Method for producing proteins having a supramolecular structure containing physiologically active substances
The use of a flow micromixer and controlled pH conditions in the reassociation of ferritin subunits addresses the inefficiencies in encapsulating nucleic acid drugs, enhancing yield and reducing misaggregation in ferritin aggregates.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- AJINOMOTO CO INC
- Filing Date
- 2022-03-07
- Publication Date
- 2026-07-06
AI Technical Summary
Existing methods for encapsulating nucleic acid drugs like siRNA and DNA in ferritin aggregates face challenges due to their inability to efficiently enter the aggregate, leading to aggregation and reduced yield, which increases costs.
A method utilizing a flow micromixer (FMM) to reassociate ferritin subunits with physiologically active substances, controlling pH and solvent conditions to suppress misaggregation, and optimizing flow rates for efficient encapsulation.
The method achieves high yield and reduced misaggregation of ferritin encapsulating physiologically active substances, such as siRNA and DNA, by shortening exposure time and improving mixing efficiency.
Smart Images

Figure 0007884715000013 
Figure 0007884715000014 
Figure 0007884715000015
Abstract
Description
Technical Field
[0001] The present invention relates to a method for producing a protein having a supramolecular structure encapsulating a bioactive substance.
Background Art
[0002] Ferritin is a spherical protein in which 24 subunits composed of a single polypeptide chain self-organize and associate by non-covalent bonds. The outer diameter is about 12 nm, and it has a cavity of about 7 nm at the center. It is known that a protein having a supramolecular structure typified by ferritin can contain a drug in its internal cavity. A method for encapsulating a low-molecular drug in ferritin is disclosed in Non-Patent Document 1, for example, a method of adjusting the dissociation and reassociation of ferritin by changing the pH of the solution. Furthermore, a simple method of using a buffer solution having an appropriate pH according to the acid dissociation constant (pKa) of an organic compound within a pH range that does not destroy the ferritin structure has been proposed as a method for encapsulating the organic compound in ferritin.
Prior Art Documents
Patent Documents
[0003]
Patent Document 1
Non-Patent Documents
[0004]
Non-Patent Document 1
Summary of the Invention
Problems to be Solved by the Invention
[0005] The method described in Patent Document 1 involves small molecules actively entering through gaps in the aggregate, thus limiting the size of molecules that can be placed inside the aggregate. Nucleic acid drugs such as siRNA and DNA, which have attracted attention in recent years, cannot be placed through gaps in the aggregate. Therefore, a process is required in which ferritin is deassociated, mixed with the drug, and then reassociated. However, during reassociation, ferritin may aggregate, potentially degrading the quality of the drug. Aggregation leads to a decrease in yield, which in turn increases costs. Therefore, the object of the present invention is to provide a novel method for producing proteins having a supramolecular structure that encapsulates physiologically active substances. [Means for solving the problem]
[0006] As a result of diligent research by the inventors, it was found that reassociating ferritin using a flow micromixer ("FMM") suppresses the generation of misaggregates, and as a result, ferritin containing physiologically active substances can be obtained in a higher yield than by the batch method. The present invention is based on this finding. That is, the present invention provides the following manufacturing method. 1. A method for producing a protein having a supramolecular structure containing a physiologically active substance, (I) The process involves contacting a protein subunit constituting a supramolecular structure, a physiologically active substance, and a solution for forming a protein having a supramolecular structure from the subunit in a flow micromixer. The aforementioned manufacturing method. 2. The method for producing a protein having a supramolecular structure, wherein the protein is ferritin, as described in paragraph 1 above. 3. The manufacturing method according to 1 or 2, wherein in step (I), the sum of the flow rate of the subunit and the flow rate of the solution is approximately 10 mL / min or more. 4. The method for producing the subunit according to any one of 1 to 3 above, wherein the subunit is obtained by changing the pH of a solution containing a protein having a (II-1) supramolecular structure to acidic or basic. 5. The manufacturing method according to item 4, wherein the solution used in step (II-1) is a solution with a pH of approximately 1.5 to approximately 3.0 or a pH of approximately 10 to 12. 6. The manufacturing method according to any one of 1 to 5 above, wherein the solution used in step (I) to form a protein having a supramolecular structure is a solution with a pH of approximately 5.0 to approximately 9.0. 7. The method for producing the subunit according to any one of 1 to 3 above, wherein the subunit is obtained by adding a solvent to a solution containing a protein having a (II-2) supramolecular structure. 8. The manufacturing method according to item 7, wherein the solvent used in step (II-2) is selected from the group consisting of dimethyl sulfoxide (DMSO), N,N-dimethylformamide (DMF), acetonitrile, and ethanol. 9. The manufacturing method according to 7 or 8, wherein the solution used in step (I) is selected from the group consisting of Tris buffer, HEPES buffer, phosphate buffer, borate buffer, citrate buffer, carbonate buffer, and glycine buffer. 10. The manufacturing method according to any one of 4 to 9 above, wherein step (II-1) or (II-2) is performed using a flow micromixer. 11. The method for producing the physiologically active substance according to any one of the above 1 to 10, wherein the physiologically active substance is selected from the group consisting of siRNA, DNA, oligopeptides, or combinations thereof, having a mass-average molecular weight of approximately 1,000 to approximately 20,000. [Effects of the Invention]
[0007] According to the present invention, the generation of misaggregates can be suppressed. Furthermore, according to the present invention, the exposure time of the physiologically active substance to the acid, base, or solvent used for deassociation can be shortened, thereby suppressing the denaturation and degradation of the physiologically active substance. As a result, according to the present invention, proteins having a supramolecular structure containing the physiologically active substance can be obtained in high yield. [Brief explanation of the drawing]
[0008] [Figure 1]Figure 1 is a graph showing the mis-aggregate ratio when ferritin is dissociated and reassociated using the batch method. [Figure 2] Figure 2 is a graph showing the ratio of misaggregates to the total flow rate during reassociation when ferritin is deassociated and reassociated using FMM. The legend indicates the ferritin concentration of the deassociated solution. [Figure 3] Figure 3 is a graph showing the aggregate ratio when deassociation-reassociation is performed in batch-batch, FMM-batch, batch-FMM, and FMM-FMM combinations. [Modes for carrying out the invention]
[0009] 1.Definition The terms used in this specification are defined as follows: A "supramolecule" is an aggregate with a higher-order structure formed by the molecular association of multiple molecules or ions through non-covalent interactions (for example, self-assembly). "Deassociation" refers to the process of dissociating a protein, which has a supramolecular structure, into its individual subunits. "Reassociation" refers to the process of causing a disassociated protein to re-establish a supramolecular structure. "pH" refers to the value measured using a glass electrode at 25°C. To explain "mis-associated proteins" using ferritin as an example, a properly associated ferritin is an aggregate of 24 subunits. However, "mis-associated proteins" are a general term for proteins in which the 24 subunits do not form an aggregate, such as aggregates where two 24-unit groups are linked via divalent metal ions, aggregates with fewer than 24 subunits, aggregates with more than 24 subunits, or clumps of protein that have aggregated without being able to associate properly.
