Compositions of pneumococcal conjugate vaccines
A novel vaccine formulation with glycoconjugates, buffers, and adjuvants addresses precipitation issues in pneumococcal vaccines, facilitating easy resuspension and ensuring dose accuracy and stability.
Patent Information
- Application Number
- RU2025114716
- Authority / Receiving Office
- RU · RU
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2023-11-16
- Filing Date
- 2023-11-29
- Publication Date
- 2026-07-09
- Estimated Expiration
- 2043-11-29
AI Technical Summary
Existing pneumococcal conjugate vaccines face challenges with adjuvant and active ingredient precipitation during storage, leading to variable dispersion and sedimentation, making resuspension difficult as the number of serotypes and concentration increase, affecting dose accuracy.
A vaccine formulation comprising at least 21 different glycoconjugates, a succinate or histidine buffer with pH 5.0 to 7.5, calcium chloride, sodium chloride and/or sodium phosphate, a surfactant, and an adjuvant, designed to facilitate resuspension and ensure long-term stability.
The formulation effectively prevents adjuvant and active ingredient precipitation, ensuring easy resuspension and accurate dose administration, maintaining stability over time.
Smart Images

Figure 00000021 
Figure 00000022 
Figure 00000023
Abstract
Description
FIELD OF INVENTION
[0001] The present invention relates to novel vaccine formulations containing conjugated capsular saccharide antigens (glycoconjugates) and their use. The formulations of the present invention mainly contain glycoconjugates, wherein the saccharides are derived from serotypes of Streptococcus pneumoniae, in a composition of buffers, saline solutions, surfactants and adjuvants, and are specifically designed to facilitate resuspension of the adjuvant and / or glycoconjugates and ensure long-term stability of the vaccine. BACKGROUND OF THE INVENTION
[0002] Pneumococcal infections are a significant cause of morbidity and mortality worldwide. Pneumonia, febrile bacteremia, and meningitis are the most common manifestations of invasive pneumococcal disease, while dissemination of bacteria to the respiratory tract can lead to middle ear infections, sinusitis, or recurrent bronchitis. Compared to invasive disease, noninvasive manifestations are typically less severe but significantly more common.
[0003] The etiologic agent of pneumococcal diseases, Streptococcus pneumoniae (pneumococcus), is a Gram-positive encapsulated coccus surrounded by a polysaccharide capsule. Differences in the composition of this capsule allow serological differentiation of approximately 91 capsular types, some of which are frequently associated with pneumococcal disease, while others are rare. Invasive pneumococcal infections include pneumonia, meningitis, and febrile bacteremia; common noninvasive manifestations include otitis media, sinusitis, and bronchitis.
[0004] Pneumococcal polysaccharides, particularly capsular polysaccharides, are important immunogens present on the surface of bacteria. For this reason, they have become an important component in the development of pneumococcal vaccines. They have proven useful for inducing immune responses, especially when bound to carrier proteins.
[0005] Pneumococcal conjugate vaccines (PCVs) are pneumococcal vaccines used to protect against disease caused by S. pneumoniae (pneumococcus). The vaccines typically consist of a series of glycoconjugates derived from different serotypes of Streptococcus pneumoniae. There are currently six PCV vaccines approved: PREVNAR® (called Prevenar in some countries) (a heptavalent vaccine, e.g., including seven different serotypes), SYNFLORIX® (a 10-valent vaccine), PREVNAR 13® (a 13-valent vaccine), VAXNEUVANCE™ (a 15-valent vaccine), PREVNAR 20™ (a 20-valent vaccine), and PNEUMOVAX 23™ (a 23-valent vaccine).
[0006] One of the problems with vaccine formulations is the precipitation of the adjuvant and / or active ingredient (e.g., glycoconjugates) during storage prior to administration. As the number of serotypes in a pneumococcal conjugate vaccine increases, the total concentration of the active ingredient increases, resulting in variable dispersion and sedimentation of the formulation. Formulations must be resuspended by shaking before administration to ensure the accuracy of the administered dose. Resuspension of formulations becomes increasingly difficult as the number of serotypes and / or concentration of serotypes in the vaccine increases. Therefore, there is a need for a vaccine formulation that facilitates resuspension of the vaccine for administration. SUMMARY OF THE INVENTION
[0007] The present invention is based on the fundamental discovery of vaccine formulations for pneumococcal vaccines that facilitate resuspension of particles precipitated from solution to ensure dose accuracy and long-term stability.
[0008] In one embodiment, the present invention relates to compositions comprising at least 21 different glycoconjugates; a succinate or histidine buffer with a pH in the range of 5.0 to 7.5; calcium chloride, sodium chloride and / or sodium phosphate; a surfactant and an adjuvant.
[0009] In one embodiment, the composition includes at least 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 different glycoconjugates. In one embodiment, the composition is a 24-valent pneumococcal conjugate composition. In one embodiment, the composition is a 25-valent pneumococcal conjugate composition. In one embodiment, the glycoconjugates are pneumococcal polysaccharide-protein conjugates.
[0010] In one embodiment, the glycoconjugates comprise at least one glycoconjugate derived from a Streptococcus pneumoniae serotype selected from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B and combinations thereof. In one embodiment, the carrier protein for the glycoconjugate(s) is a diphtheria cross-reactive material (CRM) 197), diphtheria toxoid (DT), tetanus toxoid (TT), C5a-peptidase from Streptococcus (SCP) or rhizavidin [a.k.a. 45-179J-GGGGSSS-SP1500-AAA-SP0785] (CP1).
[0011] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F and S. pneumoniae serotypes conjugated with CRM 197 .
[0012] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from serotypes 4, 6B, 9V, 14, 18C, 19F and 23F of S. pneumoniae, and further comprises serotypes 1, 5 and 7F of S. pneumoniae. In one embodiment, serotypes 1, 4, 5, 7F, 9V and / or 23F of S. pneumoniae are conjugated to PD, serotype 18C of S. pneumoniae is conjugated to TT and serotype 19F of S. pneumoniae is conjugated to DT.
[0013] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from serotypes 4, 6B, 9V, 14, 18C, 19F and 23F of S. pneumoniae, and further comprises serotypes 1, 3, 5, 6A, 7F and 19A of S. pneumoniae. In one embodiment, the serotypes of S. pneumoniae are conjugated to CRM 197 .
[0014] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from serotypes 4, 6B, 9V, 14, 18C, 19F and 23F of S. pneumoniae, and further comprises serotypes 1, 3, 5, 6A, 7F, 19A, 22F and 33F of S. pneumoniae. In one embodiment, the serotypes of S. pneumoniae are conjugated to CRM 197 .
[0015] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from serotypes 4, 6B, 9V, 14, 18C, 19F and 23F of S. pneumoniae, and further comprises serotypes 1, 3, 5, 6A, 7F, 8, 10A, 11A, 12F, 15B, 19A, 22F and 33F of S. pneumoniae. In one embodiment, the serotypes of S. pneumoniae are conjugated to CRM 197 .
[0016] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from serotypes 4, 6B, 9V, 14, 18C, 19F and 23F of S. pneumoniae, and further comprises serotypes 1, 2, 3, 5, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F and 33F of S. pneumoniae.
[0017] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from serotypes 4, 6B, 9V, 14, 18C, 19F and 23F of S. pneumoniae, and further comprises serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F and 33F of S. pneumoniae. In one embodiment, the serotypes of S. pneumoniae are conjugated to CRM 197 .
[0018] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and 35B. In one embodiment, the S. pneumoniae serotypes are conjugated to CRM 197 . In one embodiment, S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B are conjugated to CRM197 and S. pneumoniae serotype 3 is conjugated to SCP.
[0019] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from serotypes 4, 6B, 9V, 14, 18C, 19F and 23F of S. pneumoniae, and further comprises glycoconjugates derived from serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F and 35B of S. pneumoniae. In one embodiment, the S. pneumoniae serotypes are conjugated to CRM197. In one embodiment, S. pneumoniae serotypes 1, 2, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B are conjugated to CRM 197 and S. pneumoniae serotype 3 is conjugated to SCP.
[0020] In one embodiment, the composition comprises at least 25 glycoconjugates comprising at least serotypes 4, 6B, 9V, 14, 18C, 19F and 23F of S. pneumoniae, and further comprises serotypes 1, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 18C, 19A, 22F and 33F of S. pneumoniae. In one embodiment, at least two of the serotypes of S. pneumoniae are conjugated with TT. In one embodiment, the at least two serotypes of S. pneumoniae conjugated with TT are selected from serotypes 1, 3, 5, 15B and 22F of S. pneumoniae. In one embodiment, at least 17 of the S. pneumoniae serotypes are conjugated to CRM 197 In one embodiment, at least 17 serotypes of S. pneumoniae conjugated to CRM 197 , selected from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F 22F, 23F and 33F S. pneumoniae.
[0021] In one embodiment, the pneumococcal glycoconjugates are selected from S. pneumoniae serotype 1 conjugated with CRM 197 , serotype 3 S. pneumoniae conjugated with CRM 197 , serotype 4 S. pneumoniae conjugated with CRM 197 , serotype 5 S. pneumoniae conjugated with CRM 197 , serotype 6A S. pneumoniae conjugated with CRM 197 , serotype 6B S. pneumoniae conjugated with CRM 197 , serotype 7F S. pneumoniae conjugated with CRM 197 , serotype 8 S. pneumoniae conjugated with CRM 197 , serotype 9V S. pneumoniae conjugated with CRM 197 , serotype 10A S. pneumoniae conjugated with CRM 197 , serotype 11A S. pneumoniae conjugated with CRM 197 , serotype 12F S. pneumoniae conjugated with CRM 197 , serotype 14 S. pneumoniae conjugated with CRM 197 , serotype 15A S. pneumoniae conjugated with CRM 197, serotype 15B S. pneumoniae conjugated with CRM 197 , serotype 18C S. pneumoniae conjugated with CRM 197 , serotype 19A S. pneumoniae conjugated with CRM 197 , serotype 19F S. pneumoniae conjugated with CRM 197 , serotype 22F S. pneumoniae conjugated with CRM 197 , serotype 23A S. pneumoniae conjugated with CRM 197 , serotype 23B S. pneumoniae conjugated with CRM 197 , serotype 23F S. pneumoniae conjugated with CRM 197 , serotype 24F S. pneumoniae conjugated with CRM 197 , serotype 33F S. pneumoniae conjugated with CRM 197 , serotype 35B S. pneumoniae conjugated with CRM 197 , and their combinations.
[0022] In one embodiment, the pneumococcal glycoconjugates are selected from S. pneumoniae serotype 1 conjugated with CRM 197 , serotype 3 S. pneumoniae conjugated with SCP, serotype 4 S. pneumoniae conjugated with CRM 197, serotype 5 S. pneumoniae conjugated with CRM 197 , serotype 6A S. pneumoniae conjugated with CRM 197 , serotype 6B S. pneumoniae conjugated with CRM 197 , serotype 7F S. pneumoniae conjugated with CRM 197 , serotype 8 S. pneumoniae conjugated with CRM 197 , serotype 9V S. pneumoniae conjugated with CRM 197 , serotype 10A S. pneumoniae conjugated with CRM 197 , serotype 11A S. pneumoniae conjugated with CRM 197 , serotype 12F S. pneumoniae conjugated with CRM 197 , serotype 14 S. pneumoniae conjugated with CRM 197 , serotype 15A S. pneumoniae conjugated with CRM 197 , serotype 15B S. pneumoniae conjugated with CRM 197 , serotype 18C S. pneumoniae conjugated with CRM 197 , serotype 19A S. pneumoniae conjugated with CRM 197 , serotype 19F S. pneumoniae conjugated with CRM 197, serotype 22F S. pneumoniae conjugated with CRM 197 , serotype 23A S. pneumoniae conjugated with CRM 197 , serotype 23B S. pneumoniae conjugated with CRM 197 , serotype 23F S. pneumoniae conjugated with CRM 197 , serotype 24F S. pneumoniae conjugated with CRM 197 , serotype 33F S. pneumoniae conjugated with CRM 197 , serotype 35B S. pneumoniae conjugated with CRM 197 , and their combinations.
[0023] In one embodiment, the total concentration of polysaccharide is about 1-100 μg per dose. In one embodiment, the concentration of polysaccharide for each serotype is about 1-10 μg per dose. In one embodiment, the concentration of buffer is about 1-50 mM. In one embodiment, the concentration of sodium chloride is about 1-300 mM. In one embodiment, the concentration of calcium chloride in Formulation C is about 1-50 mM. In one embodiment, the concentration of sodium phosphate in Formulation D is about 1-50 mM. In one embodiment, the surfactant is polysorbate or poloxamer having a molecular weight of about 1100 Da to 17400 Da. In one embodiment, the surfactant is polysorbate 80.In one embodiment, the surfactant is polysorbate 20. In one embodiment, the surfactant concentration is from about 0.001% to 1%. In one embodiment, the adjuvant is aluminum phosphate. In one embodiment, the adjuvant concentration is from about 0.1% to 1%.
[0024] In one embodiment, the adjuvant is a liposomal adjuvant. In another embodiment, the adjuvant comprises monophosphoryl lipid A (MPLA) and saponin. In one embodiment, the adjuvant comprises monophosphoryl lipid A phosphorylated hexaacyl disaccharide (PHAD®) and QS-21. In one embodiment, the adjuvant is liposomal novel adjuvant-1 (LiNA-1) described herein. In one embodiment, the adjuvant comprises 3D-PHAD® and QS-21. In one embodiment, the adjuvant is liposomal novel adjuvant-2 (LiNA-2) described herein. In another embodiment, the adjuvant is L1NA-2A described herein. In another embodiment, the adjuvant is L1NA-2B, as described herein. In other embodiments, the composition comprises more than one adjuvant.In a specific embodiment, the composition comprises aluminum phosphate and LiNA-2.
[0025] In one embodiment, the present invention relates to compositions comprising at least 21 different glycoconjugates; a succinate buffer having a pH in the range of 5.0 to 7.5; calcium chloride; sodium chloride; a surfactant and an adjuvant.
[0026] In one embodiment, the composition includes at least 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 different glycoconjugates. In one embodiment, the composition is a 24-valent pneumococcal conjugate composition. In one embodiment, the composition is a 25-valent pneumococcal conjugate composition. In one embodiment, the glycoconjugates are pneumococcal polysaccharide-protein conjugates.
[0027] In one embodiment, the glycoconjugates comprise at least one glycoconjugate derived from a Streptococcus pneumoniae serotype selected from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B and combinations thereof. In one embodiment, the carrier protein of the glycoconjugate(s) is a diphtheria cross-reactive material (CRM) 197 ), diphtheria toxoid (DT), tetanus toxoid (TT), C5a-peptidase from Streptococcus (SCP) or rhizavidin [a.a. 45-17 9J-GGGGSSS-SP1500-AAA-SP0785] (CP1).
[0028] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumonia serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and the S. pneumoniae serotypes are conjugated to CRM 197 .
[0029] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and further comprises S. pneumoniae serotypes 1, 5 and 7F. In one embodiment, S. pneumoniae serotypes 1, 4, 5, 7F, 9V and / or 23F are conjugated to PD, S. pneumoniae serotype 18C is conjugated to TT and S. pneumoniae serotype 19F is conjugated to DT.
[0030] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and further comprises S. pneumoniae serotypes 1, 3, 5, 6A, 7F and 19A. In one embodiment, the S. pneumoniae serotypes are conjugated to CRM 197 .
[0031] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and further includes serotypes 1, 3, 5, 6A, 7F, 19A, 22F and 33F of S. pneumoniae. In one embodiment, the S. pneumoniae serotypes are conjugated to CRM 197 .
[0032] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and further includes serotypes 1, 3, 5, 6A, 7F, 8, 10A, 11A, 12F, 15B, 19A, 22F and 33F S. pneumoniae. In one embodiment, the S. pneumoniae serotypes are conjugated to CRM 197 .
[0033] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and further includes serotypes 1, 2, 3, 5, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F and 33F S. pneumoniae.
[0034] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and further includes serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F and 33F of S. pneumoniae. In one embodiment, the S. pneumoniae serotypes are conjugated to CRM 197 .
[0035] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and 35B. In one embodiment, the S. pneumoniae serotypes are conjugated to CRM 197 . In one embodiment, S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B are conjugated to CRM 197 and S. pneumoniae serotype 3 is conjugated to SCP.
[0036] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and further includes glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F and 35B. In one embodiment, the S. pneumoniae serotypes are conjugated to CRM 197 . In one embodiment, S. pneumoniae serotypes 1, 2, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B are conjugated to CRM 197 and S. pneumoniae serotype 3 is conjugated to SCP.
[0037] In one embodiment, the composition comprises at least 25 glycoconjugates comprising at least serotypes 4, 6B, 9V, 14, 18C, 19F and 23F of S. pneumoniae, and further comprises serotypes 1, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 18C, 19A, 22F and 33F of S. pneumoniae. In one embodiment, at least two of the serotypes of S. pneumoniae are conjugated with TT. In one embodiment, the at least two serotypes of S. pneumoniae conjugated with TT are selected from serotypes 1, 3, 5, 15B and 22F of S. pneumoniae. In one embodiment, at least 17 of the S. pneumoniae serotypes are conjugated to CRM 197 In one embodiment, at least 17 serotypes of S. pneumoniae conjugated to CRM 197 i are selected from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F 22F, 23F and 33F of S. pneumoniae.
[0038] In one embodiment, the pneumococcal glycoconjugates are selected from S. pneumoniae serotype 1 conjugated with CRM 197 , serotype 3 S. pneumoniae conjugated with CRM 197 , S. pneumoniae serotype 4 S. pneumoniae conjugated with CRM 197 , S. pneumoniae serotype 5 S. pneumoniae conjugated with CRM 197 , serotype 6A S. pneumoniae conjugated with CRM 197 , serotype 6B S. pneumoniae conjugated with CRM 197 , serotype 7F S. pneumoniae conjugated with CRM 197 , serotype 8 S. pneumoniae conjugated with CRM 197 , serotype 9V S. pneumoniae conjugated with CRM 197 , serotype 10A S. pneumoniae conjugated with CRM 197 , serotype 11A S. pneumoniae conjugated with CRM 197 , serotype 12F S. pneumoniae conjugated with CRM 197 , serotype 14 S. pneumoniae conjugated with CRM 197 , serotype 15A S. pneumoniae conjugated with CRM197 , serotype 15B S. pneumoniae conjugated with CRM 197 , serotype 18C S. pneumoniae conjugated with CRM 197 , serotype 19A S. pneumoniae conjugated with CRM 197 , serotype 19F S. pneumoniae conjugated with CRM 197 , serotype 22F S. pneumoniae conjugated with CRM 197 , serotype 23A S. pneumoniae conjugated with CRM 197 , serotype 23B S. pneumoniae conjugated with CRM 197 , serotype 23F S. pneumoniae conjugated with CRM 197 , serotype 24F S. pneumoniae conjugated with CRM 197 , serotype 33F S. pneumoniae conjugated with CRM 197 , serotype 35B S. pneumoniae conjugated with CRM 197 , and their combinations.
[0039] In one embodiment, the pneumococcal glycoconjugates are selected from S. pneumoniae serotype 1 conjugated with CRM 197 , serotype 3 S. pneumoniae conjugated with SCP, serotype 4 S. pneumoniae conjugated with CRM197 , serotype 5 S. pneumoniae conjugated with CRM 197 , serotype 6A S. pneumoniae conjugated with CRM 197 , serotype 6B S. pneumoniae conjugated with CRM 197 , serotype 7F S. pneumoniae conjugated with CRM 197 , serotype 8 S. pneumoniae conjugated with CRM 197 , serotype 9V S. pneumoniae conjugated with CRM 197 , serotype 10A S. pneumoniae conjugated with CRM 197 , serotype 11A S. pneumoniae conjugated with CRM 197 , serotype 12F S. pneumoniae conjugated with CRM 197 , serotype 14 S. pneumoniae conjugated with CRM 197 , serotype 15A S. pneumoniae conjugated with CRM 197 , serotype 15B S. pneumoniae conjugated with CRM 197 , serotype 18C S. pneumoniae conjugated with CRM 197 , serotype 19A S. pneumoniae conjugated with CRM 197 , serotype 19F S. pneumoniae conjugated with CRM 197, serotype 22F S. pneumoniae conjugated with CRM 197 , serotype 23A S. pneumoniae conjugated with CRM 197 , serotype 23B S. pneumoniae conjugated with CRM 197 , serotype 23F S. pneumoniae conjugated with CRM 197 , serotype 24F S. pneumoniae conjugated with CRM 197 , serotype 33F S. pneumoniae conjugated with CRM 197 , serotype 35B S. pneumoniae conjugated with CRM 197 , and their combinations.
[0040] In one embodiment, the total concentration of the polysaccharide is about 1-100 μg per dose. In one embodiment, the concentration of the polysaccharide for each serotype is about 1-10 μg per dose. In one embodiment, the concentration of the buffer is about 1-50 mM. In one embodiment, the concentration of sodium chloride is about 1-300 mM. In one embodiment, the surfactant is a polysorbate or poloxamer having a molecular weight of about 1100 Da to 17400 Da. In one embodiment, the surfactant is polysorbate 80. In one embodiment, the surfactant is polysorbate 20. In one embodiment, the concentration of the surfactant is about 0.001% to 1%.In one embodiment, the adjuvant is aluminum phosphate. In one embodiment, the concentration of the adjuvant is from about 0.1% to about 1%. In another embodiment, the concentration of the adjuvant is from about 0.01% to about 0.1%. In another embodiment, the concentration of the adjuvant is from about 0.1 to about 1.0 mg / mL. In one embodiment, the concentration of the adjuvant is about 0.025%. In a particular embodiment, the adjuvant is aluminum phosphate at a concentration of about 0.025%.
[0041] In one embodiment, the present invention relates to compositions comprising at least 21 different glycoconjugates; a succinate buffer having a pH in the range of 5.0 to 7.5; sodium chloride; sodium phosphate; a surfactant and an adjuvant.
[0042] In one embodiment, the composition includes at least 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 different glycoconjugates. In one embodiment, the composition is a 24-valent pneumococcal conjugate composition. In one embodiment, the composition is a 25-valent pneumococcal conjugate composition. In one embodiment, the glycoconjugates are pneumococcal polysaccharide-protein conjugates.
[0043] In one embodiment, the glycoconjugates comprise at least one glycoconjugate derived from a Streptococcus pneumoniae serotype selected from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B and combinations thereof. In one embodiment, the carrier protein of the glycoconjugate(s) is diphtheria cross-reactive material (CRM) 197), diphtheria toxoid (DT), tetanus toxoid (TT), C5a-peptidase from Streptococcus (SCP) or rhizavidin [a.k.a. 45-179J-GGGGSSS-SP1500-AAA-SP0785] (CP1).
[0044] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and the S. pneumoniae serotypes are conjugated to CRM 197 .
[0045] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and further comprises S. pneumoniae serotypes 1, 5 and 7F. In one embodiment, S. pneumoniae serotypes 1, 4, 5, 7F, 9V and / or 23F are conjugated to PD, S. pneumoniae serotype 18C is conjugated to TT and S. pneumoniae serotype 19F is conjugated to DT.
[0046] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and further comprises S. pneumoniae serotypes 1, 3, 5, 6A, 7F and 19A. In one embodiment, the S. pneumoniae serotypes are conjugated to CRM 197 .
[0047] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and further includes serotypes 1, 3, 5, 6A, 7F, 19A, 22F and 33F of S. pneumoniae. In one embodiment, the S. pneumoniae serotypes are conjugated to CRM 197 .
[0048] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and further includes serotypes 1, 3, 5, 6A, 7F, 8, 10A, 11A, 12F, 15B, 19A, 22F and 33F S. pneumoniae. In one embodiment, the S. pneumoniae serotypes are conjugated to CRM 197 .
[0049] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and further includes serotypes 1, 2, 3, 5, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F and 33F S. pneumoniae.
[0050] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and further includes serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F and 33F of S. pneumoniae. In one embodiment, the S. pneumoniae serotypes are conjugated to CRM 197 .
[0051] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and 35B. In one embodiment, the S. pneumoniae serotypes are conjugated to CRM 197 . In one embodiment, S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B are conjugated to CRM197 and S. pneumoniae serotype 3 is conjugated to SCP.
[0052] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and further comprises glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F and 35B. In one embodiment, the S. pneumoniae serotypes are conjugated to CRM 197 . In one embodiment, S. pneumoniae serotypes 1, 2, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B are conjugated to CRM 197 and S. pneumoniae serotype 3 is conjugated to SCP.
