and O-LIT (light gray) using SOLiD reagents with 5 rounds or eLIT (dark gray) using JEB.Mean detection rate: SOLiD = 54.6% (n = 41 cells from 1 replication), JEB = 76.4±8.6% (n = 439 cells from 8 replications). Error bar = population standard deviation. [Figure 4B] See the explanation in Figure 4A. [Figure 4C] See the explanation in Figure 4A. [Figure 4D] See the explanation in Figure 4A. [Figure 5A] Figures 5A–5F are a series of images, schematics, and graphs showing the tracing of 46 regions along chromosome X. Figure 5A is the layout of the ChrX-46plex-2K library overlaid on a trimmed real field from the first round of LIT sequencing in PGP1f. The micrograph shows the analyzed maximum intensity z projection. Figure 5B shows close-up images of cells (squares in the real field of view in Figure 5A) sequenced with OligoFISSEQ-eLIT for 5 rounds, hybridized with the ChrX-46plex-2K library and with the main street and back street removed. The numbers in white indicate the sequencing round. The left panel shows the whole nucleus (DAPI) from the first round of sequencing. The smaller panel on the right shows close-ups of each sequencing round with the "toto hive," which detects all targets using labeled secondary oligos (T). The images show the analyzed maximum z projection. Figure 5C is a bar graph showing the target detection efficiency of the ChrX-46plex-2K library after hierarchical 2 detection and 5 rounds of eLIT (MS and MSBS) in PGP1f. Mean detection = 74.6 ± 2.5% (n = 146 cells from 5 replications). Error bars = population standard deviation. Figures 5D-5E are a series of images showing mapping and tracing (Figure 5D) and 3D visualization (Figure 5E) of ChrX-46plex-2K after interpolation of cells from Figure 5B. Figure 5F is an image showing the pairwise distance matrix after interpolation of nuclei from Figure 5B. Figure 5G is an image showing the ChrX-46plex (MS and MSBS) population pairwise spatial distance measurement. Mean pairwise spatial distance from the cell population (n = 61 cells from 2 replications) after hierarchical 1 detection. [Figure 5B]Refer to the explanation in Figure 5A. [Figure 5C] Refer to the explanation in Figure 5A. [Figure 5D] Refer to the explanation in Figure 5A. [Figure 5E] Refer to the explanation in Figure 5A. [Figure 5F] Refer to the explanation in Figure 5A. [Figure 5G] Refer to the explanation in Figure 5A. [Figure 6A]Figures 6A–6D are a series of images, schematics, and graphs illustrating the extensions and applications of OligoFISSEQ. Figure 6A shows an image and schematic diagram of a gene target illustrating OligoFISSEQ detection of a single gene target. The actual field of view of the sample is from the first round of O-eLIT against PGP1f. The squares enclose specific gene targets after 5 rounds. The numbers indicate the percentage of targets detected out of 11. The image shows the maximum z projection analyzed. Figure 6B is a bar graph showing the target detection efficiency of a 6-gene library after 5 rounds of O-eLIT, excluding hierarchical 2 detection and main street and back street detection. n = 61 cells from 2 replications. Error bars = standard deviation within the cell population. Figure 6C is an image combining OligoFISSEQ-LIT and immunofluorescence. The 36plex-5K library was sequenced with 4 rounds of OligoFISSEQ-LIT and then immunofluorescence was performed. The images show the maximum intensity z projections with chromosome traces overlaid. Figure 6D is a series of images showing the combination of OligoSTORM and OligoFISSEQ-LIT (O-LITSTORM) for multiplexing genome visualization using superresolution microscopy. The Chr2-6plex-5K library was hybridized to PGP1f cells and prepared for one round of OligoSTORM to visualize all targets simultaneously, and then the targets were decoded by two rounds of O-LIT. The left panel shows OligoSTORM images after DBSCAN, at which point the cluster identities are unknown. The center panel shows micrographs from the first round of O-LIT. The images show the analyzed maximum z projections. The center right panel shows magnified views of the decoded targets. The right panel shows magnified views of the targets from OligoSTORM. The bottom panel shows diffraction-limited and STORM images of each target. [Figure 6B] Refer to the explanation in Figure 6A. [Figure 6C] Refer to the explanation in Figure 6A. [Figure 6D-1] Refer to the explanation in Figure 6A. [Figure 6D-2] Refer to the explanation in Figure 6A. [Figure 7] This is a workflow flowchart for the chromosome tracing process. [Figure 8] This is a series of histograms showing the distances between 36 consecutive sitting positions. [Figure 9] This is a histogram of the distance between consecutive sitting ChrX-46plexes. [Figure 10A]Figures 10A–10H are a series of schematic diagrams, images, and graphs illustrating methods for visualizing and identifying highly multiplicated in-situ targets. Figure 10A is a schematic diagram of oligonucleotide modification enabling specific cleavage. Here, a phosphorothiolate-modified oligonucleotide is shown as a non-limiting example. The sulfide modification replaces the cross-linking oxygen of the oligonucleotide phosphate backbone and is indicated by an asterisk (*). Treatment with a heavy metal (50 mM AgNO3) under mild conditions results in cleavage of the oligonucleotide at the sulfide substitution (indicated by a scissors illustration), resulting in the oligonucleotide being divided into two parts and generating a 5' phosphate (PO4). This sulfide modification can be positioned at any nucleotide position within the oligonucleotide, demonstrating its flexibility. Figure 10B is a schematic diagram illustrating the exemplary use of a phosphorothiolate oligo for enzyme-mediated ligation, targeted cleavage, and oligonucleotide elongation. A primer containing the 5' phosphate is elongated by ligation with the phosphorothiolate oligo. AgNO3-mediated cleavage occurs at a user-defined position (marked with an asterisk), resulting in the cleavage of the extended oligo and the regeneration of 5' PO4. The oligo can be further extended by introducing another sulfide-modified oligo. Figure 10C is a schematic diagram showing the use of phosphorothiolate oligochemistry to improve the specificity and signal of fluorescence in situ sequencing (FISSEQ). This schematic diagram shows a 4-labeled ligation sequencing (SBL) scheme used in SOLiD (Sequencing by Oligonucleotide Ligation and Detection). As shown in the figure, 8nt (nucleotide) fluorescently labeled oligos can be used. SOLiD uses a two-base scheme, where nt1 and nt2 correspond to specific fluorophores (shaded circles in the table) from the 3' end to the 5' end; nt3-5 are a mixture of A, C, T, and G; and nt6-8 are universal bases with a phosphorothiolate (indicated by *) between nt5 and nt6.The SOLiD oligo pool consists of 1,024 different oligo species. In contrast, the “Just Enough Barcode” (JEB) scheme and chemistry described herein reduces the number of oligo species to, for example, 4 by restricting nt1-5 to specific sequences and having nt6-8 as deoxyinosine nucleotides ("universal bases"). Note that the restriction of the 5nt sequence in JEB is an application of the non-restrictive example. Phosphothiolate-modified oligos are suitable for any combination of designated / restricted nts. Furthermore, fluorophore complexation is flexible and compatible with many different fluorophores or detectable labels. Figure 10D is a schematic diagram showing the use of JEB chemistry to improve OligoFISSEQ. Illustrated are barcoded oligopaints compatible with SBL. Figure 10E is a schematic diagram of OligoFISSEQ using JEB. First, a 5' phosphorylated ligating primer hybridizes to the ligating sequencing primer binding site on the oligopaint street. Next, JEB oligos are introduced along with DNA ligase. JEB oligos complementary to the barcode (e.g., SEQ ID NO: 6-9) hybridize and ligate. Unligated JEBs are identified, and the image is captured. The JEB oligos are cleaved between nt5 and nt6, releasing a fluorophore and exposing 5' PO4. This cycle is repeated until all barcodes are sequenced. Examples of ligated oligos include SEQ ID NO: 2 (GACCA), SEQ ID NO: 12 (nnnAGACCGACCA, where n contains a universal nucleotide base (e.g., deoxyinosine), and the oligo further includes a sulfur modification between nucleotides 3 and 4 in place of the bridging oxygen of the phosphate backbone), or SEQ ID NO: 13 (AGACCGAGCGTGACTAGACCGACCA). Figure 10F is a series of images showing that OligoFISSEQ using JEB oligos had an improved signal compared to SOLiD oligos.The image shows a representative image from the first round of sequencing of 9,000 barcoded oligopaints targeting a 2.4 Mb region on Chr19 (chromosome 19). Two nuclei were present in each image. The imaging conditions (e.g., exposure, excitation, etc.) were the same for both images. Figure 10G is a bar graph showing that OligoFISSEQ using JEB oligos exhibited a signal-to-noise ratio (SNR) more than four times higher than that of SOLiD oligos. The histogram compares the SNR of the sequencing signals from the image in Figure 10F. The SNR was calculated by measuring the brightest pixel at each sequencing focus from the z projection of the image in Figure 10F and dividing by the mean nuclear background intensity (i.e., areas where no sequencing signal is present). The value was then normalized to SNR along with SOLiD. Figure 10H is a schematic diagram showing the workflow for multiplexed genome visualization. The primary oligopaint library (small gray circles) is hybridized to fixed cells. This allows each target to be sequenced in multiple rounds (for example, 3 rounds as shown in the diagram). After sequencing is complete, each focus can be decoded, compared to a key, and a unique barcode can be identified. [Figure 10B] Refer to the explanation in Figure 10A. [Figure 10C] Refer to the explanation in Figure 10A. [Figure 10D] Refer to the explanation in Figure 10A. [Figure 10E] Refer to the explanation in Figure 10A. [Figure 10F] Refer to the explanation in Figure 10A. [Figure 10G] Refer to the explanation in Figure 10A. [Figure 10H] Refer to the explanation in Figure 10A. [Figure 11A]Figures 11A–11E are a series of schematic diagrams and images showing "Just Enough Barcode" (JEB) overhangs. Figure 11A shows a schematic diagram of the color barcode of the Chr2-6plex-1K library. Six genomic regions (labeled A–F in Figure 11A) along human chromosome 2 were targeted with 1,000 oligopaint oligos per genomic region. Each genomic region contains a specific barcode, and one round is shown here (e.g., in Figures 11A–11E). Figure 11B shows one round of OligoFISSEQ-eLIT using JEBs, visualizing the Chr2-6plex-1K library in PGP1f cells. One of the JEBs (indicated by an arrow) contains an oligonucleotide (oligo) overhang instead of a fluorophore and is not visualized in these images (e.g., Cy3). Images show the maximum intensity z projection. The scale bar is 10 μm. Figure 11C shows the hybridization of the same nucleus as in Figure 11B with a fluorophore-labeled oligo complementary to the oligo overhang on the JEB. The Cy3 signal appears. In Figure 11D, the fluorophore-labeled oligo hybridized to the JEB overhang is washed away with 60% formamide. The Cy3 signal disappears. In Figure 11E, a new double fluorophore-labeled oligo is hybridized to the JEB overhang. The Cy3 signal reappears. [Figure 11B] Refer to the explanation in Figure 11A. [Figure 11C] Refer to the explanation in Figure 11A. [Figure 11D] Refer to the explanation in Figure 11A. [Figure 11E] Refer to the explanation in Figure 11A. [Figure 12A] Figures 12A–12B are a series of images and graphs showing 129plex oligopaint FISH on a metaphase spread derived from human male peripheral blood lymphocytes. [Figure 12B] Refer to the explanation in Figure 12A. [Figure 13] This is a series of images showing four rounds of OligoFISSEQ using JEB oligonucleotides against human male peripheral blood lymphocytes. [Figure 14]This image shows decoding of a metaphase spread derived from human male peripheral blood lymphocytes using three rounds of OligoFISSEQ. [Figure 15] This image shows karyotype analysis using four rounds of OligoFISSEQ on a metaphase spread derived from human male peripheral blood lymphocytes. [Figure 16] This is a series of images and graphs demonstrating the enhancement of fluorescence signals in situ sequencing signals by gold nanoparticles (Au-NP). Main-street and back-street sequencing primers were labeled with 50 nm Au-NP and 30 nm Au-NP, respectively. The target was six spots in Chr 19, approximately 0.5 kb and 15 oligonucleotides per spot. TxR refers to the "Texas Red" fluorophore. [Figure 17A] Figures 17A–17B are a series of images and graphs demonstrating the combination of OligoSTORM and OligoFISSEQ to accelerate genome superresolution imaging. In Figure 17A, a 36plex-5K library was hybridized to PGP1f cells and imaged with OligoSTORM for one round (2 hours) to simultaneously visualize all 66 targets, followed by decoding of the targets with four rounds of OligoFISSEQ (2–3 hours per round). Figure 17B shows each chromosomal region imaged with OligoSTORM separately. The orientation may differ from that in Figure 17A. [Figure 17B-1] Refer to the explanation in Figure 17A. [Figure 17B-2] Refer to the explanation in Figure 17A. [Figure 17B-3] Refer to the explanation in Figure 17A. [Modes for carrying out the invention]
[0151] Detailed explanation Aspects of the techniques described herein include oligonucleotide compositions and sets for analyzing, detecting, and / or visualizing target molecules, as well as corresponding methods. In some aspects of any aspect, the identity of at least one oligonucleotide tag (e.g., a barcoded oligopaint) conjugated to at least one target molecule is determined using a set of readout molecules. Such oligonucleotide tags and readout molecule sets each contain a limited number of barcode regions and barcode hybridized regions. Compared to other methods (e.g., SOLiD chemistry), these readout molecule sets and sequencing methods, referred herein as "Just Enough Barcode" (JEB) or "Exact Barcode," are simplified, discard unwanted oligos, and produce a higher level of sequencing signal. Furthermore, the sets and methods described herein demonstrate at least two advantages compared to other compositions and methods: (1) reducing the number of oligonucleotide tags (e.g., oligopaints) required to generate a sufficient signal from the target molecule, and (2) increasing the number of detectable barcode bits, and therefore increasing the number of uniquely identifiable targets. Ultimately, the sets and methods described herein will enable imaging of the entire human genome.
[0152] Accordingly, in one aspect, this specification describes at least two sets of readout molecules, each readout molecule comprising: (a) a 3'-side barcode hybridized region of a nucleotide or analogue containing a unique sequence distinct from the 3'-side sequences of all other readout molecules in the set; (b) a 5'-side non-barcode hybridized region of a nucleotide or analogue containing a sequence identical to the 5'-side sequences of all other readout molecules in the set; (c) a sulfur modification in place of the bridging oxygen of the phosphate backbone between the 5'-side and the 3'-side; and (d) an optically detectable label.
[0153] In another context, this specification describes a method for detecting (and / or analyzing) at least one target molecule in a sample, the method being as follows: (a) A step of contacting the sample with at least one oligonucleotide tag, each oligonucleotide tag comprising (i) a recognition domain that specifically binds to a target molecule to be detected (and / or analyzed), and (ii) a barcode region comprising at least one barcode bit; (b) the step of bringing the sample into contact with the set of readout molecules described herein; and (c) A step of detecting the relative order of optically detectable labels hybridized to at least one oligonucleotide tag, wherein the at least one oligonucleotide tag hybridizes to at least one target molecule, the relative order of the optically detectable labels enables identification of which oligonucleotide tag hybridizes to the target molecule at that location. Includes.
[0154] As used herein, the term “readout molecule” means a molecule comprising at least 1) a detectable label, and 2) a barcode hybridize region, the latter being an oligonucleotide sequence complementary to and / or specifically hybridizing to at least a portion of at least one oligonucleotide tag. As used herein, the term “oligonucleotide tag” means an oligonucleotide comprising a recognition domain and / or at least one street. The recognition domain specifically binds to a target molecule to be detected, and the street comprises a barcode region containing at least one barcode bit (or unit). Each barcode hybridize region hybridizes to a specific barcode bit of the oligonucleotide tag. In some aspects of any given situation, the total number of unique barcode bits and / or barcode hybridize regions is considerably less than the total number of possible unique barcode bits. Such a limited number reduces the total number of readout molecules required and increases the signal-to-noise ratio of readout molecules being detected.
[0155] This specification describes readout molecules and sets thereof. As used herein, the term “readout molecule” means a molecule comprising at least 1) a detectable label, and 2) an oligonucleotide sequence that is complementary to and / or specifically hybridizes to at least a portion of at least one oligonucleotide tag. In some aspects of any aspect, the readout molecule includes a barcode hybridize region that is complementary to and hybridizes to at least a portion of at least one oligonucleotide tag (e.g., a barcode region). In some aspects of any aspect, the readout molecule includes one barcode hybridize region and at least one other region (e.g., a non-barcode hybridize region). In some aspects of any aspect, the readout molecule includes one barcode hybridize region and at least one modification. In some aspects of any aspect, the readout molecule includes a single barcode hybridize region. In some aspects of any given situation, the readout molecule includes a single label, or an optically detectable single label, or a single label that provides an optically detectable single signal.
[0156] In some aspects of any given context, the readout molecule is DNA and / or RNA. In some aspects of any given context, the readout molecule comprises DNA and / or RNA. In some aspects of any given context, the readout molecule consists of DNA and / or RNA, or is essentially composed of DNA and / or RNA. In some aspects of any given context, the readout molecule comprises a polypeptide.
[0157] In some aspects of any given plane, the read molecule includes (a) a 3'-side barcode hybridized region, (b) a 5'-side non-barcode hybridized region, (c) a modification between the 3'-side and 5'-side regions, and (d) a detectable label (see, for example, Figure 10C). In some aspects of any given plane, the read molecule includes (a) a 5'-side barcode hybridized region, (b) a 3'-side non-hybridized region, (c) a modification between the 3'-side and 5'-side regions, and (d) a detectable label. In some aspects of any given plane, the read molecule includes (a) a barcode hybridized region, (b) at least one non-barcode hybridized region, (c) a modification between the barcode hybridized region and at least one non-barcode hybridized region, and (d) a detectable label.
[0158] In some aspects of any given situation, the readout molecule includes (a) a 3'-side barcode hybridized region of a nucleotide or analogue containing a unique sequence distinct from the 3' region sequences of all other readout molecules in the set; (b) a 5' region of a nucleotide or analogue containing a sequence identical to the 5' region sequences of all other readout molecules in the set; (c) a sulfur modification in place of the bridging oxygen of the phosphate backbone between the 5' region and the 3' region; and (d) an optically detectable label (see, for example, Figure 10C).
[0159] In some aspects of any given plane, the read molecule includes (a) a 3'-side barcode hybridized region, (b) a 5'-side non-barcode hybridized region, (c) modifications between the 3'-side and 5'-side regions, and optionally (d) a detectable label (see, for example, Figure 10C or Figures 11A-11E). In some aspects of any given plane, the read molecule includes (a) a 5'-side barcode hybridized region, (b) a 3'-side non-hybridized region, (c) modifications between the 3'-side and 5'-side regions, and optionally (d) a detectable label. In some aspects of any given plane, the read molecule includes (a) a barcode hybridized region, (b) at least one non-barcode hybridized region, (c) modifications between the barcode hybridized region and at least one non-barcode hybridized region, and optionally (d) a detectable label.
[0160] In some aspects of any given situation, the readout molecule includes (a) a 3'-side barcode hybridized region of a nucleotide or analogue containing a unique sequence distinct from the 3' region sequences of all other readout molecules in the set; (b) a 5' region of a nucleotide or analogue containing a sequence identical to the 5' region sequences of all other readout molecules in the set; (c) a sulfur modification in place of the bridging oxygen of the phosphate backbone between the 5' region and the 3' region, and optionally (d) an optically detectable label (see, for example, Figure 10C or Figures 11A-11E).
[0161] In some aspects of any given aspect, the read molecule includes (a) a 3'-side barcode hybridized region, (b) a 5'-side non-barcode hybridized region, and (c) modifications between the 3' region and the 5' region (see, for example, Figure 10C or Figures 11A-11E). In some aspects of any given aspect, the read molecule includes (a) a 5'-side barcode hybridized region, (b) a 3'-side non-hybridized region, and (c) modifications between the 3' region and the 5' region. In some aspects of any given aspect, the read molecule includes (a) a barcode hybridized region, (b) at least one non-barcode hybridized region, and (c) modifications between the barcode hybridized region and the at least one non-barcode hybridized region.
[0162] In some aspects of any given situation, the readout molecule comprises (a) a 3'-side barcode hybridized region of a nucleotide or analogue containing a unique sequence distinct from the 3' region sequences of all other readout molecules in the set; (b) a 5'-side non-barcode hybridized region of a nucleotide or analogue; and (c) a sulfur modification in place of the bridging oxygen of the phosphate backbone between the 5' region and the 3' region.
[0163] In some aspects of any given situation, the readout molecule comprises: (a) a 3'-side barcode hybridized region of a nucleotide or analogue containing a unique sequence distinct from the 3'-side sequences of all other readout molecules in the set; (b) a 5'-side non-barcode hybridized region of a nucleotide or analogue containing a sequence identical to the 5'-side sequences of all other readout molecules in the set; (c) a sulfur modification in place of the bridging oxygen of the phosphate backbone between the 5'-side and the 3'-side; (d) an optically detectable label; and (e) nanoparticles.
[0164] In some aspects of any given situation, the readout molecule comprises (a) a 3'-side barcode hybridized region of a nucleotide or analogue containing a unique sequence distinct from the 3'-side sequences of all other readout molecules in the set of readout molecules; (b) a 5'-side non-barcode hybridized region of a nucleotide or analogue containing a sequence identical to the 5'-side sequences of all other readout molecules in the set; (c) a sulfur modification in place of the bridging oxygen of the phosphate backbone between the 5'-side and the 3'-side; and (d) a metal nanoparticle.
[0165] In some aspects of any aspect, the readout molecule comprises a 3'-side barcode hybridized region of a nucleotide or its analogue; a 5'-side non-barcode hybridized region of a nucleotide or its analogue; a sulfur modification in place of the bridging oxygen of the phosphate backbone between the 5' region and the 3' region; and metal nanoparticles. In some aspects of any aspect, the readout molecule further comprises an optically detectable label.
[0166] As used herein, the term “barcode hybridize region” refers to a region of a read molecule that contains a sequence complementary to and thus hybridizing with at least a portion of the barcode region of an oligonucleotide tag. In some aspects of any given aspect, the barcode hybridize region is located at the 3' end of the read molecule and is therefore called the “3'-side barcode hybridize region.” In some aspects of any given aspect, the barcode hybridize region is located at the 5' end of the read molecule and is therefore called the “5'-side barcode hybridize region.” In some aspects of any given aspect, the barcode hybridize region is located between the 5' and 3' ends of the read molecule and is therefore called the “barcode hybridize region.”
[0167] In some aspects of any given configuration, the barcode hybridized region is on the 3' side of the non-barcode hybridized region. In some aspects of any given configuration, the barcode hybridized region is on the 5' side of the non-barcode hybridized region. In some aspects of any given configuration, the barcode hybridized region is on the 3' side of the label. In some aspects of any given configuration, the barcode hybridized region is on the 5' side of the label.
[0168] In some aspects of any given plane, the barcode hybridize region (e.g., the 3'-side barcode hybridize region) is the length of at least one nucleotide (or its analogue). In some aspects of any given plane, the barcode hybridize region (e.g., the 3'-side barcode hybridize region) is the length of five nucleotides (and / or its analogue). As a non-limiting example, the barcode hybridize region (e.g., the 3'-side barcode hybridize region) is the length of one nucleotide, two nucleotides, three nucleotides, four nucleotides, five nucleotides, six nucleotides, seven nucleotides, eight nucleotides, nine nucleotides, or at least ten nucleotides. In some aspects of any given plane, the length of the barcode hybridize region corresponds to the bit size of the barcode region of the oligonucleotide tag, where “bit” refers to a distinct unit of the barcode region of the oligonucleotide tag, where one bit is the length of at least one nucleotide (or its analogue).
[0169] In some aspects of any given situation, each barcode hybridize region contains a unique sequence distinct from the barcode hybridize region sequences of all other read molecules in the set of read molecules. In some aspects of any given situation, each barcode hybridize region contains a unique sequence distinct from the barcode hybridize region sequences of at least one (e.g., at least one, at least two, at least three, at least four, etc.) other read molecules in the set of read molecules. In some aspects of any given situation, each type of read molecule contains a barcode hybridize region sequence that is as different as possible from each of the other types of barcode hybridize regions of the other types of read molecules in its set. The differences between barcode hybridize region sequences can be measured or quantified by metrics such as the Hamming distance. As a non-limiting example, the barcode hybridized regions differ from each other by a Hamming distance of at least 2 base pairs, at least 3 base pairs, at least 4 base pairs, at least 5 base pairs, at least 6 base pairs, at least 7 base pairs, at least 8 base pairs, at least 9 base pairs, or at least 10 base pairs.
[0170] In some aspects of any given context, the barcode hybridize region includes nucleotides and / or nucleotide analogs further described herein. Non-limiting examples of barcode hybridize region sequences include (5' to 3'): GAGCG (SEQ ID NO: 1); GACCA (SEQ ID NO: 2); AGACC (SEQ ID NO: 3); and TGACT (SEQ ID NO: 4); see, for example, Figure 10C. Further non-limiting examples of barcode hybridize region sequences include: GCGAG (SEQ ID NO: 14); ACCAG (SEQ ID NO: 15); CCAGA (SEQ ID NO: 16); and TCAGT (SEQ ID NO: 17). It is expected that any given nucleotide or nucleotide analog sequence can become a barcode hybridize region, insofar as each barcode hybridize region in the set of readout molecules is distinct and separate from all other barcode hybridize regions.
[0171] In some aspects of any given aspect, the read molecule includes at least one other region in addition to the barcode hybridize region. In some aspects of any given aspect, the read molecule includes a 3'-side barcode hybridize region and a 5'-side non-barcode hybridize region. In some aspects of any given aspect, the read molecule includes a 5'-side barcode hybridize region and a 3'-side non-barcode hybridize region. In some aspects of any given aspect, the read molecule includes a barcode hybridize region, a 5'-side non-barcode hybridize region, and a 3'-side non-barcode hybridize region.
[0172] In some aspects of any aspect, the non-barcode hybridize region (e.g., the 5' non-barcode hybridize region) comprises nucleotides and / or nucleotide analogs further described herein. In some aspects of any aspect, the non-barcode hybridize region (e.g., the 5' non-barcode hybridize region) contains a sequence identical to the non-barcode hybridize region (e.g., the 5' non-barcode hybridize region) sequence of all other read molecules in its set of read molecules. In some aspects of any aspect, the non-barcode hybridize region (e.g., the 5' non-barcode hybridize region) contains a sequence identical to the non-barcode hybridize region (e.g., the 5' non-barcode hybridize region) sequence of at least one (e.g., at least one, at least two, at least five, at least four, etc.) other read molecules in its set of read molecules. In some aspects of any given situation, the non-barcode hybridized region (e.g., the 5' non-barcode hybridized region) contains a sequence that is not identical to the sequence of the non-barcode hybridized region (e.g., the 5' non-barcode hybridized region) of at least one (e.g., at least one, at least two, at least five, at least four, etc.) other read molecules in its set of read molecules.
[0173] In some aspects of any given aspect, the non-barcode hybridized region (e.g., the 5' non-barcode hybridized region and / or the 3' non-barcode hybridized region) contains only universal nucleotide bases. In some aspects of any given aspect, the non-barcode hybridized region (e.g., the 5' non-barcode hybridized region and / or the 3' non-barcode hybridized region) contains only deoxyinosine nucleotides.
[0174] In some aspects of any given plane, the non-barcode hybridized region (e.g., the 5' non-barcode hybridized region) is at least one nucleotide (or an analogue thereof) in length. In some aspects of any given plane, the non-barcode hybridized region (e.g., the 5' non-barcode hybridized region) is three nucleotides (and / or an analogue thereof) in length. As a non-limiting example, the non-barcode hybridized region (e.g., the 5' non-barcode hybridized region) is one nucleotide, two nucleotides, three nucleotides, four nucleotides, five nucleotides, six nucleotides, seven nucleotides, eight nucleotides, nine nucleotides, or at least ten nucleotides in length.