[0010] 2. Manufacturing method of the present invention This invention provides a method for producing a supramolecular protein by associating subunits of a protein with a supramolecular structure in a FMM in the presence of a physiologically active substance, thereby encapsulating the physiologically active substance in the cavity at its center. The step of obtaining the physiologically active substance-containing aggregate from the subunits, i.e., the reassociation step, is referred to as step (I). FMM is generally a device for mixing two or more liquids in a space of several tens to several hundreds of microns. The FMM used in the method of the present invention is of a continuous flow type. The FMM used in the present invention has, for example, a first flow path through which the subunits flow, a second flow path through which the physiologically active substance flows, and a third flow path through which a solution ( "reassociation solution") for forming an aggregate from the subunits flows, and includes a place where the subunits, the physiologically active substance, and the solution meet and are mixed. The subunit stream and the physiologically active substance stream may be premixed, and then the reassociation solution stream may be merged and mixed there, or the subunit stream, the physiologically active substance stream, and the solution stream may be simultaneously merged and mixed at the mixing place. When the physiologically active substance to be encapsulated is weak against the acid, base, or solvent used for dissociation, the latter is preferable because it can shorten the time for the physiologically active substance to come into contact with the acid or the like.
[0011] 〔Reassociation〕 The means for reassociating the protein having a supramolecular structure from the subunits is not particularly limited. For example, it can be carried out by adjusting the pH of the mixed stream of the subunit stream and the physiologically active substance stream to neutral, for example, about 5 to about 9. This step is suitable when dissociation is carried out by the step (II-1) described later. The pH adjustment in step (I-1) can be carried out by adding the reassociation solution to the mixed stream. The pH of the reassociation solution can be appropriately set according to the pH of the dissociation solution, but generally, it is preferably about 5.0 to 10.0. Examples of substances for making the pH neutral include Tris buffer, HEPES buffer, phosphate buffer, borate buffer, citrate buffer, carbonate buffer, glycine buffer, etc. Among these, Tris buffer or phosphate buffer is preferable because it has a wide pH buffering ability. A solution containing a substance for making the pH neutral and selected from the group consisting of phosphoric acid or Tris hydrochloride with a pH of about 5.0 to about 9.0 is desirable. When the protein is ferritin, it is known to reassociate when the pH is set to 5.0 (Biochemistry 1987, 26, 1831 - 1837). Therefore, the pH of the reassociation solution is preferably about 5.0 to about 9.0, more preferably about 7.0 to about 9.0. As a substance for making the pH acidic, hydrochloric acid is preferred because it is desirable to be low molecular weight to avoid competition with the substance to be encapsulated.
[0012] Reassociation can also be carried out by diluting the mixed stream of the (I - 2) subunit stream and the bioactive substance stream. This step is suitable when dissociation is carried out by the step (II - 2) described later. When the complex protein is dissociated into subunits by adding a solvent, the presence of the solvent prevents the subunits from naturally reassociating. Therefore, by diluting to exclude the solvent, reassociation becomes possible. Thus, although it varies depending on the concentration and flow rate of the subunits, it is preferable to adjust the volume of each solution so that the dilution ratio is, for example, 10 to 20 times. The dilution in step (I - 2) can be carried out by adding a diluent as the reassociation solution to the mixed stream. Examples of the diluent include Tris buffer, HEPES buffer, phosphate buffer, borate buffer, citrate buffer, carbonate buffer, and glycine buffer. In particular, Tris buffer is preferred because it has a high buffering capacity from neutral to weakly alkaline. Dilution can also be carried out by dialysis. Specifically, for example, when a ferritin solution dissociated by an acid is placed in a dialysis tube and dialysis is carried out using the external solution as a diluent, the pH inside the dialysis tube can be made neutral to carry out reassociation. Those skilled in the art can appropriately select the reassociation means according to the concentration and liquid volume of the reassociated supramolecular structure. However, for efficiently obtaining a stable supramolecular structure, step (I - 1) is preferred.
[0013] In this invention, by using FMM, the time required to form aggregates can be shortened. As a result, the occurrence of misaggregates can be suppressed. If the flow rate of the subunit solution and the flow rate of the reassembly solution are set to, for example, about 10 mL / min or more, the number of misaggregates is reduced. If both flow rates are independently about 10 to about 100 mL / min, the number of misaggregates is further reduced. In particular, as the sum of the flow rates of the subunit solution and the reassembly solution (hereinafter sometimes referred to as "TFR" (abbreviation for Total Flow Rate)) increases, the misaggregate ratio decreases. In particular, setting the TFR to about 10 mL / min or more is industrially advantageous because it allows the misaggregate ratio to be kept low even when scaled up. In particular, it is better if the flow rate of the subunit solution is greater than the flow rate of the reassembly solution. At this time, if the difference between the flow rates of the subunit solution and the reassembly solution is about 1 to 10, the mixing performance is improved, and the misaggregate ratio can be suppressed.