[0053] In one embodiment, the composition comprises at least 25 glycoconjugates comprising at least serotypes 4, 6B, 9V, 14, 18C, 19F and 23F of S. pneumoniae, and further comprises serotypes 1, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 18C, 19A, 22F and 33F of S. pneumoniae. In one embodiment, at least two of the serotypes of S. pneumoniae are conjugated with TT. In one embodiment, the at least two serotypes of S. pneumoniae conjugated with TT are selected from serotypes 1, 3, 5, 15B and 22F of S. pneumoniae. In one embodiment, at least 17 of the S. pneumoniae serotypes are conjugated to CRM 197 In one embodiment, at least 17 serotypes of S. pneumoniae conjugated to CRM 197 selected from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F 22F, 23F and 33F S. pneumoniae.
[0054] In one embodiment, the pneumococcal glycoconjugates are selected from S. pneumoniae serotype 1 conjugated with CRM 197 , serotype 3 S. pneumoniae conjugated with SCP, serotype 4 S. pneumoniae conjugated with CRM 197 , serotype 5 S. pneumoniae conjugated with CRM 197 , serotype 6A S. pneumoniae conjugated with CRM 197 , serotype 6B S. pneumoniae conjugated with CRM 197 , serotype 7F S. pneumoniae conjugated with CRM 197 , serotype 8 S. pneumoniae conjugated with CRM 197 , serotype 9V S. pneumoniae conjugated with CRM 197 , serotype 10A S. pneumoniae conjugated with CRM 197 , serotype 11A S. pneumoniae conjugated with CRM 197 , serotype 12F S. pneumoniae conjugated with CRM 197 , serotype 14 S. pneumoniae conjugated with CRM 197 , serotype 15A S. pneumoniae conjugated with CRM 197, serotype 15B S. pneumoniae conjugated with CRM 197 , serotype 18C S. pneumoniae conjugated with CRM 197 , serotype 19A S. pneumoniae conjugated with CRM 197 , serotype 19F S. pneumoniae conjugated with CRM 197 , serotype 22F S. pneumoniae conjugated with CRM 197 , serotype 23A S. pneumoniae conjugated with CRM 197 , serotype 23B S. pneumoniae conjugated with CRM 197 , serotype 23F S. pneumoniae conjugated with CRM 197 , serotype 24F S. pneumoniae conjugated with CRM 197 , serotype 33F S. pneumoniae conjugated with CRM 197 , serotype 35B S. pneumoniae conjugated with CRM 197 , and their combinations.
[0055] In one embodiment, the pneumococcal glycoconjugates are selected from S. pneumoniae serotype 1 conjugated with CRM 197 , serotype 3 S. pneumoniae conjugated with CRM 197, S. pneumoniae serotype 4 S. pneumoniae conjugated with CRM 197 , S. pneumoniae serotype 5 S. pneumoniae conjugated with CRM 197 , serotype 6A S. pneumoniae conjugated with CRM 197 , serotype 6B S. pneumoniae conjugated with CRM 197 , serotype 7F S. pneumoniae conjugated with CRM 197 , serotype 8 S. pneumoniae conjugated with CRM 197 , serotype 9V S. pneumoniae conjugated with CRM 197 , serotype 10A S. pneumoniae conjugated with CRM 197 , serotype HA S. pneumoniae conjugated with CRM 197 , serotype 12F S. pneumoniae conjugated with CRM 197 , serotype 14 S. pneumoniae conjugated with CRM 197 , serotype 15A S. pneumoniae conjugated with CRM 197 , serotype 15B S. pneumoniae conjugated with CRM 197 , serotype 18C S. pneumoniae conjugated with CRM 197 , serotype 19A S. pneumoniae conjugated with CRM 197, serotype 19F S. pneumoniae conjugated with CRM 197 , serotype 22F S. pneumoniae conjugated with CRM 197 , serotype 23A S. pneumoniae conjugated with CRM 197 , serotype 23B S. pneumoniae conjugated with CRM 197 , serotype 23F S. pneumoniae conjugated with CRM 197 , serotype 24F S. pneumoniae conjugated with CRM 197 , serotype 33F S. pneumoniae conjugated with CRM 197 , serotype 35B S. pneumoniae conjugated with CRM 197 , and their combinations.
[0056] In one embodiment, the total concentration of polysaccharide is about 1-100 μg per dose. In one embodiment, the concentration of polysaccharide for each serotype is about 1-10 μg per dose. In one embodiment, the concentration of buffer is about 1-50 mM. In one embodiment, the concentration of sodium chloride is about 1-300 mM. In one embodiment, the concentration of calcium chloride is about 1-50 mM. In one embodiment, the surfactant is polysorbate or poloxamer having a molecular weight of about 1100 Da to 17400 Da. In one embodiment, the surfactant is polysorbate 80. In one embodiment, the surfactant is polysorbate 20.In one embodiment, the surfactant concentration is between about 0.001% and 1%. In one embodiment, the adjuvant is aluminum phosphate. In one embodiment, the adjuvant concentration is between about 0.1% and 1%.
[0057] In one embodiment, the present invention relates to compositions comprising at least 21 different glycoconjugates; a histidine buffer having a pH in the range of 5.0 to 7.5; sodium chloride; a surfactant and an adjuvant.
[0058] In one embodiment, the composition includes at least 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 different glycoconjugates. In one embodiment, the composition is a 24-valent pneumococcal conjugate composition. In one embodiment, the composition is a 25-valent pneumococcal conjugate composition. In one embodiment, the glycoconjugates are pneumococcal polysaccharide-protein conjugates.
[0059] In one embodiment, the glycoconjugates comprise at least one glycoconjugate derived from a Streptococcus pneumoniae serotype selected from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B and combinations thereof. In one embodiment, the carrier protein of the glycoconjugate(s) is a diphtheria cross-reactive material (CRM) 197), diphtheria toxoid (DT), tetanus toxoid (TT), C5a-peptidase from Streptococcus (SCP) or rhizavidin [a.k.a. 45-179J-GGGGSSS-SP1500-AAA-SP0785] (CP1).
[0060] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and the S. pneumoniae serotypes are conjugated to CRM 197 .
[0061] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and further comprises S. pneumoniae serotypes 1, 5 and 7F. In one embodiment, S. pneumoniae serotypes 1, 4, 5, 7F, 9V and / or 23F are conjugated to PD, S. pneumoniae serotype 18C is conjugated to TT and S. pneumoniae serotype 19F is conjugated to DT.
[0062] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and further comprises S. pneumoniae serotypes 1, 3, 5, 6A, 7F and 19A. In one embodiment, the S. pneumoniae serotypes are conjugated to CRM 197 .
[0063] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and further includes serotypes 1, 3, 5, 6A, 7F, 19A, 22F and 33F of S. pneumoniae. In one embodiment, the S. pneumoniae serotypes are conjugated to CRM 197 .
[0064] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and further includes serotypes 1, 3, 5, 6A, 7F, 8, 10A, 11A, 12F, 15B, 19A, 22F and 33F S. pneumoniae. In one embodiment, the S. pneumoniae serotypes are conjugated to CRM 197 .
[0065] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and further includes serotypes 1, 2, 3, 5, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F and 33F S. pneumoniae.
[0066] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and further includes serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F and 33F of S. pneumoniae. In one embodiment, the S. pneumoniae serotypes are conjugated to CRM 197 .
[0067] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and 35B. In one embodiment, the S. pneumoniae serotypes are conjugated to CRM 197 . In one embodiment, S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, and 35B are conjugated to CRM197 and S. pneumoniae serotype 3 is conjugated to SCP.
[0068] In one embodiment, the composition comprises at least 25 glycoconjugates, including at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and further includes glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F and 35B. In one embodiment, the S. pneumoniae serotypes are conjugated to CRM 197 . In one embodiment, S. pneumoniae serotypes 1, 2, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B are conjugated to CRM 197 and S. pneumoniae serotype 3 is conjugated to SCP.
[0069] In one embodiment, the composition comprises at least 25 glycoconjugates comprising at least serotypes 4, 6B, 9V, 14, 18C, 19F and 23F of S. pneumoniae, and further comprises serotypes 1, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 18C, 19A, 22F and 33F of S. pneumoniae. In one embodiment, at least two of the serotypes of S. pneumoniae are conjugated with TT. In one embodiment, the at least two serotypes of S. pneumoniae conjugated with TT are selected from serotypes 1, 3, 5, 15B and 22F of S. pneumoniae. In one embodiment, at least 17 of the S. pneumoniae serotypes are conjugated to CRM 197 In one embodiment, at least 17 serotypes of S. pneumoniae conjugated to CRM 197 selected from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F 22F, 23F and 33F S. pneumoniae.
[0070] In one embodiment, the pneumococcal glycoconjugates are selected from S. pneumoniae serotype 1 conjugated with CRM 197 , serotype 3 S. pneumoniae conjugated with CRM 197 , serotype 4 S. pneumoniae conjugated with CRM 197 , serotype 5 S. pneumoniae conjugated with CRM 197 , serotype 6A S. pneumoniae conjugated with CRM 197 , serotype 6B S. pneumoniae conjugated with CRM 197 , serotype 7F S. pneumoniae conjugated with CRM 197 , serotype 8 S. pneumoniae conjugated with CRM 197 , serotype 9V S. pneumoniae conjugated with CRM 197 , serotype 10A S. pneumoniae conjugated with CRM 197 , serotype HA S. pneumoniae conjugated with CRM 197 , serotype 12F S. pneumoniae conjugated with CRM 197 , serotype 14 S. pneumoniae conjugated with CRM 197 , serotype 15A S. pneumoniae conjugated with CRM 197, serotype 15B S. pneumoniae conjugated with CRM 197 , serotype 18C S. pneumoniae conjugated with CRM 197 , serotype 19A S. pneumoniae conjugated with CRM 197 , serotype 19F S. pneumoniae conjugated with CRM 197 , serotype 22F S. pneumoniae conjugated with CRM 197 , serotype 23A S. pneumoniae conjugated with CRM 197 , serotype 23B S. pneumoniae conjugated with CRM 197 , serotype 23F S. pneumoniae conjugated with CRM 197 , serotype 24F S. pneumoniae conjugated with CRM 197 , serotype 33F S. pneumoniae conjugated with CRM 197 , serotype 35B S. pneumoniae conjugated with CRM 197 , and their combinations.
[0071] In one embodiment, the pneumococcal glycoconjugates are selected from S. pneumoniae serotype 1 conjugated with CRM 197 , serotype 3 conjugated with SCP, serotype 4 S. pneumoniae conjugated with CRM 197, serotype 5 S. pneumoniae conjugated with CRM 197 , serotype 6A S. pneumoniae conjugated with CRM 197 , serotype 6B S. pneumoniae conjugated with CRM 197 , serotype 7F S. pneumoniae conjugated with CRM 197 , serotype 8 S. pneumoniae conjugated with CRM 197 , serotype 9V S. pneumoniae conjugated with CRM 197 , serotype 10A S. pneumoniae conjugated with CRM 197 , serotype 11A S. pneumoniae conjugated with CRM 197 , serotype 12F S. pneumoniae conjugated with CRM 197 , serotype 14 S. pneumoniae conjugated with CRM 197 , serotype 15A S. pneumoniae conjugated with CRM 197 , serotype 15B S. pneumoniae conjugated with CRM 197 , serotype 18C S. pneumoniae conjugated with CRM 197 , serotype 19A S. pneumoniae conjugated with CRM 197 , serotype 19F S. pneumoniae conjugated with CRM 197, serotype 22F S. pneumoniae conjugated with CRM 197 , serotype 23A S. pneumoniae conjugated with CRM 197 , serotype 23B S. pneumoniae conjugated with CRM 197 , serotype 23F S. pneumoniae conjugated with CRM 197 , serotype 24F S. pneumoniae conjugated with CRM 197 , serotype 33F S. pneumoniae conjugated with CRM 197 , serotype 35B S. pneumoniae conjugated with CRM 197 , and their combinations.
[0072] In one embodiment, the total concentration of polysaccharides is about 1-100 μg per dose. In one embodiment, the concentration of polysaccharide of each serotype is about 1-10 μg per dose. In one embodiment, the concentration of the buffer is about 1-50 mM. In one embodiment, the concentration of sodium chloride is about 1-300 mM. In one embodiment, the concentration of sodium phosphate is about 1-50 mM. In one embodiment, the surfactant is a polysorbate or poloxamer having a molecular weight of about 1100 Da to 17400 Da. In one embodiment, the surfactant is polysorbate 80. In one embodiment, the surfactant is polysorbate 20.In one embodiment, the surfactant concentration is between about 0.001% and 1%. In one embodiment, the adjuvant is aluminum phosphate. In one embodiment, the adjuvant concentration is between about 0.1% and 1%.
[0073] In one embodiment, the composition comprises 25 glycoconjugates, 5 mM succinate pH 5.8, 150 mM sodium chloride, 20 mM calcium chloride, 0.02% polysorbate 80 and 0.25 mg / mL aluminum phosphate. In one embodiment, the 25 glycoconjugates include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof.[007 4] In one embodiment, the formulation includes 25 glycoconjugates, 5 mM succinate pH 5.8, 40 mM sodium phosphate, 245 mM sodium chloride, 0.02% polysorbate 80, and 0.25 mg / mL aluminum phosphate. In one embodiment, the 25 glycoconjugates include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof.
[0075] In one embodiment, the composition comprises 25 glycoconjugates, 25 mM histidine pH 5.8, 245 mM sodium chloride, 0.02% polysorbate 80 and 0.25 mg / ml aluminum phosphate. In one embodiment, the 25 glycoconjugates include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B and combinations thereof.
[0076] In one embodiment, the present invention relates to a composition comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, wherein at time T0, substantially all of the at least 25 different glycoconjugates are dissolved in a liquid phase or adsorbed onto the insoluble aluminum phosphate adjuvant as a fully dispersed liquid suspension and the at least 25 different glycoconjugates are present at a concentration C0 in the liquid phase; at time T1, a portion of the at least 25 different glycoconjugates adsorbed onto the insoluble adjuvant precipitate from the liquid phase to form a precipitate and the at least 25 different glycoconjugates are present at a concentration C0 in the liquid phase;at time T2, an additional portion of the at least 25 different glycoconjugates adsorbed on the insoluble adjuvant precipitates from the liquid phase to form a sediment and the at least 25 different glycoconjugates are present at a concentration of C2 in the liquid phase; and wherein the sedimentation rate is measured over time by static multiple light scattering to detect particle migration in the liquid, wherein the measuring head comprises a pulsed near infrared light source having a wavelength of approximately 880 nm and having synchronous transmission detectors 180° from the light source and backscatter detectors 45° from the light source that move along the height of a flat-bottomed cylindrical glass sample cuvette to obtain sediment data every 20 μm;
[0077] In one embodiment, T0 is 0 hours. In one embodiment, T1 is about 0.01 hours to 4 hours. In one embodiment, T1 is about 1 hour to 2 hours. In one embodiment, T2 is about 1 hour to 5 hours. In one embodiment, T2 is about 4 hours. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2.
[0078] In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 0 mm to 20 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is at least 2 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is approximately 2 mm to 25 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 10 mm. In one embodiment, the sedimentation rate of the sedimentation front is less than the peak thickness of 10 mm at a time of approximately 1 hour and exceeds the peak thickness of 18 mm at a time of approximately 4 hours.
[0079] In one embodiment, the invention further comprises a time point T3, wherein at time point T3, the sedimentation of the glycoconjugate adsorbed on the insoluble aluminum phosphate is in equilibrium with the liquid phase. In one embodiment, T3 is from about 2 hours to 5 hours. In one embodiment, at T3, the peak thickness of the sedimentation front is from about 25 mm to 35 mm. In one embodiment, the composition is at rest for about 1 month. In one embodiment, the composition is at rest for about 2 weeks. In one embodiment, the composition is stored in a container. In one embodiment, the container is a syringe. In one embodiment, after T3, the composition is resuspended by 1-10 manual shakings.In one embodiment, after T3, the composition is resuspended by 1 manual shake. In one embodiment, the composition comprises the formulation described above.
[0080] In one embodiment, the present invention relates to a liquid-filled container comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, wherein: at time T0, substantially all of the at least 25 different glycoconjugates are dissolved in a liquid phase or adsorbed onto the insoluble aluminum phosphate adjuvant as a fully dispersed liquid suspension and the at least 25 different glycoconjugates are present at a concentration of C0 in the liquid phase; at time T1, a portion of the at least 25 different glycoconjugates adsorbed onto the insoluble adjuvant precipitate from the liquid phase to form a precipitate and the at least 25 different glycoconjugates have a concentration of C1 in the liquid phase;at time T2, an additional portion of the at least 25 different glycoconjugates adsorbed on the insoluble adjuvant precipitates from the liquid phase to form a sediment and the at least 25 different glycoconjugates are present at a concentration of C2 in the liquid phase; and wherein the sedimentation rate is measured over time by static multiple light scattering to detect particle migration in the liquid, wherein the measuring head comprises a pulsed near infrared light source having a wavelength of approximately 880 nm and having synchronous transmission detectors 180° from the light source and backscatter detectors 45° from the light source that move along the height of a flat-bottomed cylindrical glass sample cuvette to obtain sediment data every 20 μm;
[0081] In one embodiment, T0 is 0 hours. In one embodiment, T1 is about 0.01 hours to 4 hours. In one embodiment, T1 is about 1 hour to 2 hours. In one embodiment, T2 is about 1 hour to 5 hours. In one embodiment, T2 is about 4 hours. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2.
[0082] In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 0 mm to 20 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is at least 2 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is approximately 2 mm to 25 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 10 mm.
[0083] In one embodiment, the invention further comprises a time point T3, wherein at time point T3, the sedimentation of the glycoconjugate adsorbed on the insoluble aluminum phosphate is in equilibrium with the liquid phase. In one embodiment, T3 is from about 2 hours to 5 hours. In one embodiment, at T3, the peak thickness of the sedimentation front is from about 25 mm to 35 mm. In one embodiment, the container is at rest for about 1 month. In one embodiment, the container is at rest for at least 2 weeks. In one embodiment, the container is a syringe. In one embodiment, after T3, the composition is resuspended by 1-10 manual shakings. In one embodiment, after T3, the composition is resuspended by 1 manual shaking.In one embodiment, the liquid comprises the composition described above. BRIEF DESCRIPTION OF THE DRAWINGS.
[0084] Fig. 1 shows the sedimentation rate of various vaccine formulations by plotting the peak thickness (also known as sedimentation front) versus time (h).
[0085] Fig. 2 shows the area on the graph (shaded) between the sedimentation curve of the control composition with seven serotypes and the sedimentation curve of the control composition with 20 serotypes.
[0086] Fig. 3 shows the area on the graph (shaded) between the sedimentation curve of the control composition with seven serotypes and the sedimentation curve of the control composition with 25 serotypes.
[0087] Fig. 4 shows the sediment height of various vaccine formulations.
[0088] Fig. 5 shows the resuspension of various formulations after being left at rest for 3 days or 2 weeks.
[0089] Figure 6 graphically represents the number of manual vortexes required to resuspend the test samples in a prefilled syringe (PFS) at 2 days, 7 days, and 30 days after syringe storage. The tested samples included samples with and without LiNA-2A (as discussed in Example 6).
[0090] Fig. 7 graphically represents the number of manual vortexes required to resuspend the test samples in a pre-filled syringe (PFS) at time points of 0 days, 7 days, and 30 days after syringe storage. The tested samples included samples with and without LiNA-2A (as discussed in Example 6). DETAILED DESCRIPTION OF THE INVENTION
[0091] The present invention is based on the fundamental discovery of vaccine formulations for pneumococcal vaccines that facilitate the resuspension of particles that precipitate from the liquid phase to ensure dose accuracy and long-term stability.
[0092] Before describing the present compositions and methods, it should be understood that the present invention is not limited to the specific compositions, methods, and experimental conditions described, as such compositions, methods, and conditions may vary. It should also be understood that the terminology used in this description is intended only to describe particular embodiments and is not intended to be limiting, since the scope of the present invention is limited only by the appended claims.
[0093] As used in this specification and the appended claims, the singular form "a" includes plural references unless the context clearly requires otherwise. Thus, for example, reference to "a method" includes one or more methods and / or steps of the type described herein that will become apparent to those skilled in the art after reading this text, etc.
[0094] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
[0095] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, it is understood that modifications and variations are encompassed within the spirit and scope of the present invention. Preferred methods and materials are described below. Vaccine formulations
[0096] In some embodiments, the vaccine formulations of the present invention comprise one or more of the following immunogens: natural or artificially produced proteins, recombinant proteins, glycoproteins, peptides, carbohydrates, saccharides, nucleic acids, haptens, whole viruses, bacteria, protozoa or virus-like particles, or conjugates thereof. Illustrative nucleic acids or polynucleotides of the vaccine formulations include, but are not limited to, ribonucleic acids (RNA), including mRNA, and deoxyribonucleic acids (DNA). In some embodiments, the vaccine formulations include DNA encoding a polypeptide or fragment thereof described herein. In some embodiments, the vaccine formulations include RNA encoding a polypeptide or fragment thereof described herein. In some embodiments, the vaccine formulations include an mRNA polynucleotide encoding a polypeptide or fragment thereof described herein.In some embodiments, the vaccine formulations include a modified RNA molecule (modRNA).
[0097] In some embodiments, the vaccine formulations of the present invention comprise capsular saccharide antigens, optionally wherein the capsular saccharides are conjugated. The vaccine formulations of the present invention typically comprise conjugated capsular saccharide antigens (also referred to as glycoconjugates), wherein the saccharides are derived from S. pneumoniae serotypes.
[0098] It is preferred that the number of capsular saccharides of S. pneumoniae is at least 25 different serotypes (or "v", valences, "25v"). In one embodiment, there are 21 different serotypes. In one embodiment, there are 22 different serotypes. In one embodiment, there are 23 different serotypes. In one embodiment, there are 24 different serotypes. In one embodiment, there are 25 different serotypes. In one embodiment, there are 26 different serotypes. In one embodiment, there are 27 different serotypes. In one embodiment, there are 28 different serotypes. In one embodiment, there are 29 different serotypes. In one embodiment, there are 30 different serotypes. In one embodiment, there are 31 different serotypes. In one embodiment, there are 32 different serotypes.In one embodiment, there are 32 different serotypes. In one embodiment, there are 33 different serotypes. In one embodiment, there are 34 different serotypes. In one embodiment, there are 35 different serotypes. The capsular saccharides are conjugated to a carrier protein to form glycoconjugates, as described below.
[0099] In a preferred embodiment, each of the saccharides is individually conjugated to different carrier protein molecules (each carrier protein molecule has only one type of saccharide conjugated to it). In this embodiment, the capsular saccharides are said to be individually conjugated to the carrier protein.
[0100] For the purposes of the invention, the term "glycoconjugate" refers to a capsular saccharide linked either covalently or through a high-affinity interaction to a carrier protein. In one embodiment, the capsular saccharide is linked directly to the carrier protein. In a second embodiment, the capsular saccharide is linked to the protein via a spacer / linker. Carrier proteins
[0101] In a preferred embodiment, the glycoconjugate carrier protein is selected from the group consisting of: DT (diphtheria toxoid), TT (tetanus toxoid) or fragment C of TT, CRM 197 (a non-toxic but antigenically identical variant of diphtheria toxin), other DT mutants (such as CRM 176 , CRM 228 , CRM 45 (Uchida et al. (1973) J. Biol. Chem. 218:3838-384 4), CRM9, CRM 102 , CRM 103 or CRM 107; and other mutations described by Nicholls and Youle in Genetically Engineered Toxins, Ed: Frankel, Maecel Dekker Inc. (1992); deletion or mutation of Glu-148 to Asp, Gln, or Ser and / or Ala 158 to Gly and other mutations described in U.S. Pat. Nos. 4,709,017 and 4,950,740; mutation of at least one or more residues from Lys 516, Lys 526, Phe 530, and / or Lys 534 and other mutations described in U.S. Pat. Nos. 5,917,017 and 6,455,673; or the fragment described in U.S. Pat. No. 5,843,711), pneumococcal pneumolysin (ply) (Kuo et al.(1995) Infect Immune 63:2706-2713), including ply inactivated in some manner, such as dPLY-GMBS (WO 2004 / 081515, WO 2006 / 032499) or dPLY-formol, PhtX, including PhtA, PhtB, PhtD, PhtE (the sequences of PhtA, PhtB, PhtD or PhtE are provided in WO 00 / 37105 and WO 00 / 39299) and fusion constructs of Pht proteins, such as PhtDE fusion constructs, PhtBE fusion constructs, Pht A-E (WO 01 / 98334, WO 03 / 054007, WO 2009 / 000826), OMPC (meningococcal outer membrane protein), which is usually extracted from Neisseria meningitidis serogroup B (EP0372501), PorB (from M. meningitidis), PD (protein D of Haemophilus influenzae; see, e.g. EP0594610 B), or their immunologically functional equivalents, synthetic peptides (EP0378881, EP0427347), heat shock proteins (WO 93 / 17712, WO 94 / 03208), pertussis proteins (WO 98 / 58668, EP0471177), cytokines, lymphokines, growth factors or hormones (WO 91 / 01146), artificial proteins containing multiple human CD4+ T cell epitopes from different pathogen-derived antigens (Falugi et al. (2001) Eur J Immunol 31:3816-3824), such as the N19 protein (Baraldoi et al. (2004) Infect Immun 72:4884-4887), pneumococcal surface protein PspA (WO 02 / 091998), iron uptake proteins (WO 01 / 72337), Clostridium difficile toxin A or B (WO 00 / 61761), transferrin-binding proteins, pneumococcal adhesion protein (PsaA), recombinant Pseudomonas aeruginosa exotoxin A (in particular its non-toxic mutants (such as exotoxin A having a glutamic acid 553 substitution (Douglas et al. (1987) J. Bacteriol. 169(11): 4967-4971)).Other proteins such as ovalbumin, keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA), or purified protein derivative of tuberculin (PPD) can also be used as carrier proteins. Other suitable carrier proteins include inactivated bacterial toxins such as cholera toxoid (e.g., as described in WO 2004 / 083251), Escherichia coli LT, E. coli ST, and P. aeruginosa exotoxin A. Another suitable carrier protein is Streptococcus C5a-peptidase (SCP). Another suitable carrier protein is rhizavidin [a.a. 45-179J-GGGGSSS-SP1500-AAA-SP0785] (CP1).