[0175] In some aspects of any given plane, the non-barcode hybridized region of at least one readout molecule is not linked to a detectable label. In some aspects of any given plane, the non-barcode hybridized region of at least one readout molecule specifically hybridizes to an oligonucleotide. In some aspects of any given plane, the oligonucleotide contains at least one detectable label. In some aspects of any given plane, the oligonucleotide specifically hybridizes to at least one other oligonucleotide (e.g., a branching reaction). In some aspects of any given plane, the oligonucleotide is an amplification primer. In some aspects of any given plane, the oligonucleotide is a sequencing primer. In some aspects of any given plane, the oligonucleotide is an imager strand for super-resolution microscopy (e.g., DNA-PAINT).
[0176] In some aspects of any given plane, the non-barcode hybridize region of at least one read molecule is at least 5 nucleotides long. In some aspects of any given plane, the non-barcode hybridize region of at least one read molecule is at least 10 nucleotides long. In some aspects of any given plane, the non-barcode hybridize region of at least one read molecule is at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotides long. In some aspects of any given plane, the non-barcode hybridize region contains a sequence identical to the non-barcode hybridize region sequence of all other read molecules in its set.
[0177] In some aspects of any given configuration, the readout molecule includes modifications between the barcode hybridized region and the non-barcode hybridized region. In some aspects of any given configuration, the readout molecule includes modifications to the phosphate skeleton between the barcode hybridized region and the non-barcode hybridized region, for example, the chemistry of which is different from that of the natural phosphate skeleton of the nucleic acid. In some aspects of any given configuration, the readout molecule includes modifications between the 3'-side barcode hybridized region and the 5'-side non-barcode hybridized region. In some aspects of any given configuration, the readout molecule includes modifications between the 5'-side barcode hybridized region and the 3'-side non-barcode hybridized region. In some aspects, the readout molecule includes modifications between the 5' end of the barcode hybridized region and the 3' end of the non-barcode hybridized region. In some aspects, the readout molecule includes modifications between the 3' end of the barcode hybridized region and the 5' end of the non-barcode hybridized region.
[0178] In some aspects of any given context, the modification includes a sulfur modification in place of the bridging oxygen of the phosphate skeleton of the readout molecule (see, e.g., Figure 10A). “Sulfur modification” means the addition of at least one sulfur atom to the phosphate skeleton, either as an addition or substitution. In some aspects of any given context, the modification includes a phosphorothiolate cleavage site. In some aspects of any given context, the modification includes a cleavable modification within the skeleton (see, e.g., US 2014 / 0349294; Xu and Kool, Nucleic Acids Res. 1998 Jul 1, 26(13):3159-64; all of the respective contents are incorporated herein by reference). In some aspects of any given context, the readout molecule includes any cleavable modifications further described herein.
[0179] In some aspects of any given aspect, the readout molecule comprises nnnTGACT (SEQ ID NO: 6), nnnAGACC (SEQ ID NO: 7), nnnGACCA (SEQ ID NO: 8), or nnnGAGCG (SEQ ID NO: 9). In some aspects of any given aspect, "n" (e.g., in one of SEQ ID NO: 6-9) comprises a universal nucleotide base (e.g., deoxyinosine). In some aspects of any given aspect, the oligo further comprises a sulfur modification in place of the bridging oxygen of the phosphate backbone between nucleotides 3 and 4 (e.g., in one of SEQ ID NO: 6-9).
[0180] In some aspects of any given plane, the readout molecule includes a detectable label, e.g., an optically detectable molecule, i.e., a label detectable by light or other electromagnetic wavelengths. In some aspects of any given plane, at least one readout molecule (e.g., of a set of readout molecules) includes a detectable label. In some aspects of any given plane, at least one readout molecule (e.g., of a set of readout molecules) includes an optically detectable label. In some aspects of any given plane, the detectable label is a fluorescent label. In some aspects of any given plane, the detectable label is a fluorophore, and detection is performed by fluorescence microscopy. In some aspects of any given plane, the readout molecule includes an optically detectable label. In some aspects of any given plane, the detectable label includes biotin, amines, metals, metal nanoclusters (e.g., gold, silver, or copper), noble metal nanoparticles, anchor molecules, quantum dots, acridites, or DNA origami structures. In some aspects of any given plane, the detectable label includes DNA origami structures (i.e., DNA nanoscale folds that create non-arbitrary two- and three-dimensional shapes); see, for example, Rothemund, “Folding DNA to create nanoscale shapes and patterns”, Nature 440, 297-302 (2006). In some aspects of any given plane, the detectable label is detected using electron microscopy, fluorescence microscopy, dark-field microscopy, or any combination thereof. In some aspects of any given plane, the readout molecule may contain any detectable label. Non-limiting examples of detectable labels, fluorophores, and detection techniques are further described herein. In some aspects of any given plane, each readout molecule contains at least one detectable label. Non-limiting examples include each readout molecule containing at least one, at least two, at least three, at least four, or at least five detectable labels.
[0181] In some aspects of any given situation, the detectable label may be ligated to the 5' end of the readout molecule, the detectable label may be ligated to the 3' end of the readout molecule, or the detectable label may be ligated to both the 5' and 3' ends of the readout molecule. In some aspects of any given situation, the detectable label ligated to the 5' end of the readout molecule is of the same type as the detectable label ligated to the 3' end of the readout molecule. In some aspects of any given situation, the detectable label ligated to the 5' end of the readout molecule is of a different type than the detectable label ligated to the 3' end of the readout molecule.
[0182] In some aspects of any given plane, the detectable label is located at the 5' end of the readout molecule and is ligated to the 5' non-barcode hybridized region. In some aspects of any given plane, the detectable label is located at the 3' end of the readout molecule and is ligated to the 3' non-barcode hybridized region. In some aspects of any given plane, the detectable label is cleaved from the readout molecule after detection.
[0183] In some aspects of any given situation, at least two readout molecules collectively include at least two distinguishable and detectable labels. Non-limiting examples include two readout molecules collectively including two distinguishable and detectable labels, three readout molecules collectively including three distinguishable and detectable labels, four readout molecules collectively including four distinguishable and detectable labels, or at least five readout molecules collectively including at least five distinguishable and detectable labels. In some aspects of any given situation, the pool of readout molecules includes more readout molecules than distinguishable and detectable labels, for example, the same detectable label may be present on multiple readout molecules.
[0184] In some aspects of any given situation, the set of readout molecules described herein includes at least two labels, where the 3' regions and labels of the set are organized as corresponding pairs, so that all readout molecules containing a first 3' region also include a corresponding first label, and all readout molecules containing a second 3' region also include a corresponding second label, and each readout molecule does not include a label that does not correspond to its 3' region.
[0185] In some aspects of any aspect, the set of read molecules includes four distinguishable labels. In some aspects of any aspect, the set of read molecules includes at least two distinguishable labels, at least three distinguishable labels, or at least four distinguishable labels. In some aspects of any aspect, the set of read molecules includes five, six, seven, eight, nine, ten, or more distinguishable labels. In some aspects of any aspect, the set of read molecules includes more than four distinguishable labels, which can be realized using additional labels (e.g., more than four distinguishable fluorophores), additional barcode bits (e.g., more than four unique barcode bits), and additional barcode hybridize regions of the read molecule (e.g., more than four unique barcode hybridize regions, where each unique barcode hybridize region hybridizes with one of the more than four unique barcode bits).
[0186] In some aspects of any aspect, the readout molecules described herein include optically detectable labels and nanoparticles. In some aspects of any aspect, the readout molecules described herein include nanoparticles of metal particles. The nanoparticles (e.g., metal nanoparticles) enhance the fluorescence of the detectable label through distance-dependent plasmon-enhanced coupling. In some aspects of any aspect, the nanoparticles (e.g., metal nanoparticles) are coupled to at least one readout molecule described herein. In some aspects of any aspect, the at least one readout molecule coupled to the nanoparticles (e.g., metal nanoparticles) includes an optically detectable label (e.g., at the distal end of the readout molecule compared to coupling with the nanoparticles). In some aspects of any aspect, the nanoparticles (e.g., metal nanoparticles) are coupled to at least two readout molecules, which may be the same readout molecule described herein or different readout molecules. As a non-limiting example, nanoparticles (e.g., metal nanoparticles) may be linked to at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 readout molecules as described herein. By linking the nanoparticles to at least two readout molecules in this manner, the signal can be amplified. Thus, the overall signal amplification may result from multiple readout molecules linked to the nanoparticles (e.g., metal nanoparticles) and / or plasmon fluorescence enhancement (between the nanoparticles, e.g., metal nanoparticles, and optically detectable labels such as fluorophores).
[0187] In some aspects of any configuration, the optically detectable label comprises a fluorophore (e.g., Texas Red, FITC, or other fluorophores further described herein). In some aspects of any configuration, the nanoparticles comprise metal nanoparticles. Non-limiting examples of metal nanoparticles include, but are not limited to, Au, Ag, Ni, Co, Pt, Pd, Cu, Ti, and Al nanoparticles, as well as combinations thereof. In some aspects of any configuration, the nanoparticles comprise gold nanoparticles. In some aspects of any configuration, the nanoparticles comprise gold nanorods.
[0188] In some aspects of any given surface, the nanoparticles (e.g., metal nanoparticles) have a diameter of about 1.2 nm. In some aspects of any given surface, the nanoparticles (e.g., metal nanoparticles) have a diameter of about 3 nm. In some aspects of any given surface, the nanoparticles (e.g., metal nanoparticles) have a diameter of about 5 nm. In some aspects of any given surface, the nanoparticles (e.g., metal nanoparticles) have a diameter of about 10 nm. In some aspects of any given surface, the nanoparticles (e.g., metal nanoparticles) have a diameter of about 30 nm. In some aspects of any given surface, the nanoparticles (e.g., metal nanoparticles) have a diameter of about 50 nm. In some embodiments of any surface, the nanoparticles (e.g., metallic nanoparticles) have a diameter of at least 1 nm, at least 2 nm, at least 3 nm, at least 4 nm, at least 5 nm, at least 10 nm, at least 15 nm, at least 20 nm, at least 25 nm, at least 30 nm, at least 35 nm, at least 40 nm, at least 45 nm, at least 50 nm, at least 55 nm, at least 60 nm, at least 65 nm, at least 70 nm, at least 75 nm, at least 80 nm, at least 85 nm, at least 90 nm, at least 95 nm, or at least 100 nm.
[0189] In some aspects of any given plane, the nanoparticles are located at the 3' end of the readout molecule. In some aspects of any given plane, the nanoparticles are located at the 5' end of the readout molecule. In some aspects of any given plane, the nanoparticles are located at both the 3' and 5' ends of the readout molecule. In some aspects of any given plane, the nanoparticles are located at the 3' end of the readout molecule, and the optically detectable label is located at the 5' end of the readout molecule. In some aspects of any given plane, the nanoparticles are located at the 5' end of the readout molecule, and the optically detectable label is located at the 3' end of the readout molecule.
[0190] In some aspects of any given plane, the nanoparticles are at least 20 nucleotides from the detectable label. In some aspects of any given plane, the nanoparticles are at least 30 nucleotides from the detectable label. In some aspects of any given plane, the nanoparticles are at least 5 nucleotides, at least 10 nucleotides, at least 15 nucleotides, at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, at least 45 nucleotides, at least 50 nucleotides, at least 55 nucleotides, at least 60 nucleotides, at least 65 nucleotides, at least 70 nucleotides, at least 75 nucleotides, at least 80 nucleotides, at least 85 nucleotides, at least 90 nucleotides, at least 95 nucleotides, or at least 100 nucleotides from the detectable label.
[0191] In one aspect, a set of readout molecules is described herein. In some aspects of any aspect, a set comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 readout molecules as described herein. In some aspects of any aspect, a set comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 distinct and distinguishable types of readout molecules.
[0192] In one aspect, this specification describes at least two sets of readout molecules, each readout molecule comprising: (a) a 3'-side barcode hybridize region of a nucleotide or analogue containing a unique sequence distinct from the 3'-side sequences of all other readout molecules in the set; (b) a 5'-side non-barcode hybridize region of a nucleotide or analogue containing a sequence identical to the 5'-side sequences of all other readout molecules in the set; (c) a sulfur modification in place of the bridging oxygen of the phosphate backbone between the 5'-side and the 3'-side; and (d) an optically detectable label.
[0193] In one aspect, this specification describes at least two sets of readout molecules, each readout molecule comprising: (a) a 3'-side barcode hybridize region of a nucleotide or analogue containing a unique sequence distinct from the 3'-side sequences of all other readout molecules in the set; (b) a 5'-side non-barcode hybridize region of a nucleotide or analogue containing a sequence identical to the 5'-side sequences of all other readout molecules in the set; (c) a sulfur modification in place of the bridging oxygen of the phosphate backbone between the 5'-side and the 3'-side; and optionally (d) an optically detectable label.
[0194] In one aspect, this specification describes at least two sets of readout molecules, each readout molecule comprising: (a) a 3'-side barcode hybridize region of a nucleotide or analogue containing a unique sequence distinct from the 3'-side sequences of all other readout molecules in the set; (b) a 5'-side non-barcode hybridize region of a nucleotide or analogue; and (c) a sulfur modification in place of a bridging oxygen of the phosphate backbone between the 5'-side and the 3'-side.
[0195] In one aspect, this specification describes at least two sets of readout molecules, each readout molecule comprising: (a) a 3'-side barcode hybridize region of a nucleotide or analogue containing a unique sequence distinct from the 3'-side sequences of all other readout molecules in the set; (b) a 5'-side non-barcode hybridize region of a nucleotide or analogue containing a sequence identical to the 5'-side sequences of all other readout molecules in the set; (c) a sulfur modification in place of the bridging oxygen of the phosphate backbone between the 5'-side and the 3'-side; and (d) an optically detectable label, wherein at least one readout molecule further comprises a nanoparticle.
[0196] In some aspects of any given phase, each read molecule in a set, including a first barcode hybridize region (e.g., a 3'-side barcode hybridize region), contains only the first distinguishable label. In other words, each barcode hybridize region corresponds to a label that is distinguishable from the labels of any other barcode hybridize region. In some aspects of any given phase, each read molecule in a set, including any selected barcode hybridize region (e.g., a 3'-side barcode hybridize region), contains only the corresponding given distinguishable label.
[0197] In some aspects of any given plane, the first distinguishable marker includes only the first barcode hybridize region of the read molecule (e.g., the 3'-side barcode hybridize region). In other words, each marker corresponds to one barcode hybridize region that is distinguishable from other barcode hybridize regions. In some aspects of any given plane, there is a one-to-one relationship between the number of detectable markers and the type of barcode hybridize region (i.e., the type of read molecule). As a non-limiting example, a set of read molecules may include four distinguishable optically detectable markers and four distinguishable barcode hybridize regions, where each type of read molecule includes one of the four distinguishable markers, and the other read molecules in the set do not include that marker, and each type of read molecule includes one of the four barcode hybridize regions, and the other read molecules in the set do not include that barcode hybridize region.
[0198] In some aspects of any given plane, a set of read molecules includes two distinguishable labels and two distinguishable barcode hybridized regions, where each label corresponds to one barcode hybridized region and each barcode hybridized region corresponds to one label. In some aspects of any given plane, a set of read molecules includes three distinguishable labels and three distinguishable barcode hybridized regions, where each label corresponds to one barcode hybridized region and each barcode hybridized region corresponds to one label. In some aspects of any given plane, a set of read molecules includes four distinguishable labels and four distinguishable barcode hybridized regions, where each label corresponds to one barcode hybridized region and each barcode hybridized region corresponds to one label. In some aspects of any given plane, one readout molecule set includes five distinguishable labels and five distinguishable barcode hybridized regions, where each label corresponds to one barcode hybridized region and each barcode hybridized region corresponds to one label. In some aspects of any given plane, one readout molecule set includes six distinguishable labels and six distinguishable barcode hybridized regions, where each label corresponds to one barcode hybridized region and each barcode hybridized region corresponds to one label. In some aspects of any given plane, one readout molecule set includes seven distinguishable labels and seven distinguishable barcode hybridized regions, where each label corresponds to one barcode hybridized region and each barcode hybridized region corresponds to one label. In some aspects of any given plane, a set of read molecules comprises eight distinguishable labels and eight distinguishable barcode hybridized regions, where each label corresponds to one barcode hybridized region and each barcode hybridized region corresponds to one label. In some aspects of any given plane, a set of read molecules comprises n distinguishable labels and n distinguishable barcode hybridized regions, where each label corresponds to one barcode hybridized region and each barcode hybridized region corresponds to one label.
[0199] In some aspects of any given situation, the first distinguishable marker includes a pool of limited barcode hybridized regions (e.g., 3'-side barcode hybridized regions). In other words, each marker corresponds to at least one barcode hybridized region, and each of these at least one barcode hybridized region is distinguishable from other barcode hybridized regions. As a non-limiting example, each distinguishable marker corresponds to 2, 3, 4, 5, 6, 7, 8, 9, or at least 10 distinct barcode hybridized regions, and other distinguishable markers do not correspond to these barcode hybridized regions. In some aspects, each distinguishable marker corresponds to fewer than 256 distinct barcode hybridized regions, e.g., fewer than 200, fewer than 100, fewer than 50, fewer than 25, fewer than 10, or fewer than 5 distinct barcode hybridized regions. This limited number of barcode hybridized regions (and therefore the barcode regions of oligonucleotide tags as well) reduces the number of molecules required to be read in each set and increases the signal output of the detection method described herein.
[0200] In some aspects of any given situation, in a set of readout molecules, each type of readout molecule contains a distinct nucleotide or nucleotide analog at the 3' end of its 3' hybridize region. As a non-limiting example, in a set of four types of readout molecules, one readout molecule contains a 3'-side barcode hybridize region with adenine (A) at the first nucleotide (nt) position (i.e., the most 3'-side nucleotide) of the 3'-side barcode hybridize region; one readout molecule contains a 3'-side barcode hybridize region with thymine (T) at the first nt position of the 3'-side barcode hybridize region; one readout molecule contains a 3'-side barcode hybridize region with cytosine (C) at the first nt position of the 3'-side barcode hybridize region; and one readout molecule contains a 3'-side barcode hybridize region with guanine (G) at the first nt position of the 3'-side barcode hybridize region.
[0201] In some aspects of any given plane, in a set of readout molecules containing nucleotides and nucleotide analogs, the first nt position of the 3' hybridize region is A, T, C, G, uracil (U), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl, and other alkyl derivatives of adenine and guanine, 2-propyl, and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6- This may include azouracil, cytosine and thymine, 5-uracil (pseudracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, as well as (anal) other 8-substituted adenines and guanines, 5-halo, in particular 5-bromo, 5-trifluoromethyl, as well as other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-daazaadenine, 3-deazaguanine, 3-deazaadenine, or any other nucleotide analogs described herein. In some aspects of any aspect, at least two readout molecules of the set are DNA and / or RNA. In some aspects of any aspect, at least two readout molecules of the set include DNA and / or RNA. In some aspects of any given plane, at least two readout molecules of the set molecule consist of DNA and / or RNA, or are essentially composed of DNA and / or RNA. In some aspects of any given plane, at least two readout molecules of the set include polypeptides.
[0202] In some aspects of any given phase, the set of readout molecules includes at least one SEQ ID NO: 6-9. In some aspects of any given phase, the set of readout molecules includes at least two SEQ ID NO: 6-9. In some aspects of any given phase, the set of readout molecules includes at least three SEQ ID NO: 6-9. In some aspects of any given phase, the set of readout molecules includes SEQ ID NO: 6-9.
[0203] In one aspect, this specification describes the use of the readout molecules or sets thereof for the detection of at least one target molecule; signal amplification; branching reactions; hybridization chain reactions (HCR); signal amplification by exchange reactions (SABER); rolling circle amplification (RCA); in situ sequencing; matrix attachment; or super-resolution microscopy. In some aspects of any aspect, the readout molecules or sets thereof can be attached to a matrix, including, but not limited to, a nuclear matrix, a cellular matrix, or a hydrogel.
[0204] In one aspect, this specification describes a method for detecting at least one target molecule in a sample. In some aspects of any aspect, the method includes contacting the sample with at least one oligonucleotide tag. In some aspects of any aspect, each oligonucleotide tag includes a recognition domain that specifically binds to the target molecule to be detected, and a street comprising a barcode region.
[0205] As used herein, the term “oligonucleotide tag” means an oligonucleotide comprising a recognition domain and / or at least one street. In some aspects of any aspect, an oligonucleotide tag comprises, but is not limited to, oligopaint, multiplex-error-robust fluorescence in situ hybridization (MERFISH) oligos, seqFISH oligos, sequential probing of targets (SPOTs) oligos, high-coverage microscopy-based technology (Hi-M) oligos, or optical reconstruction of chromatin structures (ORCA) oligos, or any oligonucleotide used in FISH, and / or a target molecule, such as an oligonucleotide sequence, a portion of a DNA sequence, or any oligonucleotide (e.g., a recognition domain) having sequence complementarity to a particular chromosome or a subchromosomal region of a particular chromosome. For further details, see, for example, Cardozo et al., Mol Cell. 2019 Apr 4;74(1):212-222; Mateo et al., Nature. 2019 Apr;568(7750):49-54; Wang et al., Scientific Reports volume 8, Article number: 4847 (2018); Shah et al., Neuron, Volume 92, Issue 2, 19 October 2016, Pages 342-357; Eng et al., Nat Methods. 2017 Dec;14(12):1153-1155; all of the contents of each are incorporated herein by reference.
[0206] As used herein, the term “street” refers to a portion of an oligonucleotide tag (e.g., oligopaint) that does not have identity with or hybridize to a target sequence. In some aspects of any aspect, a street includes a barcode region. As used herein, “barcode region” refers to a region of a cassette that contains at least one nucleotide. In non-limiting examples, a barcode region may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In some aspects of any aspect, at least one nucleotide in the barcode region contains a modified nucleic acid base as further described herein.
[0207] In some aspects of any given situation, the barcode region is unique to each oligonucleotide tag. As described herein, each barcode region of an oligonucleotide tag includes at least one bit or unit, where each bit corresponds to at least one barcode hybridize region complementary to at least a portion of that bit. In non-limiting examples, each bit of the oligonucleotide tag barcode region corresponds to one barcode hybridize region of one read molecule, two barcode hybridize regions of two read molecules, three barcode hybridize regions of three read molecules, four barcode hybridize regions of four read molecules, or at least five barcode hybridize regions of at least five read molecules, where each barcode hybridize region includes a unique sequence that is complementary to and hybridizes to at least a portion of the bits of the oligonucleotide tag's barcode region.
[0208] In some aspects of any given plane, one bit is the length of one nucleotide, two nucleotides, three nucleotides, four nucleotides, five nucleotides, six nucleotides, seven nucleotides, eight nucleotides, nine nucleotides, or at least ten nucleotides. In some aspects of any given plane, the barcode area of the oligonucleotide tag includes at least one bit. As a non-limiting example, the barcode area of the oligonucleotide tag includes one bit, two bits, three bits, four bits, five bits, six bits, seven bits, eight bits, nine bits, or at least ten bits.
[0209] In some aspects of any given aspect, the sequence of barcode regions differs from the barcode regions of other oligonucleotide tags in that the selection and / or order of barcode bits is unique to each oligonucleotide tag. In some aspects of any given aspect, each oligonucleotide tag has a different barcode region, e.g., a barcode region having a different sequence of barcode bits and / or nucleotides. In some aspects of any given aspect, a street of oligonucleotide tags includes at least two barcode regions, and each barcode region in the street differs from the other barcode regions in the street, e.g., a barcode region having a different sequence of barcode bits and / or nucleotides. In some aspects of any given aspect, the sequence of barcode regions is the same as and common to at least one barcode region of other oligonucleotide tags.
[0210] In some aspects of any given situation, the street of each oligonucleotide tag does not overlap with the street of any other oligonucleotide tag, depending on the barcode area or ordered set of barcode bits. In some aspects of any given situation, the street of each oligonucleotide tag does not overlap with the street of any other oligonucleotide tag, at least in that the spatial order of the barcode bits within the street is different. As a non-limiting example, a barcode containing three barcode bits (e.g., barcode bits "A", "B", and "C") in spatial order 5'-ABC-3' has a unique spatial order of barcode bits that is different from any other street containing a spatial order of barcode bits selected from 5'-ACB-3', 5'-BAC 3', 5'-BCA 3', 5'-CAB 3', or 5'-CBA 3', and each of the aforementioned streets is unique and distinct from one another in their spatial order of those barcode bits.
[0211] In some aspects of any given situation, the street of each oligonucleotide tag (e.g., OligoPaint) does not overlap with the streets of other oligonucleotide tags in that at least the spatial order of the barcode bits within the street is different, and the street of each oligonucleotide tag does not overlap with the streets of other oligonucleotide tags in that at least one or more barcode regions within the street are different.
[0212] In some aspects of any aspect, the street of the oligonucleotide tag further includes a primer-binding region for annealing of the sequencing primer. In some aspects of any aspect, the sequencing primer is DNA or RNA and includes nucleotides and / or nucleotide analogs. In some aspects of any aspect, the sequencing primer is at least 5 nucleotides, at least 10 nucleotides, at least 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, or at least 25 nucleotides long. In some aspects of any aspect, the sequencing primer includes a 5' phosphate. In some aspects of any aspect, the primer-binding region is at least 5 nucleotides, at least 10 nucleotides, at least 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, or at least 25 nucleotides long.
[0213] In some aspects of any given plane, the primer binding region is located 5' to the barcode region of the oligonucleotide tag. In some aspects of any given plane, the primer binding region is located immediately 5' to the barcode region of the oligonucleotide tag.
[0214] In some aspects of any given situation, an oligonucleotide tag (e.g., oligopaint) includes a recognition domain. As used herein, “recognition domain” is a domain of an oligonucleotide tag (e.g., oligopaint) that specifically binds to a target molecule and / or sequence to be detected. In non-limiting examples, the recognition domain may be a nucleic acid sequence complementary to a target molecule and / or sequence, such as a region of a chromosome. Thus, the sequence of the recognition domain will differ depending on the identity of the desired target. It is common in the art to design a recognition domain that specifically hybridizes to any given target under specific conditions, for example, using widely available and free software for that purpose (e.g., Primer3 or PrimerBank, both available on the World Wide Web). In some aspects of any given situation, the recognition domain may have at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with a portion of the target molecule and / or target sequence. In some aspects of any given context, the recognition domain includes a "genomic homology" domain, i.e., a domain that specifically binds to a region of the genome. In some aspects of any given context, multiple recognition domains found on the same or separate oligonucleotide tags (e.g., oligopaint) may specifically bind to a single target molecule and / or target sequence. As a non-limiting example, at least two, at least three, at least four, at least five, at least ten, at least twenty, at least thirty, at least forty, or at least fifty recognition domains may specifically bind to a target molecule and / or target sequence.
[0215] In some aspects of any given situation, when multiple oligonucleotide tags are present, each of the recognition domain sequences may be unique relative to the other recognition domains present. In some aspects of any given situation, when multiple oligonucleotide tags are present, the recognition domain sequences do not overlap with one another.
[0216] In some aspects of any given situation, the recognition domain includes, but is not limited to, oligopaint, multiplex-error-robust fluorescence in situ hybridization (MERFISH) oligos, seqFISH oligos, RNA sequential target probing (SPOT) oligos, high coverage microscopy (Hi-M) oligos, or optical reconstruction of chromatin structures (ORCA) oligos, or any oligonucleotide used in FISH, and / or target molecules, such as oligonucleotide sequences, portions of DNA sequences, or any oligonucleotide (e.g., a recognition domain) having sequence complementarity to a particular chromosome or a subchromosomal region of a particular chromosome. For further details, see, for example, Cardozo et al., Mol Cell. 2019 Apr 4;74(1):212-222; Mateo et al., Nature. 2019 Apr;568(7750):49-54; Wang et al., Scientific Reports volume 8, Article number: 4847 (2018); Shah et al., Neuron, Volume 92, Issue 2, 19 October 2016, Pages 342-357; Eng et al., Nat Methods. 2017 Dec;14(12):1153-1155; all of these are incorporated herein by reference.