[0014] The flow micromixer used in this invention can be a general type, such as a slit type, disc type, or forced-contact type. The forced-contact type is preferred because it minimizes blockage problems caused by the flow path and provides excellent mixing performance. The cross-sectional shape of the flow channel is not particularly limited, but using a V-shape can reduce mis-aggregations. The inner diameter of the flow path is not particularly limited; for example, a diameter of approximately 0.1 to 1.0 mm can be suitably used. Using an inner diameter of approximately 0.2 to 0.5 mm is further advantageous in reducing the misaggregate ratio. Using a flow micromixer with a V-shaped channel with an inner diameter of approximately 0.2 to 0.5 μm further reduces misaggregations. The length of each channel can be set as appropriate, but it is preferably about 10 to 20,000 μm, more preferably about 100 to 5,000 μm, and preferably about 200 to 3,000 μm, as this provides sufficient mixing performance. The lengths of each channel may be the same or different, but it is preferable that they be the same. For the material of the flow path, inorganic materials such as SUS (stainless steel) or organic materials such as polytetrafluoroethylene (PTFE) can be used. As the flow micromixer used in this invention, commercially available products from companies such as Fraunhofer IMM, YMC, and Sanko Seiki Kogyo can be used. The mixture exiting the flow micromixer is sent to a receiver tank. The protein, which has reformed its supramolecular structure and contains bioactive substances at its center, can be recovered from the receiver tank using ultrafiltration or column chromatography techniques.
[0015] The proteins obtained by the manufacturing method of the present invention are aggregates having a supramolecular structure and have a cavity in the center that can contain physiologically active substances. Examples of such proteins include ferritin, an 11-mer protein called TRAP, bromoperoxidase, the substrate protein of the M1 virus, and galactoside O-acetyltransferase. One type of protein may be used alone, or two or more types may be used in combination. Ferritin has H-forms and L-forms as subunits, and in the present invention, either one may be used, or both may be used in combination. Of these, ferritin is preferred because its deassociation and reassociation can be easily controlled by pH. The subunit used in step (I) consists of a single polypeptide chain that constitutes such an aggregate protein. The subunit is dissolved in a suitable solvent and used in solution form. Examples of solvents include dimethyl sulfoxide (DMSO), N,N-dimethylformamide (DMF), acetonitrile, and ethanol. Of these, DMSO and DMF, which are amphiphilic, are preferred. A subunit concentration of approximately 0.1 to 50 g / L is preferred because it makes the low-viscosity solution easy to handle.
[0016] [Withdrawal from meeting] The manufacturing method of the present invention may include a step of deassociating a protein having a supramolecular structure before step (I). That is, it may include a step of dissociating the protein in an aggregate state into individual subunits. This step is referred to as step (II). The subunits obtained in this step can be used in step (I). According to the inventors' findings, the effect of the time required for deassociation on the yield of the aggregate after reassociation is not greater than the effect of the time required for reassociation on the yield of the aggregate after reassociation. Therefore, deassociation may be performed in batch or flow.
[0017] As a means of deassociation, for example, one can make the pH of the solution containing the protein aggregate before the physiologically active substance is encapsulated acidic. This step will be referred to as step (II-1) hereafter. The pH at this time should be around 1.5 to 3.0. Substances that make the pH acidic include hydrochloric acid, glycine hydrochloride, and sulfuric acid. Of these, glycine hydrochloride buffer is preferred because it is excellent at controlling the pH. As for the solution containing the substance that makes the pH acidic, one selected from the group consisting of hydrochloride salts with a pH of approximately 1 to approximately 3.0 is excellent at controlling the pH. Since ferritin is known to deassociate when the pH is 2.5 (Biochemistry 1987, 26, 1831-1837), the pH of the solution is preferably about 1.5 to 3.0, and more preferably about 1.5 to 2.5. As a substance to acidify the pH, glycine hydrochloride, which is excellent at controlling pH, is preferred. It has been reported that ferritin can be reversibly degraded at a pH of approximately 10-12 (Yi Gou, et. al., Frontiers in Pharmacology, 2018 Apr 27; 9:421). Therefore, in the case of ferritin, in step (II-1), ferritin can be unassociated with its subunits by adjusting the pH of the solution containing the protein aggregate before the physiologically active substance is encapsulated to approximately 10-12. Empirically, acidic conditions are more favorable for deassociation than alkaline conditions; therefore, it is preferable to use a solution with a pH of approximately 1.5 to 3.0 for deassociation.
[0018] Another method for deassociating is to add a solvent to the solution containing the aggregate. This step will hereafter be referred to as step (II-2). Examples of solvents that can be used in step (II-2) include DMSO, DMF, acetonitrile, and ethanol. When the protein is ferritin, DMF or DMSO is preferred from the viewpoint of maintaining the ferritin subunit structure. Those skilled in the art can appropriately select the deassociation method depending on the ferritin concentration and the scale of deassociation, but considering the effort required for solvent removal and the effects of solvent residue, step (II-1) is preferred, and the method of making the pH acidic is even more preferred.
[0019] When step (II-1) is used as the de-association means, the re-association step (I-1) is preferred, and when step (II-2) is used as the de-association means, the re-association step (I-2) is preferred. Using steps (II-1) and (I-1) in combination can further reduce mis-associated bodies.
[0020] When deassociation is performed in a flow manner, it can be done using a flow micromixer (FMM). In this case, a solution containing protein aggregates that do not contain physiologically active substances and a solution containing a substance that makes the pH acidic and / or a diluted solvent are supplied from separate channels. In this case, the flow rates of the former and the latter may be the same or different, and independently may be about 1 mL / min or more. If the flow rate is about 5 to 100 mL / min, it can be expected that the efficiency of encapsulation will be further increased. When both flow rates are about 5 mL / min, the efficiency of encapsulation is increased.
[0021] It is preferable to perform deassociation using FMM as well, as this reduces misaggregates. In this embodiment, if the deassociation means is step (II-1) and the reassociation means is step (I-1), the number of misaggregates can be further reduced. In particular, it is preferable that the flow rates of the solution containing protein aggregates that do not contain physiologically active substances and the solution containing a substance that makes the pH acidic are independently about 1 mL / min or more, more preferably about 5 to about 100 mL / min, and most preferably about 5 mL / min, from the viewpoint of improving encapsulation efficiency. In particular, in the above embodiment, it is preferable that the flow rate of the subunit solution and the flow rate of the reassociation solution are independently about 10 to about 100 mL / min, as this further reduces the number of misaggregates, and it is even more preferable that the TFR is about 10 mL / min or more. It is especially preferable that the difference between the flow rate of the subunit solution and the flow rate of the reassociation solution is about 1 to 10, as this improves mixing performance and thus suppresses the misaggregate ratio.