[0102] In a preferred embodiment, the glycoconjugate carrier protein is independently selected from the group consisting of TT, DT, DT mutants (such as CRM 197), H. influenzae protein D, PhtX, PhtD, PhtDE fusion constructs (in particular those described in WO 01 / 98334 and WO 03 / 054007), inactivated pneumolysin, PorB, N19 protein, PspA, OMPC, C. difficile toxin A or B, PsaA, Streptococcus C5a peptidase (SCP) and biotin-streptavidin.
[0103] In one embodiment, the carrier protein of the glycoconjugates of the invention is DT (diphtheria toxoid). In another embodiment, the carrier protein of the glycoconjugates of the invention is TT (tetanus toxoid). In one embodiment, the carrier protein for the glycoproteins is C5a-peptidase from Streptococcus (SCP). In another embodiment, the carrier protein for the glycoconjugates of the invention is PD (protein D of I. influenzae; see, for example, EP0594610B).
[0104] In a preferred embodiment, the capsular saccharides of the invention are conjugated to the CRM197 protein. The CRM197 protein is a non-toxic form of diphtheria toxin, but is immunologically indistinguishable from diphtheria toxin. CRM 197 produced by Corynebacterium diphtheria infected with the nontoxigenic phage β197tox-, created by nitrosoguanidine mutagenesis of the toxigenic corynephage-β (Uchida et al. (1971) Nature New Biology 233:8-11). The CRM protein 197 It has the same molecular weight as diphtheria toxin but differs from it by a single base change (guanine to adenine) in the structural gene. This single base change causes an amino acid substitution (glutamic acid instead of glycine) in the mature protein and eliminates the toxic properties of diphtheria toxin. The CRM protein 197 is a safe and effective T-cell-dependent saccharide carrier. More details about CRM 197and its production can be found, for example, in US Patent No. 5,614,382.
[0105] In one embodiment, the capsular saccharides of the invention are conjugated to a CRM protein 197 or the A-chain of CRM197 (see CN 103495161). In one embodiment, the capsular saccharides of the invention are conjugated to the A-chain of CRM197 obtained by expression in genetically recombinant E. coli (see CN 103495161). In one embodiment, all of the capsular saccharides of the invention are conjugated to CRM 197 In one embodiment, all of the capsular saccharides of the invention are conjugated to the A chain of CRM197.
[0106] Accordingly, in frequent embodiments, the glycoconjugates of the invention comprise CRM197 as a carrier protein, wherein a capsular polysaccharide is covalently linked to CRM197. Capsular saccharides
[0107] The term "saccharide" throughout the present description may refer to a polysaccharide or an oligosaccharide and includes both. In frequent embodiments, the saccharide is a polysaccharide, in particular the capsular polysaccharide of S. pneumoniae.
[0108] Capsular polysaccharides are prepared by standard methods known to those of ordinary skill in the art.
[0109] In the context of the present invention, capsular polysaccharides can be obtained or can be derived from, for example, serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and 35B of S. pneumoniae. Typically, capsular polysaccharides are obtained by growing each serotype of S. pneumoniae in a medium (for example, in a soy-based medium), and then obtaining polysaccharides from the bacterial culture. The bacterial strains of S. pneumoniae used to produce the corresponding polysaccharides that are used in the glycoconjugates of the invention can be obtained from publicly known culture collections or clinical samples.
[0110] In one embodiment, the composition includes at least 21 different polysaccharides. In one embodiment, the composition includes at least 22 different polysaccharides. In one embodiment, the composition includes at least 23 different polysaccharides. In one embodiment, the composition includes at least 24 different polysaccharides. In one embodiment, the composition includes at least 25 different polysaccharides. In one embodiment, the composition includes at least 26 different polysaccharides. In one embodiment, the composition includes at least 27 different polysaccharides. In one embodiment, the composition includes at least 28 different polysaccharides. In one embodiment, the composition includes at least 29 different polysaccharides. In one embodiment, the composition includes at least 30 different polysaccharides.In one embodiment, the composition comprises at least 31 different polysaccharides. In one embodiment, the composition comprises at least 32 different polysaccharides. In one embodiment, the composition comprises at least 33 different polysaccharides. In one embodiment, the composition comprises at least 34 different polysaccharides. In one embodiment, the composition comprises at least 35 different polysaccharides.
[0111] The population of organisms (of each S. pneumoniae serotype) is often scaled up from a seeded vial to seeded bottles and passaged through one or more seed fermentors of increasing volume until production-scale fermentation volumes are reached. At the end of the cell growth cycle, the cells are lysed, and the lysate medium is then collected for further processing (purification) (see, e.g., WO 2006 / 110381, WO 2008 / 118752, and U.S. Patent Application Publications 2006 / 0228380, 2006 / 0228381, 2008 / 0102498, and 2008 / 0286838).
[0112] Individual polysaccharides are typically purified by centrifugation, precipitation, ultrafiltration and / or column chromatography (see, for example, WO 2006 / 110352 and WO 2008 / 118752).
[0113] The purified polysaccharides can be activated (e.g., chemically activated) to become reactive (e.g., with an eTEC spacer) and then incorporated into the glycoconjugates of the invention as described further herein.
[0114] The capsular polysaccharides of S. pneumoniae contain repeating oligosaccharide units that can contain up to 8 sugar residues.
[0115] In one embodiment, the capsular saccharide of the invention may be a single oligosaccharide unit or be shorter than the native saccharide chain length of repeating oligosaccharide units. In one embodiment, the capsular saccharide of the invention is a single repeating oligosaccharide unit of the corresponding serotype.
[0116] In one embodiment, the capsular saccharide of the invention may be an oligosaccharide. Oligosaccharides have a low number of repeating units (typically 5-15 repeating units) and are typically produced synthetically or by hydrolysis of polysaccharides.
[0117] At the same time, it is preferable that all capsular saccharides of the present invention and those present in the vaccine formulations of the present invention are polysaccharides. High-molecular-weight capsular polysaccharides are capable of inducing certain antibody immune responses due to epitopes present on the antigen surface. Preferably, the isolation and purification of high-molecular-weight capsular polysaccharides for use in the conjugates, compositions, and methods of the present invention are provided.
[0118] In some embodiments, the purified polysaccharides prior to conjugation have a molecular weight of 10 kDa to 4000 kDa. In other such embodiments, the polysaccharide has a molecular weight of 50 kDa to 4000 kDa. In other such embodiments, the polysaccharide has a molecular weight of 50 kDa to 3500 kDa. In other such embodiments, the polysaccharide has a molecular weight of 50 kDa to 3000 kDa. In other such embodiments, the polysaccharide has a molecular weight of 50 kDa to 2500 kDa. In other such embodiments, the polysaccharide has a molecular weight of 50 kDa to 2000 kDa. In other such embodiments, the polysaccharide has a molecular weight of 50 kDa to 1750 kDa. In other such embodiments, the polysaccharide has a molecular weight of from 50 kDa to 1500 kDa. In other such embodiments, the polysaccharide has a molecular weight of from 50 kDa to 1250 kDa.In other such embodiments, the polysaccharide has a molecular weight of 50 kDa to 1000 kDa. In other such embodiments, the polysaccharide has a molecular weight of 50 kDa to 750 kDa. In other such embodiments, the polysaccharide has a molecular weight of 50 kDa to 500 kDa. In other such embodiments, the polysaccharide has a molecular weight of 100 kDa to 4000 kDa. In other such embodiments, the polysaccharide has a molecular weight of 100 kDa to 3500 kDa. In other such embodiments, the polysaccharide has a molecular weight of 100 kDa to 3000 kDa. In other such embodiments, the polysaccharide has a molecular weight of 100 kDa to 2500 kDa. In other such embodiments, the polysaccharide has a molecular weight of 100 kDa to 2000 kDa. In other such embodiments, the polysaccharide has a molecular weight of from 100 kDa to 2000 kDa. In other such embodiments, the polysaccharide has a molecular weight of from 100 kDa to 1750 kDa.In other such embodiments, the polysaccharide has a molecular weight of 100 kDa to 1500 kDa. In other such embodiments, the polysaccharide has a molecular weight of 100 kDa to 1250 kDa. In other such embodiments, the polysaccharide has a molecular weight of 100 kDa to 1000 kDa. In other such embodiments, the polysaccharide has a molecular weight of 100 kDa to 750 kDa. In other such embodiments, the polysaccharide has a molecular weight of 100 kDa to 500 kDa. In other such embodiments, the polysaccharide has a molecular weight of 200 kDa to 4000 kDa. In other such embodiments, the polysaccharide has a molecular weight of 200 kDa to 3500 kDa. In other such embodiments, the polysaccharide has a molecular weight of 200 kDa to 3000 kDa. In other such embodiments, the polysaccharide has a molecular weight of 200 kDa to 2500 kDa. In other such embodiments, the polysaccharide has a molecular weight of 200 kDa to 2000 kDa.In other such embodiments, the polysaccharide has a molecular weight of 200 kDa to 2000 kDa. In other such embodiments, the polysaccharide has a molecular weight of 200 kDa to 1750 kDa. In other such embodiments, the polysaccharide has a molecular weight of 200 kDa to 1500 kDa. In other such embodiments, the polysaccharide has a molecular weight of 200 kDa to 1250 kDa. In other such embodiments, the polysaccharide has a molecular weight of 200 kDa to 1000 kDa. In other such embodiments, the polysaccharide has a molecular weight of 200 kDa to 750 kDa. In other such embodiments, the polysaccharide has a molecular weight of 200 kDa to 500 kDa. Any integer within the above ranges is contemplated as an embodiment of the invention.
[0119] The polysaccharide may undergo some reduction in size during normal purification procedures. Additionally, as described herein, the polysaccharide can be subjected to size reduction methods prior to conjugation. Mechanical or chemical size reduction can be used. Chemical hydrolysis can be carried out using acetic acid. Mechanical size reduction can be carried out using grinding by high-pressure homogenization. The molecular weight ranges mentioned above apply to purified polysaccharides prior to conjugation (e.g., prior to activation).
[0120] In a preferred embodiment, the purified polysaccharides are capsular polysaccharide from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F or 35B, wherein the capsular polysaccharide has a molecular weight falling within one of the molecular weight ranges as described herein above.
[0121] As used herein, the term "molecular weight" of a polysaccharide or a conjugate of a carrier protein and a polysaccharide refers to the molecular weight calculated by size exclusion chromatography (SEC) in combination with a multi-angle laser light scattering (MALLS) detector.
[0122] In some embodiments, the pneumococcal saccharides of serotypes 9V, 18C, 11A, 15B, 22F and / or 33F of the invention are O-acetylated. In some embodiments, the pneumococcal saccharides of serotypes 9V, 11A, 15B, 22F and / or 33F of the invention are O-acetylated.
[0123] The purified polysaccharides described herein are chemically activated to produce saccharides reactive with a carrier protein. These pneumococcal conjugates are produced by separate processes and formulated into a single dosage formulation as briefly described below and elsewhere in the art. Polysaccharides from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F
[0124] Capsular saccharides from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F can be obtained by standard methods known to those of ordinary skill in the art (see, for example, WO 2006 / 110381). Capsular polysaccharides can be obtained by growing each serotype of S. pneumoniae in a medium; at the end of the growth cycle, the cells are lysed, and then the medium with the lysate is collected for subsequent processing (purification). Individual polysaccharides are typically purified by centrifugation, precipitation, ultrafiltration and / or column chromatography (see, for example, WO 2006 / 110352 and WO 2008 / 118752). The purified polysaccharides can be further processed as described hereinafter to produce the glycoconjugates of the invention. Polysaccharides from S. pneumoniae serotype 8
[0125] The serotype 8 polysaccharide repeating unit consists of a linear tetrasaccharide unit with one glucuronic acid (Glc pA), two glucopyranoses (Glc p ) and one galactopyranose (Galp) (Jones et al. (1957) The Journal of the American Chemical Society. 79(11):2787-2793). All four monosaccharides are linked by 1,4-linkages.
[0126] Serotype 8 saccharides can be obtained directly from bacteria using isolation techniques known to those skilled in the art (see, for example, the methods described in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498 and WO 2008 / 118752). In addition, they can be obtained using synthetic protocols.
[0127] Strains of S. pneumoniae serotype 8 can be obtained from publicly available culture collections (e.g., Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical specimens. Polysaccharides from S. pneumoniae serotype 10A
[0128] The serotype 10A polysaccharide repeat unit consists of a branched hexasaccharide repeat unit with two galactofuranoses (Gal f ), three galactopyranoses (Gal p ), one N-acetylgalactosamine (Gal p NAc) and the backbone phosphoribitol (Jones, S. (2005) Carbohydrate Research 269(1): 175–181). The β-GalpNAc portion has two branching monosaccharides (β-3-Galp and β-6-Galf").
[0129] Serotype 10A saccharides can be obtained directly from bacteria using isolation techniques known to those of ordinary skill in the art (see, for example, the methods described in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498 and WO 2008 / 118752). In addition, they can be obtained using synthetic protocols.
[0130] Strains of S. pneumoniae serotype 10A can be obtained from publicly available culture collections (e.g., Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical specimens. Polysaccharides from S. pneumoniae serotype 11A
[0131] The repeating unit of the polysaccharide serotype 11A consists of a linear tetrasaccharide backbone (two galactopyranoses (Gal p ) and two gluchopyranoses (Glc p )) and pendent phosphoglycerol (Richards et al. (1988) Adv. Exp.Med. Biol. 228:595–597), as shown. The polysaccharide is O-acetylated at several positions and, based on data reported in the literature (Calix et al. (2011) J Bacteriol. 193(19):5271–5278), the overall level of O-acetylation in polysaccharide 11A is approximately 2.6 O-acetyl groups per polysaccharide repeat unit.
[0132] Serotype 11A saccharides can be obtained directly from bacteria using isolation techniques known to those of ordinary skill in the art (see, for example, the methods described in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340 and 2008 / 0102498 and WO 2008 / 118752). In addition, they can be obtained using synthetic protocols.
[0133] Strains of S. pneumoniae serotype HA can be obtained from publicly available culture collections (e.g., Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical specimens. Polysaccharides from S. pneumoniae serotype 12F
[0134] The serotype 12F polysaccharide repeating unit consists of a linear trisaccharide backbone (one N-acetyl fucosamine (Fuc p NAc), one N-acetylgalactosamine (GalpNAc) and one N-acetylmannuronic acid (Man pNAcA)) with two branches: pendent α-galactopyranose (Galp) attached to C3 of Fuc p NAc, and the disaccharide branch of α-Glc p - (1→2)-α-Glc p , attached to C3 Man p NAcA (Leontein et al. (1983) Carbohydrate Research 114(2):257-266.).
[0135] Streptococcus pneumoniae serotype 12F strains can be obtained from publicly available culture collections (e.g., Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical specimens. Polysaccharides from S. pneumoniae serotype 15A
[0136] Capsular saccharides from S. pneumoniae serotype 15A can be obtained by standard methods known to those of ordinary skill in the art (see, for example, WO 2019 / 139692). Isolates of serotype 15A pneumococci can be obtained from the American Type Culture Collection (Manassas). Capsular polysaccharides can be obtained by growing each serotype of S. pneumoniae in a medium; at the end of the growth cycle, the cells are lysed, and then the medium with the lysate is collected for subsequent processing (purification). Individual polysaccharides are typically purified by centrifugation, precipitation, ultrafiltration, and / or column chromatography (see, for example, WO 2006 / 110352 and WO 2008 / 118752). The purified polysaccharides can be further processed as described hereinafter to produce the glycoconjugates of the invention. Polysaccharides from S. pneumoniae serotype 15B
[0137] The serotype 15B polysaccharide repeating unit consists of a branched trisaccharide backbone (one N-acetylglucosamine (Glc p NAc), one galactopyranose (Gal p ) and one glucopyranose (Glc p )) with a disaccharide branch αGa lp -βGal p , linked to the C4 hydroxyl group of Glc p NAc. Phosphoglycerol is linked to the C3 hydroxyl group of the βGal residue p in the disaccharide branch (Jones et al. (2005) Carbohydrate Research 340(3):403–409). The capsular polysaccharide from serotype 15C has an identical backbone structure to serotype 15B but lacks O-acetylation.
[0138] Serotype 15B polysaccharides can be obtained directly from bacteria using isolation techniques known to those of ordinary skill in the art (see, for example, the methods described in U.S. Patent Application Publications 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498 and WO 2008 / 118752). They can also be obtained using synthetic protocols known to those skilled in the art.
[0139] Strains of S. pneumoniae serotype 15B can be obtained from publicly known culture collections (e.g., the American Type Culture Collection (ATCC, Manassas, VA, USA) (e.g., strain deposit No. ATCC10354) or Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA, USA)) or from clinical specimens. Polysaccharides from S. pneumoniae serotype 22F
[0140] The serotype 22F polysaccharide repeating unit consists of a branched pentasaccharide backbone (one glucuronic acid (GlC p A), one glucopyranose (Glc p ), one galactofuranose (Gal f ) and two rhamnopyranoses (Rha p )), where the αGlC branch p attached to the hydroxyl group of C3 βRha p (Richards et al. (1989) Canadian Journal of Chemistry 67(6):1038–1050). Approximately 80% of the C2 hydroxyl groups of the βRha residue p in the repeating unit of the polysaccharide are O-acetylated.
[0141] Serotype 22F polysaccharides can be obtained directly from bacteria using isolation techniques known to those of ordinary skill in the art (see, for example, the methods described in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498 and WO 2008 / 118752). In addition, they can be obtained using synthetic protocols.
[0142] Strains of S. pneumoniae serotype 22F can be obtained from publicly available culture collections (e.g., Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical specimens. Polysaccharides from S. pneumoniae serotypes 23A and 23B
[0143] Capsular saccharides from S. pneumoniae serotypes 23A and 23B can be obtained by standard methods known to those of ordinary skill in the art (see, for example, WO 2019 / 050814). Isolates of serotype 23A pneumococci can be obtained from the Merck Culture Collection, and isolates of serotype 23B can be obtained from the Centers for Disease Control and Prevention (Atlanta, GA). Capsular polysaccharides can be obtained by growing each serotype of S. pneumoniae in medium; at the end of the growth cycle, the cells are lysed, and then the medium with the lysate is collected for subsequent processing (purification). Individual polysaccharides are typically purified by centrifugation, precipitation, ultrafiltration, and / or column chromatography (see, for example, WO 2006 / 110352 and WO 2008 / 118752). The purified polysaccharides can be further processed, as described further herein, to obtain the glycoconjugates of the invention. Polysaccharides from S. pneumoniae serotype 24F
[0144] Capsular saccharides from S. pneumoniae serotype 24F can be obtained by standard methods known to those of ordinary skill in the art (see, for example, WO 2019 / 050815). Isolates of serotype 24F pneumococci can be obtained from the Merck Culture Collection. Capsular polysaccharides can be obtained by growing each serotype of S. pneumoniae in a medium; at the end of the growth cycle, the cells are lysed, and then the medium with the lysate is collected for subsequent processing (purification). Individual polysaccharides are typically purified by centrifugation, precipitation, ultrafiltration, and / or column chromatography (see, for example, WO 2006 / 110352 and WO 2008 / 118752). The purified polysaccharides can be further processed as described hereinafter to produce the glycoconjugates of the invention. Polysaccharides from S. pneumoniae serotype 33F
[0145] The polysaccharide repeating unit of serotype 33F consists of a branched pentasaccharide backbone (two galactopyranoses (Galp ), two galactofuranoses (Gal f ) and one glucopyranose (Glc p ) with terminal αGal p , attached to the hydroxyl group of C2 of the αGal residue p , in the backbone (Lemercinier et al. (2006) Carbohydrate Research 341(1):68–74). It has been reported in the literature that the C2 hydroxyl group of the 3-β-Gal residue f the backbone is O-acetylated.
[0146] Serotype 33F polysaccharides can be obtained from bacteria using isolation techniques known to those of ordinary skill in the art (see, for example, the methods described in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498 and WO 2008 / 118752). In addition, they can be obtained using synthetic protocols.
[0147] Strains of S. pneumoniae serotype 33F can be obtained from publicly available culture collections (e.g., Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical specimens. Polysaccharides from S. pneumoniae serotype 35B
[0148] Capsular saccharides from S. pneumoniae serotype 35B can be obtained by standard methods known to those of ordinary skill in the art (see, for example, WO 2020 / 247299). Isolates of serotype 35B pneumococci can be obtained from the Merck Culture Collection. Capsular polysaccharides can be obtained by growing each serotype of S. pneumoniae in a medium; at the end of the growth cycle, the cells are lysed, and then the medium with the lysate is collected for subsequent processing (purification). Individual polysaccharides are typically purified by centrifugation, precipitation, ultrafiltration, and / or column chromatography (see, for example, WO 2006 / 110352 and WO 2008 / 118752). The purified polysaccharides can be further processed as described hereinafter to produce the glycoconjugates of the invention. Glycoconjugates
[0149] Purified saccharides are chemically activated to produce saccharides (i.e., activated saccharides) capable of reacting with the carrier protein. After activation, each capsular saccharide is individually conjugated to the carrier protein to form a glycoconjugate.
[0150] Within the framework of the present invention, glycoconjugates can be obtained or can originate from, for example, serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and 35B of S. pneumoniae.
[0151] In one embodiment, the composition includes at least 21 different glycoconjugates. In one embodiment, the composition includes at least 22 different glycoconjugates. In one embodiment, the composition includes at least 23 different glycoconjugates. In one embodiment, the composition includes at least 24 different glycoconjugates. In one embodiment, the composition includes at least 25 different glycoconjugates. In one embodiment, the composition includes at least 26 different glycoconjugates. In one embodiment, the composition includes at least 27 different glycoconjugates. In one embodiment, the composition includes at least 28 different glycoconjugates. In one embodiment, the composition includes at least 29 different glycoconjugates. In one embodiment, the composition includes at least 30 different glycoconjugates.In one embodiment, the composition comprises at least 31 different glycoconjugates. In one embodiment, the composition comprises at least 32 different glycoconjugates. In one embodiment, the composition comprises at least 33 different glycoconjugates. In one embodiment, the composition comprises at least 34 different glycoconjugates. In one embodiment, the composition comprises at least 35 different glycoconjugates.
[0152] In one embodiment, each capsular saccharide is conjugated to the same carrier protein. Chemical activation of the saccharides and subsequent conjugation of the carrier protein can be achieved by activation and conjugation methods known in the art and briefly described below. Glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 1EA, 19F, and 23F
[0153] Capsular polysaccharides from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F are prepared by standard methods known to those of ordinary skill in the art (see, for example, WO 2006 / 110381, WO 2008 / 118752, WO 2006 / 110352, and U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2008 / 0102498, and 2008 / 0286838).