[0217] In some aspects of any given context, the recognition domain includes any nucleobinding composition, such as a non-nucleic acid, e.g., a DNA-binding polypeptide. Non-limiting examples include sequence-specific single-stranded DNA-binding proteins or factors, sequence-specific double-stranded DNA-binding proteins or factors, DNA-RNA-binding proteins or factors, or RNA-binding proteins or factors. Non-limiting examples of such nucleic acid-binding compositions include, but are not limited to, transcription factors, restriction enzymes, activator-like effector nucleases (TALENs), and CRISPR-Cas-type factors. In some aspects of any given context, the nucleic acid-binding composition lacks nuclease activity.
[0218] In some aspects of any given setting, the target molecule includes non-nucleic acid molecules, such as polypeptides. Therefore, the recognition domain includes any composition that specifically binds to the target polypeptide. Non-limiting examples of such polypeptide-binding recognition domains include, but are not limited to, antibodies (e.g., nanobodies), aptamers, small molecules, ligands, and known binding partners of specific polypeptides.
[0219] In some aspects of any given context, the oligonucleotide tag does not specifically recognize a target molecule, in that it is not linked to a recognition domain but to an element for detecting the oligonucleotide-tagged element of interest. The oligonucleotide tag may include at least one anchor region and at least one barcode region, but may be a nucleic acid, for example, without a recognition domain. Non-limiting examples of such oligonucleotide-tagged elements include small molecules (e.g., for drug sorting), polypeptides, cells, or non-biological materials (e.g., metals, chemicals, etc.). Methods for detecting such oligonucleotide-tagged elements may be identical to those used for detecting oligonucleotide tags (e.g., oligopaint) described herein (e.g., contacting them with a readout molecule pool that hybridizes to a specific cassette type of oligonucleotide tag). In some aspects of any given context, multiple types of target molecules and / or multiple types of tagging elements may be detected simultaneously using, for example, at least one oligonucleotide tag that recognizes DNA (e.g., oligopaint), at least one oligonucleotide tag that recognizes polypeptides, and / or at least one oligonucleotide-tagged element.
[0220] In some aspects of any given plane, an oligonucleotide tag (e.g., oligopaint) includes at least one street. As used herein, the term “street” refers to a portion of an oligonucleotide tag (e.g., oligopaint) that does not have identity with or hybridize to a target sequence. A street includes a region for detection and / or a region for amplification. In an unrestricted example, an oligonucleotide tag (e.g., oligopaint) includes two streets. In some aspects of any given plane, a street may be one or more “main streets” and / or “back streets.” In an unrestricted example, the main street is 5' to the recognition domain, the main street is 5' to the back street, and / or the main street is 5' to both the recognition domain and the back street. In an unrestricted example, the back street is 3' to the recognition domain, the back street is 3' to the main street, and / or the back street is 3' to both the recognition domain and the main street. As an unrestricted example, the main street is 3' to the recognition domain, the main street is 3' to the back street, and / or the main street is 3' to both the recognition domain and the back street. As an unrestricted example, the back street is 5' to the recognition domain, the back street is 5' to the main street, and / or the back street is 5' to both the recognition domain and the main street.
[0221] In some aspects of any given aspect, a street (e.g., a main street and / or a back street) includes at least one barcode region and / or at least one universal primer binding region. As used herein, “universal primer binding region” refers to the region to which a universal primer (e.g., a universal forward primer, a universal reverse primer) binds. As used herein, “universal primer” refers to a primer used on a plurality of individual oligonucleotide tags (e.g., oligopaint) or on a set of oligonucleotide tags. A universal primer may be used, for example, to amplify oligonucleotide tags (e.g., oligopaint) by PCR to produce, for example, an oligonucleotide tag or a set of oligonucleotide tags. In some aspects of any given aspect, the universal primer binding region of each oligonucleotide tag (e.g., oligopaint) is identical to the universal primer binding region of the remaining oligonucleotide tags, e.g., any other oligonucleotide tags to which the sample is in contact.
[0222] In some aspects of any aspect, the street includes at least one universal primer binding region and / or at least one barcode region. In an unrestricted example, the universal primer binding region is at least on the 5' side of the barcode region. In an unrestricted example, a universal forward primer binding region that specifically binds to a universal forward primer is located at the 5' end of an oligonucleotide tag (e.g., oligopaint). In an unrestricted example, the universal primer binding region is at least on the 3' side of one barcode region. In an unrestricted example, a universal reverse primer binding region that specifically binds to a universal reverse primer is located at the 3' end of an oligonucleotide tag (e.g., oligopaint). In some aspects of any aspect, the universal primer binding region is located on both sides (both 5' and 3') of any barcode region present on the oligonucleotide tag (e.g., oligopaint). In some aspects of any aspect, the universal reverse primer binding region includes a recognition site for a nickel endonuclease (NE) so that, for example, the oligonucleotide tag (e.g., oligopaint) becomes single-stranded upon exposure to NE. In some aspects of any given situation, oligonucleotide tags (e.g., oligopaints) are not necessarily amplified (e.g., by PCR and / or universal priming regions). In some aspects of any given situation, the described oligonucleotide tags (e.g., oligopaints) may be newly synthesized and used "directly from the test tube".
[0223] In some aspects of any given plane, the oligonucleotide tag includes a linkage-based target identification (LIT) primer binding site and a LIT barcode region. In other words, the oligonucleotide tag includes a primer binding site and a barcode region detected using the linkage-based sequencing (SBL) method described herein (see, e.g., Figures 1A, 1C, 4A, and 10D). In some aspects of any given plane, the main street of the oligonucleotide tag includes a LIT primer binding site and a LIT barcode (see, e.g., Figures 1A, 4A, and 10D). In some aspects of any given plane, the back street of the oligonucleotide tag includes a LIT primer binding site and a LIT barcode region (see, e.g., Figures 1A, 4A, and 10D). In some aspects of any given plane, the main street and back street of the oligonucleotide tag each include a LIT primer binding site and a LIT barcode region (see, e.g., Figures 1A, 4A, and 10D).
[0224] In some aspects of any given plane, the oligonucleotide tag includes an exact-linked-based target identification (eLIT) primer binding site and an eLIT barcode region. In other words, the oligonucleotide tag includes a primer binding site and a barcode region detected using a linkage-based sequencing (SBL) method involving a set of readout molecules described herein (see, e.g., Figures 1A, 1C, 4A, and 10D). In some aspects of any given plane, the main street of the oligonucleotide tag includes an eLIT primer binding site and an eLIT barcode region (see, e.g., Figures 1A, 4A, and 10D). In some aspects of any given plane, the back street of the oligonucleotide tag includes an eLIT primer binding site and an eLIT barcode region (see, e.g., Figures 1A, 4A, and 10D). In some aspects of any given plane, the main street and back street of the oligonucleotide tag each include an eLIT primer binding site and an eLIT barcode region (see, e.g., Figures 1A, 4A, and 10D).
[0225] In some aspects of any given plane, the oligonucleotide tag further comprises a synthetic-based target recognition (SIT) primer binding site and an SIT barcode region. In other words, the oligonucleotide tag further comprises a primer binding site and a barcode region detected using the synthetic sequencing (SBS) method described herein (see, e.g., Figures 1A and 1D). In some aspects of any given plane, the main street of the oligonucleotide tag comprises an eLIT primer binding site and an eLIT barcode region, and the back street of the oligonucleotide tag comprises a SIT primer binding site and an SIT barcode region (see, e.g., Figure 1A). In some aspects of any given plane, the back street of the oligonucleotide tag comprises an eLIT primer binding site and an eLIT barcode region, and the main street of the oligonucleotide tag comprises a SIT primer binding site and an SIT barcode region (see, e.g., Figure 1A). In some aspects of any given plane, the main street of the oligonucleotide tag comprises an eLIT primer site, an eLIT barcode region, a SIT primer binding site, and an SIT barcode region. In some aspects of any given configuration, the backstreet of the oligonucleotide tag includes an eLIT primer site, an eLIT barcode region, a SIT primer binding site, and a SIT barcode region.
[0226] In some aspects of any given plane, the oligonucleotide tag further includes a hybridization-based target identification (HIT) oligonucleotide binding site and a HIT barcode region. In other words, the oligonucleotide tag further includes an oligonucleotide binding site and a barcode region detected using the hybridization sequencing (SBH) method described herein (see, for example, Figures 1A and 1E). In some aspects of any given plane, a method for detecting an oligonucleotide tag including a HIT oligonucleotide binding site and a HIT barcode is further described in U.S. Provisional Patent Application No. 62 / 880,216, filed July 30, 2019, the contents of which are incorporated herein by reference in their entirety.
[0227] In some aspects of any aspect, the oligonucleotide tag further comprises a HIT oligonucleotide binding site, and the secondary oligonucleotide comprises a HIT barcode region (see, for example, Figures 1A and 1E). In some aspects of any aspect, a method for detecting an oligonucleotide tag comprising a HIT oligonucleotide binding site comprises contacting the oligonucleotide tag with a secondary oligonucleotide (hereinafter also referred to herein as a bridge oligonucleotide or "bridge"), wherein the secondary oligonucleotide comprises at least one barcode region and at least one region that is complementary to and hybridizes with the oligonucleotide binding site of the oligonucleotide tag. In some aspects of any aspect, the method further comprises contacting the secondary oligonucleotide with at least two readout molecules, wherein each readout molecule comprises an oligonucleotide that specifically hybridizes with the secondary oligonucleotide, and a detectable label.
[0228] In some aspects of any given plane, the main street of the oligonucleotide tag includes an eLIT primer binding site and an eLIT barcode region, and the back street of the oligonucleotide tag includes a HIT oligonucleotide binding site and a HIT barcode region (see, for example, Figure 1A). In some aspects of any given plane, the back street of the oligonucleotide tag includes an eLIT primer binding site and an eLIT barcode region, and the main street of the oligonucleotide tag includes a HIT oligonucleotide binding site and a HIT barcode region (see, for example, Figure 1A). In some aspects of any given plane, the main street of the oligonucleotide tag includes an eLIT primer binding site, an eLIT barcode region, a HIT oligonucleotide binding site, and a HIT barcode region. In some aspects of any given plane, the back street of the oligonucleotide tag includes an eLIT primer binding site, an eLIT barcode region, a HIT oligonucleotide binding site, and a HIT barcode region.
[0229] In some aspects of any given aspect, the oligonucleotide tag (e.g., main street and / or back street) includes any combination of eLIT (or LIT) primer binding sites, eLIT (or LIT) barcode regions, SIT primer binding sites, SIT barcode regions, HIT oligonucleotide binding sites, and HIT barcode regions, as shown in Table 1 below, where "X" indicates that the oligonucleotide tag includes that site or region.
[0230] (Table 1) Exemplary combinations of primer binding sites and barcode regions TIFF0007872730000001.tif135164TIFF0007872730000002.tif211164
[0231] This specification describes a method for detecting at least one target molecule in a sample. Therefore, in one aspect, this specification describes a method for detecting at least one target molecule in a sample, and the method is as follows: (a) A step of contacting the sample with at least one oligonucleotide tag, each oligonucleotide tag comprising (i) a recognition domain that specifically binds to a target molecule to be detected, and (ii) a street comprising a barcode region; (b) the step of bringing the sample into contact with the set of readout molecules described herein; and (c) A step of detecting the relative order of optically detectable labels hybridized to at least one oligonucleotide tag, wherein the at least one oligonucleotide tag hybridizes to at least one target molecule, the relative order of the optically detectable labels enables identification of which oligonucleotide tag hybridizes to the target molecule at that location. This includes, in some aspects of any given situation, the specific hybridization of the read molecule to the street is determined by the identity between the barcode region and the barcode hybridized region.
[0232] In some aspects of any given situation, the sample is brought into contact with an oligonucleotide tag of at least one type (i.e., containing the same recognition domain). In a non-limiting example, the sample is brought into contact with at least one, at least two, at least three, at least four, or at least five types of oligonucleotide tags. In some aspects of any given situation, the sample is brought into contact with multiple sets of oligonucleotide tags to "paint" the chromosome. Therefore, in some aspects of any given plane, the sample is brought into contact with oligonucleotide tags of at least 500, at least 750, at least 1,000, at least 2,000, at least 3,000, at least 4,000, at least 5,000, at least 6,000, at least 7,000, at least 8,000, at least 9,000, at least 10,000, at least 20,000, at least 30,000, at least 40,000, at least 50,000, at least 60,000, at least 70,000, at least 80,000, at least 90,000, or at least 100,000 types. In some aspects of any given plane, at least one target molecule can be detected in multiple sequences using oligonucleotide tags, i.e., at least two different oligonucleotide tags can be used simultaneously on the same sample.
[0233] In some aspects of any given situation, the sample is brought into contact with at least one set of readout molecules. In non-limiting examples, the sample is brought into contact with one set of readout molecules, two sets of readout molecules, three sets of readout molecules, four sets of readout molecules, or at least five sets of readout molecules.
[0234] In some aspects of any given plane, the detection step includes detecting the relative spatial order of readout molecules hybridized to at least one oligonucleotide tag. Different labels (e.g., color) of the readout molecules correlate with one or more barcode regions, and the spatial order of different readout molecules provides information about the order of barcode regions on a single oligonucleotide tag, making it possible to distinguish a number of different oligonucleotide tags by the barcoded signals provided by each group of readout molecules. Thus, in some aspects of any given plane, the relative spatial order of detectable labels allows for the identification of which oligonucleotide tag is hybridized to the target molecule at that location.
[0235] In some aspects of any given plane, each barcode region is unique to each oligonucleotide tag, and each barcode region contains at least one barcode bit, as further described herein. In some aspects of any given plane, the total number of unique barcode bits is less than the total number of possible unique barcode bits. As used herein, the phrase “total number of possible unique barcode bits” refers to the number of potential nucleotides and / or nucleotide analogs and can be used as a power of the number of nucleotide and / or nucleotide analog positions in one bit (i.e., the length of the barcode bit). As a non-limiting example, for a barcode bit that is 5 nucleotides long and composed of 4 different nucleotides, the total number of possible unique barcode bits is 4^5 or 4*4*4*4*4 or 1024.
[0236] In some aspects of any given state, the total number of unique barcode bits is less than 10% of the total number of possible unique barcode bits. As an unrestricted example, for a barcode bit that is 5 nucleotides long and composed of 4 different nucleotides, the total number of unique barcode bits is less than 100 (approximately 1024 * 0.1). In some aspects of any given state, the total number of unique barcode bits is less than 1% of the total number of possible unique barcode bits. As an unrestricted example, for a barcode bit that is 5 nucleotides long and composed of 4 different nucleotides, the total number of unique barcode bits is less than 10 (1024 * 0.01).
[0237] In some aspects of any given situation, the total number of unique barcode bits is at least two unique barcode bits. As a non-limiting example, the total number of unique barcode bits is at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten unique barcode bits. In some aspects of any given situation, the total number of unique barcode bits is 10 or less unique barcode bits. As a non-limiting example, the total number of unique barcode bits is at most two, at most three, at most four, at most five, at most six, at most seven, at most eight, at most nine, or at most ten unique barcode bits. In some aspects of any given situation, the total number of unique barcode bits is 10 or less unique barcode bits.
[0238] In some aspects of any scenario, the barcode hybridization regions are unique to each read molecule. In some aspects of any scenario, the total number of unique barcode hybridization regions used in a set of read molecules is less than the total number of possible unique barcode hybridization regions. As used herein, the phrase "total number of possible unique barcode hybridization regions" refers to the number of nucleotides and / or nucleotide analogs, and can be used as the power of the number of nucleotide and / or nucleotide analog positions in one bit within the barcode hybridization region (i.e., the length of the region). As a non-limiting example, for a barcode hybridization region that is 5 nucleotides long and composed of 4 different nucleotides, the total number of possible barcode hybridization regions is 4^5 or 4*4*4*4*4 or 1024.
[0239] In some aspects of any scenario, the total number of unique barcode hybridization regions in a set of read molecules is less than 10% of the total number of possible unique barcode hybridization regions. As a non-limiting example, for a barcode hybridization region that is 5 nucleotides long and composed of 4 different nucleotides, the total number of unique barcode hybridization regions is less than 100. In some aspects of any scenario, the total number of unique barcode hybridization regions in a set of read molecules is less than 1% of the total number of possible unique barcode hybridization regions. As a non-limiting example, for a barcode hybridization region that is 5 nucleotides long and composed of 4 different nucleotides, the total number of unique barcode hybridization regions is less than 10.
[0240] In some aspects of any scenario, the total number of unique barcode hybridizing regions in a set of read molecules is at least two unique barcode hybridizing regions. By way of non-limiting example, the total number of unique barcode hybridizing regions is at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 unique barcode hybridizing regions. In some aspects of any scenario, the total number of unique barcode hybridizing regions is 10 or fewer unique barcode hybridizing regions. By way of non-limiting example, the total number of unique barcode hybridizing regions is at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, or at most 10 unique barcode hybridizing regions. In some aspects of any scenario, the total number of unique barcode hybridizing regions is 10 or fewer unique barcode hybridizing regions.
[0241] In some aspects of any given context, the detection step is carried out by a sequencing method. In some aspects of any given context, the sequencing method includes sequencing by coupling (SBL), sequencing by synthesis (SBS), sequencing by hybridization (SBH), and / or sequencing by cyclic reversible polymerization hybridization chain reaction. In some aspects of any given context, sequencing by coupling includes enzyme-based coupling. In some aspects of any given context, sequencing by coupling includes chemical coupling, copper coupling, copper-free click reaction, amine-EDC-based coupling, or thiol-maleimide Michael addition. For example, see Shendure et al., Science 309 (5741): 1728-32; 2005; Guo et al., 2008, Proc Natl Acad Sci US A. 2008 Jul 8, 105(27):9145-50; Lee et al. 2014, Science 343 (6177): 1360-1363; Chen et al. 2018, Nucleic Acids Research 46 (4): e22-e22; Wang et al. 2018, Science 361 (6400): eaat5691; Patent publications WO 2013 / 055995, US 2014 / 0349294, WO 2008 / 151127; and U.S. Patent No. 8,481,258. All of the contents of each section are incorporated herein by reference.
[0242] In some aspects of any given plane, the detection method further includes contacting the sample with at least one oligonucleotide tag, and then contacting the sample with at least one sequencing primer. In some aspects of any given plane, the detection method further includes contacting the sample with at least one sequencing primer before contacting the sample with a set of readout molecules.
[0243] In some aspects of any aspect, after contacting the sample with a set of readout molecules (under conditions that allow hybridization), the detection method further includes ligating the 3' end of the readout molecule to an adjacent nucleotide having a 5' phosphate group. In some aspects of any aspect, after contacting the sample with a set of readout molecules, an optically detectable label is detected. In some aspects of any aspect, the optically detectable label or any region containing the optically detectable label (e.g., a 5'-side non-barcode hybridized region) is removed from the readout molecule through a cleavage step. In some aspects of any aspect, the detection method further includes at least one washing step during any of the steps described herein.
[0244] In some aspects of any given phase, the steps of contacting, linking, detecting, and cutting the set of molecules to be read are repeated iteratively until the entire barcode area is detected. In some aspects of any given phase, the number of repetitions of the steps of contacting, linking, detecting, and cutting the set of molecules to be read corresponds to the number of barcode bits in the barcode area of the oligonucleotide tag. As a non-limiting example, if the barcode area contains 8 barcode bits, the steps of contacting, linking, detecting, and cutting the set of molecules to be read are repeated iteratively 8 times.
[0245] Therefore, in one aspect, this specification describes a method for detecting at least one target molecule in a sample, the method being as follows: (a) A step of contacting the sample with at least one oligonucleotide tag, each oligonucleotide tag comprising (i) a recognition domain that specifically binds to a target molecule to be detected, and (ii) a street comprising a barcode region; (b) A step of contacting the sample with at least one sequencing primer, wherein the sequencing primer hybridizes to at least one alkyl group tag; (c) The step of bringing the sample into contact with the set of readout molecules described herein; (d) The step of linking the 3' end of the readout molecule to a 5' phosphate group (for example, of the sequencing primer or another readout molecule); (e) A step of detecting an optically detectable sign; (f) A step of cutting the 5' region of the readout molecule (for example, including the optically detectable label); (g) Repeat steps (c) to (f) until the entire barcode area is detected; (h) A step of detecting the relative order of optically detectable labels hybridized to the at least one oligonucleotide tag, wherein the at least one oligonucleotide tag hybridizes to the at least one target molecule, the relative order of the optically detectable labels enables identification of which oligonucleotide tag hybridizes to the target molecule at that location. This includes [specific examples]. See, for instance, Figure 10B or Figure 10E.
[0246] In some aspects of any aspect, the sample is brought into contact with a set of read molecules, which are also referred to herein as a set, a "read set," or a "read pool." In some aspects of any aspect, each read pool is directed to determine the identity of a barcode bit at a specific location in the barcode region of an oligonucleotide tag. As a non-limiting example, the sample is brought into contact with at least one read set sequentially or simultaneously to detect at least one barcode bit in the barcode region. As a non-limiting example, the sample is brought into contact with at least one read set sequentially to detect first and second barcode bits of one or more streets. In some aspects of any aspect, the read set includes two read molecules, three read molecules, four read molecules, or at least five read molecules. In some aspects of any aspect, the read set includes two distinct detectable labels, three distinct detectable labels, four distinct detectable labels, or at least five distinct detectable labels.
[0247] In some aspects of any given situation, the readout set includes a subset of readout molecules linked to a detectable label of the same type. As a non-limiting example, the subset of readout molecules linked to a detectable label of the same type includes the same nucleotide at one position in the barcode hybridize region and at least one of the following: (1) a different nucleotide at another position in the barcode hybridize region, (2) a denatured nucleotide at another position in the barcode hybridize region, or (3) a universal nucleotide at another position in the barcode hybridize region. The universal nucleotide includes a universal base that can bind to any nucleotide. Non-limiting examples of universal bases include inosine, deoxyinosine, hypoxanthine, nitroazole, isocarbostyryl analogs, azolecarboxamide, or aromatic triazole analogs (see, for example, Loakes et al., Nucleic Acids Res. 2001 Jun 15;29(12):2437-47; Berger et al., Nucleic Acids Res. 2000 Aug 1; 28(15):2911-2914; Liang et al., RSC Advances 3(35); June 2013).
[0248] In some aspects of any aspect, the readout set comprises at least two subsets of readout molecules, each subset being linked to a detectable label of the same type, distinct from the detectable labels linked to other subsets of readout molecules, and each subset detecting the same barcode bit in the barcode region, distinct from the nucleotide at the same position in the barcode region detected by other subsets of readout molecules. In some aspects of any aspect, the readout set comprises one subset, two subsets, three subsets, four subsets, or at least five subsets of readout molecules.
[0249] In some aspects of any given plane, the sample is brought into contact with a first readout set that recognizes a first bit of the barcode area of at least one oligonucleotide tag. In some aspects of any given plane, the sample is brought into contact with a second readout set that recognizes a second bit of the barcode area of at least one oligonucleotide tag. In some aspects of any given plane, the sample is brought into contact with a third readout set that recognizes a third bit of the barcode area of at least one oligonucleotide tag. In some aspects of any given plane, the sample is brought into contact with a fourth readout set that recognizes a fourth bit of the barcode area of at least one oligonucleotide tag. In some aspects of any given plane, the sample is brought into contact with a fifth readout set that recognizes a fifth bit of the barcode area of at least one oligonucleotide tag. In some aspects of any given plane, the sample is brought into contact with an nth readout set that recognizes the nth bit of the barcode area of at least one oligonucleotide tag, where n is an integer from 1 to 10. In some aspects of any given plane, each readout set is the same. In some aspects of any given state, each readout molecule set is different from all other readout sets. In some aspects of any given state, at least one readout molecule set is different from all other readout sets. In some aspects of any given state, at least one readout molecule set is the same as at least one other readout set.
[0250] In some aspects of any given phase, the sample is brought into contact with each readout set sequentially. In some aspects of any given phase, between the contact of the sample with the nth readout set and the (n+1)th readout set, the readout sets are detected as described herein, and the nth readout set is washed away with any buffer suitable for use in a hybridization reaction, e.g., 60% formamide in 2XSSCT (where SSC refers to sodium citrate saline buffer and T refers to TWEEN).
[0251] In some aspects of any given situation, the sample is brought into contact with at least two readout sets simultaneously. Non-limiting examples include bringing the sample into contact with at least two, at least three, at least four, or at least five readout sets simultaneously. Compared to bringing the sample into contact with one readout set, bringing the sample into contact with at least two readout sets simultaneously may offer further advantages, including, but are not limited to, signal amplification, introduction of additional optically detectable markers (e.g., pseudocolors combined with different fluorophores), and increased process speed.
[0252] In some aspects of any given plane, a method for detecting at least one target molecule in a sample includes contacting the sample with at least one oligonucleotide tag, contacting the sample with at least one readout set, and detecting the relative spatial order of the readout molecules. In some aspects of any given plane, the specific hybridization of the readout molecule to the oligonucleotide tag is determined by or dependent on the identity of the barcode region.
[0253] In some aspects of any given situation, detection is performed at least single-cell resolution. In some aspects of any given situation, detection is performed at subcellular resolution. In some aspects of any given situation, detection is performed at at least mononuclear resolution. As a non-limiting example, detection may be performed at a resolution of at least 200 nm, at least 300 nm, at least 400 nm, at least 500 nm, at least 600 nm, at least 700 nm, at least 800 nm, at least 900 nm, at least 1 μm, at least 2 μm, at least 3 μm, at least 4 μm, at least 5 μm, at least 6 μm, at least 7 μm, at least 8 μm, at least 9 μm, or at least 10 μm. In some aspects of any given situation, detection is performed at a resolution that can distinguish individual target molecules, such as chromosomes. In some aspects of any given situation, detection is performed at superresolution. As a non-limiting example, detection may be performed with a superresolution of at least 10 nm, at least 20 nm, at least 30 nm, at least 40 nm, at least 50 nm, at least 60 nm, at least 70 nm, at least 80 nm, at least 90 nm, at least 100 nm, at least 110 nm, at least 120 nm, at least 130 nm, at least 140 nm, at least 150 nm, at least 160 nm, at least 170 nm, at least 180 nm, at least 190 nm, at least 200 nm, at least 210 nm, at least 220 nm, at least 230 nm, at least 240 nm, or at least 250 nm.
[0254] In one aspect, this specification describes an enhanced method for detecting at least one target molecule in a sample, the method being as follows: (a) A step of contacting the sample with at least one oligonucleotide tag, each oligonucleotide tag comprising (i) a recognition domain that specifically binds to a target molecule to be detected, and (ii) a barcode region comprising at least one barcode bit; (b) The step of bringing the sample into contact with a readout molecule or set thereof as described herein (for example, at least one readout molecule comprising nanoparticles, e.g., metal nanoparticles, and / or at least one readout molecule comprising an optically detectable label, e.g., a fluorophore); and (c) A step of detecting the relative order of optically detectable labels hybridized to at least one oligonucleotide tag, wherein the at least one oligonucleotide tag hybridizes to at least one target molecule, the relative order of the optically detectable labels enables identification of which oligonucleotide tag hybridizes to the target molecule at that location. This includes, in some aspects of any given situation, the method is enhanced by overall signal amplification using nanoparticles (e.g., metal nanoparticles). Such signal amplification may result from multiple readout molecules linked to nanoparticles (e.g., metal nanoparticles) and / or plasmon fluorescence enhancement (between nanoparticles, e.g., metal nanoparticles, and optically detectable labels, such as fluorophores).