[0022] [Physiologically active substances] Examples of physiologically active substances to be encapsulated include siRNA (small interfering RNA), DNA, and oligopeptides, with a mass-average molecular weight of approximately 1,000 to 20,000. Of these, since the cavity inside ferritin is approximately 7 nm, a mass-average molecular weight of approximately 1,000 to 15,000 is more preferable, and 1,000 to 10,000 is even more preferable. Because the size of the cavity varies depending on the aggregate, different physiologically active substances are suitable for encapsulation. For example, the cavity size of ferritin is approximately 7 nm, making peptides, DNA, and siRNA suitable. The physiologically active substance is brought into contact with the protein in solution and encapsulated within it. Examples of solvents that make up the physiologically active substance solution include Tris buffer. Of these, it is preferable that the solvent be neutral in order to suppress hydrolysis by acid. A concentration of approximately 1 to approximately 100 μM of the physiologically active substance solution is preferable because it suppresses aggregation of the physiologically active substance.
[0023] In the reassembly process, the protein aggregates containing the bioactive substances and the bioactive substances not encapsulated in the protein aggregates can be recovered using an ultrafiltration membrane or a dialysis membrane, such as Spectrum's tangential flow dialysis. The recovered bioactive substances can be reused. For example, by joining the solution containing the recovered bioactive substances to the flow of the subunit solution in process (I), the encapsulation of bioactive substances into protein aggregates can be continuously performed. When deassociation is performed by FMM, the encapsulation of the bioactive substance into the protein aggregate can be continuously carried out by joining the solution containing the recovered bioactive substance to the flow of the subunit solution in step (I), or the flow of the solution with a pH of approximately 1.5 to 3.0 or 10 to 12 in step (II-1), the flow of the solvent in step (II-2), or the flow of the protein aggregate solution that does not contain the bioactive substance. If the bioactive substance to be encapsulated is sensitive to the acids, bases, or solvents used for deassociation, it is preferable to join the flow of the subunit solution in step (I) or the flow of the protein aggregate solution that does not contain the bioactive substance, as this shortens the time the bioactive substance is exposed to the acid, etc.
[0024] In a particularly preferred embodiment of the present invention, step (II-1) is performed by adjusting the pH of the protein aggregate solution that does not contain the physiologically active substance to approximately 2.3 to approximately 2.5 using a glycine hydrochloride buffer with a pH of approximately 2 to approximately 2.5, and then step (I-1) is performed by neutralizing the pH of the unassociated protein subunit solution using a Tris hydrochloride buffer with a pH of approximately 7.0 to approximately 9.0. This allows for reassociation. At this time, if the sum of the flow rates of the subunit solution and the Tris hydrochloride buffer is approximately 10 mL / min or more, the misassociation rate can be reduced. Furthermore, it is particularly preferable that the protein is ferritin and the physiologically active substance is DNA.
[0025] The method of the present invention can be carried out without using a physiologically active substance. That is, according to the present invention, dissociation and reassociation of a protein having a supramolecular structure can be carried out. By this method, the supramolecular structure can be utilized as an adsorption carrier or the like.
Example
[0026] <Analysis conditions> 〔Method for analyzing the ratio of misassembled complexes〕 The ratio of misassembled complexes was analyzed by gel filtration chromatography under the following conditions. TIFF0007884715000001.tif22150
[0027] 〔Method for analyzing the amount of DNA encapsulated〕 The amount of DNA encapsulated inside ferritin was measured by quantifying the P concentration in the amount of DNA contained inside ferritin using HPLC-ICP-MS. Note that HPLC is an abbreviation for high performance liquid chromatography, and ICP-MS is an abbreviation for inductively coupled plasma mass spectrometer. Each analysis condition is shown below.
Table A
[0028] <Method for analyzing the amount of siRNA and peptide encapsulated> For the ferritin recovered by the same method as the method for analyzing the ratio of misassembled complexes, a 0.2N hydrochloric acid (HCl) solution was dropped to make the pH 2 or less, and the ferritin was dissociated again. The dissociated solution was subjected to gel filtration chromatography again to quantify the encapsulated components.
[0029] Solution b used below is a 100 mM glycine hydrochloride buffer prepared by diluting a 1000 mM glycine hydrochloride buffer (pH 2.3) with ultrapure water. Solution d is a 350 mM tris hydrochloride buffer prepared by diluting a 1000 mM tris hydrochloride buffer (pH 9.0) with ultrapure water. Furthermore, the ferritin used was ferritin (Lot A) that was fermented and purified in-house according to the method disclosed in Patent Document 1.
[0030] 1. Comparison of aggregate ratios in FMR / Batch Reference Examples 1-7 (Investigation of FMM reassociation rate with ferritin 1g / L) Using a V-shaped forced-contact micromixer with an inner diameter of 500 μm, a 10 mM Tris buffer solution a containing 2 g / L of ferritin was mixed with solution b to adjust the pH to approximately 2.3-2.5, thereby deassociating ferritin. The flow rate of each solution was set to 5 mL / min. This yielded a deassociated solution c with a ferritin concentration of 1 g / L and a glycine hydrochloride concentration of 50 mM. Ferritin was reassociated by mixing deassociation solution c with solution d at a predetermined flow rate using a V-shaped forced-contact micromixer with an inner diameter of 500 μm to adjust the pH to approximately 7.3. The resulting solution was analyzed using the above method and conditions, and the misaggregate ratio was measured. The flow rates of solution c and solution d, as well as the misaggregate ratio, are shown in Table 1.
[0031] [Table 1]
[0032] Reference Examples 8-11 (Investigation of FMM reassociation rate with ferritin 3g / L) Ferritin deassociation and reassociation were performed in the same manner as in Reference Examples 1-7, except that the ferritin concentration in solution a was changed to 6 g / L. The ferritin concentration in deassociation solution c was 3 g / L. The flow rates of solutions c and d, as well as the misaggregate ratios, are shown in Table 2.