[0154] In a preferred embodiment, at least one of the capsular polysaccharides from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F is conjugated to a carrier protein by reductive amination (such as described in U.S. Patent Application Publication Nos. 2006 / 0228380, 2007 / 0231340, 2007 / 0184071 and 2007 / 0184072, WO 2006 / 110381, WO 2008 / 079653, and WO 2008 / 1437 09). In a preferred embodiment, all capsular polysaccharides from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F are conjugated to a carrier protein via reductive amination. Glycoconjugates from S. pneumoniae serotypes 8, 11A, 15B and 22F
[0155] In one embodiment, glycoconjugates of serotypes 8, 11A, 15B, and 22F are prepared by activating the polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide can be attached directly or through a spacer (linker) group to an amino group on the carrier protein. For example, the spacer can be cystamine or cysteamine to form a thiolated polysaccharide that can be attached to the carrier via a thioether linkage obtained after reaction with a maleimide-activated carrier protein (e.g., using GMBS) or a haloacetylated carrier protein (e.g., using iodoacetimide, SIB, S1AB, sulfo-SIAB, SIA, or SBAP).Preferably, a cyanate ester (optionally prepared via CDAP chemistry) is attached to hexanediamine or adipic acid dihydrazide (ADH) and the amino-derivatized saccharide is conjugated to a carrier protein using carbodiimide chemistry (e.g., EDAC or EDC) via a carboxyl group on the carrier protein. Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348, and WO 96 / 129094.
[0156] Other suitable methods use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by reacting the free hydroxyl group of the saccharide with CDI (see Bethell et al. (1979) J. Biol. Chern. 25 4:257 2-257 4; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by reaction with the protein to form a carbamate linkage. This may involve reduction of the anomeric end to a primary hydroxyl group, optional addition / removal of a protecting group from the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a carbamate intermediate of CDI, and attachment of the carbamate intermediate of CDI to the amino group of the protein.
[0157] In preferred embodiments, the glycoconjugates of serotypes 8, 11A, 15B, and 22F of the invention are prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to form aldehyde functional groups from adjacent diols in an individual hexasaccharide unit, (2) reduction of the activated polysaccharide and carrier protein (e.g., CRM 197 ) to form a conjugate. Methods for producing glycoconjugates from serotypes 8, 11A, 15B, and 22F of S. pneumoniae are known and described in WO 2015110941. Glycoconjugates from S. pneumoniae serotype 12F
[0158] In the glycoconjugates from S. pneumoniae serotype 12F of the present invention, the saccharide is selected from the group consisting of a polysaccharide and an oligosaccharide, and the carrier protein is selected from any suitable carrier as described herein or known to those skilled in the art. In some preferred embodiments, the saccharide is a polysaccharide from S. pneumoniae serotype 12F.
[0159] In one embodiment, glycoconjugates from S. pneumoniae serotype 12F are produced using CDAP. The polysaccharides are activated with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide can be attached directly or through a spacer (linker) group to an amino group on a carrier protein (preferably CRM). 197). For example, the spacer can be cystamine or cysteamine to produce a thiolated polysaccharide that can be attached to the carrier via a thioether linkage obtained after reaction with a maleimide-activated carrier protein (e.g., using GMBS) or a haloacetylated carrier protein (e.g., using iodoacetimide, SIB, S1AB, sulfo-SIAB, SIA, or SBAP). Preferably, a cyanate ester (optionally obtained via CDAP chemistry) is attached to hexanediamine or adipic acid dihydrazide (ADH), and the amino-derivatized saccharide is conjugated to the carrier protein using carbodiimide chemistry (e.g., EDAC or EDC) via a carboxyl group on the carrier protein.
[0160] Other conjugation methods use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by the reaction of the free hydroxyl group of the saccharide with CDI (see Bethell et al. (1979) J. Biol. Chern. 25 4:2572–2574; Hearn et al. (1981) J. Chromatogr. 218:509–518), followed by reaction with the protein to form a carbamate linkage. This may involve reduction of the anomeric end to a primary hydroxyl group, optional addition / removal of a protecting group from the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a carbamate intermediate of CDI, and attachment of the carbamate intermediate of CDI to the amino group of the protein.
[0161] In one embodiment, capsular polysaccharides from S. pneumoniae serotype 12F are conjugated to a carrier protein via reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to form aldehyde functional groups from adjacent diols in an individual hexasaccharide unit, (2) reduction of the activated polysaccharide and carrier protein to form a conjugate. Methods for producing glycoconjugates from S. pneumoniae serotype 12F are known and are described in WO 2015110941. Glycoconjugates from S. pneumoniae serotype 15A
[0162] Capsular polysaccharides from S. pneumoniae serotype 15A are obtained by standard methods known to those of ordinary skill in the art (see, for example, WO 2019 / 139692).
[0163] In preferred embodiments, the serotype 15A glycoconjugates of the invention are prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to form aldehyde functional groups from adjacent diols in the individual hexasaccharide unit, (2) reduction of the activated polysaccharide and carrier protein (e.g., CRM 197 ) to form a conjugate. Methods for producing glycoconjugates from S. pneumoniae serotype 15A are known and described in WO 2019 / 139692. Glycoconjugates from S. pneumoniae serotypes 23A and 23B
[0164] Capsular polysaccharides from S. pneumoniae serotypes 23A and 23B are obtained by standard methods known to those of ordinary skill in the art (see, for example, WO 2019 / 050814).
[0165] In preferred embodiments, the glycoconjugates of serotypes 23A and 23B of the invention are prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to form aldehyde functional groups from adjacent diols in an individual hexasaccharide unit, (2) reduction of the activated polysaccharide and carrier protein (e.g., CRM 197 ) to form a conjugate. Methods for producing glycoconjugates from S. pneumoniae serotypes 23A, 23B, and 24F are known and described in WO 2019 / 050814. Glycoconjugates from S. pneumoniae serotype 24F
[0166] Capsular polysaccharides from S. pneumoniae serotype 24F are obtained by standard methods known to those of ordinary skill in the art (see, for example, WO 2019 / 050815).
[0167] In preferred embodiments, the serotype 24F glycoconjugates of the invention are prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to form aldehyde functional groups from adjacent diols in the individual hexasaccharide unit, (2) reduction of the activated polysaccharide and carrier protein (e.g., CRM 197 ) to form a conjugate. Methods for producing glycoconjugates from S. pneumoniae serotype 24F are known and described in WO 2019 / 050815. Glycoconjugates from S. pneumoniae serotype 33F
[0168] In one embodiment, serotype 33F glycoconjugates are prepared by activating a polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide can be attached directly or through a spacer (linker) group to an amino group on a carrier protein (preferably CRM 197). For example, the spacer can be cystamine or cysteamine to produce a thiolated polysaccharide that can be attached to the carrier via a thioether linkage obtained after reaction with a maleimide-activated carrier protein (e.g., using GMBS) or a haloacetylated carrier protein (e.g., using iodoacetimide, SIB, S1AB, sulfo-SIAB, SIA, or SBAP). Preferably, a cyanate ester (optionally obtained via CDAP chemistry) is attached to hexanediamine or adipic acid dihydrazide (ADH), and the amino-derivatized saccharide is conjugated to the carrier protein using carbodiimide chemistry (e.g., EDAC or EDC) via a carboxyl group on the carrier protein. Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348 and WO 96 / 129094.
[0169] Other conjugation methods use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by the reaction of the free hydroxyl group of the saccharide with CDI (see Bethell et al. (1979) J. Biol. Chern. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by reaction with the protein to form a carbamate linkage. This may involve reduction of the anomeric end to a primary hydroxyl group, optional addition / removal of a protecting group from the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a carbamate intermediate of CDI, and attachment of the carbamate intermediate of CDI to the amino group of the protein.
[0170] In certain embodiments, the serotype 33F glycoconjugates of the invention are prepared using reductive amination. In such an embodiment, the serotype 33F glycoconjugates of the invention can be prepared using reductive amination in the aqueous phase (RAC / aqueous). Reductive amination in the aqueous phase has been successfully used to produce pneumococcal conjugate vaccine (see, for example, WO 2006 / 110381). Although preferably, in reductive amination, the serotype 33F glycoconjugates are prepared by reductive amination in DMSO (RAC / DMSO). Due to the difficulties associated with maintaining O-acetyl functionality using the RAC / aqueous process, reductive amination in DMSO is preferred. RAC / DMSO has been successfully used to produce pneumococcal conjugate vaccine (see, for example, WO 2006 / 110381).
[0171] In preferred embodiments, the serotype 33F glycoconjugates of the invention are prepared using eTEC conjugation (hereinafter “eTEC-linked serotype 33F glycoconjugates”), as described, for example, in Examples 1, 2 and 3 and in WO 2014 / 027302. Glycoconjugates from S. pneumoniae serotype 35B
[0172] Capsular polysaccharides from S. pneumoniae serotype 35B are prepared by standard methods known to those of ordinary skill in the art (see, for example, WO 2020 / 247299).
[0173] In preferred embodiments, the serotype 35B glycoconjugates of the invention are prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to form aldehyde functional groups from adjacent diols in the individual hexasaccharide unit, (2) reduction of the activated polysaccharide and carrier protein (e.g., CRM 197) to form a conjugate. Methods for producing glycoconjugates from S. pneumoniae serotype 35B are known and described in WO 2020 / 247299. Combinations of glycoconjugates
[0174] In one embodiment, the vaccine formulations of the invention comprise any of the glycoconjugates or combination of glycoconjugates described herein.
[0175] In one embodiment, the compositions include at least 25 glycoconjugates. In one embodiment, the composition includes at least 21 glycoconjugates. In one embodiment, the composition includes at least 22 glycoconjugates. In one embodiment, the composition includes at least 23 glycoconjugates. In one embodiment, the composition includes at least 24 glycoconjugates. In one embodiment, the composition includes at least 25 glycoconjugates. In one embodiment, the composition includes at least 26 glycoconjugates. In one embodiment, the composition includes at least 27 glycoconjugates. In one embodiment, the composition includes at least 28 glycoconjugates. In one embodiment, the composition includes at least 29 glycoconjugates. In one embodiment, the composition comprises at least 30 glycoconjugates.In one embodiment, the composition comprises at least 31 glycoconjugates. In one embodiment, the composition comprises at least 32 glycoconjugates. In one embodiment, the composition comprises at least 33 glycoconjugates. In one embodiment, the composition comprises at least 34 glycoconjugates. In one embodiment, the composition comprises at least 35 glycoconjugates.
[0176] In one embodiment, the compositions of the present invention include at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F.
[0177] In one embodiment, the compositions of the present invention include at least glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F and 23F.
[0178] In one embodiment, the compositions of the present invention include at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F and 33F.
[0179] In one embodiment, the compositions of the present invention include at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F and 33F.
[0180] In one embodiment, the compositions of the present invention include at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F and 33F.
[0181] In one embodiment, the compositions of the present invention include at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 5, 4, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.
[0182] In one embodiment, the compositions of the present invention include at least glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 4, 5, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F and 33F.
[0183] In one embodiment, the compositions of the present invention include at least glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 22F and 33F.
[0184] In one embodiment, the compositions of the present invention include at least glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 24F, 33F and 35B.
[0185] In one embodiment, the compositions of the present invention include at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.
[0186] In one embodiment, the compositions of the present invention include at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and 35B.
[0187] In one embodiment, the compositions of the present invention include at least one glycoconjugate derived from S. pneumoniae serotype 1, a glycoconjugate of S. pneumoniae serotype 3, a glycoconjugate of S. pneumoniae serotype 4, and a glycoconjugate of S. pneumoniae serotype 4. S. pneumoniae serotype 5 glycoconjugate, S. pneumoniae serotype 6A glycoconjugate, S. pneumoniae serotype 6B glycoconjugate, S. pneumoniae serotype 7F glycoconjugate, S. pneumoniae serotype 8 glycoconjugate, S. pneumoniae glycoconjugate. serotype 9V of S. pneumoniae, glycoconjugate of serotype 10A of S. pneumoniae, glycoconjugate of serotype NA of S. pneumoniae, glycoconjugate of serotype 12F of S. pneumoniae, glycoconjugate of serotype 14 S. pneumoniae, glycoconjugate of S. pneumoniae. S. pneumoniae 15A, S. pneumoniae serotype 15B glycoconjugate, S. pneumoniae serotype 18C glycoconjugate, S. pneumoniae serotype 19A glycoconjugate, S. pneumoniae serotype 19F glycoconjugate, S. pneumoniae serotype glycoconjugate. 22F S. pneumoniae, glycoconjugate of serotype 23A S. pneumoniae, glycoconjugate of serotype 23B S.pneumoniae, S. pneumoniae serotype 23F glycoconjugate, S. pneumoniae serotype 24F glycoconjugate, S. pneumoniae serotype 33F glycoconjugate, S. pneumoniae serotype 35B glycoconjugate, and combinations thereof.
[0188] In one embodiment, the compositions include glycoconjugates derived from S. pneumoniae serotype 1, S. pneumoniae serotype 3 glycoconjugate, S. pneumoniae serotype 4 glycoconjugate, S. pneumoniae serotype 5 glycoconjugate, pneumoniae serotype 5 glycoconjugate. S. pneumoniae serotype 6A glycoconjugate, S. pneumoniae serotype 6B glycoconjugate, S. pneumoniae serotype 7F glycoconjugate, S. pneumoniae serotype 8 glycoconjugate, S. pneumoniae serotype 9V glycoconjugate, S. pneumoniae glycoconjugate. serotype 10A of S. pneumoniae, glycoconjugate of serotype HA of S. pneumoniae, glycoconjugate of serotype 12F of S. pneumoniae, glycoconjugate of serotype 14 of S. pneumoniae, glycoconjugate of serotype 15A, glycoconjugate of S. pneumoniae. 15B S. pneumoniae, glycoconjugate of serotype 18C of S. pneumoniae, glycoconjugate of serotype 19A of S. pneumoniae, glycoconjugate of serotype 19F of S. pneumoniae, glycoconjugate of serotype 22F of S. pneumoniae, glycoconjugate of serotype pneumoniae. 23A S. pneumoniae, glycoconjugate of serotype 23B S. pneumoniae, glycoconjugate of serotype 23F S.pneumoniae, S. pneumoniae serotype 24F glycoconjugate, serotype 33F glycoconjugate, and serotype 35B glycoconjugate.
[0189] In one embodiment, the compositions of the present invention comprise at least glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, and the glycoconjugates are conjugated to CRM 197 .
[0190] In one embodiment, the compositions of the present invention include at least glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, IF, 9V, 14, 18C, 19F and 23F. In one embodiment, the glycoconjugates of S. pneumoniae serotypes 1, 4, 5, IF, 9V and / or 23F are conjugated to PD, the glycoconjugates of S. pneumoniae serotype 18C are conjugated to TT and the glycoconjugates of S. pneumoniae serotype 19F are conjugated to DT.
[0191] In one embodiment, the compositions of the present invention include at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, IF, 9V, 14, 18C, 19A, 19F, 23F and 33F, and the glycoconjugates of the S. pneumoniae serotypes are conjugated to CRM 197 .
[0192] In one embodiment, the compositions of the present invention include at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F and 33F, and the glycoconjugates of the S. pneumoniae serotypes are conjugated to CRM 197 .
[0193] In one embodiment, the compositions of the present invention include at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F and 33F, and the glycoconjugates of the S. pneumoniae serotypes are conjugated to CRM 197 .
[0194] In one embodiment, the compositions of the present invention include at least glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 4, 5, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F and 33F, and the glycoconjugates of the S. pneumoniae serotypes are conjugated to CRM 197 .
[0195] In one embodiment, the compositions of the present invention include at least glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 9N, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 22F and 33F. In one embodiment, the glycoconjugates of S. pneumoniae serotypes are conjugated to CRM 197 . In one embodiment, glycoconjugates of S. pneumoniae serotypes 1, 2, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24 F, 33F, and 35B are conjugated to CRM 197 and S. pneumoniae serotype 3 glycoconjugates are conjugated to SCP.
[0196] In one embodiment, the formulations of the present invention comprise at least glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23B, 24F, 33F and 35B. In one embodiment, the glycoconjugates of S. pneumoniae serotypes are conjugated to CRM 197 . In one embodiment, glycoconjugates of S. pneumoniae serotypes 1, 2, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23B, 24F, 33F and 35B are conjugated to CRM 197 , and S. pneumoniae serotype 3 glycoconjugates are conjugated to SCP.
[0197] In one embodiment, the compositions of the present invention include at least glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 24F, 33F and 35B. In one embodiment, at least two of the glycoconjugates of the S. pneumoniae serotypes are conjugated to TT. In one embodiment, at least two glycoconjugates of S. pneumoniae serotypes conjugated to TT are selected from serotypes 1, 3, 5, 15B and 22F of S. pneumoniae. In one embodiment, at least 17 of the glycoconjugates of S. pneumoniae serotypes are conjugated to CRM 197 In one embodiment, at least 17 glycoconjugates of S. pneumoniae serotypes conjugated to CRM 197 r are selected from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F 22F, 23F and 33F of S. pneumoniae.
[0198] In one embodiment, the compositions of the present invention include at least glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F. In one embodiment, the glycoconjugates of S. pneumoniae serotypes 1, 4, 5, 7F, 9V and / or 23F are conjugated to PD, the glycoconjugates of S. pneumoniae serotype 18C are conjugated to TT and the glycoconjugates of S. pneumoniae serotype 19F are conjugated to DT.
[0199] In one embodiment, the compositions of the present invention comprise at least glycoconjugates derived from S. pneumoniae serotype 1 conjugated to CRM 197 , S. pneumoniae serotype 3 conjugated with CRM 197 , S. pneumoniae serotype 4 conjugated with CRM 197 , S. pneumoniae serotype 5 conjugated with CRM 197 , S. pneumoniae serotype 6A conjugated with CRM 197 , S. pneumoniae serotype 6B conjugated with CRM197 , S. pneumoniae serotype 7F conjugated with CRM 197 , S. pneumoniae serotype 8 conjugated with CRM 197 , S. pneumoniae serotype 9V conjugated with CRM 197 , S. pneumoniae serotype 10A conjugated with CRM 197 , S. pneumoniae serotype 11A conjugated with CRM 197 , S. pneumoniae serotype 12F conjugated with CRM 197 , S. pneumoniae serotype 14 conjugated with CRM 197 , S. pneumoniae serotype 15A conjugated with CRM 197 , S. pneumoniae serotype 15B conjugated with CRM 197 , S. pneumoniae serotype 18C conjugated with CRM 197 , S. pneumoniae serotype 19A conjugated with CRM 197 , S. pneumoniae serotype 19F conjugated with CRM 197 , S. pneumoniae serotype 22F conjugated with CRM 197 , S. pneumoniae serotype 23A conjugated with CRM 197 , S. pneumoniae serotype 23B conjugated with CRM 197, S. pneumoniae serotype 23F conjugated with CRM 197 , S. pneumoniae serotype 24F conjugated with CRM 197 , S. pneumoniae serotype 33F conjugated with CRM 197 , S. pneumoniae serotype 35B conjugated with CRM 197 and their combinations.
[0200] Preferably, all glycoconjugates of the above-described vaccine formulations are individually conjugated to a carrier protein. Dosage
[0201] The amount of glycoconjugate(s) in each dose is selected as the amount that induces an immunoprotective response without the significant adverse side effects of typical vaccines. This amount varies depending on the specific immunogen used and how it is presented. The amount of glycoconjugate
[0202] The amount of a specific glycoconjugate in a vaccine formulation can be calculated based on the total polysaccharide for that conjugate (conjugated and unconjugated). For example, a glycoconjugate with 20% free polysaccharide will have approximately 80 μg of conjugated polysaccharide and approximately 20 μg of unconjugated polysaccharide in a 100 μg polysaccharide dose. The amount of glycoconjugate may vary depending on the pneumococcal serotype. The saccharide concentration can be determined using a uronic acid assay.
[0203] The "immunogenic amount" of the various polysaccharide components in the vaccine formulations may vary and in each case may be about 1 μg, about 2 μg, about 3 μg, about 4 μg, about 5 μg, about 6 μg, about 7 μg, about 8 μg, about 9 μg, about 10 μg, about 15 μg, about 20 μg, about 30 μg, about 40 μg, about 50 μg, about 60 μg, about 70 μg, about 80 μg, about 90 μg, or about 100 μg of any particular polysaccharide antigen.
[0204] Typically, each dose will be from 0.1 μg to 100 μg of polysaccharide for a given serotype, in particular from 0.5 μg to 20 μg, more specifically from 1.0 μg to 10 μg, and even more specifically from 2.0 μg to 5.0 μg. As an embodiment of the invention, any integer within any of the above ranges is contemplated.
[0205] In one embodiment, each dose contains from about 1.0 μg to about 6.0 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains from about 1.5 μg to about 5.0 μg of polysaccharide for each specific glycoconjugate. In a preferred embodiment, each dose contains from about 2.0 μg to about 4.0 μg of polysaccharide for each specific glycoconjugate. In a more preferred embodiment, each dose contains from about 2.0 μg to about 3.0 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains about 1.0 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains approximately 1.2 mcg of polysaccharide for each particular glycoconjugate.In one embodiment, each dose contains approximately 1.4 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains approximately 1.6 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains approximately 1.8 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains approximately 2.0 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains approximately 2.2 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains approximately 2.4 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains approximately 2.6 μg of polysaccharide for each specific glycoconjugate.In one embodiment, each dose contains approximately 2.8 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains approximately 3.0 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains approximately 3.2 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains approximately 3.4 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains approximately 3.6 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains approximately 3.8 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains approximately 4.0 μg of polysaccharide for each specific glycoconjugate.In one embodiment, each dose contains approximately 4.2 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains approximately 4.4 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains approximately 4.6 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains approximately 4.8 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains approximately 5.0 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains approximately 5.2 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains approximately 5.4 μg of polysaccharide for each specific glycoconjugate.In one embodiment, each dose contains approximately 5.6 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains approximately 5.8 μg of polysaccharide for each specific glycoconjugate. In one embodiment, each dose contains approximately 6.0 μg of polysaccharide for each specific glycoconjugate.
[0206] In one embodiment, each dose contains from about 1.0 μg to about 3.0 μg of a polysaccharide for glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains from about 1.5 μg to about 3.0 μg of polysaccharide for glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In a preferred embodiment, each dose contains from about 2.0 μg to about 3.0 μg of polysaccharide for glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B.In a more preferred embodiment, each dose contains from about 2.5 μg to about 3.0 μg of polysaccharide for glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose comprises about 1.0 μg of polysaccharide for glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35BB. In one embodiment, each dose comprises about 1.1 μg of polysaccharide for glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains approximately 1.2 μg of polysaccharide for glycoconjugates from S.pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains approximately 1.3 mcg of polysaccharide for glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains approximately 1.4 mcg of polysaccharide for glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains approximately 1.5 μg of polysaccharide for glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B.In one embodiment, each dose contains approximately 1.6 mcg of polysaccharide for glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains approximately 1.7 mcg of polysaccharide for glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose comprises about 1.8 polysaccharides for glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose comprises about 1.9 polysaccharides for glycoconjugates from S.pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains approximately 2.0 μg of polysaccharide for glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains approximately 2.1 mcg of polysaccharide for glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains approximately 2.2 mcg of polysaccharide for glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B.In one embodiment, each dose contains approximately 2.3 mcg of polysaccharide for glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains approximately 2.4 mcg of polysaccharide for glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose comprises about 2.5 μg of polysaccharide for glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose comprises about 2.6 μg of polysaccharide for glycoconjugates from S.pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains approximately 2.7 mcg of polysaccharide for glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains approximately 2.8 polysaccharides of glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. In one embodiment, each dose contains approximately 2.9 polysaccharides for glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B.In one embodiment, each dose contains approximately 3.0 μg of polysaccharide for glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F and / or 35B. Amount of carrier.
[0207] Typically, each dose contains from 10 μg to 150 μg of carrier protein, in particular from 15 μg to 100 μg of carrier protein, more specifically from 25 μg to 75 μg of carrier protein, and even more specifically from 50 μg to 70 μg of carrier protein. In one embodiment, said carrier protein is CRM 197 In one embodiment, said carrier protein is an SCP.