[0255] In some aspects of any given situation, the signal of an optically detectable label (e.g., metal nanoparticles) of at least one readout molecule containing nanoparticles is increased by at least 1.5 times compared to the signal of an optically detectable label of the same readout molecule without nanoparticles. In some aspects of any given situation, the signal of an optically detectable label of at least one readout molecule containing nanoparticles is increased by at least 3 times compared to the signal of an optically detectable label of the same readout molecule without nanoparticles. In some aspects of any given situation, the signal of an optically detectable label of at least one readout molecule containing nanoparticles is increased by at least 10 times compared to the signal of an optically detectable label of the same readout molecule without nanoparticles. In some aspects of any given situation, the signal of an optically detectable label of at least one readout molecule containing nanoparticles is increased by at least 50 times compared to the signal of an optically detectable label of the same readout molecule without nanoparticles. In some aspects of any given plane, the signal of an optically detectable label of at least one readout molecule containing nanoparticles is increased by at least 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9.2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 times compared to the signal of an optically detectable label of the same readout molecule without nanoparticles.
[0256] In one aspect, this specification describes a method for karyotyping a biological sample, which is as follows: (a) A step of contacting the sample with at least one oligonucleotide tag specific to at least one chromosome, wherein each oligonucleotide tag comprises (i) a recognition domain that specifically binds to a target molecule to be detected, and (ii) a barcode region comprising at least one barcode bit; (b) The step of bringing the sample into contact with the set of readout molecules described herein; (c) Detecting the relative order of optically detectable labels hybridized to the at least one oligonucleotide tag, wherein the at least one oligonucleotide tag is hybridized to the at least one target molecule, whereby the relative order of the optically detectable labels enables identification of which oligonucleotide tag is hybridized to the target molecule at that location; and (d) Determining the identity of at least one chromosome according to the identity of the at least one oligonucleotide tag specific to the at least one chromosome comprising.
[0257] In some embodiments of any aspect, the sample is contacted with at least one oligonucleotide tag specific to the p-arm of at least one chromosome. In some embodiments of any aspect, the sample is contacted with at least one oligonucleotide tag specific to the q-arm of at least one chromosome. In some embodiments of any aspect, the sample is contacted with at least one oligonucleotide tag specific to the p-arm of at least one chromosome and at least one oligonucleotide tag specific to the q-arm of at least one chromosome. In some embodiments of any aspect, the sample is contacted with at least two oligonucleotide tags specific to the p-arm or q-arm of at least one chromosome. In some embodiments of any aspect, the sample is contacted with at least three oligonucleotide tags specific to the p-arm or q-arm of at least one chromosome.
[0258] In some aspects of any given plane, the sample is brought into contact with at least six oligonucleotide tags specific to each chromosome arm. In some aspects of any given plane, the sample is brought into contact with at least ten oligonucleotide tags specific to each chromosome arm. In some aspects of any given plane, the sample is brought into contact with at least twenty oligonucleotide tags specific to each chromosome arm. In some aspects of any given plane, the sample is brought into contact with at least five, at least ten, at least fifteen, at least twenty, at least twenty five, at least thirty, at least thirty, at least thirty five, at least forty, at least forty fourty, at least fifty, at least fifty, at least fifty five, at least sixty, at least sixty, at least seventy, at least seventy, at least eighty, at least eighty, at least ninety, at least ninety, or at least one hundred, or one hundred oligonucleotide tags specific to each chromosome arm.
[0259] In some aspects of any given situation, the methods described herein may be carried out sequentially or concurrently with additional methods, such as immunofluorescence (see, e.g., Figure 6C) or OligoSTORM (see, e.g., Figure 6D, Figures 17A-17B), but are not limited to these.
[0260] In one aspect, this specification describes a method for generating a high-resolution image of at least one target molecule in a sample, the method being as follows: (a) the step of imaging the at least one target molecule using a high-resolution imaging technique for at least one round; and (b) the step of determining the identity of the at least one imaged target molecule. This includes: In some aspects of any given situation, the step of determining the identity of the at least one imaged target molecule is as follows: (i) A step of contacting the sample with at least one oligonucleotide tag, each oligonucleotide tag comprising (A) a recognition domain that specifically binds to a target molecule to be detected, and (B) a barcode region comprising at least one barcode bit; (ii) the step of bringing the sample into contact with the set of readout molecules described herein; and (iii) A step of detecting the relative order of optically detectable labels hybridized to the at least one oligonucleotide tag, wherein the at least one oligonucleotide tag hybridizes to the at least one target molecule, and the relative order of the optically detectable labels allows for the identification of which oligonucleotide tag hybridizes to the target molecule at that location. Includes.
[0261] In some aspects of any given plane, the method includes imaging at least 2 target molecules. In some aspects of any given plane, the method includes imaging at least 12 target molecules. In some aspects of any given plane, the method includes imaging at least 66 target molecules. In some aspects of any given plane, the method includes imaging at least 258 target molecules. In some aspects of any given plane, the method includes imaging at least 500 target molecules. In some aspects of any given plane, the method includes imaging at least 5000 target molecules.
[0262] In some aspects of any given situation, the method is at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, at least 200, at least 210, at least 220, at least 230, at least 240, at least 250, at least 260 , including imaging at least 270, at least 280, at least 290, at least 300, at least 310, at least 320, at least 330, at least 340, at least 350, at least 360, at least 370, at least 380, at least 390, at least 400, at least 410, at least 420, at least 430, at least 440, at least 450, at least 460, at least 470, at least 480, at least 490, at least 500, at least 1000, at least 1500, at least 2000, at least 2500, at least 3000, at least 3500, at least 4000, at least 4500, or at least 5000 target molecules.
[0263] In some aspects of any given plane, all target molecules are imaged at once. In some aspects of any given plane, at least half of the target molecules are imaged at once. In some aspects of any given plane, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the target molecules are imaged at once.
[0264] In some aspects of any given situation, the method includes at least two rounds of high-resolution imaging. In some aspects of any given situation, the method includes at least three rounds of high-resolution imaging. In some aspects of any given situation, the method includes at least five rounds of high-resolution imaging. In some aspects of any given situation, the method includes at least twenty rounds of high-resolution imaging. In some aspects of any given situation, the method includes at least one round, at least two rounds, at least three rounds, at least four rounds, at least five rounds, at least ten rounds, at least fifteen rounds, at least twenty rounds, at least twenty-five rounds, at least thirty rounds, at least three five rounds, at least forty rounds, at least forty rounds, at least forty-five rounds, at least fifty rounds, at least fifty rounds, at least fifty rounds, at least sixty rounds, at least sixty rounds, at least seventy rounds, at least seventy rounds, at least eighty rounds, at least eighty rounds, at least ninety rounds, at least ninety-five rounds, or at least one hundred rounds of high-resolution imaging.
[0265] In some aspects of any given situation, high-resolution imaging techniques are selected from the group consisting of oligostochastic optical reconstruction microscopy (OligoSTORM); structured illumination microscopy (SIM); stimulated emission suppression (STED) microscopy; and point accumulation of oligo DNA in nanoscale topology (DNA-PAINT). In some aspects of any given situation, high-resolution imaging techniques include oligostochastic optical reconstruction microscopy (OligoSTORM). In some aspects of any given situation, high-resolution imaging techniques include structured illumination microscopy (SIM). In some aspects of any given situation, high-resolution imaging techniques include stimulated emission suppression (STED) microscopy. In some aspects of any given situation, high-resolution imaging techniques include point accumulation of oligo DNA in nanoscale topology (DNA-PAINT). For example, see Wu and Shroff, Faster, sharper, and deeper: structured illumination microscopy for biological imaging, Nature Methods 15, 1011-1019 (2018); Vicidomini et al. STED super-resolved microscopy. Nat Methods 15, 173-182 (2018); Beliveau et al. In situ super-resolution imaging of genomic DNA with OligoSTORM and OligoDNA-PAINT. Methods Mol Biol 2017 1663:231-252; the contents of each are incorporated herein by reference.
[0266] In some aspects of any given phase, detecting the relative order of optically detectable labels hybridized to the at least one oligonucleotide tag includes contacting the sample with the set of readout molecules for at least two rounds. In some aspects of any given phase, detecting the relative order of optically detectable labels hybridized to the at least one oligonucleotide tag includes contacting the sample with the set of readout molecules for at least three rounds. In some aspects of any given phase, detecting the relative order of optically detectable labels hybridized to the at least one oligonucleotide tag includes contacting the sample with the set of readout molecules for at least five rounds. In some aspects of any given phase, detecting the relative order of optically detectable labels hybridized to the at least one oligonucleotide tag includes contacting the sample with the set of readout molecules for at least ten rounds. In some aspects of any given phase, detecting the relative order of optically detectable labels hybridized to the at least one oligonucleotide tag includes contacting the sample with the set of readout molecules for at least twenty rounds.
[0267] In some aspects of any given plane, detecting the relative order of optically detectable labels hybridized to the at least one oligonucleotide tag involves contacting the sample with a set of readout molecules for at least 1 round, at least 2 rounds, at least 3 rounds, at least 4 rounds, at least 5 rounds, at least 10 rounds, at least 15 rounds, at least 20 rounds, at least 25 rounds, at least 30 rounds, at least 35 rounds, at least 40 rounds, at least 45 rounds, at least 50 rounds, at least 55 rounds, at least 60 rounds, at least 65 rounds, at least 70 rounds, at least 75 rounds, at least 80 rounds, at least 85 rounds, at least 90 rounds, at least 95 rounds, or at least 100 rounds.
[0268] In some aspects of any given context, the compositions and methods described herein include improvements to compositions and methods relating to oligopaint technology. As used herein, the term “oligopaint” refers to, for example, an oligonucleotide sequence, a portion of a DNA sequence, or a polynucleotide having a sequence complementary to a particular chromosome or a subchromosomal region of a particular chromosome.
[0269] Traditionally, fluorescent in-situ hybridization (FISH) probes are derived from cloned genomic regions or flow-fractionated chromosomes. These probes are either directly labeled via nic translation or PCR in the presence of fluorophore-binding nucleotides, or indirectly labeled with nucleotide-binding haptens such as biotin and digoxigenin, and then visualized with secondary detection reagents. Conventional FISH probes have limitations due to repetitive sequences and inconsistent potency. Furthermore, target regions are limited by the availability of clones and the size of their genomic inserts. While it is possible to target larger regions with conventional FISH probes, this approach is often difficult and expensive because it requires the separate preparation and optimization of each clone for hybridization.
[0270] Oligopaint is an improved FISH technique that allows for the mass production of oligo libraries and the use of parallel synthesis as a renewable probe source. The oligo libraries can be amplified by PCR (optionally using fluorophore-conjugated primers). The amplified products can be enzymatically treated to produce highly efficient single-stranded, strand-specific probes capable of visualizing regions ranging from tens of kilobases to megabases. Oligopaint may include synthetic probes and arrays, which are optionally computer-patterned and / or computer-designed.
[0271] For publications covering OligoPaint and related technologies, see, for example: Beliveau et al. OligoMiner provides a rapid, flexible environment for the design of genome-scale oligonucleotide in situ hybridization probes. Proc. Nat. Acad. Sci. USA 2018 115:E2183-E2192; Beliveau et al. In situ super-resolution imaging of genomic DNA with OligoSTORM and OligoDNA-PAINT. Methods Mol Biol 2017 1663:231-252; Wang et al. Spatial organization of chromatin domains and compartments in single chromosomes. Science 2016 353:598-602; Boettiger et al. Super-resolution imaging reveals distinct chromatin folding for different epigenetic states. Nature. 2016 529:418-22; Schmidt et al. Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries. Nat Commun 2015 Nov 16;6:8634; Murgha et al. Combined in vitro transcription and reverse transcription method to amplify and label complex synthetic oligonucleotide probe libraries. BioTechniques 2015 58:301-7; Beliveau et al.Single-molecule super-resolution imaging of chromosomes and in situ haplotype visualization using Oligopaint FISH probes. Nat Commun 2015 6:7147; Beliveau et al. Visualizing genomes with Oligopaint FISH probes. Curr Protocols Mol Biol 2014 14.23; Beliveau et al. A versatile design and synthesis platform for visualizing genomes with Oligopaint FISH probes. Proc. Nat. Acad. Sci. USA 2012 109:21301-6; US 2010 / 0304994 A1; US 2018 / 0223347 A1; WO 2018 / 045186 A1; US 2014 / 0364333 A1; US 2019 / 0032121 A1; US 2013 / 0143208 See A1; US 10,119,160 B2; US 2018 / 0057867 A1; US 2019 / 0127786 A1; US 2018 / 0292318 A1; WO 2017 / 189525 A1; WO 2018 / 183851 A1; WO 2018 / 183860 A1; WO 2018 / 045181 A1; US 2016 / 0040235 A1; see A1; all contents of each are incorporated herein by reference.
[0272] As used herein, the terms “oligopainted” and “oligopainted region” refer, respectively, to a target nucleotide sequence (e.g., a chromosome) or a region of a target nucleotide sequence (e.g., a subchromosomal region) that is hybridized with one or more oligopaints. Oligopaints can be used to label target nucleotide sequences, e.g., chromosomes and subchromosomal regions of chromosomes, during, but not limited to, various cell cycle phases such as interphase, preprophase, prophase, prometaphase, metaphase, anaphase, telophase, and cytokinesis.
[0273] This specification describes a method comprising OligoFISSEQ, namely an oligopaint containing a barcode decoded by fluorescence in situ sequencing. The OligoFISSEQ method and composition are further described in Japanese Patent Publications WO 2017 / 161251 and US 2019 / 0032121, the contents of which are incorporated herein by reference.
[0274] In some aspects of any given setting, FISH methods may include oligopaint, multiplex-error-robust fluorescence in situ hybridization (MERFISH), seqFISH, sequential RNA target probing (SPOTs), high-coverage microscopy (Hi-M), or optical reconstruction of chromatin structure (ORCA), or any method involving contacting a sample with a target molecule, such as an oligonucleotide sequence, a portion of a DNA sequence, or any oligonucleotide (e.g., a recognition domain) having sequence complementarity to a specific chromosome or a subchromosomal region of a specific chromosome. For further details, see, for example, Cardozo et al., Mol Cell. 2019 Apr 4;74(1):212-222; Mateo et al., Nature. 2019 Apr;568(7750):49-54; Wang et al., Scientific Reports volume 8, Article number: 4847 (2018); Shah et al., Neuron, Volume 92, Issue 2, 19 October 2016, Pages 342-357; Eng et al., Nat Methods. 2017 Dec;14(12):1153-1155; all of these are incorporated herein by reference.
[0275] In some aspects of any given context, the sets and methods described herein include detecting at least one target molecule in a sample. In some aspects of any given context, the target molecule includes nucleic acids, polypeptides, cell surface molecules, and / or inorganic substances. In some aspects of any given context, the target molecule includes DNA, e.g., genomic DNA, genomic DNA organized as chromosomes, or complementary DNA (cDNA). In some aspects of any given context, the target molecule includes RNA, e.g., messenger RNA (mRNA) or ribosomal RNA (rRNA). In some aspects of any given context, the target molecule is DNA and / or RNA. In some aspects of any given context, the target molecule includes DNA and / or RNA. In some aspects of any given context, the target molecule consists of or is essentially made up of DNA and / or RNA. In some aspects of any given context, the target molecule includes polypeptides.
[0276] In some aspects of any given phase, at least one target molecule contains 1 kb of nucleic acid. In some aspects of any given phase, at least one target molecule contains 15 kb of nucleic acid. In some aspects of any given phase, at least one target molecule contains 50 kb of nucleic acid. In some aspects of any given phase, at least one target molecule contains 100 kb of nucleic acid. In some aspects of any given phase, at least one target molecule contains 1 Mb of nucleic acid. In some aspects of any given phase, at least one target molecule contains a chromosome. In some aspects of any given phase, at least one target molecule contains a genome.
[0277] In some aspects of any given situation, the target molecule, oligonucleotide tag, readout molecule, and sequencing primer can be any combination of DNA and RNA. As an unrestricted example, the target molecule, oligonucleotide tag, readout molecule, and sequencing primer can all be DNA. As an unrestricted example, the target molecule, oligonucleotide tag, readout molecule, and sequencing primer can all be RNA. As an unrestricted example, the target molecule can be DNA; the oligonucleotide tag, readout molecule, and sequencing primer can be RNA. As an unrestricted example, the target molecule can be RNA; the oligonucleotide tag, readout molecule, and sequencing primer can be DNA. Any other combination of DNA and RNA can be used in the same way. In some aspects of any given situation, the target molecule, oligonucleotide tag, readout molecule, and sequencing primer consist of or are essentially made of DNA and / or RNA.
[0278] In some aspects of any aspect, the target molecule includes, but is not limited to, polypeptides, intracellular proteins, transmembrane proteins, or extracellular proteins. In some aspects of any aspect, the target molecule includes, but is not limited to, cell surface molecules, transmembrane proteins, membrane lipids, membrane receptors, or transmembrane receptors. In some aspects of any aspect, the target molecule includes, but is not limited to, inorganic substances, including any material derived from a non-biological source such as glass, ceramics, metals (e.g., circuit boards, metal-containing surfaces), or any other solid substrate. In some aspects of any aspect, the target molecule is covalently or non-covalently linked to nucleic acids, polypeptides, cell surface molecules, or inorganic substances. Non-limiting examples of such linkers and link portions are further described herein.
[0279] In some aspects of any given situation, one target molecule is detected. In some aspects of any given situation, at least two target molecules are detected simultaneously. As a non-limiting example, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least twenty, at least twenty, at least thirty, at least forty, at least fifty, at least sixty, at least seventy, at least eight, at least nine, at least ten, at least twenty, at least twenty, at least thirty, at least forty, at least fifty, at least sixty, at least seventy, at least eighty, at least ninety, or at least one hundred target molecules are detected simultaneously.
[0280] In some aspects of any given situation, two or more regions of the target molecule are detected simultaneously. Non-limiting examples include the detection of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 regions of one or more target molecules.
[0281] In some aspects of any given context, the sample is a cell, cell culture, or tissue sample. In some aspects of any given context, the sample includes an organoid (i.e., a self-organized three-dimensional tissue culture derived from a stem cell). As an unrestricted example, cells, cell cultures, or tissue samples may be collected in a single batch or under conditions in which individual chromosomes are distinguishable, such as under mitosis. In some aspects of any given context, the sample includes a human cell nucleus. In some aspects of any given context, the sample includes a nucleus derived from a cell of any organism. In some aspects of any given context, the sample includes metaphase chromosomes. In some aspects of any given context, the sample includes a metaphase chromosome spread. In some aspects of any given context, the metaphase chromosomes are obtained from a cultured cell nucleus. In some aspects of any given context, the metaphase chromosomes are obtained from a nucleus extracted from a tissue section, organoid, or biopsy specimen.
[0282] The terms “sample” or “test sample,” as used herein, refer to a sample taken from or isolated from a living organism, such as a blood or tissue sample derived from the subject. In some aspects of any aspect, the present invention encompasses several types of biological samples. In some aspects of any aspect, a biological sample is a cell, tissue, or peripheral blood or body fluid. Exemplary biological samples include, but are not limited to, biopsies, tumor samples, biological fluid samples; blood; serum; plasma; urine; sperm; mucus; tissue biopsies; organ biopsies; synovial fluid; bile; cerebrospinal fluid; mucous secretions; exudates; sweat; saliva; and / or tissue samples, etc. The term also includes mixtures of the above-mentioned samples. The term “test sample” also includes untreated or pretreated (or pre-processed) biological samples. In some aspects of any aspect, a test sample includes cells derived from the subject.
[0283] In some aspects of any given plane, at least one target molecule is detected in at least one cell in the sample. In some aspects of any given plane, at least one target molecule is detected simultaneously in at least two cells in the sample. As a non-limiting sample, at least one target molecule is simultaneously detected in at least 2, at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1,000, at least 1,000, at least 1,000, at least 2,000, at least 3,000, at least 4,000, at least 5,000, at least 6,000, at least 7,000, at least 8,000, at least 9,000, or at least 10,000 cells in the sample.
[0284] Test samples can be obtained by removing the sample from the subject, but this may also be done by using a sample that has already been isolated (for example, one that was isolated at a previous point in time and was isolated by the same person or a different person).
[0285] In some aspects of any given context, the test sample may be an untreated test sample. As used herein, the phrase “untreated test sample” refers to a test sample that has not undergone any prior treatment other than dilution and / or suspension in solution. Exemplary methods of treating a test sample include, but are not limited to, centrifugation, filtration, sonication, homogenization, heating, freezing, and thawing, as well as combinations thereof. In some aspects of any given context, the test sample may be a frozen test sample, e.g., frozen tissue. A frozen sample may be thawed before using the methods, assays, and systems described herein. A frozen sample may be centrifuged after thawing before being subjected to the methods, assays, and systems described herein. In some aspects of any given context, the test sample may be a clarified test sample, e.g., obtained by centrifugation and collection of the supernatant containing the clarified test sample. In some aspects of any given context, the test sample may be a pretreated test sample, e.g., supernatant or filtrate obtained by a treatment selected from the group consisting of centrifugation, filtration, thawing, purification, and any combination thereof. In some aspects of any given situation, test specimens may be treated with chemical and / or biological reagents. Chemical and / or biological reagents may be used to protect and / or maintain the stability of the specimen, including the biomolecules (e.g., nucleic acids and proteins) contained within it, during treatment. One exemplary reagent is a protease inhibitor, which is commonly used to protect or maintain the stability of proteins during treatment. Those in the parties concerned are likely familiar with appropriate methods and treatment procedures for the pretreatment of biological specimens necessary to determine the levels of expression products as described herein.
[0286] In some aspects of any given context, the methods, assays, and systems described herein may further include steps for obtaining a test sample from a subject, or steps for obtaining a test sample. In some aspects of any given context, the subject may be a human subject.
[0287] This specification describes compositions comprising nucleotides or analogs thereof (e.g., oligonucleotide tags, readout molecules, secondary oligonucleotides, primers, etc.). Nucleotides comprise a phosphate backbone, a pentose sugar (e.g., ribose, deoxyribose), and a nucleic acid base (e.g., adenine, cytosine, guanine, thymine, uracil). As used herein, the term “analog” (i.e., nucleotide analog, nucleoside analog, nucleic acid analog, etc.) refers to a nucleotide-like composition comprising at least one modification of the phosphate backbone, pentose sugar, and / or nucleic acid base. Non-limiting examples of nucleotide analogs are further described herein, but the nucleic acids described herein (e.g., oligonucleotide tags, readout molecules, secondary oligonucleotides, and / or primers) may include any nucleotide analog known in the art.
[0288] In some aspects of any given context, the nucleic acids described herein (e.g., oligonucleotide tags, readout molecules, secondary oligonucleotides, and / or primers) are chemically modified to enhance stability or other advantageous characteristics. The nucleic acids described herein can be synthesized and / or modified by methods established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, SL et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA (incorporated herein by reference). Modifications include, for example, (a) terminal modifications, such as 5'-terminal modifications (phosphorylation, complexation, inverted linkages, etc.) and 3'-terminal modifications (complexation, DNA nucleotides, inverted linkages, etc.); (b) base modifications, such as stabilizing bases, destabilizing bases, or replacement with bases that form base pairs with a wide range of partners, base removal (debastic nucleotides), or complex bases; (c) sugar modifications (e.g., at the 2' or 4' position) or sugar replacements; and (d) skeletal modifications, including modification or replacement of phosphodiester bonds. Specific examples of nucleic acid compounds useful in the embodiments described herein include, but are not limited to, nucleic acids containing modified skeletons or nucleic acids that do not contain natural internucleoside bonds. Nucleic acids having modified skeletons include, in particular, nucleic acids that do not have a phosphorus atom in their skeleton. For the purposes of this specification, and as is sometimes referred to in the art, modified nucleic acids that do not have a phosphorus atom in their internucleoside skeleton can also be considered oligonucleosides. In some aspects of any given plane, the modified nucleic acid has a phosphorus atom in its internucleoside skeleton.
[0289] Examples of modified nucleic acid skeletons include phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotryesters, aminoalkylphosphotryesters, methyl and other alkylphosphonates, such as 3'-alkylenephosphonates and chiral phosphonates, phosphinates, phosphoramidates, such as 3'-aminophosphoramidates and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonoates, thionoalkylphosphotryesters, and boranophosphates, their 2'-5' linked analogues, and those with reverse polarity, where adjacent pairs of nucleoside units are linked from 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms are also included. Modified nucleic acid skeletons that do not contain phosphorus atoms have skeletons formed by short-chain alkyl or cycloalkyl nucleoside bonds, mixed heteroatoms and alkyl or cycloalkyl nucleoside bonds, or one or more short-chain heteroatoms or heterocyclic nucleoside bonds. These include skeletons with morpholino bonds (partially formed from the sugar portion of nucleosides); siloxane skeletons; sulfide, sulfoxide, and sulfone skeletons; formacetyl and thioformacetyl skeletons; methyleneformacetyl and thioformacetyl skeletons; alkene-containing skeletons; sulfamate skeletons; methyleneimino and methylenehydrazino skeletons; sulfonate and sulfonamide skeletons; amide skeletons; mixed N, O, S, Other skeletons having a CH2 component, as well as oligonucleotides having a heteroatom skeleton, and specifically, --CH2--NH--CH2--, --CH2--N(CH3)--O--CH2-- [known as the methylene (methylimino) or MMI skeleton], --CH2--O--N(CH3)--CH2--, --CH2--N(CH3)--N(CH3)--CH2--, and --N(CH3)--CH2--CH2-- [where the native phosphodiester skeleton is represented as --O--P--O--CH2--].
[0290] Modified nucleic acids may also include one or more substituted sugar moieties. The nucleic acids described herein may include at the 2' position one of the following: OH;F;O-, S-, or N-alkyl;O-, S-, or N-alkenyl;O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, where alkyl, alkenyl, and alkynyl may be substituted or unsubstituted C1-C10 alkyl or C2-C10 alkenyl and alkynyl. Exemplary preferred modifications include O[(CH2)nO]mCH3, O(CH2).nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3)]2, where n and m are 1 to about 10. In some aspects of any given situation, the dsRNA contains at the 2' position one of the following: C1-C10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleavage group, reporter group, intercalator, group for improving the pharmacokinetic properties of nucleic acids, or group for improving the pharmacodynamic properties of nucleic acids, and other substituents having similar properties. In some aspects of any given configuration, the modification includes 2'-methoxyethoxy (2'-O--CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., an alkoxy-alkoxy group. Other exemplary modifications include the O(CH2)2ON(CH3)2 group, also known as 2'-dimethylaminooxyethoxy, i.e., 2'-DMAOE, and also as described in the examples below, 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O--CH2--O--CH2--N(CH2)2.
[0291] Other modifications include 2'-methoxy (2'-OCH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2), and 2'-fluoro (2'-F). Similar modifications can be made at other positions in nucleic acids, specifically at the sugar of the 3' terminal nucleotide or at the 3' position of 2'-5' ligated dsRNA, and at the 5' position of the 5' terminal nucleotide. Nucleic acids may also have sugar mimes such as cyclobutyl moieties instead of pentofuranosyl sugars.