[0033] [Table 2]
[0034] Reference Examples 12-14 (Investigation of FMM reassociation rate with ferritin 5g / L) Ferritin deassociation and reassociation were performed in the same manner as in Reference Examples 1-7, except that the ferritin concentration in solution a was changed to 10 g / L. The ferritin concentration in deassociation solution c was 5 g / L. The flow rates of solutions c and d, as well as the misaggregate ratios, are shown in Table 3.
[0035] [Table 3]
[0036] Reference Example 15 (Comparative batch, deassociation solution c = ferritin 1 g / L, 200 μL) 100 μL of a 10 mM Tris buffer solution a containing 2 g / L of ferritin was placed in an Eppendorf tube, and 100 μL of solution b was added and mixed to adjust the pH to approximately 2.3-2.5, thereby performing ferritin deassociation by batch method. This yielded a deassociated solution c with a ferritin concentration of 1 g / L. Unless otherwise specified, in the examples section, the final concentration of deassociated solution c was kept the same for both the batch method and the flow micromixer method. Ferritin was reassociated in a batch manner by adding 50 μL of solution d to 200 μL of deassociation solution c in an Eppendorf tube and mixing to adjust the pH to approximately 7.3. As a result, the misaggregate ratio was 10.1%.
[0037] Reference example 16 (comparative batch, deassociation solution c = ferritin 5 g / L, 2 mL) One mL of a 10 mM Tris buffer solution a containing 10 g / L of ferritin was placed in an Eppendorf tube, and one mL of solution b was added and mixed to adjust the pH to approximately 2.3-2.5, thereby performing ferritin deassociation by batch. This yielded a deassociated solution c with a ferritin concentration of 5 g / L. Ferritin reassociation was performed in a batch manner by taking 2 mL of deassociation solution c into a Falcon tube, adding 500 μL of solution d, and mixing to adjust the pH to approximately 7.3. The misassociation rate at this time was 31.0%.
[0038] Reference example 17 (comparative batch, deassociation solution c = ferritin 5 g / L, 10 mL) 5 mL of a 10 mM Tris buffer solution a containing 10 g / L of ferritin was placed in a beaker, 5 mL of solution b was added, and the mixture was stirred with a magnetic stirrer to adjust the pH to approximately 2.3-2.5, thereby performing ferritin deassociation by batch method. This yielded a deassociated solution c with a ferritin concentration of 5 g / L. Ferritin reassociation was performed in a batch manner by adding 2 mL of solution d to a beaker containing 10 mL of deassociation solution c and stirring with a magnetic stirrer to adjust the pH to approximately 7.3. The misaggregate rate at this time was 33.9%.
[0039] Figure 1 summarizes the comparative examples 15-17 mentioned above. Comparing examples 15 and 16 reveals that the number of misaggregates tends to increase with ferritin concentration. Furthermore, comparing examples 16 and 17 reveals that the number of misaggregates tends to increase with increasing liquid volume during recombination. This is because a larger liquid volume requires a longer time for complete mixing, and a similar example is described in Kouhei Tsumoto et al, Protein Expression and Purification, 28 (2003) 1-8 (especially in the sections on “Dilution” and “Mixing”). On the other hand, when plotting the sum of flow velocities at reassembly on the x-axis and the misaggregate ratio on the y-axis for reference examples 1 to 14 using FMM, the results are as shown in Figure 2. In the range where the sum of flow velocities is small, the misaggregate ratio is high, but as the flow velocity increases, the misaggregate ratio decreases, and when the sum of flow velocities exceeds 10 mL / min, the misaggregate ratio becomes constant. In other words, in the batch method, the misaggregate ratio increases with increasing liquid volume, whereas when using FMM, not only does the misaggregate ratio not increase even when the sum of flow velocities is increased, but a misaggregate ratio equivalent to that obtained when carried out on a small scale, such as in Examples 15 and 16, can be obtained.
[0040] Reference Examples 18-19 (Confirmation of FMM Reproducibility) The same experiment as in Reference Example 5 was repeated two more times, and the misaggregate ratio was measured to be 11.3% and 9.2%, respectively. This indicates that FMM has excellent reproducibility and is superior to the batch method in the production process.
[0041] Example 20 (Batch Method) One mL of a 10 mM Tris buffer solution a containing 2 g / L of ferritin was placed in an Eppendorf tube, and one mL of solution b was added and mixed to adjust the pH to approximately 2.3-2.5, thereby performing ferritin deassociation by batch method. This yielded a deassociated solution c with a ferritin concentration of 1 g / L. 2 mL of deassociation solution c was placed in a Falcon tube, and 500 μL of solution d was gently added to slowly adjust the pH to approximately 7.3. This allowed for the reassociation of ferritin by batch. The misaggregate ratio was measured at 67.1%, clearly indicating that a gradual pH adjustment, i.e., a rapid mixing rate, influences the increase in the misaggregate ratio.
[0042] 2. Cross-testing during reconciliation / deconciliation in FMM Reference Examples 21-24 disclosed below used ferritin from a different lot (Lot B) than Reference Examples 1-20, which was newly prepared according to the method described in Patent Document 1. Reference Example 21 (Comparative batch, ferritin 1g / L, 200μL); Lot difference from Reference Example 15 100 μL of a 10 mM Tris buffer solution a containing 2 g / L of ferritin was placed in an Eppendorf tube, 100 μL of solution b was added, and the mixture was combined to adjust the pH to approximately 2.3-2.5, thereby performing ferritin deassociation by batch method. A deassociated solution c with a ferritin concentration of 1 g / L was obtained. Ferritin reassociation was performed in a batch manner by taking 200 μL of the deassociation solution into an Eppendorf tube and adding 50 μL of solution d to adjust the pH to approximately 7.3. As a result, the misassociation rate was 3.6%.