[0208] In one embodiment, each dose contains about 25 μg of carrier protein. In one embodiment, each dose contains about 26 μg of carrier protein. In one embodiment, each dose contains about 27 μg of carrier protein. In one embodiment, each dose contains about 28 μg of carrier protein. In one embodiment, each dose contains about 29 μg of carrier protein. In one embodiment, each dose contains about 30 μg of carrier protein. In one embodiment, each dose contains about 31 μg of carrier protein. In one embodiment, each dose contains about 32 μg of carrier protein. In one embodiment, each dose contains about 33 μg of carrier protein. In one embodiment, each dose contains about 34 μg of carrier protein.In one embodiment, each dose contains about 35 μg of carrier protein. In one embodiment, each dose contains about 36 μg of carrier protein. In one embodiment, each dose contains about 37 μg of carrier protein. In one embodiment, each dose contains about 38 μg of carrier protein. In one embodiment, each dose contains about 39 μg of carrier protein. In one embodiment, each dose contains about 40 μg of carrier protein. In one embodiment, each dose contains about 41 μg of carrier protein. In one embodiment, each dose contains about 42 μg of carrier protein. In one embodiment, each dose contains about 43 μg of carrier protein. In one embodiment, each dose contains about 44 μg of carrier protein.In one embodiment, each dose contains about 45 μg of carrier protein. In one embodiment, each dose contains about 46 μg of carrier protein. In one embodiment, each dose contains about 47 μg of carrier protein. In one embodiment, each dose contains about 48 μg of carrier protein. In one embodiment, each dose contains about 49 μg of carrier protein. In one embodiment, each dose contains about 50 μg of carrier protein. In one embodiment, each dose contains about 51 μg of carrier protein. In one embodiment, each dose contains about 52 μg of carrier protein. In one embodiment, each dose contains about 53 μg of carrier protein. In one embodiment, each dose contains about 54 μg of carrier protein.In one embodiment, each dose contains about 55 μg of carrier protein. In one embodiment, each dose contains about 56 μg of carrier protein. In one embodiment, each dose contains about 57 μg of carrier protein. In one embodiment, each dose contains about 58 μg of carrier protein. In one embodiment, each dose contains about 59 μg of carrier protein. In one embodiment, each dose contains about 60 μg of carrier protein. In one embodiment, each dose contains about 61 μg of carrier protein. In one embodiment, each dose contains about 62 μg of carrier protein. In one embodiment, each dose contains about 63 μg of carrier protein. In one embodiment, each dose contains about 64 μg of carrier protein.In one embodiment, each dose contains approximately 65 μg of carrier protein. In one embodiment, each dose contains approximately 66 μg of carrier protein. In one embodiment, each dose contains approximately 67 μg of carrier protein. In one embodiment, each dose contains approximately 68 μg of carrier protein. In one embodiment, each dose contains approximately 69 μg of carrier protein. In one embodiment, each dose contains approximately 70 μg of carrier protein. In one embodiment, each dose contains approximately 71 μg of carrier protein. In one embodiment, each dose contains approximately 72 μg of carrier protein. In one embodiment, each dose contains approximately 73 μg of carrier protein. In one embodiment, each dose contains approximately 74 μg of carrier protein.In one embodiment, each dose contains approximately 75 mcg of carrier protein.
[0209] In one embodiment, each dose contains approximately 60 μg to 70 μg of carrier protein. Additional antigens
[0210] In some embodiments, the vaccine formulations described herein comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or more antigens. In some embodiments, the vaccine formulation comprises more than one antigen specific for a particular type of virus or bacteria. In particular embodiments, the vaccine formulation comprises more than one antigen specific for S. pneumoniae. In other embodiments, the vaccine formulation comprises antigens specific for a combination of two or more types of bacteria. In other embodiments, the vaccine composition comprises antigens specific to a combination of two or more viral species. In some embodiments, the vaccine composition comprises antigens specific to a combination of at least one viral species and at least one bacterial species.
[0211] In some embodiments, the selected antigens are specific for chickenpox or herpes zoster, human respiratory syncytial virus infection (RSV), cytomegalovirus infection (CMV), human metapneumovirus, human influenza viruses type 1 or type 3, Lyme disease, streptococcal pneumonia, Clostridioides difficile, coronaviruses, Escherichia coli, Klebsiella pneumoniae, influenza virus, HIV-1, hepatitis A, hepatitis B, human papillomavirus, meningococcal meningitis type A, meningococcal meningitis type B, meningococcal meningitis type C, meningococcal meningitis type W, meningococcal meningitis type Y, tetanus, diphtheria, pertussis, poliomyelitis, Haemophilus influenzae type B, dengue, vesicular stomatitis, enteric type, pneumococcus, Japanese encephalitis virus, anthrax, herpes zoster, malaria, norovirus or malignancy.
[0212] The vaccine compositions of the invention comprise conjugated saccharide antigens (glycoconjugates) of S. pneumoniae. They may also additionally include antigens from other pathogens, in particular from bacteria and / or viruses. Preferred additional antigens are selected from: diphtheria toxoid (D), tetanus toxoid (T), pertussis antigen (P), which is typically acellular (Pa), hepatitis B virus (HBV) surface antigen (HBsAg), hepatitis A virus (HAV) antigen, Haemophilus influenzae type b (Hib) capsular saccharide conjugate, inactivated poliovirus vaccine (IPV).
[0213] In one embodiment, the vaccine formulations of the invention comprise DT-Pa. In one embodiment, the vaccine formulations of the invention comprise DT-Pa-Hib, DT-Pa-IPV, or DT-Pa-HBsAg. In one embodiment, the vaccine formulations of the invention comprise DT-Pa-HBsAg-IPV or DT-Pa-HBsAg-Hib. In one embodiment, the vaccine formulations of the invention comprise DT-Pa-HBsAg-IPV-Hib.
[0214] Pertussis Antigens: Bordetella pertussis causes whooping cough. Pertussis antigens in vaccines are either cellular (whole cell, in the form of inactivated B. pertussis cells) or acellular. The production of cellular pertussis antigens has been widely described (for example, it can be produced by heat inactivation of a phase I culture of B. pertussis). However, acellular antigens are preferably used in the context of the invention. When using acellular antigens, it is preferable to use one, two, or (preferably) three of the following antigens: (1) detoxified pertussis toxin (pertussis toxoid or PT); (2) filamentous hemagglutinin (FHA); (3) pertactin (also known as the 69-kilodalton outer membrane protein). FHA and pertactin can be treated with formaldehyde before use according to the invention. RT is preferably detoxified by treatment with formaldehyde and / or glutaraldehyde.Acellular pertussis antigens are preferably adsorbed to one or more aluminum salt adjuvants. Alternatively, they can be added unadsorbed. If pertactin is added, it is preferably already adsorbed to aluminum hydroxide adjuvant. PT and FHA can be adsorbed to aluminum hydroxide or aluminum phosphate adjuvant. Adsorption of all PT, FHA, and pertactin to aluminum hydroxide is most preferred.
[0215] Inactivated Poliovirus Vaccine: Poliovirus causes poliomyelitis. Instead of using an oral poliovirus vaccine, preferred embodiments of the invention use IPV. Polioviruses must be inactivated before administration to patients, and this can be achieved by treatment with formaldehyde. Poliomyelitis can be caused by one of three types of poliovirus. These three types are similar and cause identical symptoms, but they are antigenically different, and infection with one type does not protect against infection with others. Therefore, the invention preferably uses three poliovirus antigens: poliovirus type 1 (e.g., the Mahoney strain), poliovirus type 2 (e.g., the MEF-1 strain), and poliovirus type 3 (e.g., the Saukett strain). The viruses are preferably grown, purified, and inactivated separately, and then combined to produce a common trivalent mixture for use in the invention.
[0216] Diphtheria toxoid: Corynebacterium diphtheriae causes diphtheria. Diphtheria toxoid can be processed (e.g., with formalin or formaldehyde) to remove toxicity while maintaining the ability to induce specific antitoxin antibodies after injection. These diphtheria toxoids are used in diphtheria vaccines. Preferred diphtheria toxoids are those produced by formaldehyde treatment. Diphtheria toxoid can be produced by growing C. diphtheriae in a nutrient medium, followed by formaldehyde treatment, ultrafiltration, and precipitation. The toxoid material can then be processed by a process involving sterile filtration and / or dialysis. Diphtheria toxoid is preferably adsorbed onto aluminum hydroxide adjuvant.
[0217] Tetanus Toxoid: Clostridium tetani causes tetanus. Tetanus toxoid can be processed to produce a protective toxoid. Toxoids are used in tetanus vaccines. Preferred tetanus toxoids are those produced by treatment with formaldehyde. Tetanus toxoid can be produced by growing C. tetani in a nutrient medium, followed by treatment with formaldehyde, ultrafiltration, and precipitation. The material can then be processed through a process involving sterile filtration and / or dialysis.
[0218] Hepatitis A virus antigens: Hepatitis A virus (HAV) is one of the known agents that causes viral hepatitis. The preferred component of HAV is based on inactivated virus, and inactivation can be achieved by formalin treatment.
[0219] Hepatitis B virus (HBV) is one of the known agents that causes viral hepatitis. The main component of the capsid is a protein known as HBV surface antigen, or more commonly HBsAg, which is typically a 226-amino acid polypeptide with a molecular weight of ~24 kDa. All existing hepatitis B vaccines contain HBsAg, and when this antigen is administered to a normal vaccinee, it stimulates the production of anti-HBsAg antibodies, which protect against HBV infection.
[0220] For vaccine production, HBsAg is obtained by two methods: purification of the particulate antigen from the plasma of chronic hepatitis B carriers or protein expression using recombinant DNA methods (e.g., recombinant expression in yeast cells). Unlike native HBsAg (i.e., as in the plasma-purified product), yeast-expressed HBsAg is generally non-glycosylated, and this is the most preferred form of HBsAg for use in the invention.
[0221] Haemophilus influenzae type b conjugate antigens: Haemophilus influenzae type b (Hib) causes bacterial meningitis. Hib vaccines are typically based on the capsular saccharide antigen, the production of which has been widely described. The Hib saccharide can be conjugated to a carrier protein to enhance its immunogenicity, especially in children. Typical carrier proteins include tetanus toxoid, diphtheria toxoid, and CRM. 197 , the H. influenzae D protein, and the outer membrane protein complex of serogroup B meningococci. The saccharide portion of the conjugate may include full-length polyribosylribitol phosphate (PRP) derived from Hib bacteria and / or fragments of full-length PRP. Hib conjugates may be adsorbed or unadsorbed on an aluminum salt adjuvant.
[0222] In one embodiment, the vaccine formulations of the invention further comprise a conjugated capsular saccharide of N. meningitidis serogroup Y (MenY) and / or a conjugated capsular saccharide of N. meningitidis serogroup C (MenC).
[0223] In one embodiment, the vaccine formulations of the invention further comprise a conjugated capsular saccharide of N. meningitidis serogroup A (MenA), a conjugated capsular saccharide of N. meningitidis serogroup W135 (MenW135), a conjugated capsular saccharide of M. meningitidis serogroup Y (MenY), and / or a conjugated capsular saccharide of N. meningitidis serogroup C (MenC).
[0224] In one embodiment, the vaccine formulations of the invention further comprise a conjugated capsular saccharide of N. meningitidis serogroup W135 (MenW135), a conjugated capsular saccharide of M. meningitidis serogroup Y (MenY), and / or a conjugated capsular saccharide of N. meningitidis serogroup C (MenC). Composition
[0225] The compositions of the invention may be in liquid form (i.e., solutions or suspensions) or in lyophilized form. Liquid compositions can advantageously be administered directly from their packaged form and are thus ideally suited for injection without the need for reconstitution in an aqueous medium, as is otherwise required for lyophilized compositions of the invention.
[0226] The composition of the present invention can be prepared using methods generally recognized in the art. For example, individual pneumococcal conjugates can be formulated with a physiologically acceptable carrier to produce the composition. Examples of such carriers include, but are not limited to, water, buffered saline, polyhydric alcohols (e.g., glycerol, propylene glycol, liquid polyethylene glycol), and dextrose solutions.
[0227] The present invention relates to compositions comprising any combination of glycoconjugates described herein and a pharmaceutically acceptable excipient, carrier, or diluent.
[0228] In one embodiment, the vaccine formulations of the invention are in liquid form, preferably in aqueous liquid form.
[0229] The vaccine formulations of the invention may include one or more of a buffer, a salt, a divalent cation, a nonionic detergent, a cryoprotectant such as a sugar, and an antioxidant such as a free radical scavenger or a chelating agent, or any multiple combinations thereof.
[0230] In one embodiment, the vaccine formulations of the invention include a buffer. In one embodiment, the buffer has a pKa of from about 3.5 to about 7.5. In some embodiments, the buffer is phosphate, succinate, histidine, or citrate. In some embodiments, the buffer is succinate at a final concentration of from 1 mM to 10 mM. In one specific embodiment, the final concentration of the succinate buffer is approximately 5 mM.
[0231] In one embodiment, the buffer is a succinate or histidine buffer. In one embodiment, the buffer has a concentration of about 1 mM to 30 mM. In a preferred embodiment, the buffer is a succinate buffer having a final concentration of about 1 mM to 10 mM. In a more preferred embodiment, the buffer is a succinate buffer having a final concentration of about 5 mM to 9 mM. In one embodiment, the buffer is a succinate buffer having a final concentration of about 1 mM. In one embodiment, the buffer is a succinate buffer having a final concentration of about 2 mM. In one embodiment, the buffer is a succinate buffer having a final concentration of about 3 mM.In one embodiment, the buffer is a succinate buffer having a final concentration of approximately 4 mM. In one embodiment, the buffer is a succinate buffer having a final concentration of approximately 5 mM. In one embodiment, the buffer is a succinate buffer having a final concentration of approximately 6 mM. In one embodiment, the buffer is a succinate buffer having a final concentration of approximately 7 mM. In one embodiment, the buffer is a succinate buffer having a final concentration of approximately 8 mM. In one embodiment, the buffer is a succinate buffer having a final concentration of approximately 9 mM. In one embodiment, the buffer is a succinate buffer having a final concentration of approximately 10 mM.In a preferred embodiment, the buffer is a succinate buffer having a final concentration of approximately 5 mM.
[0232] In one embodiment, the buffer is a histidine buffer. In one embodiment, the histidine buffer is a histidine buffer having a final concentration of about 1 mM to 30 mM. In a preferred embodiment, the buffer is a histidine buffer having a final concentration of about 10 mM to 30 mM. In a more preferred embodiment, the buffer is a histidine buffer having a final concentration of about 20 mM to 30 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of about 1 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of about 2 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of about 3 mM.In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 4 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 5 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 6 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 7 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 8 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 9 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 10 mM.In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 11 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 12 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 13 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 14 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 15 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 16 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 17 mM.In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 18 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 19 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 20 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 21 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 22 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 23 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 24 mM.In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 25 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 26 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 27 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 28 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 29 mM. In one embodiment, the buffer is a histidine buffer having a final concentration of approximately 30 mM.
[0233] In a preferred embodiment, the buffer is a histidine buffer having a final concentration of 25 mM. In one embodiment, the buffer has a pH of about 5.0 to 7.5. In a preferred embodiment, the buffer has a pH of about 5.0 to 6.5. In a more preferred embodiment, the buffer has a pH of about 5.5 to 6.0. In one embodiment, the buffer has a pH of about 5.0. In one embodiment, the buffer has a pH of about 5.1. In one embodiment, the buffer has a pH of about 5.2. In one embodiment, the buffer has a pH of about 5.3. In one embodiment, the buffer has a pH of about 5.4. In one embodiment, the buffer has a pH of about 5.5. In one embodiment, the buffer has a pH of about 5.6. In one embodiment, the buffer has a pH of about 5.7.In one embodiment, the buffer has a pH of about 5.8. In one embodiment, the buffer has a pH of about 5.9. In one embodiment, the buffer has a pH of about 6.0. In one embodiment, the buffer has a pH of about 6.1. In one embodiment, the buffer has a pH of about 6.2. In one embodiment, the buffer has a pH of about 6.3. In one embodiment, the buffer has a pH of about 6.4. In one embodiment, the buffer has a pH of about 6.5. In one embodiment, the buffer has a pH of about 6.6. In one embodiment, the buffer has a pH of about 6.7. In one embodiment, the buffer has a pH of about 6.8. In one embodiment, the buffer has a pH of about 6.9. In one embodiment, the buffer has a pH of about 7.0. In one embodiment, the buffer has a pH of about 7.1.In one embodiment, the buffer has a pH of about 7.2. In one embodiment, the buffer has a pH of about 7.3. In one embodiment, the buffer has a pH of about 7.4. In one embodiment, the buffer has a pH of about 7.5. In a preferred embodiment, the buffer is a succinate or histidine buffer having a pH of 5.8.
[0234] In one embodiment, the formulations of the invention comprise a salt. In some embodiments, the salt is selected from the group consisting of sodium phosphate, calcium chloride, magnesium chloride, potassium chloride, sodium chloride, and combinations thereof. In one specific embodiment, the salt is sodium chloride. In one specific embodiment, the vaccine formulations of the invention comprise sodium chloride at a concentration of 150 mM.
[0235] In one embodiment, the salt is sodium phosphate, calcium chloride, sodium chloride, or a combination thereof. In one embodiment, the salt has a concentration of about 1 mM to 300 mM. In one embodiment, the salt is sodium chloride. In one embodiment, the salt is sodium chloride having a concentration of about 50 mM to 300 mM. In one embodiment, the salt is sodium chloride having a concentration of about 100 mM to 200 mM. In a preferred embodiment, the salt is sodium chloride having a concentration of about 200 mM to 300 mM. In a more preferred embodiment, the salt is sodium chloride having a concentration of about 150 mM to 250 mM. In one embodiment, the salt is sodium chloride having a concentration of about 50 mM.In one embodiment, the salt is sodium chloride having a concentration of about 7.5 mM. In one embodiment, the salt is sodium chloride having a concentration of about 100 mM. In one embodiment, the salt is sodium chloride having a concentration of about 125 mM. In one embodiment, the salt is sodium chloride having a concentration of about 150 mM. In one embodiment, the salt is sodium chloride having a concentration of about 175 mM. In one embodiment, the salt is sodium chloride having a concentration of about 200 mM. In one embodiment, the salt is sodium chloride having a concentration of about 225 mM. In one embodiment, the salt is sodium chloride having a concentration of about 250 mM.In one embodiment, the salt is sodium chloride having a concentration of about 275 mM. In one embodiment, the salt is sodium chloride having a concentration of about 300 mM. In one embodiment, the salt is sodium chloride having a concentration of about 125 mM. In one embodiment, the salt is sodium chloride having a concentration of about 130 mM. In one embodiment, the salt is sodium chloride having a concentration of about 135 mM. In one embodiment, the salt is sodium chloride having a concentration of about 140 mM. In one embodiment, the salt is sodium chloride having a concentration of about 145 mM. In one embodiment, the salt is sodium chloride having a concentration of about 150 mM.In one embodiment, the salt is sodium chloride having a concentration of about 155 mM. In one embodiment, the salt is sodium chloride having a concentration of about 160 mM. In one embodiment, the salt is sodium chloride having a concentration of about 165 mM. In one embodiment, the salt is sodium chloride having a concentration of about 170 mM. In one embodiment, the salt is sodium chloride having a concentration of about 175 mM. In one embodiment, the salt is sodium chloride having a concentration of about 225 mM. In one embodiment, the salt is sodium chloride having a concentration of about 230 mM. In one embodiment, the salt is sodium chloride having a concentration of about 235 mM.In one embodiment, the salt is sodium chloride having a concentration of about 240 mM. In one embodiment, the salt is sodium chloride having a concentration of about 245 mM. In one embodiment, the salt is sodium chloride having a concentration of about 250 mM. In one embodiment, the salt is sodium chloride having a concentration of about 255 mM. In one embodiment, the salt is sodium chloride having a concentration of about 260 mM. In one embodiment, the salt is sodium chloride having a concentration of about 265 mM. In one embodiment, the salt is sodium chloride having a concentration of about 270 mM. In one embodiment, the salt is sodium chloride having a concentration of about 275 mM.In a specific embodiment, the salt is sodium chloride having a concentration of 150 mM. In a specific embodiment, the salt is sodium chloride having a concentration of 245 mM.
[0236] In one embodiment, the salt is magnesium chloride. In one embodiment, the salt is magnesium chloride having a concentration of about 10 mM to 50 mM. In a preferred embodiment, the salt is magnesium chloride having a concentration of about 20 mM to 50 mM. In a more preferred embodiment, the salt is magnesium chloride having a concentration of about 30 mM to 50 mM. In a specific embodiment, the salt is magnesium chloride having a concentration of about 35 mM to 45 mM. In one embodiment, the salt is magnesium chloride having a concentration of about 10 mM. In one embodiment, the salt is magnesium chloride having a concentration of about 15 mM. In one embodiment, the salt is magnesium chloride having a concentration of about 20 mM.In one embodiment, the salt is magnesium chloride having a concentration of about 25 mM. In one embodiment, the salt is magnesium chloride having a concentration of about 30 mM. In one embodiment, the salt is magnesium chloride having a concentration of about 35 mM. In one embodiment, the salt is magnesium chloride having a concentration of about 40 mM. In one embodiment, the salt is magnesium chloride having a concentration of about 45 mM. In one embodiment, the salt is magnesium chloride having a concentration of about 50 mM. In a particular embodiment, the salt is magnesium chloride having a concentration of about 40 mM.
[0237] In one embodiment, the salt is calcium chloride. In one embodiment, the salt is calcium chloride having a concentration of about 1 mM to 50 mM. In a particular embodiment, the salt is calcium chloride. In a preferred embodiment, the salt is calcium chloride having a concentration of about 10 mM to 30 mM. In a more preferred embodiment, the salt is calcium chloride having a concentration of about 15 mM to 25 mM. In one embodiment, the salt is calcium chloride having a concentration of about 5 mM. In one embodiment, the salt is calcium chloride having a concentration of about 10 mM. In one embodiment, the salt is calcium chloride having a concentration of about 15 mM.In one embodiment, the salt is calcium chloride having a concentration of approximately 20 mM. In one embodiment, the salt is calcium chloride having a concentration of approximately 25 mM. In one embodiment, the salt is calcium chloride having a concentration of approximately 30 mM. In one embodiment, the salt is calcium chloride having a concentration of approximately 35 mM. In one embodiment, the salt is calcium chloride having a concentration of approximately 40 mM. In a preferred embodiment, the salt is calcium chloride having a concentration of 20 mM.
[0238] In one embodiment, the salt is sodium phosphate. In one embodiment, the salt is sodium phosphate having a concentration of about 1 mM to 50 mM. In a preferred embodiment, the salt is sodium phosphate having a concentration of about 20 mM to 50 mM. In a more preferred embodiment, the salt is sodium phosphate having a concentration of about 35 mM to 45 mM. In one embodiment, the salt is sodium phosphate having a concentration of about 5 mM. In one embodiment, the salt is sodium phosphate having a concentration of about 10 mM. In one embodiment, the salt is sodium phosphate having a concentration of about 15 mM. In one embodiment, the salt is sodium phosphate having a concentration of about 20 mM.In one embodiment, the salt is sodium phosphate having a concentration of about 25 mM. In one embodiment, the salt is sodium phosphate having a concentration of about 30 mM. In one embodiment, the salt is sodium phosphate having a concentration of about 35 mM. In one embodiment, the salt is sodium phosphate having a concentration of about 35 mM. In one embodiment, the salt is sodium phosphate having a concentration of about 40 mM. In one embodiment, the salt is sodium phosphate having a concentration of about 45 mM. In one embodiment, the salt is sodium phosphate having a concentration of about 50 mM. In a preferred embodiment, the salt is sodium phosphate having a concentration of 20 mM.In a preferred embodiment, the salt is sodium phosphate having a concentration of 40 mM.