[0292] Nucleic acids may also include modified or substituted nucleic acid bases (often simply referred to as "bases" in the art). As used herein, "unmodified" or "natural" nucleic acid bases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleic acid bases may also include, but are not limited to, synthetic and natural nucleic acid bases, such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl, and other alkyl derivatives of adenine and guanine, 2-propyl, and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, and 5-uracil. Examples include syl(pseudracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, and (anal) other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine, and 3-deazaguanine and 3-deazaadenine. Some of these nucleic acid bases are particularly useful for increasing the binding affinity of the inhibitory nucleic acids featured in the present invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6 and 0-6 substituted purines, such as 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase the stability of nucleic acid double helix by 0.6–1.2°C (Sanghvi, YS, Crooke, ST and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276–278), and they are exemplary base substitutions, more specifically when combined with 2'-O-methoxyethyl sugar modifications.In some aspects of any given context, modified nucleic acid bases may include d5SICS and dNAM, which are non-exclusive examples of non-natural nucleic acid bases that can be used separately or together as a base pair (see, e.g., Leconte et. al. J. Am. Chem. Soc. 2008, 130, 7, 2336-2343; Malyshev et. al. PNAS. 2012. 109 (30) 12005-12010). In some aspects of any given context, the nucleic acids described herein (e.g., oligonucleotide tags, readout molecules, secondary oligonucleotides, and / or primers) may include any modified nucleic acid bases known in the art, i.e., any nucleic acid bases modified from unmodified and / or natural nucleic acid bases.
[0293] The above-mentioned methods for preparing modified nucleic acids, skeletons, and nucleic acid bases are well known in the field of technology.
[0294] Another modification of nucleic acids featured in the present invention includes chemically linking the nucleic acid to one or more ligands, moieties, or complexes that enhance the activity, cell distribution, pharmacokinetic properties, or cell uptake of the nucleic acid. Such parts, though not limited to them, include lipid parts, such as cholesterol (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), thioethers, such as beryl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), and thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), aliphatic chains, e.g., dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), phospholipids, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), polyamine or polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetate (Manoharan et al., Tetrahedron Lett.Examples include the palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or the octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).
[0295] In some aspects of any given context, each readout molecule includes a cleavable modification. In certain aspects of this disclosure, a cleavable nucleotide moiety, also called a cleavable linkage or cleavable modification, is used in a readout molecule to separate a barcode hybridized region from a non-barcode hybridized region. The cleavable moieties are known to those skilled in the art and include chemically dissociable internucleoside linkages that can be cleaved by treatment with a chemical or by exposure to an oxidizing or reducing environment. Such cleavable moieties include phosphorothioates, phosphorothiolates, which can be cleaved with various metal ions, such as a solution of silver nitrate. Such cleavable moieties include phosphoramidates, which can be cleaved under acidic conditions, such as a solution containing acetic acid. Suitable chemicals that can cleave linkages include those that can cleave cross-linked phosphorothioate linkages and remove phosphoramidite linkers from nucleotides and / or oligonucleotides, leaving free phosphate groups at the cleavage sites of the nucleotides and / or oligonucleotides. Suitable chemical substances include, but are not limited to, AgNO3, AgCH3COO, AgBrO3, Ag2SO4, or any compound that delivers Ag2+, HgCl2, I2, Br2, I-, and Br-, etc.
[0296] The cleavable portions also include portions that can be cleaved by nucleases known to those skilled in the art. Such nucleases include restriction endonucleases such as type I, type II, type III, and type IV, endonucleases such as endonucleases I to VIII, ribonucleases, and other nucleases such as enzymes having AP endonuclease activity, enzymes having AP lyase activity, and enzymes having glycosylase activity such as uracil DNA glycosylase.
[0297] Cleavable regions include those that can be cut by light of a specific wavelength. Such cleavable regions are called photosensitive linkages and are described in Olejnik et al., Photocleavable biotin derivatives: a versatile approach for the isolation of biomolecules, Proc. Natl. Acad. Sci. USA, vol. 92, p. 7590-7594 (1995). Such photocleavable linkers can be cut by UV irradiation with wavelengths of approximately 275 to 375 nm for a period of time ranging from a few seconds to 30 minutes, for example, about 1 minute. Exemplary wavelengths include approximately 300 nm to 350 nm.
[0298] Certain nucleotides, such as dGTP, dCTP, and dTTP, can also be reacted before being incorporated for use as cleavable linkers to make them particularly sensitive to further cleavage by nucleases or chemicals. In one aspect, one or more deoxyguanosines in a given template non-hybridized nucleic acid can be oxidized with 2-nitropropane to 8-oxo-deoxyguanosine before being added to a detection (e.g., sequencing) reaction, and then cleaved using 8-oxoguanine DNA glycosylase (e.g., Fpg, hOGG1). Similarly, deoxycytosine can be pre-reacted with bisulfite or nitrite to form 5-hydroxycytosine, which can then be treated with some DNA glycosylase, e.g., hNEIL1. Other nucleotides that can be cleaved include uracil, deoxyuridine, inosine, and deoxyinosine.
[0299] Additional embodiments include nucleotides that can be cleaved in a two-step manner, such as a first step of modifying the nucleotide to make it easier to cleave, followed by a second step of cleaving the nucleotide. Such systems include the USER system (commercially available from Enzymatics (#Y918L) or New England Biolabs (#M5505L)), which is typically combined with UDG and endonuclease VIII, but other endonucleases may also be used. The enzymes UDG and endonuclease are commercially available. Furthermore, the modified nucleotides may be cleavable nucleotides, in which features such as nucleotide bonding are modified to facilitate cleavage. Examples include abasic bases, depyrimidine bases, depurine bases, phosphorothioates, and oxidized bases, such as deoxyguanosine which can be oxidized to 8-oxo-deoxyguanosine.
[0300] Therefore, internucleotide bonds can be cleaved by chemical, thermal, or photocleavage. Exemplary chemically cleavable internucleotide links used in the methods described herein include, for example, β-cyanoethers, 5'-deoxy-5'-aminocarbamates, 3'-deoxy-3'-aminocarbamates, ureas, 2'cyano-3',5'-phosphodiesters, 3'-(S)-phosphorothioate, 5'-(S)-phosphorothioate, 3'-(N)-phosphoramidate, 5'-(N)-phosphoramidate, α-aminoamides, proximal diols, ribonucleoside insertions, 2'-amino-3',5'-phosphodiesters, allyl sulfoxides, esters, silyl ethers, dithioacetals, 5'-thio-flumal, α-hydroxy-methylphosphonic acid bisamide, acetals, 3'-thio-flumal, methylphosphonates, and phosphotriesters. Internucleoside silyl groups in trialkylsilyl ethers and dialkoxysilanes are cleaved by treatment with fluoride ions. Sites that can be cleaved by base include β-cyanoethers, 5'-deoxy-5'-aminocarbamates, 3'-deoxy-3'-aminocarbamates, ureas, 2'-cyano-3',5'-phosphodiesters, 2'-amino-3',5'-phosphodiesters, esters, and ribose. Thio-containing internucleotide bonds in 3'-(S)-phosphorothioate and 5'-(S)-phosphorothioate are cleaved by treatment with silver nitrate or mercuric chloride. Sites that can be cleaved by acid include 3'-(N)-phosphoramidates, 5'-(N)-phosphoramidates, dithioacetals, acetals, and phosphonic acid bisamides. The α-aminoamide nucleoside bond can be cleaved by treatment with isothiocyanate, and titanium can be used to cleave the 2'-amino-3',5'-phosphodiester-O-ortho-benzyl nucleoside bond. Near-proximal diol linkages can be cleaved by treatment with periodic acid. Examples of thermally cleavable groups include allyl sulfoxides and cyclohexenes, while examples of photosensitive linkages include nitrobenzyl ether thymidine dimers.Methods for synthesizing and cleaving nucleic acids containing chemically cleavable groups, thermally cleavable groups, and photosensitive groups are described, for example, in U.S. Patent No. 5,700,642.
[0301] Therefore, internucleotide bonds can be cleaved by enzymatic cleavage. Nucleic acid sequences described herein may be designed to include restriction endonuclease cleavage sites. Cleavage can be induced by contacting the nucleic acid with a restriction endonuclease. A variety of restriction endonucleases with specific binding and / or cleavage sites are commercially available, for example, from New England Biolabs (Ipswich, Massachusetts). Restriction endonucleases that produce 3' overhangs, 5' overhangs, or blunt ends can be used in various embodiments. Blunt ends can be induced using restriction endonucleases that produce overhangs, or exonucleases (e.g., RecJf, exonuclease I, exonuclease T, S1 nuclease, P1 nuclease, mangubean nuclease, CELI nuclease, etc.). In exemplary embodiments, the temporary orthogonal primer binding site can be removed using an orthogonal primer / primer binding site that includes a binding and / or cleavage site for an IIS-type restricting endonuclease.
[0302] As used herein, the term “restriction endonuclease recognition site” includes, but is not limited to, a specific nucleic acid sequence to which one or more restriction enzymes bind, resulting in cleavage of a DNA molecule either at the restriction endonuclease recognition site itself or at a sequence distal to the restriction endonuclease recognition site. Restriction enzymes include, but are not limited to, type I, type II, type IIS, type III, and type IV enzymes. The REBASE database provides a comprehensive database of information on restriction enzymes, DNA methyltransferases, and related proteins involved in restriction modification. The database contains published and unpublished research, including information on restriction endonuclease recognition sites and restriction endonuclease cleavage sites, isorestriction enzymes, commercial availability, crystal and sequence data (see Roberts et al. (2005) Nucl. Acids Res. 33:D230, all of which are incorporated herein by reference for all purposes).
[0303] In some aspects, the primers of the present invention include one or more restriction endonuclease recognition sites, thereby enabling IIS-type enzymes to cleave several base pairs from the 3' end of the restriction endonuclease recognition sequence of the nucleic acid. As used herein, the term "IIS-type" refers to restriction enzymes that cleave at a site distant from their recognition sequence. IIS-type enzymes are known to cleave at a distance of 0 to 20 base pairs from their recognition site. Examples of type IIs endonucleases include enzymes that produce a 3' overhang, such as BsrI, BsmI, BstF5I, BsrDI, BtsI, MnlI, BciVI, HphI, MboII, EciI, AcuI, BpmI, MmeI, BsaXI, BcgI, BaeI, BfiI, TspDTI, TspGWI, TaqII, Eco57I, Eco57MI, GsuI, PpiI, and PsrI; enzymes that produce a 5' overhang, such as BsmAI, PleI, FauI, SapI, BspMI, SfaNI, HgaI, BvbI, FokI, BceAI, BsmFI, Ksp632I, Eco31I, Esp3I, and AarI; and enzymes that produce a blunt end, such as MlyI and BtrI. Type IIs endonucleases are commercially available and well-known in the art (New England Biolabs, Beverly, Massachusetts). Information on recognition sites, cleavage sites, and digestion conditions using Type IIs endonucleases can be found, for example, on the World Wide Web (neb.com / nebecomm / enzymefindersearch bytypeIIs.asp). Restriction endonuclease sequences and restriction enzymes are well-known in the art, and restriction enzymes are commercially available (New England Biolabs, Ipswich, Massachusetts).
[0304] In some cases, cleavable moieties may be present within oligonucleotides (e.g., readout molecules) and can be introduced during in-situ synthesis. A variety of cleavable moieties are available in the art of solid-phase and microarray oligonucleotide synthesis (see, for example, Pon, R., Methods Mol. Biol. 20:465-496 (1993); Verma et al., Ann. Rev. Biochem. 67:99-134 (1998); U.S. Patents No. 5,739,386, No. 5,700,642, and No. 5,830,655; and U.S. Patent Publications No. 2003 / 0186226 and No. 2004 / 0106728).
[0305] The cleavable sites may be located along the oligonucleotide backbone and may be modified 3'-5' nucleotide links, such as ribose, dialkoxysilane, phosphorothioate, and phosphoramidate nucleotide links, for example, as a substitute for one of the phosphodiester groups. The cleavable oligonucleotide analogs may also contain substituents on one of the bases or sugars, or substitutes on one of the bases or sugars, such as 7-deazaguanosine, 5-methylcytosine, inosine, uridine, etc.
[0306] In one embodiment, the cleavable sites contained within the modified oligonucleotide (e.g., readout molecule) may include chemically cleavable groups such as dialkoxysilane, 3'-(S)-phosphorothioate, 5'-(S)-phosphorothioate, 3'-(N)-phosphorumidate, 5'-(N)-phosphorumidate, and ribose. The synthesis and cleavage conditions of chemically cleavable oligonucleotides are described in U.S. Patents 5,700,642 and 5,830,655. For example, by selecting the cleavable sites to be introduced, either a functionalized nucleoside dimer or a modified nucleoside dimer may be prepared first and then selectively introduced into the oligonucleotide fragment as it is extended during the oligonucleotide synthesis process. Selective cleavage of dialkoxysilane may be achieved by treatment with fluoride ions. Phosphothioate nucleotide linkages may be selectively cleaved under mild oxidation conditions. Selective cleavage of phosphoramidate links may be carried out under mild acid conditions such as 80% acetic acid. Selective cleavage of ribose can be performed by treatment with diluted ammonium hydroxide.
[0307] In another embodiment, as described in U.S. Patent Application Publication No. 2003 / 0186226, an inclementable hydroxyl linker can be converted to a cleavable linker by attaching a special phosphoramidite to the hydroxyl group prior to the synthesis of a phosphoramidite or H-phosphonate oligonucleotide. Cleavage of the chemical phosphorylating agent at the completion of oligonucleotide synthesis yields an oligonucleotide (e.g., a readout molecule) with a phosphate group supported at the 3' end. The 3' phosphate end can be converted to a 3' hydroxyl end by treatment with a chemical or an enzyme such as alkaline phosphatase, which is routinely performed by those skilled in the art.
[0308] In another embodiment, the cleavable linkage portion may be a TOPS (two oligonucleotides per synthesis) linker (see, e.g., PCT Publication WO 93 / 20092). For example, TOPS phosphoramidites can be used to convert incleavable hydroxyl groups on a solid support into cleavable linkers. A preferred embodiment of the TOPS reagent is Universal TOPS® phosphoramidite. The conditions for preparation, linking, and cleavage of Universal TOPS® phosphoramidite are detailed, for example, in Hardy et al. Nucleic Acids Research 22(15):2998-3004 (1994). Universal TOPS® phosphoramidite yields a cyclic 3'-phosphorite, which can be removed under basic conditions such as extended ammonia and / or ammonia / methylamine treatment, resulting in the yield of a native 3'-hydroxyoligonucleotide.
[0309] In another embodiment, the cleavable linkage portion may be an aminolinker. The resulting oligonucleotide is linked to the linker via a phosphoramidite linkage and can be cleaved with 80% acetic acid to yield a 3'-phosphorylated oligonucleotide.
[0310] In another embodiment, the cleavable linkage portion may be a photocleavable linker, such as an ortho-nitrobenzyl photocleavable linker. The synthesis and cleavage conditions of photosensitive oligonucleotides on a solid support are described, for example, in Venkatesan et al., J. Org. Chem. 61:525-529 (1996), Kahl et al., J. Org. Chem. 64:507-510 (1999), Kahl et al., J. Org. Chem. 63:4870-4871 (1998), Greenberg et al., J. Org. Chem. 59:746-753 (1994), Holmes et al., J. Org. Chem. 62:2370-2380 (1997), and U.S. Patent No. 5,739,386. Ortho-nitrobenzyl-based linkers, such as hydroxymethyl linkers, hydroxyethyl linkers, and Fmoc-aminoethylcarboxylic acid linkers, may be available commercially.
[0311] In some aspects of any given plane, each readout molecule includes an optically detectable label. In some aspects of any given plane, the measurement and / or detection of a target molecule, e.g., a DNA target molecule, an RNA target molecule, or a polypeptide target molecule, includes contacting a sample obtained from the subject with one or more reagents described herein. In some aspects of any given plane, the reagent is detectably labeled. In some aspects of any given plane, the reagent has the ability to produce a detectable signal. In some aspects of any given plane, the reagent produces a detectable signal if the target molecule is present.
[0312] In some aspects of any given context, one or more reagents described herein may include a detectable label and / or have the ability to generate a detectable signal (for example, by catalyzing a reaction that converts a compound into a detectable product). The detectable label may include, for example, an absorbent dye, a fluorescent dye, or a radioactive label. The detectable labels described herein, methods for detecting them, and methods for incorporating them into reagents are well known in the art.
[0313] In some aspects of any given situation, detectable labels, molecules, and / or parts may be detectable by spectroscopic, photochemical, biochemical, immunochemical, electromagnetic, radiochemical, or chemical means, such as fluorescence, chemifusion, or chemiluminescence, or any other suitable means. Detectable labels used in the methods described herein may be primary labels (in which case the label includes a directly detectable part or a part that produces a directly detectable part) or secondary labels (in which case the detectable label binds to another part to produce a detectable signal, as is common in immunolabeling, for example, using secondary and tertiary antibodies). Detectable labels may be linked to reagents by covalent or non-covalent means. Alternatively, detectable labels may be linked by directly labeling a molecule that obtains binding to the reagent via a ligand-receptor binding pair arrangement, or other such specific recognition molecules. Examples of detectable labels, but not limited to, include radioisotopes, bioluminescent compounds, chromophores, antibodies, chemiluminescent compounds, fluorescent compounds, metal chelators, and enzymes.
[0314] In other embodiments, the detection reagent is a label having a fluorescent compound. When the fluorescently labeled reagent is exposed to light of an appropriate wavelength, its presence can be detected by fluorescence. In some embodiments of any aspect, the detectable labels are, but are not limited to, fluorescein, phycoerythrin, phycocyanin, o-phthalaldehyde, fluorescein, Cy3 (商標) Cy5 (商標), allophycocyanin, Texas Red, peridinin chlorophyll, cyanine, tandem complexes, such as phycoerythrin-Cy5 (商標) , green fluorescent protein, rhodamine, fluorescein isothiocyanate (FITC) and Oregon Green (商標) , rhodamine and derivatives (such as Texas Red and tetrarhodimine isothiocyanate (TRITC)), biotin, phycoerythrin, AMCA, CyDyes (商標) , 6-carboxyfluorescein (commonly known by the abbreviations FAM and F), 6-carboxy-2',4',7',4,7-hexachlorofluorescein (HEX), 6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein (JOE or J), N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA or T), 6-carboxy-X-rhodamine (ROX or R), 5-carboxyrhodamine-6G (R6G' or G5), 6-carboxyrhodamine-6G (R6G6 or G6), and rhodamine 110; cyanine dyes, such as Cy3, Cy5, and Cy7 dyes; coumarin, such as umbelliferone; benzimidazole dyes, such as Hoechst 33258; phenanthridine dyes, such as Texas Red; ethidium dyes; acridine dyes; carbazole dyes; phenoxazine dyes; porphyrin dyes; polymethine dyes, such as cyanine dyes, such as Cy3, Cy5, and others; BODIPY dyes and quinoline dyes, etc., can be fluorescent dye molecules or fluorophores. In some embodiments of any aspect, the detectable label is, but not limited to, 3 H, 125 I, 35 S, 14 C, 32 P, and 33The label may be radioactive, such as P. In some aspects of any given situation, the detectable label may be an enzyme, such as horseradish peroxidase and alkaline phosphatase, but is not limited to these. The enzyme label may produce, for example, a chemiluminescent signal, a color signal, or a fluorescent signal. Enzymes envisioned for use in detecting antibody reagents include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, delta-V steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-VI phosphatase, glucoamylase, and acetylcholinesterase. In some aspects of any given situation, the detectable labels are, but are not limited to, chemiluminescent labels such as lucigenin, luminol, luciferin, isoluminol, theromatic acridinium esters, imidazole, acridinium salts, and oxalate esters. In some aspects of any given situation, the detectable labels may be, but are not limited to, spectral colorimetric labels such as colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, and latex) beads.
[0315] In some aspects of any given situation, the detection reagent may also be labeled with a detectable tag such as c-Myc, HA, VSV-G, HSV, FLAG, V5, HIS, or biotin. Other detection systems may also be used, such as the biotin-streptavidin system. In this system, an antibody that is immune to (i.e., specific to) the biomarker of interest is biotinylated. The amount of biotinylated antibody bound to the biomarker is determined using a streptavidin-peroxidase complex and a chromogenic substrate. Such streptavidin peroxidase detection kits are commercially available, for example, from DAKO in Carpinteria, California. The reagent also, 152The reagent can be detectably labeled with a fluorescent metal such as Eu or other lanthanide metals. These metals can be attached to the reagent using a metal chelating group such as diethylenetriaminepentaacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).
[0316] The detection method used is by a specific detectable label used on the readout molecule. In certain exemplary embodiments, chromosomes and / or chromosomal regions to which one or more oligonucleotide tags (e.g., oligopaint) and / or readout molecules are conjugated may be selected and / or sorted using a microscope, spectrophotometer, tube luminometer or plate luminometer, X-ray film, scintillator, fluorescent cell sorting (FACS) device, or microfluidic device, etc.
[0317] In some aspects of any given situation, the detectable label includes a fluorophore or a fluorescent compound. Systems and devices for measuring fluorescence are well known in the art. Fluorescence measurement requires a light source that emits light containing a suitable absorption or excitation wavelength. The absorption or excitation wavelengths of the compounds described herein are approximately 300–800 nm. In some aspects of any given situation, the light source emits light containing, essentially having, or consisting of wavelengths between 300–870 nm. When light comes into contact with a sample, it excites electrons in certain substances, also known as fluorophores, within the sample, causing the substance to emit light in the form of fluorescence (luminescence).
[0318] A system or device for measuring fluorescence then detects the emission. In some embodiments, the system or device may include a filter or monochromator so that only light of a desired wavelength reaches the detection unit of the system or device. In some embodiments of any aspect, the system or device is configured to detect light containing, essentially having, or consisting of wavelengths between 300 and 800 nm. Suitable systems and devices are commercially available, such as the 20 / 30 PV™ Microspectrometer or 508 PV™ Microscope Spectrometer from CRAIC (San Dimas, California), the Duetta™, FluoroMax™, Fluorolog™, QuantaMaster 8000™, DeltaFlex™, DeltaPro, or Nanolog™ from Horiba (Irvine, California), or the SP8 Lightning™, SP8 Falcon™, SP8 Dive™, TCS SPE™, HCS A™, or TCS SP8 X™ from Leica (Buffalo Grove, Illinois).
[0319] In some aspects of any given situation, fluorescence microscopy may be used to detect and record the results of in-situ hybridization using routine methods known in the art. Alternatively, digital (computer-aided) fluorescence microscopy with image processing capabilities may be used. Two well-known systems for imaging FISH of chromosomes with multiple color labels are multi-fish (M-FISH) and spectral karyotyping (SKY). See Schrock et al. (1996) Science 273:494; Roberts et al. (1999) Genes Chrom. Cancer 25:241; Fransz et al. (2002) Proc. Natl. Acad. Sci. USA 99:14584; Bayani et al. (2004) Curr. Protocol. Cell Biol. 22.5.1-22.5.25; Danilova et al. (2008) Chromosoma 117:345; U.S. Patent No. 6,066,459; and the section on chromosome painting and detection of painted chromosomes in the instructions for use (molecular probe) of the FISH TAG® DNA Multicolor Kit.
[0320] In certain exemplary embodiments, images of fluorescently labeled chromosomes are detected and recorded using a computerized imaging system such as the Applied Imaging Corporation CytoVision® system (Applied Imaging Corporation, Santa Clara, California), with modifications (e.g., software, Chroma 84000 filter set, and enhanced filter wheel). Other preferred systems include a computerized imaging system using a cooled CCD camera (Photometrics, NU200 series, equipped with Kodak® KAF 1400 CCD) coupled with a Zeiss Axiophot® microscope, where images are processed as described in Ried et al. (1992) Proc. Natl. Acad. Sci. USA 89:1388. Other preferred imaging and analysis systems are described by Schrock et al., as above; and Speicher et al. (1996) Nature Genet. 12:368. In some aspects of any given situation, oligonucleotide tags (e.g., oligopaint) are visualized using super-resolution microscopy (e.g., imaging by stochastic optical reconstruction microscopy (STORM)).
[0321] The in-situ hybridization methods described herein can be performed on a variety of biological or clinical samples, with cells at any (or all) stages of the cell cycle (e.g., mitosis, meiosis, interphase, G0, G1, S, and / or G2). Examples include all types of cell cultures, animal or plant tissues, peripheral blood lymphocytes, buccal smears, scrapes prepared from uncultured primary tumors, cancer cells, bone marrow, cells obtained from biopsies or from bodily fluids (e.g., blood, urine, sputum, etc.), cells derived from amniotic fluid, cells derived from maternal blood (e.g., fetal cells), and cells derived from the testes and ovaries. Samples are prepared using conventional techniques for the assays of the present invention, which typically depend on the source from which the sample or specimen was taken. These examples should not be construed as limiting the types of samples to which the methods and / or compositions described herein can be applied.
[0322] Hybridization of the oligonucleotide tag of the present invention (e.g., Oligopaint) to a target chromosome sequence can be achieved by standard in-situ hybridization (ISH) techniques (see, for example, Gall and Pardue (1981) Meth. Enzymol. 21:470; Henderson (1982) Int. Review of Cytology 76:1). Generally, ISH includes the following main steps: (1) immobilization of the biological structure to be detected (e.g., chromosome spread); (2) increasing the accessibility of the target DNA by pre-hybridization of the biological structure (e.g., denaturation by heat or alkali); (3) optionally pre-hybridization to reduce nonspecific binding (e.g., by blocking the hybridization force of repetitive sequences); (4) hybridizing the nucleic acid mixture to the nucleic acids of the biological structure or tissue; (5) removing unhybridized nucleic acid fragments by washing after hybridization; and (6) detecting the hybridized labeled oligonucleotide (e.g., hybridized oligonucleotide tag, e.g., oligopaint). The reagents used in each of these steps, and their usage conditions, vary depending on the specific situation. For example, step 3 is not always necessary, as the recognition domains described herein may be designed to avoid repetitive sequences. Hybridization conditions are also described in U.S. Patent No. 5,447,841. It should be understood that numerous variations of in-situ hybridization protocols and conditions are known and that they can be used in connection with the present invention by those skilled in the art in accordance with the guidance provided herein.
[0323] As used herein, the term “hybridization” refers to the process by which two single-stranded polynucleotides are non-covalently joined to form a stable double-stranded polynucleotide. The term “hybridization” may also refer to triple-stranded hybridization. The resulting (usually) double-stranded polynucleotide is “hybridized” or “duplex.” “Hybridization conditions” typically include salt concentrations of less than about 1 M, more typically less than about 500 mM, and even more typically less than about 200 mM. Hybridization temperatures can be as low as 5°C, but are typically higher than 22°C, more typically higher than about 30°C, and often above about 37°C. Hybridization is usually carried out under stringent conditions, i.e., conditions under which the probe hybridizes to its target subsequence. Stringent conditions are sequence-dependent and vary from situation to situation. The longer the fragment, the higher the hybridization temperature may be required for specific hybridization. Other factors, including the base composition and length of the complementary chain, the presence of organic solvents, and the degree of base mismatching, can also affect the stringency of hybridization; however, the combination of parameters is more important than the absolute measure of any single parameter alone. Generally, stringent conditions are selected so that the Tm at a given ionic strength and pH for a particular sequence is about 5°C lower. Exemplary stringent conditions include a salt concentration of at least 0.01 M to 1 M Na ion (or other salt), a pH of 7.0–8.3, and a temperature of at least 25°C. For example, conditions for 5×SSPE (750 mM NaCl, 50 mM sodium phosphate, 5 mM EDTA, pH 7.4) and a temperature of 25–30°C are suitable for allele-specific probe hybridization.For stringent conditions, see, for example, Sambrook, Fritsche and Maniatis, Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press (1989), and Anderson Nucleic Acid Hybridization, 1st Ed., BIOS Scientific Publishers Limited (1999). Expressions such as "specifically hybridizes to" or "specifically hybridizes to" refer to the fact that, under stringent conditions, a molecule substantially binds to, duplicates, or hybridizes to, or exclusively to, one or more specific nucleotide sequences present in a complex mixture (e.g., whole-cell) DNA or RNA.