[0043] Reference Examples 22-24 (Investigation of FMM reassociation rate with ferritin 1g / L); Lot differences from Reference Examples 3-5 Using a V-shaped forced-contact micromixer with an inner diameter of 500 μm, a 10 mM Tris buffer solution a containing 2 g / L of ferritin was mixed with solution b to adjust the pH to approximately 2.3-2.5, thereby deassociating ferritin. The flow rate of each solution was set to 5 mL / min. This yielded a deassociated solution c containing 1 g / L of ferritin and 50 mM of glycine hydrochloride. Ferritin was reassociated by mixing deassociation solution c with solution d at a predetermined flow rate using a V-shaped forced-contact micromixer with an inner diameter of 500 μm to adjust the pH to approximately 7.3. The flow rates of solutions c and d, as well as the misaggregate ratios, are shown in Table 4.
[0044] [Table 4]
[0045] Reference Examples 25-28 disclosed below use ferritin (lot C) prepared separately from Reference Examples 1-24, according to the method described in Patent Document 1. Reference example 25 (comparative batch, ferritin 1g / L, 2mL) 1000 μL of a 10 mM Tris buffer solution a containing 2 g / L of ferritin was placed in an Eppendorf tube, and 1000 μL of solution b was added and mixed to adjust the pH to approximately 2.3-2.5. As a result, a deassociation solution c with a ferritin concentration of 1 g / L was obtained. In this way, ferritin deassociation was performed by a batch method. Ferritin reassociation was performed in a batch manner by taking 2000 μL of deassociation solution c into an Eppendorf tube and adding 500 μL of solution d to adjust the pH to approximately 7.3. As a result, the misassociation rate was 17.0%.
[0046] Reference Example 26 (Example of deassociation-reassociation performed in an FMM batch (1g / L)) Using a V-shaped forced-contact micromixer with an inner diameter of 500 μm, ferritin was deassociated by mixing a 10 mM Tris buffer solution a containing 2 g / L of ferritin with solution b to adjust the pH to approximately 2.3-2.5. The flow rate of each solution was set to 5 mL / min. This yielded a deassociated solution c containing 1 g / L of ferritin and 50 mM of glycine hydrochloride. Ferritin reassociation was performed in a batch manner by taking 2000 μL of deassociation solution c into an Eppendorf tube and adding 500 μL of solution d to adjust the pH to approximately 7.3. As a result, the misassociation rate was 11.2%.
[0047] Reference Example 27 (Example of deassociation-reassociation performed using batch-FMM (1g / L)) Ferritin was deassociated in a batch manner by taking 2000 μL of a 10 mM Tris buffer solution a containing 2 g / L of ferritin into an Eppendorf tube and mixing it with 2000 μL of solution b to adjust the pH to approximately 2.3-2.5. A deassociated solution c with a ferritin concentration of 1 g / L was obtained. Deassociation solution c and solution d were mixed using a V-shaped forced-contact micromixer to adjust the pH to approximately 7.3, and ferritin reassociation was performed. At this time, the flow rate of deassociation solution c was 8 mL / min, and the flow rate of solution d was 2 mL / min. As a result, the misaggregate ratio was 8.0%.
[0048] Reference Example 28 (Example of deassociation-reassociation performed using FMM-FMM (1g / L)) Using a V-shaped forced-contact micromixer with an inner diameter of 500 μm, ferritin was deassociated by mixing a 10 mM Tris buffer solution a containing 2 g / L of ferritin with solution b to adjust the pH to approximately 2.3-2.5. The flow rate of each solution was set to 5 mL / min. This yielded a deassociated solution c containing 1 g / L of ferritin and 50 mM of glycine hydrochloride. Deassociation solution c and solution d were mixed using a V-type forced-contact micromixer to adjust the pH to approximately 7.3, and ferritin reassociation was performed. At this time, the flow rate of deassociation solution c was 8 mL / min, and the flow rate of solution d was 2 mL / min. As a result, the misaggregate ratio was 6.3%. Summarizing the results from examples 25-28, we get the relationship shown in Figure 3. Table 5 shows a list of the conditions for Reference Examples 1 to 28. [Table 5]
[0049] 3. Comparison of DNA-encapsulated ferritin production by FMM / Batch Examples 1-2 (DNA-encapsulated FMM example, ferritin 1g / L) Using a V-shaped forced-contact micromixer with an inner diameter of 500 μm, a 10 mM Tris buffer solution a containing 2 g / L of ferritin and 10 μM of ssDNA (product name "K3 Et-Free", manufactured by Gene Design Co., Ltd.) was mixed with solution b, and the pH was adjusted to approximately 2.3 to 2.5 to deassociate ferritin. This yielded a deassociated solution c with a ferritin concentration of 1 g / L, a dsDNA concentration of 5 μM, and a glycine hydrochloride concentration of 50 mM. Ferritin reassociation was induced by mixing deassociation solution c and solution d at a predetermined flow rate using a V-shaped forced-contact micromixer with an inner diameter of 500 μm to adjust the pH to approximately 7.3. The flow rates of solutions c and d, as well as the dsDNA concentration in the reassociated product, are shown in Table 6.
[0050] [Table 6]
[0051] Comparative Example 1 (DNA-encapsulated batch comparative example, ferritin 1 g / L, 200 μL) 200 μL of a 10 mM Tris buffer solution a containing 2 g / L ferritin and 10 μM ssDNA (product name "K3 Et-Free", manufactured by Gene Design Co., Ltd.) was placed in an Eppendorf tube, and 200 μL of solution b was added and mixed. By adjusting the pH to approximately 2.3-2.5, ferritin deassociation was performed by batch method. This yielded a deassociated solution c with a ferritin concentration of 1 g / L and a dsNDA concentration of 5 μM. Ferritin reassociation was performed in a batch manner by taking 400 μL of deassociation solution c into an Eppendorf tube and mixing it with 100 μL of solution d to adjust the pH to approximately 7.3. The concentration of DNA encapsulated in ferritin was measured and found to be below the limit of quantification (0.06 μM).