[0239] In one embodiment, the salts are sodium phosphate and sodium chloride. In one embodiment, the concentration of sodium phosphate is about 1 mM to 50 mM and the concentration of sodium chloride is about 50 mM to 300 mM. In one embodiment, the concentration of sodium phosphate is about 10 mM to 30 mM and the concentration of sodium chloride is about 100 mM to 300 mM. In a preferred embodiment, the concentration of sodium phosphate is about 15 mM to 25 mM and the concentration of sodium chloride is about 200-300 mM. In a preferred embodiment, the concentration of sodium phosphate is about 30 mM to 50 mM and the concentration of sodium chloride is about 200-300 mM. In one embodiment, the concentration of sodium phosphate is about 5 mM.In one embodiment, the sodium phosphate concentration is about 10 mM. In one embodiment, the sodium phosphate concentration is about 15 mM. In one embodiment, the sodium phosphate concentration is about 20 mM. In one embodiment, the sodium phosphate concentration is about 25 mM. In one embodiment, the sodium phosphate concentration is about . In one embodiment, the sodium phosphate concentration is about 35 mM. In one embodiment, the sodium phosphate concentration is about 40 mM. In one embodiment, the sodium phosphate concentration is about 45 mM. In one embodiment, the sodium phosphate concentration is about 50 mM. In one embodiment, the sodium chloride concentration is about 125 mM.In one embodiment, the sodium chloride concentration is about 130 mM. In one embodiment, the sodium chloride concentration is about 135 mM. In one embodiment, the sodium chloride concentration is about 140 mM. In one embodiment, the sodium chloride concentration is about 145 mM. In one embodiment, the sodium chloride concentration is about 150 mM. In one embodiment, the sodium chloride concentration is about 155 mM. In one embodiment, the sodium chloride concentration is about 160 mM. In one embodiment, the sodium chloride concentration is about 165 mM. In one embodiment, the sodium chloride concentration is about 170 mM. In one embodiment, the sodium chloride concentration is about 175 mM.In one embodiment, the sodium chloride concentration is about 180 mM. In one embodiment, the sodium chloride concentration is about 185 mM. In one embodiment, the sodium chloride concentration is about 190 mM. In one embodiment, the sodium chloride concentration is about 200 mM. In one embodiment, the sodium chloride concentration is about 205 mM. In one embodiment, the sodium chloride concentration is about 210 mM. In one embodiment, the sodium chloride concentration is about 215 mM. In one embodiment, the sodium chloride concentration is about 220 mM. In one embodiment, the sodium chloride concentration is about 225 mM. In one embodiment, the sodium chloride concentration is about 230 mM.In one embodiment, the sodium chloride concentration is approximately 235 mM. In one embodiment, the sodium chloride concentration is approximately 240 mM. In one embodiment, the sodium chloride concentration is approximately 245 mM. In one embodiment, the sodium chloride concentration is approximately 250 mM. In one embodiment, the sodium chloride concentration is approximately 255 mM. In one embodiment, the sodium chloride concentration is approximately 260 mM. In one embodiment, the sodium chloride concentration is approximately 265 mM. In one embodiment, the sodium chloride concentration is approximately 270 mM. In one embodiment, the sodium chloride concentration is approximately 275 mM.In a specific embodiment, the sodium phosphate concentration is approximately 20 mM and the sodium chloride concentration is approximately 150 mM. In a specific embodiment, the salt is sodium phosphate having a concentration of 20 mM and sodium chloride having a concentration of 245 mM. In a specific embodiment, the salt is sodium phosphate having a concentration of 40 mM and sodium chloride having a concentration of 245 mM.
[0240] In one embodiment, the salts are sodium chloride and calcium chloride. In one embodiment, the concentration of sodium chloride is about 50 to 300 mM and the concentration of calcium chloride is about 1 mM to 50 mM. In a preferred embodiment, the concentration of sodium chloride is about 100 to 250 mM and the concentration of calcium chloride is about 20 mM to 30 mM. In a more preferred embodiment, the concentration of sodium chloride is about 100 to 200 mM and the concentration of calcium chloride is about 15 mM to 25 mM. In one embodiment, the concentration of sodium chloride is about 125 mM. In one embodiment, the concentration of sodium chloride is about 130 mM. In one embodiment, the concentration of sodium chloride is about 135 mM.In one embodiment, the sodium chloride concentration is about 140 mM. In one embodiment, the sodium chloride concentration is about 145 mM. In one embodiment, the sodium chloride concentration is about 150 mM. In one embodiment, the sodium chloride concentration is about 155 mM. In one embodiment, the sodium chloride concentration is about 160 mM. In one embodiment, the sodium chloride concentration is about 165 mM. In one embodiment, the sodium chloride concentration is about 170 mM. In one embodiment, the sodium chloride concentration is about 175 mM. In one embodiment, the calcium chloride concentration is about . In one embodiment, the calcium chloride concentration is about 5 mM.In one embodiment, the calcium chloride concentration is approximately 10 mM. In one embodiment, the calcium chloride concentration is approximately 15 mM. In one embodiment, the calcium chloride concentration is approximately 20 mM. In one embodiment, the calcium chloride concentration is approximately 25 mM. In one embodiment, the calcium chloride concentration is approximately 30 mM. In one embodiment, the calcium chloride concentration is approximately 35 mM. In one embodiment, the calcium chloride concentration is approximately 40 mM. In a specific embodiment, the sodium chloride concentration is approximately 150 mM and the calcium chloride concentration is approximately 20 mM.
[0241] In one embodiment, the salts are sodium chloride and magnesium chloride. In one embodiment, the sodium chloride concentration is about 50 to 300 mM and the sodium chloride concentration is 1 mM to 50 mM. In a preferred embodiment, the sodium chloride concentration is about 100 to 250 mM and the sodium chloride concentration is 10 mM to 30 mM. In a more preferred embodiment, the sodium chloride concentration is about 100 to 200 mM and the sodium chloride concentration is 15 mM to 25 mM. In one embodiment, the sodium chloride concentration is about 125 mM. In one embodiment, the sodium chloride concentration is about 130 mM. In one embodiment, the sodium chloride concentration is about 135 mM. In one embodiment, the sodium chloride concentration is approximately 140 mM.In one embodiment, the sodium chloride concentration is about 145 mM. In one embodiment, the sodium chloride concentration is about 150 mM. In one embodiment, the sodium chloride concentration is about 155 mM. In one embodiment, the sodium chloride concentration is about 160 mM. In one embodiment, the sodium chloride concentration is about 165 mM. In one embodiment, the sodium chloride concentration is about 170 mM. In one embodiment, the sodium chloride concentration is about 175 mM. In one embodiment, the magnesium chloride concentration is about 5 mM. In one embodiment, the magnesium chloride concentration is about 10 mM. In one embodiment, the magnesium chloride concentration is about 15 mM.In one embodiment, the magnesium chloride concentration is approximately 20 mM. In one embodiment, the magnesium chloride concentration is approximately 25 mM. In one embodiment, the magnesium chloride concentration is approximately 30 mM. In one embodiment, the magnesium chloride concentration is approximately 35 mM. In one embodiment, the magnesium chloride concentration is approximately 35 mM. In one embodiment, the magnesium chloride concentration is approximately 40 mM. In a specific embodiment, the sodium chloride concentration is approximately 150 mM and the magnesium chloride concentration is approximately 20 mM.
[0242] In one embodiment, the vaccine formulations of the invention comprise a surfactant. In one embodiment, the surfactant is selected from the group consisting of polysorbate 20 (TWEEN™20), polysorbate 40 (TWEEN™40), polysorbate 60 (TWEEN™60), polysorbate 65 (TWEEN™65), polysorbate 80 (TWEEN™80), polysorbate 85 (TWEEN™85), TRITON™ N-101, TRITON™ X-100, octoxynol 40, nonoxynol-9, triethanolamine, triethanolamine polypeptide oleate, polyoxyethylene-660 hydroxystearate (PEG-15, Solutol H 15), polyoxyethylene-35-ricinoleate (CREMOPHOR® EL), soy lecithin, and poloxamer.
[0243] In one particular embodiment, the surfactant is polysorbate 80. In some of these embodiments, the final concentration of polysorbate 80 in the composition is at least 0.0001% to 10% polysorbate 80 by weight (w / w). In some of these embodiments, the final concentration of polysorbate 80 in the composition is at least 0.001% to 1% polysorbate 80 by weight (w / w). In some of these embodiments, the final concentration of polysorbate 80 in the composition is at least 0.001% to 1% polysorbate 80 by weight (w / w). In other embodiments, the final concentration of polysorbate 80 in the composition is 0.01% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.02% polysorbate 80 (w / w).In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.03% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.04% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.05% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.06% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.07% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.08%, In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.09% polysorbate 80 (w / w). In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.1% polysorbate 80 (w / w).In another embodiment, the final concentration of polysorbate 80 in the composition is 1% polysorbate 80 (w / w).
[0244] In one particular embodiment, the surfactant is polysorbate 20. In some of these embodiments, the final concentration of polysorbate 20 in the composition is at least 0.0001% to 10% polysorbate 20 by weight (w / w). In some of these embodiments, the final concentration of polysorbate 20 in the composition is at least 0.001% to 1% polysorbate 20 by weight (w / w). In some of these embodiments, the final concentration of polysorbate 20 in the composition is at least 0.001% to 1% polysorbate 20 by weight (w / w). In other embodiments, the final concentration of polysorbate 20 in the composition is 0.01% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.02% polysorbate 20 (w / w).In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.03% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.04% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.05% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.06% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.07% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.08%, In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.09% polysorbate 20 (w / w). In other embodiments, the final concentration of polysorbate 20 in the formulation is 0.1% polysorbate 20 (w / w).In another embodiment, the final concentration of polysorbate 20 in the composition is 1% polysorbate 20 (w / w).
[0245] In one embodiment, the compositions of the present invention include an adjuvant. The adjuvants of the compositions are described in detail below.
[0246] In one embodiment, the formulations of the present invention have a total glycoconjugate concentration of about 10 to 500 μg / ml. In one embodiment, the total glycoconjugate concentration is about 20 to 400 μg / ml. In one embodiment, the total glycoconjugate concentration is about 30 to 300 μg / ml. In a preferred embodiment, the total glycoconjugate concentration is about 50 to 200 μg / ml. In a more preferred embodiment, the total glycoconjugate concentration is about 100 to 150 μg / ml.
[0247] In one embodiment, the total concentration of the glycoconjugate is approximately 115 μg / mL. In one embodiment, the total concentration of the glycoconjugate is approximately 120 μg / mL. In one embodiment, the total concentration of the glycoconjugate is approximately 115 μg / mL. In one embodiment, the total concentration of the glycoconjugate is approximately 119 μg / mL.
[0248] In certain embodiments, the vaccine formulations of the invention have a pH of 5.5 to 7.5, more preferably a pH of 5.6 to 7.0, even more preferably a pH of 5.8 to 6.0.
[0249] In one embodiment, the present invention relates to formulations comprising at least 21 different polysaccharide-protein conjugates; a succinate buffer or a histidine buffer having a pH in the range of 5.0 to 7.5; calcium chloride, sodium chloride, calcium chloride and / or sodium phosphate; a surfactant; and an adjuvant. In one embodiment, the present invention relates to formulations comprising at least 21 different polysaccharide-protein conjugates; a succinate buffer having a pH in the range of 5.0 to 7.5; calcium chloride; sodium chloride; a surfactant; and an adjuvant. In one embodiment, the present invention relates to formulations comprising at least 21 different polysaccharide-protein conjugates; a succinate buffer having a pH in the range of 5.0 to 7.5; Sodium chloride; sodium phosphate; surfactant and adjuvant.In one embodiment, the present invention relates to compositions comprising at least 21 different polysaccharide-protein conjugates; a histidine buffer having a pH in the range of 5.0 to 7.5; sodium chloride; a surfactant; and an adjuvant. In a preferred embodiment, the surfactant is polysorbate 80 or polysorbate 20. In a more preferred embodiment, the surfactant is polysorbate 80.
[0250] In one embodiment, the composition comprises 25 polysaccharide-protein conjugates, 5 mM succinate pH 5.8, 150 mM sodium chloride, 20 mM calcium chloride, 0.02% polysorbate 80 and 0.25 mg / mL aluminum phosphate. In one embodiment, the 25 polysaccharide-protein conjugates comprise one or more of S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof.
[0251] In one embodiment, the composition comprises 25 polysaccharide-protein conjugates, 5 mM succinate pH 5.8, 40 mM sodium phosphate, 245 mM sodium chloride, 0.02% polysorbate 80 and 0.25 mg / mL aluminum phosphate. In one embodiment, the 25 polysaccharide-protein conjugates comprise one or more of S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B, and combinations thereof.
[0252] In one embodiment, the composition comprises 25 polysaccharide-protein conjugates, 25 mM histidine pH 5.8, 245 mM sodium chloride, 0.02% polysorbate 80 and 0.25 mg / ml aluminum phosphate. In one embodiment, the 25 polysaccharide-protein conjugates comprise one or more of S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B and combinations thereof.
[0253] In one embodiment, the present invention relates to a container filled with any of the vaccine formulations described herein. In one embodiment, the container is selected from the group consisting of a vial, a syringe, a flask, a fermenter, a bioreactor, a bag, a jar, an ampoule, a cartridge, and a disposable syringe pen. In certain embodiments, the container is siliconized.
[0254] In one embodiment, the container of the present invention is made of glass, metal (e.g., steel, stainless steel, aluminum, etc.) and / or polymers (e.g., thermoplastics, elastomers, thermoplastic elastomers).
[0255] In one embodiment, the container of the present invention is made of glass. Stability
[0256] In certain cases, it may be difficult to resuspend compositions or formulations containing significant amounts of glycoconjugates that have been quiescent for some time (e.g., sitting on a shelf). Excessive sedimentation or a sediment that is too dense (e.g., abbreviated "sediment height," as detailed below) may prevent resuspension of the glycoconjugates, resulting in the composition or formulation becoming unusable or injectable. Furthermore, if sedimentation occurs too rapidly, it may hinder manufacturing and formulation of an appropriate dosage form (e.g., the composition begins to settle before transfer to the container).As described in detail herein, in compositions or formulations containing a significant amount of glycoconjugates, in one embodiment of the present invention, a sedimentation rate is detailed that provides compositions that are easier to manufacture for sale and / or resuspend for use.
[0257] Sedimentation velocity can be measured as described in this field. One method for measuring sedimentation velocity is using Turbiscan ® TOWER. Turbiscan ® TOWER uses static multiple light scattering to detect particle migration in liquid dispersions. The measuring head is equipped with a pulsed near-infrared light source (λ=880 nm) and synchronous transmission (180° from the light source) and backscatter detectors (45° from the light source) that move along the height of a flat-bottomed cylindrical glass sample cuvette, acquiring data every 20 µm.
[0258] In certain embodiments, measurements are performed at room temperature using -20 mL of sample. Samples are vortexed to resuspend immediately prior to measurement. In certain embodiments, measurements are performed after vortexing to position the sample in the scanner. The sedimentation onset time is defined as the time at which the sample reaches 45% transparency improvement at the meniscus and is obtained from the transmission data. The sedimentation rate is reported as the slope of the sedimentation front position versus time curve.
[0259] In one embodiment, the present invention relates to a composition comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, wherein at time T0, substantially all of the at least 25 different glycoconjugates are dissolved in a liquid phase or adsorbed onto the insoluble aluminum phosphate adjuvant as a fully dispersed liquid suspension and the at least 25 different glycoconjugates are present at a concentration of C0 in the liquid phase; at time T1, a portion of the at least 25 different glycoconjugates adsorbed onto the insoluble adjuvant precipitate from the liquid phase to form a precipitate and the at least 25 different glycoconjugates are present at a concentration of C1 in the liquid phase;at time T2, an additional portion of the at least 25 different glycoconjugates adsorbed on the insoluble adjuvant precipitates from the liquid phase to form a sediment and the at least 25 different glycoconjugates are present at a concentration of C2 in the liquid phase; and wherein the sedimentation rate is measured over time by static multiple light scattering to detect particle migration in the liquid, wherein the measuring head comprises a pulsed near infrared light source having a wavelength of approximately 880 nm and having synchronous transmission detectors 180° from the light source and backscatter detectors 45° from the light source that move along the height of a flat-bottomed cylindrical glass sample cuvette to obtain sediment data every 20 μm;
[0260] In one embodiment, the composition includes at least 21 different glycoconjugates. In one embodiment, the composition includes at least 22 different glycoconjugates. In one embodiment, the composition includes at least 23 different glycoconjugates. In one embodiment, the composition includes at least 24 different glycoconjugates. In one embodiment, the composition includes at least 25 different glycoconjugates. In one embodiment, the composition includes at least 26 different glycoconjugates. In one embodiment, the composition includes at least 27 different glycoconjugates. In one embodiment, the composition includes at least 28 different glycoconjugates. In one embodiment, the composition includes at least 29 different glycoconjugates.In one embodiment, the composition comprises at least 30 different glycoconjugates. In one embodiment, the composition comprises at least 31 different glycoconjugates. In one embodiment, the composition comprises at least 32 different glycoconjugates. In one embodiment, the composition comprises at least 33 different glycoconjugates. In one embodiment, the composition comprises at least 34 different glycoconjugates. In one embodiment, the composition comprises at least 35 different glycoconjugates.
[0261] In one embodiment, T0 is 0 hours. In one embodiment, T1 is about 0.01 hours to 4 hours. In one embodiment, T1 is about 1 hour to 2 hours. In a preferred embodiment, T1 is about 0.01 hours to 4 hours. In one embodiment, T1 is 0.1 hours. In one embodiment, T1 is about 0.2 hours. In one embodiment, T1 is about 0.3 hours. In one embodiment, T1 is about 0.4 hours. In one embodiment, T1 is about 0.5 hours. In one embodiment, T1 is about 0.6 hours. In one embodiment, T1 is about 0.7 hours. In one embodiment, T1 is about 0.8 hours.In one embodiment, T1 is approximately 0.9 hours. In one embodiment, T1 is approximately 1.0 hours. In one embodiment, T1 is approximately 1.1 hours. In one embodiment, T1 is approximately 1.2 hours. In one embodiment, T1 is approximately 1.3 hours. In one embodiment, T1 is approximately 1.4 hours. In one embodiment, T1 is approximately 1.5 hours. In one embodiment, T1 is approximately 1.6 hours. In one embodiment, T1 is approximately 1.7 hours. In one embodiment, T1 is approximately 1.8 hours. In one embodiment, T1 is approximately 1.9 hours. In one embodiment, T1 is approximately 2.0 hours.In one embodiment, T1 is approximately 2.1 hours. In one embodiment, T1 is approximately 2.2 hours. In one embodiment, T1 is approximately 2.3 hours. In one embodiment, T1 is approximately 2.4 hours. In one embodiment, T1 is approximately 2.5 hours. In one embodiment, T1 is approximately 2.6 hours. In one embodiment, T1 is approximately 2.7 hours. In one embodiment, T1 is approximately 2.8 hours. In one embodiment, T1 is approximately 2.9 hours. In one embodiment, T1 is approximately 3.0 hours. In one embodiment, T1 is approximately 3.1 hours. In one embodiment, T1 is approximately 3.2 hours.In one embodiment, T1 is approximately 3.3 hours. In one embodiment, T1 is approximately 3.4 hours. In one embodiment, T1 is approximately 3.5 hours. In one embodiment, T1 is approximately 3.6 hours. In one embodiment, T1 is approximately 3.7 hours. In one embodiment, T1 is approximately 3.8 hours. In one embodiment, T1 is approximately 3.9 hours. In one embodiment, T1 is approximately 4.0 hours.
[0262] In one embodiment, T2 is about 1 hour to 5 hours. In a preferred embodiment, T2 is about 1 to 3 hours. In a more preferred embodiment, T2 is about 1 to 2 hours. In a specific embodiment, T2 is about 4 hours. In one embodiment, T2 is about 1.0 hour. In one embodiment, T2 is about 1.1 hours. In one embodiment, T2 is about 1.2 hours. In one embodiment, T2 is about 1.3 hours. In one embodiment, T2 is about 1.4 hours. In one embodiment, T2 is about 1.5 hours. In one embodiment, T2 is about 1.6 hours.In one embodiment, T2 is approximately 1.7 hours. In one embodiment, T2 is approximately 1.8 hours. In one embodiment, T2 is approximately 1.9 hours. In one embodiment, T2 is approximately 2.0 hours. In one embodiment, T2 is approximately 2.1 hours. In one embodiment, T2 is approximately 2.2 hours. In one embodiment, T2 is approximately 2.3 hours. In one embodiment, T2 is approximately 2.4 hours. In one embodiment, T2 is approximately 2.5 hours. In one embodiment, T2 is approximately 2.6 hours. In one embodiment, T2 is approximately 2.7 hours. In one embodiment, T2 is approximately 2.8 hours.In one embodiment, T2 is approximately 2.9 hours. In one embodiment, T2 is approximately 3.0 hours. In one embodiment, T2 is approximately 3.1 hours. In one embodiment, T2 is approximately 3.2 hours. In one embodiment, T2 is approximately 3.3 hours. In one embodiment, T2 is approximately 3.4 hours. In one embodiment, T2 is approximately 3.6 hours. In one embodiment, T2 is approximately 3.7 hours. In one embodiment, T2 is approximately 3.8 hours. In one embodiment, T2 is approximately 3.9 hours. In one embodiment, T2 is approximately 4.0 hours. In one embodiment, T2 is approximately 4.1 hours.In one embodiment, T2 is approximately 4.2 hours. In one embodiment, T2 is approximately 4.3 hours. In one embodiment, T2 is approximately 4.4 hours. In one embodiment, T2 is approximately 4.5 hours. In one embodiment, T2 is approximately 4.6 hours. In one embodiment, T2 is approximately 4.7 hours. In one embodiment, T2 is approximately 4.8 hours. In one embodiment, T2 is approximately 4.9 hours. In one embodiment, T2 is approximately 5 hours.
[0263] In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2.
[0264] In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2.
[0265] In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0 mm to 20.0 mm. In a preferred embodiment, the peak thickness of the sedimentation front at T1 is approximately 1 mm to 10.0 mm. In a preferred embodiment, the peak thickness of the sedimentation front at T1 is approximately 1 mm to 5.0 mm. In a more preferred embodiment, the peak thickness of the sedimentation front at T1 is at least 2 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.1 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.2 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 0.3 mm.In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.4 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.5 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.6 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.7 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.8 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.9 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 1.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 2.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 3.0 mm.In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 4.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 5.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 6.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 7.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 8.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 9.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 10.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 11.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 12.0 mm.In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 13.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 14.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 15.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 16.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 17.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 18.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 19.0 mm. In one embodiment, the peak thickness of the first solid-phase sediment at T1 is approximately 20.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 20.0 mm.
[0266] In one embodiment, at T2, the peak thickness of the sedimentation front is approximately 2 mm to 25.0 mm. In a preferred embodiment, at T2, the peak thickness of the sedimentation front is approximately 5 mm to 20.0 mm. In a more preferred embodiment, at T2, the peak thickness of the sedimentation front is approximately 5 mm to 15.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 10 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 1.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 2.0 mm. In one embodiment, in T2, the peak thickness of the sedimentation front is at least 3.0 mm.In one embodiment, the peak thickness of the sedimentation front at T2 is at least 4.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 5.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 6.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 7.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 8.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 9.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 10.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 11.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 12.0 mm.In one embodiment, the peak thickness of the sedimentation front at T2 is at least 13.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 14.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 15.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 16.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 17.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 18.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 19.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 20.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 21.0 mm.In one embodiment, the peak thickness of the sedimentation front at T2 is at least 22.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 23.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 24.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 25.0 mm.
[0267] In one embodiment, the sedimentation rate of the sedimentation front is less than the peak thickness of 10 mm at a time of approximately 1 hour and exceeds the peak thickness of 18 mm at a time of approximately 4 hours.
[0268] In one embodiment, the invention further comprises a time point T3, wherein at time point T3, the sedimentation of the glycoconjugate adsorbed on the insoluble aluminum phosphate is in equilibrium with the liquid phase. In one embodiment, T3 is from about 2 hours to 5 hours. In a preferred embodiment, T3 is from about 3 hours to 5 hours. In a more preferred embodiment, T3 is from about 4 hours to 5 hours. In one embodiment, T3 is about 2.0 hours. In one embodiment, T3 is about 2.1 hours. In one embodiment, T3 is about 2.2 hours. In one embodiment, T3 is about 2.3 hours. In one embodiment, T3 is about 2.4 hours.In one embodiment, T3 is approximately 2.5 hours. In one embodiment, T3 is approximately 2.6 hours. In one embodiment, T3 is approximately 2.7 hours. In one embodiment, T3 is approximately 2.8 hours. In one embodiment, T3 is approximately 2.9 hours. In one embodiment, T3 is approximately 3.0 hours. In one embodiment, T3 is approximately 3.1 hours. In one embodiment, T3 is approximately 3.2 hours. In one embodiment, T3 is approximately 3.3 hours. In one embodiment, T3 is approximately 3.4 hours. In one embodiment, T3 is approximately 3.5 hours. In one embodiment, T3 is approximately 3.6 hours.In one embodiment, T3 is approximately 3.7 hours. In one embodiment, T3 is approximately 3.8 hours. In one embodiment, T3 is approximately 3.9 hours. In one embodiment, T3 is approximately 4.0 hours. In one embodiment, T3 is approximately 4.1 hours. In one embodiment, T3 is approximately 4.2 hours. In one embodiment, T3 is approximately 4.3 hours. In one embodiment, T3 is approximately 4.4 hours. In one embodiment, T3 is approximately 4.5 hours. In one embodiment, T3 is approximately 4.6 hours. In one embodiment, T3 is approximately 4.7 hours. In one embodiment, T3 is approximately 4.8 hours.In one embodiment, the T3 is approximately 4.9 hours. In one embodiment, the T3 is approximately 5 hours.