[0324] As used herein, the term “specific binding” refers to a chemical interaction between two molecules, compounds, cells, and / or particles, where the first element binds to a second target element with higher specificity and affinity than it binds to a third, non-target element. In some embodiments, specific binding may refer to an affinity of the first element to the second target element that is at least 10 times, at least 50 times, at least 100 times, at least 500 times, at least 1000 times, or higher than the affinity of the first element to the third, non-target element. A reagent specific to a given target is a reagent that exhibits specific binding to that target under the conditions of the assay being used.
[0325] As used herein, the term “oligonucleotide” typically includes, but is not limited to, single-stranded DNA or RNA molecules prepared by synthetic means. The nucleotides of the present invention are typically natural nucleotides, such as nucleotides derived from adenosine, guanosine, uridine, cytidine, and thymidine. When oligonucleotides are referred to as “double-stranded,” those skilled in the art will understand that a pair of oligonucleotides exist as a hydrogen-bonded helix, typically associated with, for example, DNA. In addition to 100% complementary double-stranded oligonucleotides, as used herein, the term “double-stranded” also includes forms that include structural features such as bulges and loops (see Stryer, Biochemistry, Third Ed. (1988), all of which are incorporated herein by reference for all purposes). As used herein, the term “polynucleotide” includes, but is not limited to, two or more oligonucleotides linked to one another (e.g., by hybridization, ligation, and polymerization).
[0326] Nucleic acid and ribonucleic acid (RNA) molecules can be isolated from specific biological samples using one of numerous procedures, many of which are well known in the art, and the specific isolation procedure chosen is appropriate for the particular biological sample. For example, freeze-thaw and alkaline dissolution procedures may be useful for obtaining nucleic acid molecules from solid materials; heat and alkaline dissolution procedures may be useful for obtaining nucleic acid molecules from urine; and proteinase K extraction may be used to obtain nucleic acids from blood (Roiff, A et al. PCR: Clinical Diagnostics and Research, Springer (1994)).
[0327] In certain exemplary embodiments, universal primers can be used to amplify nucleic acid sequences, such as oligonucleotide tags (e.g., oligopaints). The term “universal primers” refers to a set of primers (e.g., forward and reverse primers) that can be used to extend / amplify multiple polynucleotide chains, for example, by hybridizing to a site common to multiple polynucleotides. For example, universal primers can be used to amplify all, or essentially all, polynucleotides in a pool. In some embodiments of any aspect, the forward and reverse primers have the same sequence. In some embodiments of any aspect, the sequence of the forward primer is different from the sequence of the reverse primer. In yet other embodiments, multiple, for example, tens, hundreds, thousands, or many more universal primers are provided.
[0328] In some aspects of any given context, universal primers may be transient primers that can be removed by enzymatic or chemical cleavage after amplification. In other aspects, universal primers may include modifications that are incorporated into the polynucleotide molecule after chain elongation. Illustrative modifications include, for example, 3' or 5' terminal caps, labels (e.g., fluorescein), or tags (e.g., biotin or other tags that facilitate the immobilization or isolation of polynucleotides).
[0329] In some aspects of any given setting, the methods disclosed herein include amplification of oligonucleotide sequences, such as oligonucleotide tags (e.g., oligopaints). The amplification method may include contacting a nucleic acid with one or more primers (e.g., universal primers) that specifically hybridize to the nucleic acid under conditions that facilitate hybridization and chain elongation. Exemplary methods for amplifying nucleic acids include polymerase chain reaction (PCR) (e.g., Mullis et al. (1986) Cold Spring Harb. Symp. Quant. Biol. 51 Pt 1:263 and Cleary et al. (2004) Nature Methods 1:241; and U.S. Patent Nos. 4,683,195 and 4,683,202), anchored PCR, race PCR, linked-chain reaction (LCR) (e.g., Landegran et al. (1988) Science 241:1077-1080; and Nakazawa et al. (1994) Proc. Natl. Acad. Sci. USA 91:360-364), autologous persistent sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874), and transcription amplification systems (Kwoh et al. Examples include amplification methods described in U.S. Patent Nos. 6,391,544, 6,365,375, 6,294,323, 6,261,797, 6,124,090, and 5,612,199, or any other nucleic acid amplification methods using techniques well known to those skilled in the art. In exemplary embodiments, the methods disclosed herein utilize PCR amplification.
[0330] Generally, PCR procedures describe a method of gene amplification comprising (i) sequence-specific hybridization of primers to a specific gene or sequence in a nucleic acid sample or library, (ii) subsequent amplification including multiple rounds of annealing, extension, and denaturation using a heat-stable DNA polymerase, and (iii) selection of PCR products having bands of appropriate size. The primers used are oligonucleotides having sufficient length and appropriate sequence to provide polymerization initiation; that is, each primer is specifically designed to be complementary to the strand of the genomic locus to be amplified. In alternative embodiments, the mRNA levels of the gene expression products described herein may be determined by reverse transcription (RT) PCR and quantitative RT-PCR (QRT-PCR) or real-time PCR. RT-PCR and QRT-PCR methods are well known in the art.
[0331] In some aspects of any given context, oligonucleotide tags (e.g., oligopaints) are not necessarily amplified (e.g., by PCR and / or universal priming regions). In some aspects of any given context, the described oligonucleotide tags (e.g., oligopaints) may be newly synthesized and used "directly from the test tube". Methods for the new synthesis of oligonucleotides are well known to those skilled in the art. As used herein, "oligonucleotide synthesis" refers to the chemical synthesis of relatively short fragments of nucleic acids having a given chemical structure. Non-limiting examples of oligonucleotide synthesis methods include phosphoramidite solid-phase synthesis, phosphoramidite synthesis, phosphodiester synthesis, phosphotryester synthesis, or phosphitetryester synthesis. See, for example, Beaucage et al. Tetrahedron Volume 48, Issue 12, 20 March 1992, Pages 2223-2311; Caruthers, J Biol Chem. 2013 Jan 11, 288(2):1420-7. In some aspects, each oligonucleotide is synthesized separately. In some embodiments, the entire oligonucleotide set is synthesized in a single reaction. In some embodiments, a subset of the entire oligonucleotide set is synthesized in a single reaction. In some embodiments, the entire oligonucleotide set is synthesized in multiple separate reactions. In some embodiments, the reaction products are isolated, for example, by high-performance liquid chromatography (HPLC) to obtain the desired oligonucleotides of high purity.
[0332] In certain exemplary embodiments, a kit is provided. As used herein, the term “kit” means any delivery system for delivering oligonucleotide tags (e.g., oligopaint), readout molecules, primers, and / or reagents (e.g., ligases, cleavage agents) to perform the methods described herein. In the context of an assay, such a kit includes a system that enables the storage, transport from one location to another, or delivery of reaction reagents (e.g., housings providing one or more of the reaction reagents, such as oligonucleotide tags, readout molecules, primers (e.g., primers specific to all oligonucleotide tags present, and / or subsets of primers specific to one or more subsets of oligonucleotide tag sequences), oligonucleotides conjugated with one or more detectable and / or recoverable labels, oligonucleotide-conjugated supports (e.g., microarrays, palettes, etc.)), and / or support materials (e.g., housings providing buffers, or instructions for performing the assay described herein, etc.). For example, a kit includes one or more housings (e.g., boxes) that contain the reaction reagents and / or support materials associated with the assay described herein. In one aspect, the kit of the present invention comprises an oligonucleotide tag (e.g., oligopaint) specific to one or more target nucleotide sequences (e.g., chromosomes) or one or more regions (e.g., subchromosomal regions) of one or more target nucleotide sequences. In another aspect, the kit of the present invention comprises a readout molecule specific to one or more oligonucleotide tags (e.g., oligopaint). In yet another aspect, the kit comprises one or more primer sequences, one or more supports to which multiple synthetic oligonucleotide sequences are attached, and one or more detectable and / or recoverable labels. Such contents can be delivered to the intended recipient together or separately. For example, a first container may contain primer sequences used in the assay, and a second container may contain supports to which multiple synthetic oligonucleotide sequences are attached.
[0333] In some aspects of any aspect, the kit provides one or more arrays and / or palettes to which multiple specific oligonucleotide sequences (e.g., oligonucleotide tags (e.g., oligopaint) and / or readout molecules) are attached. In some aspects of any aspect, the arrays and / or palettes provide multiple oligonucleotide tag sequences (e.g., oligopaint) specific to a set of binding patterns in a genome (e.g., the human genome). In some aspects of any aspect, the arrays or palettes are specific to a set of chromosomal abnormalities (e.g., one or more of translocations, insertions, inversions, deletions, duplications, repositions, aneuploidy, polyploidy, complex rearrangements, and telomere loss) associated with one or more disorders described herein. In some aspects of any aspect, the kits described herein are particularly suitable for use in clinical settings to diagnose and / or prevent one or more disorders described herein (e.g., in hospitals, clinics, medical offices, diagnostic laboratories, laboratories, etc., for example, patient diagnosis and / or prognosis, as well as prenatal diagnosis and / or prognosis).
[0334] In some aspects of any aspect, the kit provides instructions for use to amplify a plurality of specific oligonucleotide tag sequences (e.g., oligopaints) provided within the kit. In some aspects of any aspect, the kit provides instructions for use to label one or more target nucleic acid sequences (e.g., one or more chromosomal or subchromosomal regions) in a detectable and / or recoverable manner using the amplified oligonucleotide tag (e.g., oligopaint). In some aspects of any aspect, the kit provides instructions for use to label one or more target nucleic acid sequences (e.g., one or more chromosomal or subchromosomal regions) in a detectable and / or recoverable manner using the oligonucleotide tag (e.g., oligopaint) and a readout molecule. In some aspects of any aspect, the kit provides instructions for use to effectively remove one or more of the plurality of specific oligonucleotide tag sequences (e.g., oligopaints) during the amplification step, by labeling the one or more target nucleic acid sequences undetectable and / or recoverable by including one or more unlabeled amplification primers that hybridize to the one or more oligonucleotide sequences to be removed.
[0335] In some aspects of any given situation, the systems and methods described herein may be implemented by any type of hardware and / or software, and may be pre-programmed general-purpose computing devices. For example, the system may be implemented using a server, a personal computer, a portable computer, a thin client, or any suitable one or more devices. The disclosure and / or its components may be a single device in one location, or multiple devices in one or more locations, the latter connected to each other over any communication medium such as electronic cables or fiber optic cables, or wirelessly, using any suitable communication protocol.
[0336] It should also be noted that this disclosure is illustrated and discussed herein as having multiple modules that perform a particular function. These modules are illustrated only schematically based on their function for the sake of clarity and should be understood as not necessarily representing specific hardware or software. In this regard, these modules may be hardware and / or software implemented to substantially perform the particular function discussed. Furthermore, modules may be combined with each other within this disclosure, or divided into additional modules based on desired specific functions. Therefore, this disclosure should not be construed as limiting the invention, but rather as illustrating only one embodiment.
[0337] A computer system may include clients and servers. Clients and servers are typically geographically separated and communicate through a communication network. The relationship between a client and a server arises from computer programs running on each computer that have a client-server relationship with each other. In some implementations, the server sends data (e.g., HTML pages) to a client device (e.g., to display data to a user interacting with the client device and to receive user input). Data created on the client device and from that device (e.g., the results of interactions with the user) may be received by the server.
[0338] Implementations of the subject matter described herein may be implemented in a computer system that includes, for example, a backend component as a data server, or a middleware component, for example, an application server, or a frontend component, for example, a client computer having a graphical user interface or a web browser through which a user can interact with implementations of the subject matter described herein, or one or any combination of such backend, middleware, or frontend components. The components of the system may be interconnected by any form or medium of digital data communication, for example, a communication network. Examples of communication networks include local area networks ("LANs") and wide area networks ("WANs"), internetworks (e.g., the Internet), and peer-to-peer networks (e.g., ad-hoc peer-to-peer networks).
[0339] The subjects and operations described herein may be implemented in digital electronic circuits, or in computer software, firmware, or hardware, or one or more combinations thereof, including structures and their structural equivalents disclosed herein. The subjects described herein may be implemented as one or more computer programs, i.e., as computer program instructions for one or more modules coded on a computer storage medium to be executed by a data processing device or to control the operation of a data processing device. Alternatively, or in addition, program instructions may be coded on artificially generated and propagating signals, such as machine-generated electrical, optical, or electromagnetic signals, which are generated to encode information to be transmitted to a suitable receiving device for execution by a data processing device. The computer storage medium may be, or include, a computer-readable storage device, a computer-readable storage board, a random or serial-access memory array or device, or one or more combinations thereof. Furthermore, although the computer storage medium is not a propagating signal, it may be a source or destination for computer program instructions in an artificially generated propagating signal. Computer storage media can also be, or be contained within, one or more separate physical components or media (e.g., multiple CDs, disks, or other storage devices).
[0340] The operations described herein may be performed as operations performed by a “data processing device” on data stored in one or more computer-readable storage devices or received from other sources.
[0341] The term "data processing device" encompasses all types of devices, machines, and equipment for data processing, including, for example, programmable processors, computers, systems on a chip, or a combination of the aforementioned. Devices may include specialized logic circuits, such as FPGAs (Field-Programmable Gate Arrays) or ASICs (Application-Specific Integrated Circuits). In addition to hardware, devices may also include code that constitutes the execution environment for the computer program, such as processor firmware, protocol stacks, database management systems, operating systems, cross-platform runtime environments, virtual machines, or a combination of one or more of these. Devices and execution environments can provide infrastructure for a wide variety of computing models, including web services, distributed computing, and grid computing infrastructure.
[0342] Computer programs (also known as programs, software, software applications, scripts, or code) can be written in any form of programming language, including compiled or interpreted languages, declarative or procedural languages, and can be deployed in any form, for example, as standalone programs, or as modules, components, subroutines, objects, or other units suitable for use in a computer environment. Computer programs can, though not required, correspond to files in a file system. A program can be stored in part of a file that also stores other programs or data (e.g., one or more scripts stored in a markup language document), in a single file dedicated to that program, or in multiple collaborative files (e.g., a file containing one or more modules, subprograms, or parts of code). Computer programs can be deployed to run on one or more computers located at one site or distributed across multiple sites interconnected by a communication network.
[0343] The processes and logic flows described herein may be implemented by one or more programmable processors that execute one or more computer programs to perform operations by arithmetic operations on input data or by generating outputs. The processes and logic flows may also be implemented by special-purpose logic circuits, such as FPGAs (Field-Programmable Gate Arrays) or ASICs (Application-Specific Integrated Circuits), and the devices themselves may also be implemented as special-purpose logic circuits, such as FPGAs (Field-Programmable Gate Arrays) or ASICs (Application-Specific Integrated Circuits).
[0344] Examples of processors suitable for executing computer programs include both general-purpose and specialized microprocessors, as well as one or more processors of any kind in digital computers. Generally, a processor receives instructions and data from read-only memory, random-access memory, or both. The main components of a computer are a processor that performs actions according to instructions, and one or more memory devices that store instructions and data. Generally, a computer also includes one or more mass storage devices that store data, such as magnetic disks, magneto-optical disks, or optical disks, or is functionally coupled to them to receive, transmit, or send / receive data. However, a computer does not have to have such devices. Furthermore, a computer may be embedded in another device, for example, a mobile phone, a personal digital assistant (PDA), a portable audio or video player, a game console, a Global Positioning System (GPS) receiver, or a portable storage device (e.g., a Universal Serial Bus (USB) flash drive). Suitable devices for storing computer program instructions and data include all forms of non-volatile memory, media, and memory devices, such as semiconductor memory devices, e.g., EPROM, EEPROM, and flash memory devices; magnetic disks, e.g., internal hard disks or removable disks; magneto-optical disks; and CD-ROM and DVD-ROM disks. Processors and memory may be fitted with or incorporated into special-purpose logic circuits.
[0345] For convenience, the meanings of some terms and phrases used herein, in the examples and in the appended claims are provided below. Unless otherwise specified or indicated by the context, the following terms and phrases include the meanings provided below. The definitions are provided to aid in the description of specific embodiments and are not intended to limit the invention, as the scope of the invention is limited only by the claims. Unless otherwise defined, all scientific and technical terms used herein have the same meaning as commonly understood by those skilled in the art in which the invention pertains. If there is a clear discrepancy between the articulation of a term and its definition provided herein, the definition provided herein shall prevail.
[0346] For convenience, the specific terms used in this specification, the examples, and the appended claims are set forth herein.
[0347] As used herein, the term “chromosome” refers to the support structure of genes that carry heredity within a living cell, and includes DNA, proteins, RNA, and other related components. This specification uses the identification and numbering of chromosomes in the human genome according to the conventional International System of Units (SI). The size of individual chromosomes can vary within a genome containing multiple chromosomes, and between different genomes. Chromosomes can be obtained from any species. Chromosomes can be obtained from adult subjects, juvenile subjects, infant subjects, intrauterine subjects (e.g., from fetuses, via prenatal tests such as amniocentesis, chorionic villi sampling, etc., or directly from fetuses, e.g., by fetal surgery), from biological samples (e.g., biological tissues, fluids, or cells (e.g., sputum, blood, blood cells, tissue or fine-needle biopsy samples, urine, cerebrospinal fluid, ascites, and pleural fluid, or cells derived therefrom)), or from cell culture samples (e.g., primary cells, immortalized cells, partially immortalized cells, etc.). In certain exemplary embodiments, one or more chromosomes may be obtained from, but are not limited to, homozygous, Drosophila, and Caenorhabditis (C) chromosomes. It can be obtained from one or more genera such as aenorhabiditis, zebrafish (Danio), carp (Cyprinus), horse (Equus), dog (Canis), sheep (Ovis), oncorynchus, salmon (Salmo), cattle (Bos), wild boar (Sus), chicken (Gallus), eggplant (Solanum), wheat (Triticum), rice (Oryza), maize (Zea), barley (Hordeum), banana (Musa), wild oats (Avena), poplar (Populus), rapeseed (Brassica), sugarcane (Saccharum), etc.
[0348] As used herein, the term “chromosome banding” refers to staining that distinguishes chromosomes, resulting in distinguishable regions of transverse banding patterns (e.g., differently or alternately colored) that are characteristic of individual chromosomes or chromosomal regions (i.e., “banding patterns”). Conventional banding methods include G-banding (Giemsa staining), Q-banding (quinacrine mustard staining), R-banding (reverse Giemsa staining), and C-banding (centromere staining).
[0349] As used herein, the term “karyotype” refers to the chromosomal characteristics of an individual cell, cell lineage, or genome of a given species, defined by both the number and morphology of chromosomes. Karyotype can refer to a variety of chromosomal rearrangements, including, but are not limited to, translocations, insertions, inversions, deletions, duplications, transpositions, aneuploidy, complex rearrangements, and telomere loss. Typically, karyotype is presented as a systematized array of prophase or metaphase (or other condensed) chromosomes from microscopic or computer-generated images. Interphase chromosomes may also be investigated.
[0350] As used herein, the terms “aberration” or “abnormality” refer to a deviation in the structure of a chromosome or karyotype of interest from the structure of a normal (i.e., non-abnormal) homologous chromosome or karyotype. The deviation may be a single-base pair or multi-base pair deviation. When referring to a chromosome or karyotype, the terms “normal” or “non-abnormal” refer to the karyotype or staining pattern found in healthy individuals of a particular species and sex. Chromosomal abnormalities can be of numerical or structural nature and include, but are not limited to, aneuploidy, polyploidy, inversion, translocation, deletion, and duplication. Chromosomal abnormalities may correlate with the presence of a disease or susceptibility to developing a disease. Chromosomal abnormalities (aberrations) and / or abnormalities may also refer to changes that are not associated with disease, disability, and / or phenotypic changes. Such abnormalities (aberrations) and / or abnormalities may be rare or present at low frequency (e.g., a few percent of a population (e.g., polymorphism)).
[0351] Disorders associated with one or more chromosomal abnormalities include, but are not limited to, autosomal abnormalities (e.g., trisomy (Down syndrome (chromosome 21), Edwards syndrome (chromosome 18), Patau syndrome (chromosome 13), trisomy 9, Warkany syndrome (chromosome 8), trisomy 22 / cat eye syndrome, trisomy 16); monosomy and / or deletion (Wolff-Hirschorn syndrome (chromosome 4), cat cry / chromosome 5q deletion syndrome (chromosome 5), Williams syndrome (chromosome 7), Jacobsen syndrome (chromosome 11), Miller-Dieker syndrome / Smith-Magenis syndrome (chromosome 17), DiGeorge syndrome (chromosome 22)). ), genomic imprinting (Angelman syndrome / Prader-Willi syndrome (chromosome 15))); X / Y related abnormalities (e.g., monosomy (Turner syndrome (XO), trisomy or tetrasomy and / or other karyotypes or mosaics (Klinefelter syndrome (47(XXY)), 48(XXYY), 48(XXXY), 49(XXXYY), 49(XXXXY), triple X syndrome (47(XXX)), 48(XXXX), 49(XXXXX), 47(XYY), 48(XYYY), 49(XYYYY), 46(XX / XY)); translocations (e.g., leukemia or lymphoma (e.g., lymphoid (e.g., Burkitt lymphoma t(8) MYC (14 IGH), follicular lymphoma t (14 IGH; 18 BCL2), mantle cell lymphoma / multiple myeloma t (11 CCND1; 14 IGH), anaplastic large cell lymphoma t (2 ALK; 5 NPM1), acute lymphoblastic leukemia) or myeloid (e.g., Philadelphia chromosome t (9 ABL; 22 BCR), mature t acute myeloblastic leukemia (8 RUNX1T1; 21 RUNX1), acute promyelocytic leukemia t (15 PML, 17 RARA), acute megakaryoblastic leukemia t (1 RBM15; 22 MKL1)) or other (e.g., Ewing's sarcoma t (11 FiI1; 22 EWS), synovial sarcoma t (x SYT; 1 8SSX), dermatofibrosarcoma protuberance t (17 COL1A1; 22 PDGFB), myxoid liposarcoma (12 DDIT3;16 FUS), fibrinogenic small round cell tumor (11 WT1;22 EWS), alveolar rhabdomyosarcoma (2 PAX3;13 FOXO1) (1 PAX7;13 FOXO1));This includes gonadal dysplasia (e.g., mixed gonadal dysplasia, XX gonadal dysplasia) and other abnormalities (e.g., fragile X syndrome, uniparental disomy). Disorders associated with one or more chromosomal abnormalities include, but are not limited to, Beckwith-Wiedmann syndrome, branchio-otorenal syndrome, cat-cry syndrome, de Lange syndrome, holoprosencephaly, Rubinstein-Taybe syndrome, and WAGR syndrome.
[0352] Disorders associated with one or more chromosomal abnormalities include proliferative disorders (e.g., cancer). As used herein, the term “proliferative disorder” includes disorders characterized by undesirable or inappropriate growth of one or more subsets of cells in multicellular organisms. The term “cancer” refers to various types of malignant neoplasms, most of which may invade surrounding tissues and metastasize to other sites (see, e.g., PDR Medical Dictionary 1st edition, 1995). The terms “neoplasm” and “tumor” refer to abnormal tissues that grow by cell proliferation faster than normal tissues and continue to grow after the stimulus that initiated their growth has been removed (see, e.g., PDR Medical Dictionary 1st edition, 1995). Such abnormal tissues exhibit a partial or complete lack of structural coherence and functional coordination with normal tissues and may be benign (i.e., benign tumors) or malignant (i.e., malignant tumors).
[0353] Brain disorders are also associated with one or more chromosomal abnormalities, including, but are not limited to, acoustic neuroma, acquired brain injury, Alzheimer's disease, amyotrophic lateral column disease, aneurysms, aphasia, arteriovenous malformations, attention deficit hyperactivity disorder, autism, Batten disease, blepharospasm, brain tumors, cerebral palsy, Charcot-Marie-Tooth disease, Chiari malformation, CIDP, non-Alzheimer's dementia, autonomic nervous system disorders, dyslexia, dysprazia, dystonia, epilepsy, essential tremor, and Friedrich's ataxia. Examples include ataxia, Gaucher disease, Guillain-Barré syndrome, headache, migraine, Huntington's disease, hydrocephalus, Meniere's disease, motor neuron disease, multiple sclerosis, muscular dystrophy, myasthenia gravis, narcolepsy, Parkinson's disease, peripheral neuropathy, progressive supranuclear palsy, restless limb syndrome, Rett syndrome, schizophrenia, Shy-Drager syndrome, stroke, subarachnoid hemorrhage, Sydenham syndrome, Tay-Sachs disease, Tourette syndrome, transient ischemic attack, transverse myelitis, trigeminal neuralgia, tuberous sclerosis, and von Hippel-Lindau syndrome.
[0354] The terms “decrease,” “reduced,” “decrease,” or “inhibition” all mean, as used herein, a reduction of a statistically significant amount. In some embodiments, “decrease,” “decrease,” or “decrease” or “inhibition” typically mean a reduction of at least 10% compared to a baseline level (e.g., the absence of a given treatment or agent), and may include reductions of, for example, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or greater. As used herein, “decrease” or “inhibition” does not include complete inhibition or reduction compared to a baseline level. “Complete inhibition” is 100% inhibition compared to a baseline level. The reduction may preferably be to a level that is acceptable as being within the normal range for a given non-disabled individual.
[0355] The terms “increased,” “enhanced,” “strengthened,” or “activated” all mean, as used herein, an increase of a statistically significant amount. In some aspects, the terms “increased,” “enhanced,” “strengthened,” or “activated” may mean an increase of at least 10% compared to a baseline level, e.g., an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or an increase including up to 100% and 100%, or any increase of 10 to 100% compared to a baseline level, or an increase of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times compared to a baseline level, or any increase of 2 to 10 times, or more. In the context of markers or symptoms, “increase” is an increase of such a statistically significant level.
[0356] In some aspects of any given context, the reference sample or level is the level of the sample or the sample itself before contact with the composition described herein. In some aspects of any given context, the reference sample or level is the sample or level of the composition described herein before contact with the sample. In some aspects of any given context, the reference may be a sample that has been contacted with a composition that does not contain detectable labels. In some aspects of any given context, the reference may be a sample that has been contacted with a composition that contains recognition domains that are not specific to the sample. In some aspects of any given context, the reference may also be a level obtained from a control sample, a level obtained from a sample pool of control individuals, or a numerical value or range of values based thereon.
[0357] As used herein, “subject” means human or animal. Typically, animals are vertebrates such as primates, rodents, domesticated animals, or game animals. Examples of primates include chimpanzees, crab-eating macaques, spider monkeys, and macaques, such as rhesus macaques. Examples of rodents include mice, rats, woodchucks, ferrets, rabbits, and hamsters. Examples of domesticated animals and game animals include cattle, horses, pigs, deer, bison, buffalo, feline species such as domestic cats, canine species such as dogs, foxes, wolves, bird species such as chickens, emus, ostriches, and fish such as trout, catfish, and salmon. In some embodiments, the subject is a mammal, such as a primate, such as a human. The terms “individual,” “patient,” and “subject” are used interchangeably herein.
[0358] Preferably, the subject is a mammal. Mammals may be, but are not limited to, humans, non-human primates, mice, rats, dogs, cats, horses, or cattle.
[0359] As used herein, the terms “protein” and “polypeptide” are interchangeable and refer to a set of amino acid residues linked to one another by peptide bonds between the alpha-amino and carboxyl groups of adjacent residues. The terms “protein” and “polypeptide” refer to polymers of amino acids, including modified amino acids (e.g., phosphorylated, glycated, glycosylated, etc.) and amino acid analogs, regardless of their size or function. While “protein” and “polypeptide” are often used for relatively large polypeptides, and the term “peptide” is often used for smaller polypeptides, the usage of these terms overlaps in the art. The terms “protein” and “polypeptide” are interchangeable in this specification when referring to gene products and their fragments. Therefore, exemplary polypeptides or proteins include gene products, native proteins, homologs, orthologues, paralogs, fragments, and other equivalents, variants, fragments, and their analogues.