[0052] Comparative Example 2 (DNA-encapsulated batch comparative example, ferritin 1 g / L, 2 mL) One mL of a 10 mM Tris buffer solution a containing 2 g / L ferritin and 10 μM ssDNA (product name "K3 Et-Free", manufactured by Gene Design Co., Ltd.) was placed in a Falcon tube, and one mL of solution b was added and mixed to adjust the pH to approximately 2.3-2.5, thereby performing ferritin deassociation by batch method. This yielded a deassociated solution c with a ferritin concentration of 1 g / L and a dsNDA concentration of 5 μM. Ferritin reassociation was performed by batch method by taking 400 μL of deassociation solution c into an Eppendorf tube and mixing it with 500 μL of solution d to adjust the pH to approximately 7.3. The concentration of DNA encapsulated in ferritin was measured and found to be below the limit of quantification (0.06 μM).
[0053] Comparison of siRNA-encapsulated ferritin production by FMM / Batch Example 3 (siRNA-encapsulated FMM example, ferritin 1g / L) Using a V-shaped forced-contact micromixer with an inner diameter of 500 μm, a 10 mM Tris buffer solution a containing 2 g / L of ferritin and 50 μM of siRNA (EUROFINSGENOMICS, with the base sequence of SEQ ID NO: 1 (GGCGCUGCCAAGGCUGUGGGCAAGGUC)) was mixed with solution b, and the pH was adjusted to approximately 2.3-2.5 to deassociate ferritin. This yielded a deassociated solution c with a ferritin concentration of 1 g / L, an siRNA concentration of 10 μM, and a glycine hydrochloride concentration of 50 mM. Ferritin was reassociated by mixing deassociation solution c and solution d at a predetermined flow rate using a V-shaped forced-contact micromixer with an inner diameter of 500 μm to adjust the pH to approximately 7.3. The flow rates of solutions c and d, and the siRNA concentration in the reassociated product obtained by the above analysis are shown in Table 7. In this specification, "1 FTH molecule" refers to a 24-mer of FTH subunits and is synonymous with 1 mole of FTH.
[0054] Comparative Example 3 (siRNA-encapsulated batch comparative example, ferritin 1 g / L, 1000 μL) 400 μL of a 10 mM Tris buffer solution a containing 2 g / L ferritin and 50 μM siRNA (EUROFINSGENOMICS, with the nucleotide sequence of SEQ ID NO: 1) was placed in an Eppendorf tube, and 400 μL of solution b was added and mixed. By adjusting the pH to approximately 2.3-2.5, ferritin deassociation was performed by batch method. This yielded a deassociated solution c with a ferritin concentration of 1 g / L and an siRNA concentration of 10 μM. Ferritin was reassociated in a batch manner by taking 800 μL of deassociation solution c into an Eppendorf tube and mixing it with 200 μL of solution d to adjust the pH to approximately 7.3. The concentration of siRNA encapsulated in ferritin was measured. The results are shown in Table 7.
[0055] [Table 7]
[0056] Example 4 (siRNA-encapsulated FMM example, ferritin 1g / L) Using a V-shaped forced-contact micromixer with an inner diameter of 500 μm, a 10 mM Tris buffer solution a containing 2 g / L of ferritin and 50 μM of siRNA (manufactured by Thermo Fisher Scientific, with the nucleotide sequence of SEQ ID NO: 2 (GACCUUGCCCACAGCCUUGGCAGCGUC)) was mixed with solution b, and the pH was adjusted to approximately 2.3 to 2.5 to deassociate ferritin. This yielded a deassociated solution c with a ferritin concentration of 1 g / L, an siRNA concentration of 10 μM, and a glycine hydrochloride concentration of 50 mM. Ferritin was reassociated by mixing deassociation solution c and solution d at a predetermined flow rate using a V-shaped forced-contact micromixer with an inner diameter of 500 μm to adjust the pH to approximately 7.3. The flow rates of solutions c and d, as well as the siRNA concentration in the reassociated product obtained by the above analysis, are shown in Table 8.
[0057] Comparative Example 4 (siRNA-encapsulated batch comparative example, ferritin 1 g / L, 1000 μL) 400 μL of a 10 mM Tris buffer solution a containing 2 g / L ferritin and 50 μM siRNA (Thermo Fisher Scientific, with the nucleotide sequence of SEQ ID NO: 2) was placed in an Eppendorf tube, and 400 μL of solution b was added and mixed. By adjusting the pH to approximately 2.3-2.5, ferritin deassociation was performed by batch method. This yielded a deassociated solution c with a ferritin concentration of 1 g / L and an siRNA concentration of 10 μM. Ferritin was reassociated in a batch manner by taking 800 μL of deassociation solution c into an Eppendorf tube and mixing it with 200 μL of solution d to adjust the pH to approximately 7.3. The concentration of siRNA encapsulated in ferritin was measured. The results are shown in Table 8.
[0058] [Table 8]
[0059] Comparison of ferritin production amount encapsulated in fluorescent peptides using FMM / Batch Example 5 (FAM-venepeptide encapsulated FMM example, ferritin 1g / L) Using a V-shaped forced-contact micromixer with an inner diameter of 500 μm, a 10 mM Tris buffer solution a containing 2 g / L of ferritin and 0.2 mM of FAM-venepeptide (EUROFINSGENOMICS, with the amino acid sequence of SEQ ID NO: 3 fluorescently labeled with fluorescein (FAM-MNVITNLLAGVVHFLGWLV). The fluorescent label is represented as "FAM." The same applies hereafter) was mixed with solution b, and the pH was adjusted to approximately 2.3 to 2.5 to deassociate ferritin. This yielded a deassociated solution c with a ferritin concentration of 1 g / L, a FAM-venepeptide concentration of 62.5 μM, and a glycine hydrochloride concentration of 50 mM. Ferritin was reassociated by mixing deassociation solution c and solution d at a predetermined flow rate using a V-shaped forced-contact micromixer with an inner diameter of 500 μm to adjust the pH to approximately 7.3. The flow rates of solutions c and d, as well as the FAM-venepeptide concentration in the reassociated product obtained by the above analysis, are shown in Table 9.