[0269] In one embodiment, the sedimentation front in T3 is approximately 25 mm to 40 mm. In a preferred embodiment, the sedimentation front in T3 is approximately 30 mm to 40 mm. In a more preferred embodiment, the sedimentation front in T3 is approximately 35 mm to 40 mm. In one embodiment, T3 is approximately 25.0 mm. In one embodiment, T3 is approximately 26 mm. In one embodiment, T3 is approximately 27 mm. In one embodiment, T3 is approximately 28 mm. In one embodiment, T3 is approximately 29 mm. In one embodiment, T3 is approximately 30 mm. In one embodiment, T3 is approximately 31 mm. 3 In one embodiment, T3 is approximately 2 mm.In one embodiment, T3 is approximately 33 mm. In one embodiment, T3 is approximately 34 mm. In one embodiment, T3 is approximately 35 mm. In one embodiment, T3 is approximately 36 mm. In one embodiment, T3 is approximately 37 mm. In one embodiment, T3 is approximately 38 mm. In one embodiment, T3 is approximately 39 mm. In one embodiment, T3 is approximately 40 mm.
[0270] In one embodiment, the composition is quiescent for approximately 1 month. In one embodiment, the composition is quiescent for approximately 2 weeks. In one embodiment, the composition is stored in a container. In one embodiment, the container is a syringe.
[0271] In one embodiment, after T3, the composition is resuspended by about 1-10 manual shakings. In a preferred embodiment, after T3, the composition is resuspended by about 1-5 manual shakings. In a more preferred embodiment, after T3, the composition is resuspended by about 1-3 manual shakings. In one embodiment, after T3, the composition is resuspended by about 1 manual shaking. In one embodiment, after T3, the composition is resuspended by about 2 manual shakings. In one embodiment, after T3, the composition is resuspended by about 3 manual shakings. In one embodiment, after T3, the composition is resuspended by about 4 manual shakings. 5 manual shakings.In one embodiment, after T3, the composition is resuspended by approximately 6 manual shakings. In one embodiment, after T3, the composition is resuspended by approximately 7 manual shakings. In one embodiment, after T3, the composition is resuspended by approximately 8 manual shakings. In one embodiment, after T3, the composition is resuspended by approximately 9 manual shakings. In one embodiment, after T3, the composition is resuspended by approximately 10 manual shakings. In one embodiment, the composition comprises the formulation described previously.
[0272] In one embodiment, the present invention relates to a liquid-filled container comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, wherein: at time T0, substantially all of the at least 25 different glycoconjugates are dissolved in a liquid phase or adsorbed onto the insoluble aluminum phosphate adjuvant as a fully dispersed liquid suspension and the at least 25 different glycoconjugates are present at a concentration of C0 in the liquid phase; at time T1, a portion of the at least 25 different glycoconjugates adsorbed onto the insoluble adjuvant precipitate from the liquid phase to form a precipitate and the at least 25 different glycoconjugates have a concentration of C1 in the liquid phase;at time T2, an additional portion of the at least 25 different glycoconjugates adsorbed on the insoluble adjuvant precipitates from the liquid phase to form a sediment and the at least 25 different glycoconjugates are present at a concentration of C2 in the liquid phase; and wherein the sedimentation rate is measured over time by static multiple light scattering to detect particle migration in the liquid, wherein the measuring head comprises a pulsed near infrared light source having a wavelength of approximately 880 nm and having synchronous transmission detectors 180° from the light source and backscatter detectors 45° from the light source that move along the height of a flat-bottomed cylindrical glass sample cuvette to obtain sediment data every 20 μm;
[0273] In one embodiment, the container includes at least 21 different glycoconjugates. In one embodiment, the container includes at least 22 different glycoconjugates. In one embodiment, the container includes at least 23 different glycoconjugates. In one embodiment, the container includes at least 24 different glycoconjugates. In one embodiment, the container includes at least 25 different glycoconjugates. In one embodiment, the container includes at least 26 different glycoconjugates. In one embodiment, the container includes at least 27 different glycoconjugates. In one embodiment, the container includes at least 28 different glycoconjugates. In one embodiment, the container includes at least 29 different glycoconjugates.In one embodiment, the container comprises at least 30 different glycoconjugates. In one embodiment, the container comprises at least 31 different glycoconjugates. In one embodiment, the container comprises at least 32 different glycoconjugates. In one embodiment, the container comprises at least 33 different glycoconjugates. In one embodiment, the container comprises at least 34 different glycoconjugates. In one embodiment, the container comprises at least 35 different glycoconjugates.
[0274] In one embodiment, T0 is 0 hours. In one embodiment, T1 is about 0.01 hours to 4 hours. In a preferred embodiment, T1 is about 1 hour to 3 hours. In a more preferred embodiment, T1 is about 1 hour to 2 hours. In one embodiment, T1 is 0.1 hours. In one embodiment, T1 is about 0.2 hours. In one embodiment, T1 is about 0.3 hours. In one embodiment, T1 is about 0.4 hours. In one embodiment, T1 is about 0.5 hours. In one embodiment, T1 is about 0.6 hours. In one embodiment, T1 is about 0.7 hours.In one embodiment, T1 is approximately 0.8 hours. In one embodiment, T1 is approximately 0.9 hours. In one embodiment, T1 is approximately 1.0 hours. In one embodiment, T1 is approximately 1.1 hours. In one embodiment, T1 is approximately 1.2 hours. In one embodiment, T1 is approximately 1.3 hours. In one embodiment, T1 is approximately 1.4 hours. In one embodiment, T1 is approximately 1.5 hours. In one embodiment, T1 is approximately 1.6 hours. In one embodiment, T1 is approximately 1.7 hours. In one embodiment, T1 is approximately 1.8 hours. In one embodiment, T1 is approximately 1.9 hours.In one embodiment, T1 is approximately 2.0 hours. In one embodiment, T1 is approximately 2.1 hours. In one embodiment, T1 is approximately 2.2 hours. In one embodiment, T1 is approximately 2.3 hours. In one embodiment, T1 is approximately 2.4 hours. In one embodiment, T1 is approximately 2.5 hours. In one embodiment, T1 is approximately 2.6 hours. In one embodiment, T1 is approximately 2.7 hours. In one embodiment, T1 is approximately 2.8 hours. In one embodiment, T1 is approximately 2.9 hours. In one embodiment, T1 is approximately 3.0 hours. In one embodiment, T1 is approximately 3.1 hours.In one embodiment, T1 is approximately 3.2 hours. In one embodiment, T1 is approximately 3.3 hours. In one embodiment, T1 is approximately 3.4 hours. In one embodiment, T1 is approximately 3.5 hours. In one embodiment, T1 is approximately 3.6 hours. In one embodiment, T1 is approximately 3.7 hours. In one embodiment, T1 is approximately 3.8 hours. In one embodiment, T1 is approximately 3.9 hours. In one embodiment, T. i represents approximately 4.0 hours.
[0275] In one embodiment, T2 is about 1 hour to 5 hours. In a preferred embodiment, T2 is about 1 hour to 3 hours. In a more preferred embodiment, T2 is about 1 hour to 2 hours. In a specific embodiment, T2 is about 4 hours. In one embodiment, T2 is about 1.0 hour. In one embodiment, T2 is about 1.1 hours. In one embodiment, T2 is about 1.2 hours. In one embodiment, T2 is about 1.3 hours. In one embodiment, T2 is about 1.4 hours. In one embodiment, T2 is about 1.5 hours. In one embodiment, T2 is about 1.6 hours.In one embodiment, T2 is approximately 1.7 hours. In one embodiment, T2 is approximately 1.8 hours. In one embodiment, T2 is approximately 1.9 hours. In one embodiment, T2 is approximately 2.0 hours. In one embodiment, T2 is approximately 2.1 hours. In one embodiment, T2 is approximately 2.2 hours. In one embodiment, T2 is approximately 2.3 hours. In one embodiment, T2 is approximately 2.4 hours. In one embodiment, T2 is approximately 2.5 hours. In one embodiment, T2 is approximately 2.6 hours. In one embodiment, T2 is approximately 2.7 hours. In one embodiment, T2 is approximately 2.8 hours.In one embodiment, T2 is approximately 2.9 hours. In one embodiment, T2 is approximately 3.0 hours. In one embodiment, T2 is approximately 3.1 hours. In one embodiment, T2 is approximately 3.2 hours. In one embodiment, T2 is approximately 3.3 hours. In one embodiment, T2 is approximately 3.4 hours. In one embodiment, T2 is approximately 3.6 hours. In one embodiment, T2 is approximately 3.7 hours. In one embodiment, T2 is approximately 3.8 hours. In one embodiment, T2 is approximately 3.9 hours. In one embodiment, T2 is approximately 4.0 hours. In one embodiment, T2 is approximately 4.1 hours.In one embodiment, T2 is approximately 4.2 hours. In one embodiment, T2 is approximately 4.3 hours. In one embodiment, T2 is approximately 4.4 hours. In one embodiment, T2 is approximately 4.5 hours. In one embodiment, T2 is approximately 4.6 hours. In one embodiment, T2 is approximately 4.7 hours. In one embodiment, T2 is approximately 4.8 hours. In one embodiment, T2 is approximately 4.9 hours. In one embodiment, T2 is approximately 5 hours.
[0276] In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2.
[0277] In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2.
[0278] In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 0 mm to 20.0 mm. In a preferred embodiment, at T1, the peak thickness of the sedimentation front is approximately 1 mm to 10.0 mm. In a more preferred embodiment, at T1, the peak thickness of the sedimentation front is approximately 1 mm to 5.0 mm. In a specific embodiment, at T1, the peak thickness of the sedimentation front is at least 2 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 0.1 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 0.2 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 0.3 mm.In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.4 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.5 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.6 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.7 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.8 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.9 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 1.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 2.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 3.0 mm.In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 4.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 5.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 6.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 7.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 8.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 9.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 10.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 11.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 12.0 mm.In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 13.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 14.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 15.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 16.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 17.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 18.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 19.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 20.0 mm.
[0279] In one embodiment, at T2, the peak thickness of the sedimentation front is approximately 2 mm to 25.0 mm. In a preferred embodiment, at T2, the peak thickness of the sedimentation front is approximately 5 mm to 20.0 mm. In a more preferred embodiment, at T2, the peak thickness of the sedimentation front is approximately 5 mm to 15.0 mm. In a specific embodiment, at T2, the peak thickness of the sedimentation front is at least 10 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 1.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 2.0 mm. In one embodiment, in T2, the peak thickness of the sedimentation front is at least 3.0 mm.In one embodiment, the peak thickness of the sedimentation front at T2 is at least 4.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 5.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 6.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 7.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 8.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 9.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 10.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 11.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 12.0 mm.In one embodiment, the peak thickness of the sedimentation front at T2 is at least 13.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 14.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 15.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 16.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 17.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 18.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 19.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 20.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 21.0 mm.In one embodiment, the peak thickness of the sedimentation front at T2 is at least 22.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 23.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 24.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 25.0 mm.
[0280] In one embodiment, the sedimentation rate of the sedimentation front is less than the peak thickness of 10 mm at a time of approximately 1 hour and exceeds the peak thickness of 18 mm at a time of approximately 4 hours.
[0281] In one embodiment, the invention further comprises a time point T3, wherein at time point T3, the sedimentation of the glycoconjugate adsorbed on the insoluble aluminum phosphate is in equilibrium with the liquid phase. In one embodiment, T3 is from about 2 hours to 5 hours. In a preferred embodiment, T3 is from about 3 hours to 5 hours. In a more preferred embodiment, T3 is from about 4 hours to 5 hours. In one embodiment, T3 is about 2.0 hours. In one embodiment, T3 is about 2.1 hours. In one embodiment, T3 is about 2.2 hours. In one embodiment, T3 is about 2.3 hours. In one embodiment, T3 is about 2.4 hours.In one embodiment, T3 is approximately 2.5 hours. In one embodiment, T3 is approximately 2.6 hours. In one embodiment, T3 is approximately 2.7 hours. In one embodiment, T3 is approximately 2.8 hours. In one embodiment, T3 is approximately 2.9 hours. In one embodiment, T3 is approximately 3.0 hours. In one embodiment, T3 is approximately 3.1 hours. In one embodiment, T3 is approximately 3.2 hours. In one embodiment, T3 is approximately 3.3 hours. In one embodiment, T3 is approximately 3.4 hours. In one embodiment, T3 is approximately 3.5 hours. In one embodiment, T3 is approximately 3.6 hours.In one embodiment, T3 is approximately 3.7 hours. In one embodiment, T3 is approximately 3.8 hours. In one embodiment, T3 is approximately 3.9 hours. In one embodiment, T3 is approximately 4.0 hours. In one embodiment, T3 is approximately 4.1 hours. In one embodiment, T3 is approximately 4.2 hours. In one embodiment, T3 is approximately 4.4 hours. In one embodiment, T3 is approximately 4.5 hours. In one embodiment, T3 is approximately 4.6 hours. In one embodiment, T3 is approximately 4.7 hours. In one embodiment, T3 is approximately 4.8 hours.In one embodiment, the T3 is approximately 4.9 hours. In one embodiment, the T3 is approximately 5 hours.
[0282] In one embodiment, the sedimentation front in T3 is approximately 25 mm to 40 mm. In a preferred embodiment, the sedimentation front in T3 is approximately 30 mm to 40 mm. In a more preferred embodiment, the sedimentation front in T3 is approximately 35 mm to 40 mm. In one embodiment, T3oh is approximately 25.0 mm. In one embodiment, T3oh is approximately 26 mm. In one embodiment, T3oh is approximately 27 mm. In one embodiment, T3oh is approximately 28 mm. In one embodiment, T3oh is approximately 29 mm. In one embodiment, T3oh is approximately 30 mm. In one embodiment, T3oh is approximately 31 mm. In one embodiment, T3oh is approximately 2 mm.In one embodiment, T3 is approximately 33 mm. In one embodiment, T3 is approximately 34 mm. In one embodiment, T3 is approximately 35 mm. In one embodiment, T3 is approximately 36 mm. In one embodiment, T3 is approximately 37 mm. In one embodiment, T3 is approximately 38 mm. In one embodiment, T3 is approximately 39 mm. In one embodiment, T3 is approximately 40 mm.
[0283] In one embodiment, the composition is quiescent for approximately 1 month. In one embodiment, the composition is quiescent for approximately 2 weeks. In one embodiment, the composition is stored in a container. In one embodiment, the container is a syringe.
[0284] In one embodiment, after T3, the composition is resuspended by about 1-10 manual shakings. In a preferred embodiment, after T3, the composition is resuspended by about 1-5 manual shakings. In a more preferred embodiment, after T3, the composition is resuspended by about 1-3 manual shakings. In one embodiment, after T3, the composition is resuspended by about 1 manual shaking. In one embodiment, after T3, the composition is resuspended by about 2 manual shakings. In one embodiment, after T3, the composition is resuspended by about 3 manual shakings. In one embodiment, after T3, the composition is resuspended by about 4 manual shakings. In one embodiment, after T3, the composition is resuspended by 5 manual shakings.In one embodiment, after T3, the composition is resuspended by approximately 6 manual shakings. In one embodiment, after T3, the composition is resuspended by approximately 7 manual shakings. In one embodiment, after T3, the composition is resuspended by approximately 8 manual shakings. In one embodiment, after T3, the composition is resuspended by approximately 9 manual shakings. In one embodiment, after T3, the composition is resuspended by approximately 10 manual shakings. In one embodiment, the composition comprises the formulation described previously.
[0285] In one embodiment, the present invention relates to a composition comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, wherein at time T0, substantially all of the at least 25 different glycoconjugates are dissolved in a liquid phase or adsorbed onto the insoluble aluminum phosphate adjuvant as a fully dispersed liquid suspension and the at least 25 different glycoconjugates are present at a concentration C0 in the liquid phase; at time T1, a portion of the at least 25 different glycoconjugates adsorbed onto the insoluble adjuvant precipitate from the liquid phase to form a precipitate and the at least 25 different glycoconjugates are present at a concentration C1 in the liquid phase;at time T2, an additional portion of the at least 25 different glycoconjugates adsorbed on the insoluble adjuvant precipitates from the liquid phase to form a sediment and the at least 25 different glycoconjugates are present at a concentration of C2 in the liquid phase; and wherein the sedimentation rate is measured over time by static multiple light scattering to detect particle migration in the liquid, wherein the measuring head comprises a pulsed near infrared light source having a wavelength of approximately 880 nm and having synchronous transmission detectors 180° from the light source and backscatter detectors 45° from the light source that move along the height of a flat-bottomed cylindrical glass sample cuvette to obtain sediment data every 20 μm;
[0286] In one embodiment, the composition includes at least 21 different glycoconjugates. In one embodiment, the composition includes at least 22 different glycoconjugates. In one embodiment, the composition includes at least 23 different glycoconjugates. In one embodiment, the composition includes at least 24 different glycoconjugates. In one embodiment, the composition includes at least 25 different glycoconjugates. In one embodiment, the composition includes at least 26 different glycoconjugates. In one embodiment, the composition includes at least 27 different glycoconjugates. In one embodiment, the composition includes at least 28 different glycoconjugates. In one embodiment, the composition includes at least 29 different glycoconjugates.In one embodiment, the composition comprises at least 30 different glycoconjugates. In one embodiment, the composition comprises at least 31 different glycoconjugates. In one embodiment, the composition comprises at least 32 different glycoconjugates. In one embodiment, the composition comprises at least 33 different glycoconjugates. In one embodiment, the composition comprises at least 34 different glycoconjugates. In one embodiment, the composition comprises at least 35 different glycoconjugates.
[0287] In one embodiment, T0 is 0 hours. In one embodiment, T1 is approximately 0.01 hours to 4 hours after the sample has achieved 45% improvement in transparency on the meniscus. In one embodiment, T1 is approximately 1 hour to 2 hours after the sample has achieved 45% improvement in transparency on the meniscus. In a preferred embodiment, T1 is approximately 0.01 hours to 4 hours after the sample has achieved 45% improvement in transparency on the meniscus. In one embodiment, T1 is 0.1 hours after the sample has achieved 45% improvement in transparency on the meniscus. In one embodiment, T1 is approximately 0.2 hours after the sample has achieved 45% improvement in transparency on the meniscus. In one embodiment, T1 is approximately 0.3 hours.In one embodiment, T1 is approximately 0.4 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 0.5 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 0.6 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 0.7 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 0.8 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 0.9 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T1 is approximately 1.0 hour after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 1.1 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 1.2 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 1.3 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 1.4 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 1.5 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T1 is approximately 1.6 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 1.7 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 1.8 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 1.9 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 2.0 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 2.1 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T1 is approximately 2.2 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 2.3 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 2.4 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 2.5 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 2.6 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 2.7 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T1 is approximately 2.8 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 2.9 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 3.0 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 3.1 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 3.2 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 3.3 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T1 is approximately 3.4 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 3.5 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 3.6 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 3.7 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 3.8 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 3.9 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T1 is approximately 4.0 hours after the sample has achieved 45% improvement in meniscus transparency.
[0288] In one embodiment, T2 is approximately 1 hour to 5 hours after the sample has achieved 45% improvement in transparency on the meniscus. In a preferred embodiment, T2 is approximately 1 to 3 hours after the sample has achieved 45% improvement in transparency on the meniscus. In a more preferred embodiment, T2 is approximately 1 to 2 hours after the sample has achieved 45% improvement in transparency on the meniscus. In a specific embodiment, T2 is approximately 4 hours after the sample has achieved 45% improvement in transparency on the meniscus. In one embodiment, T2 is approximately 1.0 hour after the sample has achieved 45% improvement in transparency on the meniscus. In one embodiment, T2 is approximately 1.1 hours after the sample has achieved 45% improvement in transparency on the meniscus.In one embodiment, T2 is approximately 1.2 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 1.3 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 1.4 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 1.5 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 1.6 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 1.7 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T2 is approximately 1.8 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 1.9 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 2.0 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 2.1 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 2.2 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 2.3 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T2 is approximately 2.4 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 2.5 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 2.6 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 2.7 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 2.8 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 2.9 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T2 is approximately 3.0 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 3.1 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 3.2 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 3.3 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 3.4 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 3.6 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T2 is approximately 3.7 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 3.8 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 3.9 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 4.0 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 4.1 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 4.2 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T2 is approximately 4.3 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 4.4 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 4.5 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 4.6 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 4.7 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 4.8 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T2 is approximately 4.9 hours after the sample achieves 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 5 hours after the sample achieves 45% improvement in meniscus transparency.
[0289] In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2.
[0290] In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2.
[0291] In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 0 mm to 20.0 mm. In a preferred embodiment, at T1, the peak thickness of the sedimentation front is approximately 1 mm to 10.0 mm. In a preferred embodiment, at T1, the peak thickness of the sedimentation front is approximately 1 mm to 5.0 mm. In a more preferred embodiment, at T1, the peak thickness of the sedimentation front is at least 2 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 0.1 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 0.2 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 0.3 mm.In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.4 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.5 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.6 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.7 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.8 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.9 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 1.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 2.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 3.0 mm.In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 4.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 5.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 6.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 7.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 8.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 9.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 10.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 11.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 12.0 mm.In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 13.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 14.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 15.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 16.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 17.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 18.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 19.0 mm. In one embodiment, the peak thickness of the first solid-phase sediment at T1 is approximately 20.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 20.0 mm.
[0292] In one embodiment, at T2, the peak thickness of the sedimentation front is approximately 2 mm to 25.0 mm. In a preferred embodiment, at T2, the peak thickness of the sedimentation front is approximately 5 mm to 20.0 mm. In a more preferred embodiment, at T2, the peak thickness of the sedimentation front is approximately 5 mm to 15.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 10 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 1.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 2.0 mm. In one embodiment, in T2, the peak thickness of the sedimentation front is at least 3.0 mm.In one embodiment, the peak thickness of the sedimentation front at T2 is at least 4.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 5.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 6.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 7.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 8.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 9.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 10.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 11.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 12.0 mm.In one embodiment, the peak thickness of the sedimentation front at T2 is at least 13.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 14.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 15.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 16.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 17.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 18.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 19.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 20.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 21.0 mm.In one embodiment, the peak thickness of the sedimentation front at T2 is at least 22.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 23.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 24.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 25.0 mm.
[0293] In one embodiment, the sedimentation rate of the sedimentation front is less than a peak thickness of 10 mm at a time of approximately 1 hour after the sample has achieved 45% improvement in transparency on the meniscus and exceeds a peak thickness of 18 mm at a time of approximately 4 hours after the sample has achieved 45% improvement in transparency on the meniscus.
[0294] In one embodiment, the invention further comprises a time point T3, wherein at time point T3, the sedimentation of the glycoconjugate adsorbed on the insoluble aluminum phosphate is in equilibrium with the liquid phase. In one embodiment, T3 is from about 2 hours to 5 hours after the sample has achieved 45% improvement in transparency on the meniscus. In a preferred embodiment, T3 is from about 3 hours to 5 hours after the sample has achieved 45% improvement in transparency on the meniscus. In a more preferred embodiment, T3 is from about 4 hours to 5 hours after the sample has achieved 45% improvement in transparency on the meniscus. In one embodiment, T3 is about 2.0 hours after the sample has achieved 45% improvement in transparency on the meniscus.In one embodiment, T3 is approximately 2.1 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 2.2 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 2.3 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 2.4 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 2.5 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 2.6 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T3 is approximately 2.7 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 2.8 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 2.9 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 3.0 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 3.1 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 3.2 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T3 is approximately 3.3 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 3.4 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 3.5 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 3.6 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 3.7 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 3.8 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T3 is approximately 3.9 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 4.0 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 4.1 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 4.2 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 4.3 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 4.4 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T3 is approximately 4.5 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 4.6 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 4.7 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 4.8 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 4.9 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 5 hours after the sample has achieved 45% improvement in meniscus transparency.
[0295] In one embodiment, the sedimentation front in T3 is approximately 25 mm to 40 mm. In a preferred embodiment, the sedimentation front in T3 is approximately 30 mm to 40 mm. In a more preferred embodiment, the sedimentation front in T3 is approximately 35 mm to 40 mm. In one embodiment, the sedimentation front in T3 is approximately 25.0 mm. In one embodiment, the sedimentation front in T3 is approximately 26 mm. In one embodiment, the sedimentation front in T3 is approximately 27 mm. In one embodiment, the sedimentation front in T3 is approximately 28 mm. In one embodiment, the sedimentation front in T3 is approximately 29 mm. In one embodiment, the sedimentation front in T3 is approximately 30 mm. In one embodiment, the sedimentation front in T3 is approximately 31 mm. In one embodiment, the sedimentation front in T3 is approximately 2 mm.In one embodiment, T3 is approximately 33 mm. In one embodiment, T3 is approximately 34 mm. In one embodiment, T3 is approximately 35 mm. In one embodiment, T3 is approximately 36 mm. In one embodiment, T3 is approximately 37 mm. In one embodiment, T3 is approximately 38 mm. In one embodiment, T3 is approximately 39 mm. In one embodiment, T3 is approximately 40 mm.