[0360] It is further assumed that the various embodiments described herein encompass all (natural or otherwise) variants, alleles, homologs, conserved modified variants, and / or conserved substitution variants of the specific polypeptides described. With respect to amino acid sequences, those skilled in the art will recognize that any substitution, deletion, or addition to a nucleic acid, peptide, polypeptide, or protein sequence that alters one amino acid or a small percentage of all amino acids in the coding sequence is a “conserved modified variant,” where the alteration results in the substitution of one amino acid with a chemically similar amino acid and preserves the desired activity of the polypeptide. Such conserved modified variants are added to, and not excluded from, polymorphic variants, interspecific homologs, and alleles compatible with this disclosure.
[0361] A given amino acid can be replaced with a residue having similar physiological and chemical characteristics, for example, by substituting one aliphatic residue with another (e.g., Ile, Val, Leu, or Ala) or by substituting one polar residue with another polar residue (e.g., Lys and Arg; Glu and Asp; or Gln and Asn). Other such conservative substitutions, such as substitutions of entire regions having similar hydrophobic characteristics, are well known. Polypeptides containing conservative amino acid substitutions can be tested with any of the assays described herein to determine whether the desired activity, e.g., the activity and specificity of the native or reference polypeptide, is preserved.
[0362] Amino acids can be grouped according to the similarity of their side chain attributes (AL Lehninger, in Biochemistry, second ed., pp. 73-75, Worth Publishers, New York (1975): (1) Nonpolar: Ala(A), Val(V), Leu(L), Ile(I), Pro(P), Phe(F), Trp(W), Met(M); (2) Uncharged polar: Gly(G), Ser(S), Thr(T), Cys(C), Tyr(Y), Asn(N), Gln(Q); (3) Acidic: Asp(D), Glu(E); (4) Basic: Lys(K), Arg(R), His(H). Alternatively, natural residues can be grouped based on common side-chain properties: (1) Hydrophobic: norleucine, Met, Ala, Val, Leu, Ile; (2) Neutral hydrophilic: Cys, Ser, Thr, Asn, Gln; (3) Acidic: Asp, Glu; (4) Basic: His, Lys, Arg; (5) Residues that affect chain orientation: Gly, Pro; (6) Aromatic: Trp, Tyr, Phe. In a conservation permutation, one member of one of these classes is swapped with another. Specific examples of conservation permutations include: Ala to Gly or Ser; Arg to Lys; Asn to Gln or His; Asp to Glu; Cys to Ser; Gln to Asn; Glu to Asp; Gly to Ala or Pro; His to Asn or Gln; Ile to Leu or Val; Leu to Ile or Val; Lys to Arg, Gln, or Glu; Met to Leu, Tyr, or Ile; Phe to Met, Leu, or Tyr; Ser to Thr; Thr to Ser; Trp to Tyr; Tyr to Trp; and / or Phe to Val, Ile, or Leu.
[0363] In some embodiments, the polypeptides described herein (or nucleic acids encoding such polypeptides) may be a functional fragment of one of the amino acid sequences described herein. As used herein, “functional fragment” is a fragment or segment of a peptide that retains at least 50% of the activity of the wild-type reference polypeptide in the assays described below. The functional fragment may include conservative substitutions of the sequences disclosed herein.
[0364] In some embodiments, the polypeptides described herein may be variants of the sequences described herein. In some embodiments, the variants are conserved modified variants. Conservative substitution variants can be obtained, for example, by mutations in the native nucleotide sequence. As used herein, “variant” is a polypeptide that is substantially homologous to the native or reference polypeptide but has a different amino acid sequence from the native or reference polypeptide due to one or more deletions, insertions, or substitutions. The DNA sequences encoding the variant polypeptide include sequences that encode a variant protein or fragment thereof that contains one or more additions, deletions, or substitutions of nucleotides compared to the native or reference DNA sequence, but retains activity. Various PCR-based site-directed mutagenicity approaches are known in the art and can be applied by those skilled in the art.
[0365] A variant amino acid or DNA sequence may be at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to the native or reference sequence. The degree of homology (identity percentage) between a native sequence and a variant sequence can be determined by comparing the two sequences using a free computer program available on the World Wide Web (e.g., BLASTp or BLASTn with default settings), which is commonly used for this purpose.
[0366] Modification of the native amino acid sequence can be achieved by any of several techniques known to those skilled in the art. Mutations can be introduced, for example, by synthesizing an oligonucleotide containing a mutant sequence flanked by restriction sites that allow ligation to a fragment of the native sequence at a specific locus. After ligation, the resulting reconstructed sequence encodes an analog having the desired amino acid insertion, substitution, or deletion. Alternatively, oligonucleotide-directed site-specific mutagenicity procedures can be used to provide a modified nucleotide sequence having specific codons altered according to the required substitution, deletion, or insertion. Techniques for making such modifications are well-established, including, for example, those disclosed by Walder et al. (Gene 42:133, 1986); Bauer et al. (Gene 37:73, 1985); Craik (BioTechniques, January 1985, 12-19); Smith et al. (Genetic Engineering: Principles and Methods, Plenum Press, 1981); and U.S. Patents 4,518,584 and 4,737,462, all of which are incorporated herein by reference. Cysteine residues not involved in maintaining the proper conformation of the polypeptide can also be substituted with serine to improve the oxidative stability of the molecule and avoid abnormal crosslinking. Conversely, cysteine bonds can be added to polypeptides to improve their stability or promote oligomerization.
[0367] As used herein, the terms “nucleic acid” or “nucleic acid sequence” refer to any molecule, preferably a polymer molecule, incorporating units of ribonucleic acid, deoxyribonucleic acid, or analogs thereof. Nucleic acids may be single-stranded or double-stranded. A single-stranded nucleic acid may be one nucleic acid strand of denatured double-stranded DNA. Alternatively, a single-stranded nucleic acid may be a single-stranded nucleic acid that does not originate from any double-stranded DNA. In some aspects of any given context, single-stranded nucleic acids are produced by in vitro transcription after reverse transcription. In some aspects of any given context, single-stranded nucleic acids are produced by exposure to nickel endonucleases. In some aspects of any given context, single-stranded nucleic acids are newly synthesized. In one context, the nucleic acid may be DNA. In another context, the nucleic acid may be RNA. Preferred DNAs include, for example, genomic DNA or cDNA. Preferred RNAs include, for example, mRNA.
[0368] The term "expression" refers to cellular processes involved in the production of RNA and proteins, and, where applicable, secreted proteins, and, where applicable, includes, but is not limited to, transcription, transcript processing, translation, and protein folding, modification, and processing. Expression may refer to the transcription and stable accumulation of sense RNA (mRNA) or antisense RNA derived from one or more nucleic acid fragments of the present invention, and / or translation of mRNA into polypeptides.
[0369] In some embodiments, the expression of biomarkers, targets, or genes / polypeptides described herein is tissue-specific. In some embodiments, the expression of biomarkers, targets, or genes / polypeptides described herein is global. In some embodiments, the expression of biomarkers, targets, or genes / polypeptides described herein is systemic.
[0370] "Expression products" include RNA transcribed from a gene and polypeptides obtained by translation of mRNA transcribed from a gene. The term "gene" refers to a nucleic acid sequence (DNA) that is transcribed into RNA in vitro or in vivo when functionally ligated to an appropriate regulatory sequence. A gene may or may not include regions before or after the coding region, such as the 5' untranslated (5'UTR) or "leader" sequence, and the 3'UTR or "trailer" sequence, as well as intervening sequences (introns) between individual coding segments (exons).
[0371] In the context of this invention, "marker" refers to an expression product, such as a nucleic acid or polypeptide, that is present differently in a sample taken from a test subject compared to a comparative sample taken from a control subject (e.g., a healthy subject). The term "biomarker" is used interchangeably with the term "marker."
[0372] In some aspects, the methods described herein relate to measuring, detecting, or determining the level of at least one target molecule. As used herein, the terms “detection” or “measurement” refer to observing a signal from, for example, a probe, label, or target molecule indicating the presence of an analyte in a sample. Any method known in the art for detecting a particular label portion may be used for detection. Exemplary detection methods include, but are not limited to, spectroscopic, fluorescent, photochemical, biochemical, immunochemical, electrical, optical, or chemical methods. In some aspects of any aspect, the measurement may be a quantitative observation.
[0373] In some aspects of any given aspect, the polypeptides, nucleic acids, or cells described herein may be engineered. As used herein, “engineered” refers to an aspect that has been manipulated by human hands. For example, a polypeptide is considered “engineered” if at least one aspect of the polypeptide, for example, its sequence, has been manipulated by human hands so that it differs from the aspect that exists in nature. As is customary and understood to those skilled in the art, the offspring of an engineered cell are typically still said to be “engineered,” although the actual manipulation was performed on the previous element.
[0374] In some aspects of any given context, the nucleic acids described herein (e.g., oligonucleotide tags, readout molecules) are exogenous. In some aspects of any given context, the nucleic acids described herein (e.g., oligonucleotide tags, readout molecules) are ectopic. In some aspects of any given context, the nucleic acids described herein (e.g., oligonucleotide tags, readout molecules) are not endogenous.
[0375] The term “exogenous” refers to a substance present in a cell that is not of native origin. As used herein, “exogenous” may refer to a nucleic acid (e.g., a nucleic acid encoding a polypeptide) or polypeptide that is not normally found in a biological system such as a cell or organism, and is introduced into such a cell or organism through a human-involved process. Alternatively, “exogenous” may refer to a nucleic acid or polypeptide that is normally found in relatively small amounts in a biological system such as a cell or organism, and is introduced into such a cell or organism through a human-involved process to increase its quantity, for example, to produce ectopic expression or levels. In contrast, the term “endogenous” refers to a substance that is native to a biological system or cell. As used herein, “ectopic” refers to a substance found in an unusual location and / or quantity. An ectopic substance may be a substance normally found in a given cell, but in much smaller quantities and / or at a different time. Ectopic also includes substances such as polypeptides or nucleic acids that are not naturally found or expressed in a given cell in its natural environment.
[0376] In some embodiments, nucleic acids encoding nucleic acids (e.g., oligonucleotide tags, readout molecules) or polypeptides described herein constitute a vector. In some aspects described herein, a nucleic acid sequence encoding a given nucleic acid or polypeptide described herein, or any module thereof, is functionally linked to a vector. The term “vector” as used herein refers to a nucleic acid construct designed for delivery to a host cell or for transfer between different host cells. As used herein, a vector may be viral or nonviral. The term “vector” encompasses any genetic element that, when bound to an appropriate regulatory element, is capable of replication and can transfer a gene sequence into a cell. Examples of vectors include, but are not limited to, cloning vectors, expression vectors, plasmids, phages, transposons, cosmids, chromosomes, viruses, virions, and others.
[0377] In some aspects of any given context, the vector is recombinant and includes, for example, sequences derived from at least two different sources. In some aspects of any given context, the vector includes sequences derived from at least two different species. In some aspects of any given context, the vector includes sequences derived from at least two different genes and includes, for example, a fusion protein or a nucleic acid encoding an expression product functionally linked to at least one non-native (e.g., heterogeneous) gene regulatory element (e.g., promoter, repressor, activator, enhancer, response element, etc.).
[0378] In some aspects of any given context, the vectors or nucleic acids described herein are codon-optimized, for example, the native or wild-type nucleic acid sequence is modified or altered to include alternative codons, and therefore the modified or altered nucleic acid encodes the same polypeptide expression product as the native / wild-type sequence but is transcribed and / or translated with improved efficiency in the desired expression system. In some aspects of any given context, the expression system is an organism (or cells obtained from such an organism) that is not the source of the native / wild-type sequence. In some aspects of any given context, the vectors and / or nucleic acid sequences described herein are codon-optimized for expression in mammals or mammalian cells, e.g., mice, mouse cells, or human cells. In some aspects of any given context, the vectors and / or nucleic acid sequences described herein are codon-optimized for expression in human cells. In some aspects of any given context, the vectors and / or nucleic acid sequences described herein are codon-optimized for expression in yeast or yeast cells. In some aspects of any given context, the vectors and / or nucleic acid sequences described herein are codon-optimized for expression in bacterial cells. In some aspects of any given context, the vectors and / or nucleic acid sequences described herein are codon-optimized for expression in Escherichia coli (E. coli) cells.
[0379] As used herein, the term “expression vector” refers to a vector that directs the expression of RNA or polypeptides from a sequence ligated to a transcriptional regulatory sequence on the vector. The expressed sequence is often heterogeneous to the cell, though not necessarily. An expression vector may include additional elements; for example, an expression vector may have two replication systems, thus enabling maintenance in two organisms, such as being expressed in human cells and cloned and amplified in a prokaryotic host.
[0380] As used herein, the term “viral vector” refers to a nucleic acid vector construct that contains at least one element of viral origin and is tolerable for packaging into a viral vector particle. Viral vectors may contain nucleic acids encoding nucleic acids or polypeptides described herein in place of non-essential viral genes. Vectors and / or particles may be used to transfer any nucleic acid into cells, either in vitro or in vivo. Numerous forms of viral vectors are known in the art.
[0381] It should be understood that the vectors described herein may, in some embodiments, be used in combination with other suitable compositions and therapeutic agents. In some embodiments, the vectors are episomal systems. The use of suitable episomal vectors provides a means of maintaining the nucleotide of interest as high-copy-number extrachromosomal DNA in a subject, thereby eliminating the potential effect of chromosomal integration.
[0382] As used herein, “contact” means any suitable means for delivering or exposing an agent to at least one cell. Examples of delivery methods include, but are not limited to, direct delivery to a cell culture medium, perfusion, injection, or other delivery methods well known to those skilled in the art. In some embodiments, contact includes human physical actions, such as injection; dispensing, mixing, and / or decanting; and / or operation of a delivery device or machine.
[0383] The terms "statistically significant" or "significantly significant" refer to a statistically significant difference, generally meaning a difference of two standard deviations (2SD) or greater.
[0384] Except as in the examples provided or otherwise, all numbers used herein to express quantities of ingredients or reaction conditions should be understood to be modified in any case by the term "approximately." When used in relation to percentages, the term "approximately" may mean ±1%.
[0385] As used herein, the term "comprising" means that other elements may be present in addition to those explicitly stated. The use of "comprising" indicates inclusion, not limitation.
[0386] The term "consisting of" refers to the compositions, methods, and their respective components described herein, excluding any elements not present in the description of their embodiments.
[0387] As used herein, the term "consisting essentially of" refers to elements necessary for a given embodiment. This term allows for the presence of additional elements that do not significantly affect the basic, novel, or functional features of that embodiment of the invention.
[0388] As used herein, the term "corresponding to" refers to an amino acid or nucleotide at a counted position in a first polypeptide or nucleic acid, or an amino acid or nucleotide at a counted position in a second polypeptide or nucleic acid. The corresponding counted amino acid or nucleotide may be determined by alignment of candidate sequences using a homology program known in the art, such as BLAST.
[0389] As used herein, the term “specific binding” refers to a chemical interaction between two molecules, compounds, cells, and / or particles, where the first element binds to a second target element with higher specificity and affinity than it binds to a third, non-target element. In some embodiments, specific binding may refer to an affinity of the first element to the second target element that is at least 10 times, at least 50 times, at least 100 times, at least 500 times, at least 1000 times, or higher than the affinity of the first element to the third, non-target element. A reagent specific to a given target is a reagent that exhibits specific binding to that target under the conditions of the assay being used.
[0390] The singular forms “a,” “an,” and “the” also include the plural unless otherwise specified. Similarly, the term “or” includes “and” unless otherwise specified. Methods and materials similar to or equivalent to those described herein may be used in the practice or testing of this disclosure, but preferred methods and materials are listed below. The abbreviation “eg” (for example) is derived from the Latin “exempli gratia” and is used herein to refer to non-limiting examples. Thus, the abbreviation “eg” is synonymous with the term “for example.”
[0391] The grouping of alternative elements or embodiments of the Invention disclosed herein should not be construed as limiting. Each member of each group may be referred to and claimed individually or in any combination with other members of the group or other elements found therein. One or more members of a group may be included in or excluded from a group for convenience and / or patentability reasons. Where such inclusion or exclusion occurs, the group shall be deemed to be included herein as a modified form and thus satisfy all descriptions of the Markush group used in the appended claims.
[0392] Unless otherwise defined herein, scientific and technical terms used in connection with this application shall have the meanings commonly understood by those skilled in the art in which this disclosure pertains. It should be understood that the present invention is not limited to, and is therefore subject to change, the specific methodologies, protocols, reagents, and other matters described herein. The terminology used herein is for the purpose of describing specific aspects only and does not limit the scope of the present invention, which is defined solely by the claims. Definitions of common terms in immunology and molecular biology are found in: The Merck Manual of Diagnosis and Therapy, 20th Edition, published by Merck Sharp & Dohme Corp., 2018 (ISBN 0911910190, 978-0911910421); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology by Werner Luttmann, published by Elsevier, 2006; Janeway's Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), WWNorton & Company, 2016 (ISBN 0815345054, 978-0815345053); Lewin's Genes XI, published by Jones & Bartlett Publishers, 2014 (ISBN-1449659055); Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012) (ISBN 1936113414); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X); Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542); Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons, 2014 (ISBN 047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E. Coligan (ed.), John Wiley and Sons, Inc., 2005;およびCurrent Protocols in Immunology (CPI) (John E. Coligan, ADA M Kruisbeek, David H Margulies, Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc.This information is contained in the 2003 edition (ISBN 0471142735, 9780471142737), and all of this information is incorporated herein by reference.
[0393] Other terms are defined herein in connection with the descriptions of various aspects of the present invention.
[0394] All patents and other publications, including references, granted patents, patent application gazettes, and concurrently pending patent applications cited throughout this application, are expressly incorporated herein by reference for the purpose of describing and disclosing methodologies disclosed in such publications, which may be used, for example, in connection with the technology described herein. These publications are provided solely because they were disclosed prior to the filing date of this application. In this regard, no interpretation should be made that the inventors consider such disclosures to be ineligible for prior art or for any other reason. All statements regarding the dates or content of these documents are based on information available to the applicants and do not constitute an acknowledgment of the accuracy of the dates or content of these documents.
[0395] The descriptions of the aspects of this disclosure are neither exclusive nor strictly limit the disclosure to any particular form. Specific aspects and examples of the disclosure are described herein for illustrative purposes and, as will be apparent to those skilled in the art, various equivalent modifications are possible within the scope of this disclosure. For example, while the steps or functions of a method are described in a given order, in alternative embodiments the functions may be performed in a different order or substantially simultaneously. The teachings of the disclosure provided herein may be applied to other procedures or methods as appropriate. Further embodiments may be provided by combining the various aspects described herein. Aspects of this disclosure may be modified as necessary to use the above-mentioned references and compositions, functions, and concepts of the application to provide further embodiments of this disclosure. Furthermore, some modifications may be made to the structure of nucleic acids or proteins without affecting the biological or chemical action in kind or quantity, taking into consideration biological functional equivalence. These and other modifications may be made in this disclosure from the standpoint of detailed description. All such modifications shall be within the scope of the appended claims.
[0396] Certain elements of all the embodiments described above can be combined with or replaced by elements of other embodiments. Furthermore, while the advantages of certain embodiments of this disclosure have been described in the context of those embodiments, other embodiments may also exhibit such advantages, and not all embodiments are necessarily required to exhibit such advantages to fall within the scope of this disclosure.
[0397] The technologies described herein are further illustrated by the following examples, but these examples should not be construed as further limitations.
[0398] Some aspects of the technology described herein can be defined by any of the following numbered paragraphs. Section 1. A set of at least two readout molecules, where each readout molecule is as follows: a. A 3'-side barcode hybridized region of a nucleotide or its analogue, comprising a unique sequence distinct from the 3' region sequences of all other readout molecules in the set; b. A 5' non-barcode hybridized region of a nucleotide or its analogue, comprising a sequence identical to the 5' region sequence of all other readout molecules in the set; c. Sulfur modification in place of bridging oxygen of the phosphate skeleton between the 5' region and the 3' region; and d. Optically detectable labels A set that includes this. Section 2. The set described in item 1, where the marker is a fluorescent marker. Section 3. A set of optically detectable labels comprising or further comprising biotin, amines, metals, metal nanoclusters, anchor molecules, quantum dots, or acrydites, according to any one of items 1 to 2. Section 4. A set of labels, one of which is located at the 5' end of the readout molecule, as described in any one of items 1 to 3. Section 5. A set containing four distinguishable markers, as described in any one of items 1 through 4. Section 6. A set of labels described in any one of items 1 to 5, including at least two distinguishable labels. Section 7. A set of labels described in any one of items 1 to 6, including at least three distinguishable labels. Section 8. A set of labels described in any one of items 1 to 7, including at least four distinguishable labels. Section 9. A set according to any one of items 1 to 8, wherein each set containing the first 3' region contains only the first distinguishable label. Section 10. A set according to any one of items 1 to 9, wherein each set of readout molecules containing any selected 3' region contains only the corresponding given distinguishable label. Section 11. A set of any one of items 1 to 10, wherein the 3' region is the length of at least one nucleotide or its analogue. Section 12. A set described in any one of items 1 to 11, wherein the 3' region is the length of five nucleotides or their analogues. Section 13. A set described in any one of items 1 to 12, wherein the 5' region contains only universal nucleotide bases. Section 14. A set described in any one of items 1 to 13, wherein the 5' region contains only deoxyinosine nucleotides. Section 15. A set of any one of items 1 to 14, wherein the 5' region is the length of at least one nucleotide or its analogue. Section 16. A set of nucleotides described in any one of items 1 to 15, wherein the 5' region is the length of three nucleotides or their analogues. Section 17. The set according to any one of items 1 to 16, wherein at least two of the read molecules are DNA or RNA. Section 18. A method for detecting at least one target molecule in a sample, the following: a. A step of contacting the sample with at least one oligonucleotide tag, wherein each oligonucleotide tag is i. A recognition domain that specifically binds to the target molecule to be detected, and ii. A street barcode area containing at least one barcode bit Processes including; b. The step of bringing the sample into contact with the set of readout molecules described in any one of items 1 to 17; and c. A step of detecting the relative order of optically detectable labels hybridized to the at least one oligonucleotide tag, wherein the at least one oligonucleotide tag hybridizes to the at least one target molecule, and the relative order of the optically detectable labels enables identification of which oligonucleotide tag hybridizes to the target molecule at that location. Methods that include... Section 19. The method according to item 18, wherein the barcode area is unique to each oligonucleotide tag. Section 20. The method described in any one of items 18 to 19, wherein the total number of unique barcode bits is less than the total number of possible unique barcode bits. Section 21. The method described in any one of items 18 to 20, wherein the total number of unique barcode bits is less than 10% of the total number of possible unique barcode bits. Section 22. The method described in any one of items 18 to 21, wherein the total number of unique barcode bits is less than 1% of the total number of possible unique barcode bits. Section 23. The method according to any one of paragraphs 18 to 229, wherein the total number of unique barcode bits is at least two unique barcode bits. Section 24. The method described in any one of items 18 to 23, wherein the total number of unique barcode bits is 10 or less. Section 25. The method according to any one of items 18 to 24, wherein the barcode hybridized region is unique to each read molecule. Section 26. The method described in any one of items 18 to 25, wherein the total number of unique barcode hybridize regions used in the set of read molecules is less than the total number of possible unique barcode hybridize regions. Section 27. The method according to any one of items 18 to 26, wherein the total number of unique barcode hybridized regions in the set of read molecules is less than 10% of the total number of possible unique barcode hybridized regions. Section 28. The method according to any one of items 18 to 27, wherein the total number of unique barcode hybridized regions in the set of read molecules is less than 1% of the total number of possible unique barcode hybridized regions. Section 29. The method according to any one of items 18 to 28, wherein the total number of unique barcode hybridized regions in the set of read molecules includes at least two unique barcode hybridized regions. Section 30. The method according to any one of items 18 to 29, wherein the total number of unique barcode hybridized regions in the set of read molecules includes 10 or fewer unique barcode hybridized regions. Section 31. The method according to any one of claims 18 to 30, wherein the street further comprises a primer binding region for annealing of the sequencing primer. Section 32. The method according to any one of items 18 to 31, wherein the detection step is performed by a sequencing method. Section 33. The method according to any one of claims 18 to 32, wherein the sequencing method includes linkage sequencing, synthesis sequencing, hybridization sequencing, and / or sequencing by cyclic reversible polymerization hybridization chain reaction. Section 34. The sequencing by ligation is a method according to any one of items 18 to 33, including enzyme-based ligation. Section 35. A method according to any one of claims 18 to 34, wherein the sequencing by coupling includes chemical coupling, copper coupling, copper-free click reaction, amine-EDC-based coupling, or thiol-maleimide Michael addition. Section 36. The method according to any one of items 18 to 35, wherein the specific hybridization of the read molecule to the street is determined by the identity between the barcode region and the barcode hybridized region. Section 37. The method according to any one of items 18 to 36, wherein the optically detectable label is a fluorophore. Section 38. The method according to any one of items 18 to 37, wherein the detection step is performed by fluorescence microscopy. Section 39. The method according to any one of claims 18 to 38, wherein the optically detectable label further comprises biotin, an amine, a metal, a metal nanocluster, an anchor molecule, a quantum dot, or an acrydite. Section 40. The method according to any one of items 18 to 39, wherein the detection step is performed with at least single-cell resolution. Section 41. A method according to any one of items 18 to 40, wherein at least two target molecules are detected simultaneously. Section 42. A method according to any one of items 18 to 41, wherein at least three target molecules are detected simultaneously. Section 43. A method according to any one of items 18 to 42, wherein at least 10 target molecules are detected simultaneously. Section 44. A method according to any one of items 18 to 43, wherein at least 20 target molecules are detected simultaneously. Section 45. The method according to any one of claims 18 to 44, wherein the target molecule comprises a nucleic acid, polypeptide, cell surface molecule, or inorganic substance. Section 46. The method according to any one of items 18 to 45, wherein the target molecule is DNA or RNA. Section 47. The method according to any one of claims 18 to 46, wherein the target molecule is covalently or noncovalently linked to a nucleic acid, polypeptide, cell surface molecule, or inorganic substance. Section 48. The method according to any one of items 18 to 47, wherein the sample is a cell, cell culture, or tissue sample.