[0060] Comparative Example 5 (FAM-venepeptide encapsulated batch comparative example, ferritin 1 g / L, 1000 μL) 400 μL of a 10 mM Tris buffer solution a containing 2 g / L ferritin and 0.2 mM FAM-venepeptide (EUROFINSGENOMICS, with the amino acid sequence of SEQ ID NO: 3 fluorescently labeled with fluorescein) was placed in an Eppendorf tube, and 400 μL of solution b was added and mixed to adjust the pH to approximately 2.3-2.5, thereby performing ferritin deassociation by batch method. This yielded a deassociated solution c with a ferritin concentration of 1 g / L and a FAM-venepeptide concentration of 125 μM. Ferritin was reassociated in a batch manner by taking 800 μL of deassociation solution c into an Eppendorf tube and mixing it with 200 μL of solution d to adjust the pH to approximately 7.3. The concentration of FAM-venepeptide encapsulated in ferritin was measured. The results are shown in Table 9.
[0061] [Table 9]
[0062] Comparison of ferritin production amount encapsulated in fluorescent peptides using FMM / Batch Example 6 (FAM-GFIL8 encapsulated FMM example, ferritin 1g / L) Using a V-shaped forced-contact micromixer with an inner diameter of 500 μm, a 10 mM Tris buffer solution a containing 2 g / L of ferritin and 1.0 mM of FAM-GFIL8 (EUROFINSGENOMICS, with the amino acid sequence (GFILGFIL) of SEQ ID NO: 4 fluorescently labeled with fluorescein) was mixed with solution b, and the pH was adjusted to approximately 2.3-2.5 to deassociate ferritin. This yielded a deassociated solution c with a ferritin concentration of 1 g / L, a FAM-GFIL8 concentration of 62.5 μM, and a glycine hydrochloride concentration of 50 mM. Ferritin was reassociated by mixing deassociation solution c and solution d at a predetermined flow rate using a V-shaped forced-contact micromixer with an inner diameter of 500 μm to adjust the pH to approximately 7.3. The flow rates of solutions c and d, as well as the FAM-GFIL8 concentration in the reassociated product obtained by the above analysis, are shown in Table 10.
[0063] Comparative Example 6 (FAM-GFIL8 encapsulated batch comparative example, ferritin 1 g / L, 1000 μL) 400 μL of a 10 mM Tris buffer solution a containing 2 g / L ferritin and 1.0 mM FAM-GFIL8 (EUROFINSGENOMICS, with the amino acid sequence of SEQ ID NO: 4 fluorescently labeled with fluorescein) was placed in an Eppendorf tube, and 400 μL of solution b was added and mixed to adjust the pH to approximately 2.3-2.5, thereby performing ferritin deassociation by batch method. This yielded a deassociated solution c with a ferritin concentration of 1 g / L and a FAM-GFIL8 concentration of 125 μM. Ferritin was reassociated in a batch manner by taking 800 μL of deassociation solution c into an Eppendorf tube and mixing it with 200 μL of solution d to adjust the pH to approximately 7.3. The concentration of FAM-GFIL8 encapsulated in ferritin was measured. The results are shown in Table 10.
[0064] [Table 10]
[0065] [Sequence Listing Free Text] Sequence ID 1: RNA Sequence ID 2: RNA SEQ ID NO: 3: Peptide Sequence ID 4: Peptide
Claims
1. A method for producing a protein having a supramolecular structure containing a physiologically active substance, (I) A method comprising contacting a protein subunit constituting a supramolecular structure, a physiologically active substance, and a solution for forming a protein having a supramolecular structure from the subunit in a flow micromixer. The aforementioned manufacturing method.
2. The method for producing a protein having a supramolecular structure, wherein the protein is ferritin, according to claim 1.
3. The manufacturing method according to claim 1 or 2, wherein in step (I), the sum of the flow rate of the subunit and the flow rate of the solution is approximately 10 mL / min or more.
4. The method for producing the subunit according to any one of claims 1 to 3, wherein the subunit is obtained by changing the pH of a solution containing a protein having a (II-1) supramolecular structure to acidic or basic.
5. The manufacturing method according to claim 4, wherein the solution used in step (II-1) is a solution with a pH of approximately 1.5 to approximately 3.0 or a pH of approximately 10 to 12.
6. The manufacturing method according to any one of claims 1 to 5, wherein the solution used in step (I) for forming a protein having a supramolecular structure is a solution with a pH of approximately 5.0 to approximately 9.
0.
7. The method for producing the subunit according to any one of claims 1 to 3, wherein the subunit is obtained by adding a solvent to a solution containing a protein having a (II-2) supramolecular structure.
8. The manufacturing method according to claim 7, wherein the solvent used in step (II-2) is selected from the group consisting of dimethyl sulfoxide (DMSO), N,N-dimethylformamide (DMF), acetonitrile, and ethanol.
9. The manufacturing method according to claim 7 or 8, wherein the solution used in step (I) is selected from the group consisting of Tris buffer, HEPES buffer, phosphate buffer, borate buffer, citrate buffer, carbonate buffer, and glycine buffer.
10. The manufacturing method according to any one of claims 4 to 9, wherein step (II-1) or (II-2) is performed using a flow micromixer.
11. The method for producing a biologically active substance according to any one of claims 1 to 10, wherein the biologically active substance is selected from the group consisting of siRNA, DNA, oligopeptides, or combinations thereof, having a mass-average molecular weight of about 1,000 to about 20,000.
12. Step (II-1) is performed by adjusting the pH of a solution of a protein aggregate that does not contain a physiologically active substance to about 2.3 to about 2.5 using a glycine hydrochloride buffer with a pH of about 2 to about 2.
5. Furthermore, the process includes step (I-1), in which the pH of the unassociated protein subunit solution is neutralized using Tris hydrochloride buffer with a pH of approximately 7.0 to 9.
0. The manufacturing method according to claim 4 or 5.
13. The manufacturing method according to claim 12, wherein the sum of the flow rate of the subunit solution and the flow rate of the Tris hydrochloride buffer is about 10 mL / min or more.
14. The method for producing a protein according to claim 12 or 13, wherein the protein is ferritin and the physiologically active substance is DNA.
Citation Information
Patent Citations
Ferritin-loaded antitumor drug and preparation method thereof
CN106110333A
Methods and systems for protein folding in vitro
JP2009502173A
Process for producing supramolecular fiber
WO2011089753A1
Method for producing fibrous protein material and cell culturing method
WO2016021498A1
Method for manufacturing antibody-drug conjugate
WO2020075817A1