[0399] Some aspects of the technology described herein can be defined by any of the following numbered paragraphs. Section 1. A set of at least two readout molecules, where each readout molecule is as follows: a. A 3'-side barcode hybridized region of a nucleotide or its analogue, comprising a unique sequence distinct from the 3' region sequences of all other readout molecules in the set; b. A 5' non-barcode hybridized region of a nucleotide or its analogue, comprising a sequence identical to the 5' region sequence of all other readout molecules in the set; c. Sulfur modification in place of bridging oxygen of the phosphate skeleton between the 5' region and the 3' region; and d. Optically detectable labels A set that includes this. Section 2. The set described in item 1, where the marker is a fluorescent marker. Section 3. A set of optically detectable labels comprising or further comprising biotin, amines, metals, metal nanoclusters, noble metal nanoparticles, anchor molecules, quantum dots, acrydites, or DNA origami structures, as described in any one of items 1 to 2. Section 4. A set of labels, one of which is located at the 5' end of the readout molecule, as described in any one of items 1 to 3. Section 5. A set containing four distinguishable markers, as described in any one of items 1 through 4. Section 6. A set of labels described in any one of items 1 to 5, including at least two distinguishable labels. Section 7. A set of labels described in any one of items 1 to 6, including at least three distinguishable labels. Section 8. A set of labels described in any one of items 1 to 7, including at least four distinguishable labels. Section 9. A set according to any one of items 1 to 8, wherein each set containing the first 3' region contains only the first distinguishable label. Section 10. A set according to any one of items 1 to 9, wherein each set of readout molecules containing any selected 3' region contains only the corresponding given distinguishable label. Section 11. A set of any one of items 1 to 10, wherein the 3' region is the length of at least one nucleotide or its analogue. Section 12. A set described in any one of items 1 to 11, wherein the 3' region is the length of five nucleotides or their analogues. Section 13. A set described in any one of items 1 to 12, wherein the 5' region contains only universal nucleotide bases. Section 14. A set described in any one of items 1 to 13, wherein the 5' region contains only deoxyinosine nucleotides. Section 15. A set of any one of items 1 to 14, wherein the 5' region is the length of at least one nucleotide or its analogue. Section 16. A set of nucleotides described in any one of items 1 to 15, wherein the 5' region is the length of three nucleotides or their analogues. Section 17. The set according to any one of items 1 to 16, wherein at least two of the read molecules include DNA and / or RNA. Section 18. The set according to any one of items 1 to 17, wherein at least two of the readout molecules consist of DNA and / or RNA, or are essentially composed of DNA and / or RNA. Section 19. The set according to any one of claims 1 to 18, wherein at least two of the readout molecules include polypeptides. Section 20. A set of at least two readout molecules, where each readout molecule is as follows: a. A 3'-side barcode hybridized region of a nucleotide or its analogue, comprising a unique sequence distinct from the 3' region sequences of all other readout molecules in the set; b. The 5' non-barcode hybridized region of a nucleotide or its analogue; and c. Sulfur modification instead of cross-linking oxygen of the phosphate skeleton between the 5' region and the 3' region. A set that includes this. Section 21. The set according to item 20, wherein the 5' non-barcode hybridization region of at least one readout molecule specifically hybridizes with an oligonucleotide. Section 22. A set of oligonucleotides according to any one of claims 20 to 21, wherein each oligonucleotide includes at least one detectable label. Section 23. A set according to any one of claims 20 to 22, wherein an oligonucleotide specifically hybridizes with at least one other oligonucleotide. Section 24. A set of oligonucleotides, each of which is an amplification primer, as described in any one of items 20-23. Section 25. A set of sequencing primers as described in any one of items 20-24, wherein the oligonucleotide is the sequencing primer. Section 26. A set of oligonucleotides, as described in any one of items 20-25, which are imager chains for super-resolution microscopy. Section 27. A set according to any one of items 20-26, wherein the 5' non-barcode hybridized region of at least one readout molecule is at least 5 nucleotides long. Section 28. A set according to any one of items 20-27, wherein the 5' non-barcode hybridized region of at least one readout molecule is at least 10 nucleotides long. Section 29. A set according to any one of items 20 to 28, wherein the 5' non-barcode hybridized region contains the same sequence as the 5' region sequence of all other readout molecules in the set. Section 30. A set according to any one of items 20 to 29, wherein at least one readout molecule includes an optically detectable label. Section 31. A set according to any one of items 20-30, wherein at least one readout molecule is labeled with a fluorescent label. Section 32. A set of optically detectable labels comprising or further comprising fluorophores, biotin, amines, metals, metal nanoclusters, noble metal nanoparticles, anchor molecules, quantum dots, acrydites, or DNA origami structures, as described in any one of items 20 to 31. Section 33. The readout molecule is as follows: a. A 3' barcode hybridized region of a nucleotide or its analogue, which contains a unique sequence distinct from the 3' region sequences of all other readout molecules in the set of readout molecules; b. A 5' non-barcode hybridized region of a nucleotide or its analogue, comprising a sequence identical to the 5' region sequence of all other readout molecules in the set; c. Sulfur modification in place of the bridging oxygen of the phosphate skeleton between the 5' region and the 3' region; d. Optically detectable labels; and e. Nanoparticles A readout molecule that includes this molecule. Section 34. The readout molecule is as follows: a. A 3' barcode hybridized region of a nucleotide or its analogue, which contains a unique sequence distinct from the 3' region sequences of all other readout molecules in the set of readout molecules; b. A 5' non-barcode hybridized region of a nucleotide or its analogue, comprising a sequence identical to the 5' region sequence of all other readout molecules in the set; c. Sulfur modification in place of bridging oxygen of the phosphate skeleton between the 5' region and the 3' region; and d. Metal nanoparticles A readout molecule that includes this molecule. Section 35. The readout molecule is as follows: a. The 3' barcode hybridized region of a nucleotide or its analogue; b. The 5' non-barcode hybridized region of a nucleotide or its analogue; c. Sulfur modification in place of bridging oxygen of the phosphate skeleton between the 5' region and the 3' region; and d. Metal nanoparticles A readout molecule that includes this molecule. Section 36. A readout molecule according to either item 34 or 35, further comprising an optically detectable label. Section 37. A set of at least two readout molecules, where each readout molecule is as follows: a. A 3'-side barcode hybridized region of a nucleotide or its analogue, comprising a unique sequence distinct from the 3' region sequences of all other readout molecules in the set; b. A 5' non-barcode hybridized region of a nucleotide or its analogue, comprising a sequence identical to the 5' region sequence of all other readout molecules in the set; c. Sulfur modification in place of bridging oxygen of the phosphate skeleton between the 5' region and the 3' region; and d. Optically detectable labels Includes, A set containing at least one readout molecule, further comprising nanoparticles. Section 38. A set of at least two readout molecules, where each readout molecule is as follows: a. A 3'-side barcode hybridized region of a nucleotide or its analogue, comprising a unique sequence distinct from the 3' region sequences of all other readout molecules in the set; b. A 5' non-barcode hybridized region of a nucleotide or its analogue, which includes a sequence identical to the 5' region sequence of all other readout molecules in the set; and c. Sulfur modification in place of the bridging oxygen of the phosphate skeleton between the 5' region and the 3' region; Includes, A set containing at least one readout molecule, further comprising nanoparticles. Section 39. The set according to item 38, wherein at least one readout molecule further comprises an optically detectable label. Section 40. A readout molecule or set thereof according to any one of items 33 to 39, wherein the optically detectable label includes a fluorophore. Section 41. A readout molecule or set thereof according to any one of claims 33 to 40, wherein nanoparticles are linked to at least two readout molecules of the set. Section 42. A set of readout molecules or any set thereof according to any one of items 33 to 41, wherein the nanoparticles include metal nanoparticles. Section 43. A readout molecule or set thereof according to any one of items 33 to 42, wherein the metal nanoparticles are selected from the group consisting of Au, Ag, Ni, Co, Pt, Pd, Cu, Ti, and Al nanoparticles. Section 44. A set of readout molecules or any set thereof according to any one of items 33 to 43, comprising gold nanoparticles. Section 45. A set of readout molecules or any set thereof according to any one of items 33 to 44, comprising a gold nanorod. Section 46. A set of readout molecules or the same as those described in any one of items 33 to 45, wherein the nanoparticles have a diameter of approximately 1.2 nm. Section 47. A set of readout molecules or nanoparticles having a diameter of approximately 3 nm, as described in any one of items 33 to 46. Section 48. A set of readout molecules or nanoparticles having a diameter of approximately 5 nm, as described in any one of items 33 to 47. Section 49. A set of readout molecules or nanoparticles having a diameter of approximately 10 nm, as described in any one of items 33 to 48. Section 50. A set of readout molecules or nanoparticles having a diameter of approximately 30 nm, as described in any one of items 33 to 49. Section 51. A set of readout molecules or nanoparticles having a diameter of approximately 50 nm, as described in any one of items 33 to 50. Section 52. A set of readout molecules or any of the readout molecules described in any one of items 33 to 51, wherein the nanoparticle is located at the 3' end of the readout molecule. Section 53. A set of readout molecules or the same as those described in any one of items 33 to 52, wherein the nanoparticles are located at least 20 nucleotides from a detectable label. Section 54. A set of readout molecules or the set thereof according to any one of items 33 to 53, wherein the nanoparticles are located at least 30 nucleotides from a detectable label. Section 55. a. Detection of at least one target molecule; b. Signal amplification; c. Branching reaction; d. Hybridization chain reaction (HCR); e. Signal amplification by exchange reaction (SABER); f. Rolling circle amplification (RCA); g. In-situ sequencing; h. Matrix adhesion; or i. Super-resolution microscopy Use of any readout molecule or set thereof as described in any one of items 1 to 54. Section 56. A method for detecting at least one target molecule in a sample, the following: a. A step of contacting the sample with at least one oligonucleotide tag, wherein each oligonucleotide tag is i. A recognition domain that specifically binds to the target molecule to be detected, and ii. A street barcode area containing at least one barcode bit Processes including; b. The step of bringing the sample into contact with the set of readout molecules described in any one of items 1 to 54; and c. A step of detecting the relative order of optically detectable labels hybridized to the at least one oligonucleotide tag, wherein the at least one oligonucleotide tag hybridizes to the at least one target molecule, and the relative order of the optically detectable labels enables identification of which oligonucleotide tag hybridizes to the target molecule at that location. Methods that include... Section 57. The method according to paragraph 56, wherein the barcode area is unique to each oligonucleotide tag. Section 58. The method described in any one of paragraphs 56 to 57, wherein the total number of unique barcode bits is less than the total number of possible unique barcode bits. Section 59. The method described in any one of paragraphs 56 to 58, wherein the total number of unique barcode bits is less than 10% of the total number of possible unique barcode bits. Section 60. The method described in any one of paragraphs 56 to 59, wherein the total number of unique barcode bits is less than 1% of the total number of possible unique barcode bits. Section 61. The method according to any one of paragraphs 56 to 60, wherein the total number of unique barcode bits is at least two unique barcode bits. Section 62. The method described in any one of items 56 to 61, wherein the total number of unique barcode bits is 10 or less. Section 63. The method according to any one of items 56 to 62, wherein the barcode hybridized region is unique to each read molecule. Section 64. The method described in any one of items 56 to 63, wherein the total number of unique barcode hybridize regions used in the set of readout molecules is less than the total number of possible unique barcode hybridize regions. Section 65. The method according to any one of items 56 to 64, wherein the total number of unique barcode hybridized regions in the set of read molecules is less than 10% of the total number of possible unique barcode hybridized regions. Section 66. The method according to any one of items 56 to 65, wherein the total number of unique barcode hybridized regions in the set of read molecules is less than 1% of the total number of possible unique barcode hybridized regions. Section 67. The method according to any one of items 56 to 66, wherein the total number of unique barcode hybridized regions in the set of read molecules includes at least two unique barcode hybridized regions. Section 68. The method according to any one of items 56 to 67, wherein the total number of unique barcode hybridized regions in the set of read molecules includes 10 or fewer unique barcode hybridized regions. Section 69. The method according to any one of claims 56 to 68, wherein the street further comprises a primer binding region for annealing of the sequencing primer. Section 70. The method according to any one of items 56 to 69, wherein the detection step is performed by a sequencing method. Section 71. The method according to any one of claims 56 to 70, wherein the sequencing method includes linkage sequencing, synthesis sequencing, hybridization sequencing, and / or sequencing by cyclic reversible polymerization hybridization chain reaction. Section 72. The sequencing by ligation is a method according to any one of items 56 to 71, including enzyme-based ligation. Section 73. A method according to any one of claims 56 to 72, wherein the sequencing by coupling includes chemical coupling, copper coupling, copper-free click reaction, amine-EDC-based coupling, or thiol-maleimide Michael addition. Section 74. The method according to any one of items 56 to 73, wherein the specific hybridization of the read molecule to the street is determined by the identity between the barcode region and the barcode hybridized region. Section 75. The method according to any one of claims 56 to 74, wherein the optically detectable label is a fluorophore. Section 76. The method according to any one of items 56 to 75, wherein the detection step is performed by fluorescence microscopy. Section 77. The method according to any one of claims 56 to 76, wherein the optically detectable label further comprises biotin, amine, metal, metal nanocluster, noble metal nanoparticle, anchor molecule, quantum dot, acrydite, or DNA origami structure. Section 78. The method according to any one of claims 56 to 77, wherein the detection step is performed with at least single-cell resolution. Section 79. The method according to any one of claims 56 to 78, wherein the detection step is performed with at least single-nuclear resolution. Section 80. A method according to any one of items 56 to 79, wherein at least two target molecules are detected simultaneously. Section 81. A method according to any one of items 56 to 80, wherein at least three target molecules are detected simultaneously. Section 82. A method according to any one of items 56 to 81, wherein at least 10 target molecules are detected simultaneously. Section 83. A method according to any one of items 56 to 82, wherein at least 20 target molecules are detected simultaneously. Section 84. The method according to any one of claims 56 to 83, wherein the target molecule comprises a nucleic acid, polypeptide, cell surface molecule, or inorganic substance. Section 85. The method according to any one of items 56 to 84, wherein the target molecule comprises DNA and / or RNA. Section 86. The method according to any one of claims 56 to 85, wherein the target molecule comprises a polypeptide. Section 87. The method according to any one of claims 56 to 86, wherein the target molecule is covalently or acovalently linked to a nucleic acid, polypeptide, cell surface molecule, or inorganic substance. Section 88. The method according to any one of items 56 to 87, wherein the sample is a cell, cell culture, or tissue sample. Section 89. The method according to any one of items 56 to 88, wherein the sample contains an organoid. Section 90. An enhanced method for detecting at least one target molecule in a sample, the following: a. A step of contacting the sample with at least one oligonucleotide tag, wherein each oligonucleotide tag is i. A recognition domain that specifically binds to the target molecule to be detected, and ii. A street barcode area containing at least one barcode bit Processes including; b. The step of bringing the sample into contact with the readout molecule or set described in any one of items 1 to 54; and c. A step of detecting the relative order of optically detectable labels hybridized to the at least one oligonucleotide tag, wherein the at le...
Claims
1. A set of at least two readout molecules for intracellular use, each readout molecule being: a. A 3' barcode hybridize region of a nucleotide or its analogue, comprising a unique sequence distinct from the 3' barcode hybridize regions of all other readout molecules in the set; b. A 5' non-barcode hybridized region of a nucleotide or its analogue, comprising the same sequence as the 5' non-barcode hybridized region of all other readout molecules in the set; c. Sulfur modification in place of cross-linking oxygen of the phosphate skeleton between the 5'-side non-barcode hybridized region and the 3'-side barcode hybridized region; and d. Optically detectable labels A set that includes this.
2. Optically detectable markers, (i) It is a fluorescent label; (ii) comprising biotin, amines, metals, metal nanoclusters, precious metal nanoparticles, anchor molecules, quantum dots, acrydites, or DNA origami structures; and / or (iii) Located at the 5' end of the readout molecule, The set according to claim 1.
3. The set according to claim 1 is as follows: (i) The optically detectable marker of the set includes four distinguishable markers; and / or (ii) The optically detectable markers of the set include at least two distinguishable markers, at least three distinguishable markers, or at least four distinguishable markers; Here, each distinguishable mark corresponds to at least one 3'-side barcode hybridized region of the set, while the other distinguishable marks do not correspond to the 3'-side barcode hybridized region.
4. The set according to claim 1 or 2 is as follows: (i) The 3' barcode hybridized region is the length of at least one nucleotide or its analogue, or the length of five nucleotides or their analogues; (ii) The 5' non-barcode hybridized region contains only universal nucleotide bases or only deoxyinosine nucleotides; (iii) The 5' non-barcode hybridized region is the length of at least one nucleotide or its analogue, or the length of at least three nucleotides or their analogues; (iv) The at least two readout molecules include DNA and / or RNA, or the at least two readout molecules consist of DNA and / or RNA; and / or (v) The at least two readout molecules comprise polypeptides.
5. A set of at least two readout molecules for intracellular use, each readout molecule being: a. A 3' barcode hybridize region of a nucleotide or its analogue, comprising a unique sequence distinct from the 3' barcode hybridize regions of all other readout molecules in the set; b. The 5' non-barcode hybridized region of a nucleotide or its analogue; c. Sulfur modification in place of the cross-linking oxygen of the phosphate skeleton between the 5'-side non-barcode hybridized region and the 3'-side barcode hybridized region; and d. At least one detectable marker A set that includes this.
6. At least one non-barcode hybridized region on the 5' side of the readout molecule, (i) Specifically hybridizes with oligonucleotides; (ii) at least 5 nucleotides long, or at least 10 nucleotides long; and / or (iii) Having the same sequence as the 5' non-barcode hybridized region of all other readout molecules in the set, Here, the nucleotide is Includes at least one detectable marker; It specifically hybridizes with at least one other signal-amplifying oligonucleotide through a branching reaction; and / or Amplified primers, sequencing primers, or imager chains for super-resolution microscopy, The set according to claim 5.
7. The set according to claim 5 or 6, wherein at least one readout molecule includes an optically detectable label.
8. The set according to claim 7, wherein the optically detectable label of at least one readout molecule is a fluorescent label, and / or the optically detectable label comprises a fluorophore, biotin, amine, metal, metal nanocluster, noble metal nanoparticle, anchor molecule, quantum dot, acrydite, or DNA origami structure.
9. Readout molecules for intracellular use, including: a. A 3' barcode hybridize region of a nucleotide or its analogue, comprising a unique sequence distinct from the 3' barcode hybridize regions of all other readout molecules in the set of readout molecules; b. A 5' non-barcode hybridized region of a nucleotide or its analogue, comprising the same sequence as the 5' non-barcode hybridized region of all other readout molecules in the set; c. Sulfur modification in place of cross-linking oxygen of the phosphate skeleton between the 5'-side non-barcode hybridized region and the 3'-side barcode hybridized region; d. Optically detectable labels; and e. Nanoparticles A readout molecule that includes this molecule.
10. Readout molecules for intracellular use, including: a. A 3' barcode hybridize region of a nucleotide or its analogue, comprising a unique sequence distinct from the 3' barcode hybridize regions of all other readout molecules in the set of readout molecules; b. A 5' non-barcode hybridized region of a nucleotide or its analogue, comprising the same sequence as the 5' non-barcode hybridized region of all other readout molecules in the set; c. Sulfur modification in place of cross-linking oxygen of the phosphate skeleton between the 5'-side non-barcode hybridized region and the 3'-side barcode hybridized region; d. At least one detectable label; and e. Nanoparticles A readout molecule that includes this molecule.
11. A set of at least two readout molecules according to claim 9 or 10 for intracellular use.
12. The set according to claim 11, wherein at least one readout molecule includes an optically detectable label.
13. The readout molecule or set thereof according to claim 9 or 12, wherein the optically detectable label comprises a fluorophore.
14. Nanoparticles (i) They are metal nanoparticles; (ii) Metal nanoparticles selected from the group consisting of Au, Ag, Ni, Co, Pt, Pd, Cu, Ti, and Al nanoparticles; (iii) gold nanoparticles; (iv) Having a diameter of 1.2 nm, 3 nm, 5 nm, 10 nm, 30 nm, or 50 nm; (v) located at the 3' end of the readout molecule; and / or (vi) at a location at least 20 nucleotides away from an optically detectable label, or at least 30 nucleotides away from an optically detectable label, The readout molecule or set thereof according to claim 9, 12, or 13.
15. a. Detection of at least one target molecule; b. Signal amplification using the oligonucleotide of claim 6; c. A branched reaction using the oligonucleotide of claim 6; d. A hybridization chain reaction (HCR) using the oligonucleotide of claim 6; e. Signal amplification by exchange reaction (SABER) using the oligonucleotide of claim 6; f. Rolling circle amplification (RCA) using the oligonucleotide of claim 6; g. In-situ sequencing using the oligonucleotide of claim 6; h. Matrix attachment using the oligonucleotide of claim 6; or i. Super-resolution microscopy For this purpose, use of a set of readout molecules according to any one of claims 1 to 8, or use of a set of readout molecules or the set thereof according to any one of claims 9 to 14.
16. A method for detecting at least one target molecule in cells in a sample, the following: a. A step of contacting the sample with a plurality of oligonucleotide tags, wherein each oligonucleotide tag i. A recognition domain that specifically binds to the target molecule to be detected, and ii. A street barcode area containing at least one barcode bit Processes including; b. The step of bringing the sample into contact with the set of readout molecules described in any one of claims 1 to 8; and c. A step of detecting the relative order of optically detectable labels of two or more readout molecules of the set that have hybridized to at least one of the plurality of oligonucleotide tags, wherein the at least one oligonucleotide tag has hybridized to at least one target molecule, and the relative order of the optically detectable labels allows for the identification of which oligonucleotide tag has hybridized to the target molecule at that location. Methods that include...
17. The method according to claim 16, wherein the barcode area is unique to each oligonucleotide tag, and / or the barcode areas of the plurality of oligonucleotide tags include a total number of unique barcode bits: (i) Less than the total number of possible unique barcode bits, less than 10% of the total number of possible unique barcode bits, or less than 1% of the total number of possible unique barcode bits; (ii) at least two unique barcode bits; and / or (iii) The barcode bits are 10 or less.
18. The method according to claim 16 or 17, wherein the 3' side barcode hybridize region is unique to each read molecule, and / or the set of read molecules comprises a total number of unique 3' side barcode hybridize regions: (i) Less than the total number of possible unique 3' side barcode hybridization regions, less than 10% of the total number of possible unique 3' side barcode hybridization regions, or less than 1% of the total number of possible unique 3' side barcode hybridization regions; (ii) comprising at least two unique 3' side barcode hybridized regions; and / or (iii) Includes a unique 3' side barcode hybridization region of 10 or less.
19. The method according to any one of claims 16 to 18 is as follows: (i) The street further includes a primer binding region for annealing of the sequencing primer; (ii) The detection process is carried out by sequencing; (iii) The sequencing method includes sequencing by linkage, sequencing by synthesis, sequencing by hybridization, and / or sequencing by cyclic reversible polymerization hybridization chain reaction; (iv) Sequencing by coupling includes enzyme-based coupling, chemical coupling, copper coupling, copper-free click reaction, amine-EDC-based coupling, or thiol-maleimide Michael addition; and / or (v) The specific hybridization of the read molecule to the street is determined by the identity between the barcode region and the barcode hybridized region.
20. The method according to any one of claims 16 to 18 is as follows: (i) The optically detectable label is a fluorophore; (ii) The detection process is carried out by fluorescence microscopy; (iii) The optically detectable label further comprises biotin, amines, metals, metal nanoclusters, precious metal nanoparticles, anchor molecules, quantum dots, acrydites, or DNA origami structures. (iv) The detection step is performed with at least single-cell resolution or at least mononuclear resolution; and / or (v) At least two target molecules, at least three target molecules, at least ten target molecules, or at least twenty target molecules are detected simultaneously.
21. The method according to any one of claims 16 to 20 is as follows: (i) The target molecule includes nucleic acids, polypeptides, cell surface molecules, or inorganic substances; (ii) The target molecule is covalently or noncovalently linked to a nucleic acid, polypeptide, cell surface molecule, or inorganic substance; optionally, the cell surface molecule includes a transmembrane protein or transmembrane receptor; (iii) The sample is a cell, cell culture, or tissue sample; and / or (iv) The sample contains organoids.
22. An enhanced method for detecting at least one target molecule in cells in a sample, the following: a. A step of contacting the sample with a plurality of oligonucleotide tags, wherein each oligonucleotide tag i. A recognition domain that specifically binds to the target molecule to be detected, and ii. A street barcode area containing at least one barcode bit Processes including; b. The step of bringing the sample into contact with the set of readout molecules described in any one of claims 11 to 14; and c. A step of detecting the relative order of optically detectable labels of two or more readout molecules of the set that have hybridized to at least one of the plurality of oligonucleotide tags, wherein the at least one oligonucleotide tag has hybridized to at least one target molecule, and the relative order of the optically detectable labels allows for the identification of which oligonucleotide tag has hybridized to the target molecule at that location. Methods that include...
23. The method according to claim 22, wherein the signal of an optically detectable label of at least one readout molecule containing nanoparticles is increased by at least 1.5 times, at least 3 times, at least 10 times, or at least 50 times compared to the signal of an optically detectable label of the same readout molecule without nanoparticles.
24. The method according to claim 22 or 23, wherein an optically detectable label is detected using electron microscopy, fluorescence microscopy, dark-field microscopy, or any combination thereof.
25. A method for analyzing the karyotype of cells in a biological sample, the following: a. A step of contacting the sample with a plurality of oligonucleotide tags specific to at least one chromosome, wherein each oligonucleotide tag is i. A recognition domain that specifically binds to the target molecule to be detected, and ii. A street barcode area containing at least one barcode bit Processes including; b. The step of bringing the sample into contact with the set of readout molecules described in any one of claims 1 to 8 or 11 to 14; c. A step of detecting the relative order of optically detectable labels of two or more readout molecules of the set that have hybridized to at least one of the plurality of oligonucleotide tags, wherein the at least one oligonucleotide tag has hybridized to at least one target molecule, and the relative order of the optically detectable labels enables identification of which oligonucleotide tag has hybridized to the target molecule at that location; and d. A step of determining the identity of at least one chromosome according to the identity of the at least one oligonucleotide tag specific to the at least one chromosome. Methods that include...
26. The sample, (i) at least one oligonucleotide tag specific to the p arm of at least one chromosome; (ii) at least one oligonucleotide tag specific to the q arm of at least one chromosome; (iii) at least one oligonucleotide tag specific to the p arm of at least one chromosome, and at least one oligonucleotide tag specific to the q arm of at least one chromosome; (iv) at least two oligonucleotide tags specific to the p arm or q arm of at least one chromosome, or at least three oligonucleotide tags specific to the p arm or q arm of at least one chromosome; and / or (v) at most 6 oligonucleotide tags specific to each chromosome arm, at most 10 oligonucleotide tags specific to each chromosome arm, or at most 20 oligonucleotide tags specific to each chromosome arm The method according to claim 25, which involves bringing into contact with the following.
27. A method for generating a high-resolution image of at least one target molecule in cells in a sample, the following: a. The step of imaging the at least one target molecule using a high-resolution imaging method for at least one round; and b. A step of determining the identity of the at least one imaged target molecule, the following: i. A step in which the sample is brought into contact with a plurality of oligonucleotide tags, wherein each oligonucleotide tag is A. A recognition domain that specifically binds to the target molecule to be detected, and B. A street barcode area containing at least one barcode bit. Stages, including; ii. The step of bringing the sample into contact with the set of readout molecules described in any one of claims 1 to 9 or 12 to 15; and iii. A step of detecting the relative order of optically detectable labels of two or more readout molecules of the set that have hybridized to at least one of the plurality of oligonucleotide tags, wherein the at least one oligonucleotide tag has hybridized to at least one target molecule, and the relative order of the optically detectable labels allows for the identification of which oligonucleotide tag has hybridized to the target molecule at that location. Process Methods that include...
28. The method according to claim 27 is as follows: (i) The method includes imaging at least 2 target molecules, at least 12 target molecules, at least 66 target molecules, at least 258 target molecules, at least 500 target molecules, and at least 5000 target molecules; (ii) All target molecules are imaged at once, or at least half of the target molecules are imaged at once; (iii) The method includes at least two rounds of high-resolution imaging, at least three rounds of high-resolution imaging, at least five rounds of high-resolution imaging, or at least 20 rounds of high-resolution imaging; (iv) High-resolution imaging techniques are selected from the group consisting of oligo-stochastic optical reconstruction microscopy (OligoSTORM); structured illumination microscopy (SIM); stimulated release suppression (STED) microscopy; and point accumulation of oligo DNA at nanoscale topology (DNA-PAINT); (v) The step of detecting the relative order of optically detectable labels of two or more readout molecules of the set hybridized to at least one of the plurality of oligonucleotide tags includes contacting the sample with the set of readout molecules for at least two rounds, contacting the sample with the set of readout molecules for at least three rounds, contacting the sample with the set of readout molecules for at least five rounds, contacting the sample with the set of readout molecules for at least ten rounds, or contacting the sample with the set of readout molecules for at least twenty rounds; (vi) The at least one target molecule comprises a 1 kb nucleic acid, a 15 kb nucleic acid, a 50 kb nucleic acid, a 100 kb nucleic acid, and / or a 1 Mb nucleic acid; and / or (vii) The at least one target molecule includes a chromosome or genome.
Citation Information
Patent Citations
Functionalized solid support
WO2019084058A2