[0296] In one embodiment, the composition is quiescent for approximately 1 month. In one embodiment, the composition is quiescent for approximately 2 weeks. In one embodiment, the composition is stored in a container. In one embodiment, the container is a syringe.
[0297] In one embodiment, after T3, the composition is resuspended by about 1-10 manual shakings. In a preferred embodiment, after T3, the composition is resuspended by about 1-5 manual shakings. In a more preferred embodiment, after T3, the composition is resuspended by about 1-3 manual shakings. In one embodiment, after T3, the composition is resuspended by about 1 manual shaking. In one embodiment, after T3, the composition is resuspended by about 2 manual shakings. In one embodiment, after T3, the composition is resuspended by about 3 manual shakings. In one embodiment, after T3, the composition is resuspended by about 4 manual shakings. 5 manual shakings.In one embodiment, after T3, the composition is resuspended by approximately 6 manual shakings. In one embodiment, after T3, the composition is resuspended by approximately 7 manual shakings. In one embodiment, after T3, the composition is resuspended by approximately 8 manual shakings. In one embodiment, after T3, the composition is resuspended by approximately 9 manual shakings. In one embodiment, after T3, the composition is resuspended by approximately 10 manual shakings. In one embodiment, the composition comprises the formulation described previously.
[0298] In one embodiment, the present invention relates to a liquid-filled container comprising at least 25 different glycoconjugates and an insoluble aluminum phosphate adjuvant, wherein: at time T0, substantially all of the at least 25 different glycoconjugates are dissolved in a liquid phase or adsorbed onto the insoluble aluminum phosphate adjuvant as a fully dispersed liquid suspension and the at least 25 different glycoconjugates are present at a concentration of C0 in the liquid phase; at time T1, a portion of the at least 25 different glycoconjugates adsorbed onto the insoluble adjuvant precipitate from the liquid phase to form a precipitate and the at least 25 different glycoconjugates have a concentration of C1 in the liquid phase;at time T2, an additional portion of the at least 25 different glycoconjugates adsorbed on the insoluble adjuvant precipitates from the liquid phase to form a sediment and the at least 25 different glycoconjugates are present at a concentration of C2 in the liquid phase; and wherein the sedimentation rate is measured over time by static multiple light scattering to detect particle migration in the liquid, wherein the measuring head comprises a pulsed near infrared light source having a wavelength of approximately 880 nm and having synchronous transmission detectors 180° from the light source and backscatter detectors 45° from the light source that move along the height of a flat-bottomed cylindrical glass sample cuvette to obtain sediment data every 20 μm;
[0299] In one embodiment, the container includes at least 21 different glycoconjugates. In one embodiment, the container includes at least 22 different glycoconjugates. In one embodiment, the container includes at least 23 different glycoconjugates. In one embodiment, the container includes at least 24 different glycoconjugates. In one embodiment, the container includes at least 25 different glycoconjugates. In one embodiment, the container includes at least 26 different glycoconjugates. In one embodiment, the container includes at least 27 different glycoconjugates. In one embodiment, the container includes at least 28 different glycoconjugates. In one embodiment, the container includes at least 29 different glycoconjugates. In one embodiment, the container includes at least 30 different glycoconjugates.In one embodiment, the container comprises at least 31 different glycoconjugates. In one embodiment, the container comprises at least 32 different glycoconjugates. In one embodiment, the container comprises at least 33 different glycoconjugates. In one embodiment, the container comprises at least 34 different glycoconjugates. In one embodiment, the container comprises at least 35 different glycoconjugates.
[0300] In one embodiment, T0 is 0 hour. In one embodiment, T1 is approximately 0.01 hour to 4 hours after the sample achieves 45% improvement in transparency on the meniscus. In one embodiment, T1 is approximately 1 hour to 2 hours after the sample achieves 45% improvement in transparency on the meniscus. In a preferred embodiment, T1 is approximately 0.01 hour to 4 hours after the sample achieves 45% improvement in transparency on the meniscus. In one embodiment, T1 is 0.1 hour after the sample achieves 45% improvement in transparency on the meniscus. In one embodiment, T1 is approximately 0.2 hours after the sample achieves 45% improvement in transparency on the meniscus. In one embodiment, T1 is approximately 0.3 hours.In one embodiment, T1 is approximately 0.4 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 0.5 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 0.6 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 0.7 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 0.8 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 0.9 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T1 is approximately 1.0 hour after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 1.1 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 1.2 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 1.3 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 1.4 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 1.5 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T1 is approximately 1.6 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 1.7 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 1.8 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 1.9 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 2.0 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 2.1 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T1 is approximately 2.2 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 2.3 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 2.4 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 2.5 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 2.6 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 2.7 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T1 is approximately 2.8 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 2.9 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 3.0 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 3.1 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 3.2 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 3.3 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T1 is approximately 3.4 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 3.5 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 3.6 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 3.7 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 3.8 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T1 is approximately 3.9 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T1 is approximately 4.0 hours after the sample has achieved 45% improvement in meniscus transparency.
[0301] In one embodiment, T2 is approximately 1 hour to 5 hours after the sample achieves 45% improvement in transparency on the meniscus. In a preferred embodiment, T2 is approximately 1 to 3 hours after the sample achieves 45% improvement in transparency on the meniscus. In a more preferred embodiment, T2 is approximately 1 to 2 hours after the sample achieves 45% improvement in transparency on the meniscus. In a specific embodiment, T2 is approximately 4 hours after the sample achieves 45% improvement in transparency on the meniscus. In one embodiment, T2 is approximately 1.0 hour after the sample achieves 45% improvement in transparency on the meniscus. In one embodiment, T2 is approximately 1.1 hours after the sample achieves 45% improvement in transparency on the meniscus.In one embodiment, T2 is approximately 1.2 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 1.3 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 1.4 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 1.5 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 1.6 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 1.7 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T2 is approximately 1.8 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 1.9 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 2.0 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 2.1 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 2.2 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 2.3 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T2 is approximately 2.4 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 2.5 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 2.6 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 2.7 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 2.8 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 2.9 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T2 is approximately 3.0 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 3.1 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 3.2 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 3.3 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 3.4 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 3.6 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T2 is approximately 3.7 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 3.8 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 3.9 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 4.0 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 4.1 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 4.2 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T2 is approximately 4.3 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 4.4 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 4.5 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 4.6 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 4.7 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 4.8 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T2 is approximately 4.9 hours after the sample achieves 45% improvement in meniscus transparency. In one embodiment, T2 is approximately 5 hours after the sample achieves 45% improvement in meniscus transparency.
[0302] In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2.
[0303] In one embodiment, C0 is greater than both C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2. In one embodiment, C0 is greater than C1 and C2. In one embodiment, C1 is greater than C2.
[0304] In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 0 mm to 20.0 mm. In a preferred embodiment, at T1, the peak thickness of the sedimentation front is approximately 1 mm to 10.0 mm. In a more preferred embodiment, at T1, the peak thickness of the sedimentation front is approximately 1 mm to 5.0 mm. In a specific embodiment, at T1, the peak thickness of the sedimentation front is at least 2 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 0.1 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 0.2 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 0.3 mm.In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.4 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.5 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.6 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.7 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.8 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 0.9 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 1.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 2.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 3.0 mm.In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 4.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 5.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 6.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 7.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 8.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 9.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 10.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 11.0 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 12.0 mm.In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 13.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 14.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 15.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 16.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 17.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 18.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 19.0 mm. In one embodiment, the peak thickness of the sedimentation front at T1 is approximately 20.0 mm.
[0305] In one embodiment, at T2, the peak thickness of the sedimentation front is approximately 2 mm to 25.0 mm. In a preferred embodiment, at T2, the peak thickness of the sedimentation front is approximately 5 mm to 20.0 mm. In a more preferred embodiment, at T2, the peak thickness of the sedimentation front is approximately 5 mm to 15.0 mm. In a specific embodiment, at T2, the peak thickness of the sedimentation front is at least 10 mm. In one embodiment, at T1, the peak thickness of the sedimentation front is approximately 0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 1.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 2.0 mm. In one embodiment, in T2, the peak thickness of the sedimentation front is at least 3.0 mm.In one embodiment, the peak thickness of the sedimentation front at T2 is at least 4.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 5.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 6.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 7.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 8.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 9.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 10.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 11.0 mm. In one embodiment, at T2, the peak thickness of the sedimentation front is at least 12.0 mm.In one embodiment, the peak thickness of the sedimentation front at T2 is at least 13.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 14.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 15.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 16.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 17.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 18.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 19.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 20.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 21.0 mm.In one embodiment, the peak thickness of the sedimentation front at T2 is at least 22.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 23.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 24.0 mm. In one embodiment, the peak thickness of the sedimentation front at T2 is at least 25.0 mm.
[0306] In one embodiment, the sedimentation rate of the sedimentation front is less than a peak thickness of 10 mm at a time of approximately 1 hour after the sample has achieved 45% improvement in transparency on the meniscus and exceeds a peak thickness of 18 mm at a time of approximately 4 hours after the sample has achieved 45% improvement in transparency on the meniscus.
[0307] In one embodiment, the invention further comprises a time point T3, wherein at time point T3, the sedimentation of the glycoconjugate adsorbed on the insoluble aluminum phosphate is in equilibrium with the liquid phase. In one embodiment, T3 is approximately 2 hours to 5 hours after the sample has achieved 45% improvement in transparency on the meniscus. In a preferred embodiment, T3 is approximately 3 hours to 5 hours after the sample has achieved 45% improvement in transparency on the meniscus. In a more preferred embodiment, T3 is approximately 4 hours to 5 hours after the sample has achieved 45% improvement in transparency on the meniscus. In one embodiment, T3 is approximately 2.0 hours after the sample has achieved 45% improvement in transparency on the meniscus.In one embodiment, T3 is approximately 2.1 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 2.2 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 2.3 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 2.4 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 2.5 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 2.6 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T3 is approximately 2.7 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 2.8 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 2.9 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 3.0 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 3.1 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 3.2 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T3 is approximately 3.3 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 3.4 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 3.5 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 3.6 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 3.7 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 3.8 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T3 is approximately 3.9 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 4.0 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 4.1 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 4.2 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 4.3 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 4.4 hours after the sample has achieved 45% improvement in meniscus transparency.In one embodiment, T3 is approximately 4.5 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 4.6 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 4.7 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 4.8 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 4.9 hours after the sample has achieved 45% improvement in meniscus transparency. In one embodiment, T3 is approximately 5 hours after the sample has achieved 45% improvement in meniscus transparency.
[0308] In one embodiment, the sedimentation front in T3 is approximately 25 mm to 40 mm. In a preferred embodiment, the sedimentation front in T3 is approximately 30 mm to 40 mm. In a more preferred embodiment, the sedimentation front in T3 is approximately 35 mm to 40 mm. In one embodiment, T3oh is approximately 25.0 mm. In one embodiment, T3oh is approximately 26 mm. In one embodiment, T3oh is approximately 27 mm. In one embodiment, T3oh is approximately 28 mm. In one embodiment, T3oh is approximately 29 mm. In one embodiment, T3oh is approximately 30 mm. In one embodiment, T3oh is approximately 31 mm. In one embodiment, T3oh is approximately 2 mm.In one embodiment, T3 is approximately 33 mm. In one embodiment, T3 is approximately 34 mm. In one embodiment, T3 is approximately 35 mm. In one embodiment, T3 is approximately 36 mm. In one embodiment, T3 is approximately 37 mm. In one embodiment, T3 is approximately 38 mm. In one embodiment, T3 is approximately 39 mm. In one embodiment, T3 is approximately 40 mm.
[0309] In one embodiment, the composition is quiescent for approximately 1 month. In one embodiment, the composition is quiescent for approximately 2 weeks. In one embodiment, the composition is stored in a container. In one embodiment, the container is a syringe.
[0310] In one embodiment, after T3, the composition is resuspended with about 1-10 manual shakings. In a preferred embodiment, after T3, the composition is resuspended with about 1-5 manual shakings. In a more preferred embodiment, after T3, the composition is resuspended with about 1-3 manual shakings. In one embodiment, after T3, the composition is resuspended with about 1 manual shaking. In one embodiment, after T3, the composition is resuspended with about 2 manual shakings. In one embodiment, after T3, the composition is resuspended with about 3 manual shakings. In one embodiment, after T3, the composition is resuspended with about 4 manual shakings. 5 manual shakings. In one embodiment, after T3, the composition is resuspended with about 6 manual shakings.In one embodiment, after T3, the composition is resuspended with approximately 7 manual agitations. In one embodiment, after T3, the composition is resuspended with approximately 8 manual agitations. In one embodiment, after T3, the composition is resuspended with approximately 9 manual agitations. In one embodiment, after T3, the composition is resuspended with approximately 10 manual agitations. In one embodiment, the composition comprises the formulation described previously.
[0311] Figs. 1-3 show sedimentation curves for comparative formulations and formulations of the present invention. In one embodiment, the sedimentation velocity of the first solid phase precipitate is less than the sedimentation velocity of the second solid phase precipitate. The formulations of the present invention settle at a suitable rate to allow manufacturing, resuspension, and use. In certain embodiments, the formulations of the present invention have sedimentation rates that are higher than those of the control formulation with 20 serotypes. In certain embodiments, the formulations of the present invention have sedimentation rates that fall between the sedimentation curve of the control formulation with seven serotypes and the control formulation with 20 serotypes (Fig. 1 and the shaded area of Fig. 2).In certain embodiments, the formulations of the present invention have sedimentation rates that fall between the sedimentation curve of the seven-serotype control formulation and the 25-serotype control formulation (Figure 1 and the shaded area of Figure 3). In some embodiments, the formulations of the present invention have sedimentation rates that fall within the shaded area of Figure 2 or Figure 3, as illustrated by a series of matrices detailed in Table 1 below.
[0312] In one embodiment, the present invention relates to a syringe filled with any of the vaccine formulations described herein. In some embodiments, the syringe is siliconized and / or made of glass.
[0313] A typical dose of the vaccine compositions of the invention for injection has a volume of from 0.1 ml to 2 ml, more preferably from 0.2 ml to 1 ml, even more preferably a volume of about 0.5 ml.
[0314] Thus, the container or syringe as defined above is filled with a volume of from 0.1 ml to 2 ml, more preferably from 0.2 ml to 1 ml, even more preferably a volume of about 0.5 ml of any of the vaccine formulations defined herein.Adjuvants
[0315] In some embodiments, the vaccine formulations described herein may further comprise at least one, two, or three adjuvants. In some embodiments, the vaccine formulations described herein may further comprise at least one adjuvant. In some embodiments, the vaccine formulations described herein may further comprise one adjuvant. In some embodiments, the vaccine formulations described herein may further comprise two adjuvants. The term "adjuvant" refers to a compound or mixture that enhances the immune response to an antigen. Antigens may act primarily as a delivery system, primarily as an immunomodulator, or have both. Suitable adjuvants include those suitable for use in mammals, including humans.
[0316] Examples of known suitable adjuvants of the type of delivery systems that can be used in humans include, but are not limited to, alum (e.g., aluminum phosphate, aluminum sulfate, or aluminum hydroxide), calcium phosphate, liposomes, oil-in-water emulsions such as MF59 (4.3% w / v squalene, 0.5% w / v polysorbate 80 (Tween 80), 0.5% w / v sorbitan trioleate (Span 85)), water-in-oil emulsions such as Montanide, and microparticles or nanoparticles of D, L-lactide-co-glycolide (PLG) copolymer.
[0317] In one embodiment, the formulations described herein contain aluminum salts (alum) as an adjuvant (e.g., aluminum phosphate, aluminum sulfate, or aluminum hydroxide). In a preferred embodiment, the vaccine formulations described herein contain aluminum phosphate or aluminum hydroxide as an adjuvant. In a preferred embodiment, the vaccine formulations described herein contain aluminum phosphate as an adjuvant.
[0318] Additional illustrative adjuvants for enhancing the efficacy of the vaccine formulations as described herein include, but are not limited to: (1) oil-in-water emulsion formulations (with other specific immunostimulatory agents such as muramyl peptides (seebelow) or bacterial cell wall components, or without them), such as (a) SAF containing 10% squalene, 0.4% Tween 80, 5% pluronic-blocked polymer L121 and thr-MDP, either microfluidized into a submicron emulsion or shaken to produce an emulsion with a larger particle size, and (b) RIBI™ adjuvant system (RAS), (Ribi Iminunochein, Hamilton, MT), containing 2% squalene, 0.2% Tween 80 and one or more bacterial cell wall components such as monophosphorolipid A (MPL), trehalose dimycolate (TDM) and cell wall skeleton (CWS), preferably MPL+CWS (DETOX™); (2) Saponin adjuvants such as QS21, STIMULON™ (Cambridge Bioscience, Worcester, MA), ABISCO can be used. ® (Isconova, Sweden) or ISCOMATRIX ®(Commonwealth Serum Laboratories, Australia), or particles derived therefrom, such as ISCOMs (immunostimulating complexes), wherein the ISCOMs may be devoid of additional detergent (e.g. WO 00 / 07621); (3) complete Freund's adjuvant (CFA) and incomplete Freund's adjuvant (IFA); (4) cytokines such as interleukins (e.g. IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12 (e.g. WO 99 / 44636)), interferons (e.g. gamma interferon), macrophage colony-stimulating factor (M-CSF), tumor necrosis factor (TNF), etc.; (5) monophosphoryl lipid A (MPL) or 3-O-deacylated MPL (3dMPL) (see, for example, GB-2220221, EP0689454), optionally substantially free of alum when used with pneumococcal saccharides (see, for example, WO 00 / 56358); (6) combinations of 3dMPL, for example with QS21 and / or oil-in-water emulsions (see, for example, EP0835318, EP0735898, EP0761231); (7) a polyoxyethylene ether or a polyoxyethylene ester (see, e.g. WO 99 / 52549); (8) a polyoxyethylene sorbitan ester surfactant in combination with an octoxynol (e.g. WO 01 / 21207) or a polyoxyethylene alkyl ether or ester surfactant in combination with at least one further non-ionic surfactant such as an octoxynol (e.g. WO 01 / 21152); (9) a saponin and an immunostimulatory oligonucleotide (e.g. a CpG oligonucleotide) (e.g. WO 00 / 62800); (10) an immunostimulant and a metal salt particle (see, e.g. WO 00 / 23105); (11) a saponin and an oil-in-water emulsion (e.g. WO 99 / 11241); (12) saponin (e.g. QS21) +3 dMPL + IM2 (optionally + sterol) (e.g. WO 98 / 57659); (13) other substances that act as immunostimulatory agents, increasing the effectiveness of the composition.Muramyl peptides include N-acetylmuramyl-L-threonyl-D-isoglutamine (thr-MDP), N-25 acetyl-normuramil-L-alanyl-D-isoglutarninyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine MTP-PE), etc. In one embodiment of the present invention, the vaccine formulations described herein comprise a CpG oligonucleotide as an adjuvant. A CpG oligonucleotide, as used herein, refers to an immunostimulatory CpG oligodeoxynucleotide (CpG ODN), and accordingly, these terms are used interchangeably unless otherwise specified. Immunostimulatory CpG oligodeoxynucleotides contain one or more immunostimulatory CpG motifs, which are unmethylated cytosine-guanine dinucleotides, optionally in specific preferred base contexts. The methylation status of an immunostimulatory CpG motif typically refers to the cytosine residue in the dinucleotide.An immunostimulatory oligonucleotide comprising at least one unmethylated CpG dinucleotide is an oligonucleotide that comprises a 5'-unmethylated cytosine linked by a phosphate bond to a 3'-guanine and that activates the immune system by binding to Toll-like receptor 9 (TLR-9). In another embodiment, the immunostimulatory oligonucleotide may comprise one or more methylated CpG dinucleotides that activate the immune system through TLR9, but not as strongly as if the CpG motif(s) were unmethylated. The immunostimulatory CpG oligonucleotides may include one or more palindromes, which in turn may encompass a CpG dinucleotide. CpG oligonucleotides have been described in a number of issued patents, published patent applications, and other publications, including U.S. Patent Nos. 6,194,388; 6,207,646; 6214806; 6218371; 6239116 and 6339068.
[0319] In one embodiment of the present invention, the vaccine formulations described herein comprise any of the CpG oligonucleotides described from page 3, line 22 to page 12, line 36, of WO 2010 / 125480.
[0320] Different classes of CpG immunostimulatory oligonucleotides have been identified. They are referred to as classes A, B, C, and P and are described in more detail on page 3, line 22, to page 12, line 36, of WO 2010 / 125480. The methods of the invention encompass the use of these different classes of CpG immunostimulatory oligonucleotides.
[0321] In one embodiment of the present invention, the vaccine formulations described herein comprise class A CpG oligonucleotides. Preferably, the "class A" CpG oligonucleotides of the invention comprise the nucleic acid sequence: 5' GGGGACGACGTCGTGGGGGG 3' (SEQ ID NO: 1). Some non-limiting examples of class A oligonucleotides include: 5' G*G*G_G_A_C_G_A_C_G_A_C_G_T_C_G_T_G_G*G*G*G*G*G*G 3' (SEQ ID NO: 2); where "*" refers to a phosphorothioate bond and "_" refers to a phosphodiester bond.
[0322] In one embodiment of the present invention, the vaccine formulations described herein comprise class B CpG oligonucleotides. In one embodiment, the CpG oligonucleotides for use in the present invention are class B CpG oligonucleotides corresponding to the minor formula:
[0323] 5' X1X2CGX3X4 3', where X1, X2, X3, and X4 are nucleotides. In one embodiment, X2 is adenine, guanine, or thymine. In another embodiment, X3 is cytosine, adenine, or thymine.
[0324] The sequences of the class B CpG oligonucleotides of the invention are those generally described above and also disclosed in WO 96 / 02555, WO 98 / 18810 and U.S. Patent Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116 and 6,339,068. Illustrative sequences include, but are not limited to, those described in these latter applications and patents.
[0325] In one embodiment, the "class B" CpG oligonucleotides of the invention comprise the following nucleic acid sequence:
[0326] 5' TCGTCGTTTTTCGGTGCTTTT 3' (SEQ ID NO: 3), or
[0327] 5' TCGTCGTTTTTCGGTCGTTTT 3' (SEQ ID NO: 4), or
[0328] 5' TCGTCGTTTTGTCGTT1TGTCGTT 3' (SEQ ID NO: 5), or
[0329] 5' TCGTCGTTTCGTCGTT1TGTCGTT 3' (SEQ ID NO: 6), or
[0330] 5' TCGTCGTTTTGTCGTT1TTTTCGA 3' (SEQ ID NO: 7).
[0331] In any of these sequences, all of the linkages may be phosphorothioate linkages. In another embodiment, in any of these sequences, one or more of the linkages may be phosphodiester linkages, preferably between the "C" and "G" of the CpG motif, forming a semi-soft CpG oligonucleotide. In any of these sequences, the 5' T may be replaced with ethyluridine or halogen; examples of halogen substitutions include, but are not limited to, substitutions with bromuridine or iodouridine.
[0332] Some non-limiting examples of class B oligonucleotides include:
[0333] 5' T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*G*C*T*T*T*T 3 (SEQ ID NO: 8), or
[0334] 5' T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*C*G*T*T*T*T 3' (SEQ ID NO: 9), or
[0335] 5' T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3' (SEQ ID NO: 10), or
[0336] 5' T*C*G*T*C*G*T*T*T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3' (SEQ ID NO: 11), or
[0337] 5' T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*T*T*T*C*G*A 3' (SEQ ID NO: 12).
[0338] where "*" refers to the phosphorothioate linkage.
[0339] In one embodiment of the present invention, the vaccine formulations as described herein comprise a class C CpG oligonucleotide. In one embodiment, the “class C” CpG oligonucleotides of the invention have the following nucleic acid sequence:
[0340] 5' TCGCGTCGTTCGGCGCGCGCCG 3' (SEQ ID NO: 13), or
[0341] 5' TCGTCGACGTTCGGCGCGCGCCG 3' (SEQ ID NO: 14), or
[0342] 5' TCGGACGTTCGGCGCGCGCCG 3' (SEQ ID NO: 15), or
[0343] 5' TCGGACGTTCGGCGCGCCG 3' (SEQ ID NO: 16), or
[0344] 5' TCGCGTCGTTCGGCGCGCCG 3' (SEQ ID NO: 17), or
[0345] 5' TCGACGTTCGGCGCGCGCCG 3' (SEQ ID NO: 18), or
[0346] 5' TCGACGTTCGGCGCGCCG 3' (SEQ ID NO: 19), or
[0347] 5' TCGCGTCGTTCGGCGCCG 3' (SEQ ID NO: 20), or
[0348] 5' TCGCGACGTTCGGCGCGCGCCG 3' (SEQ ID NO: 21), or
[0349] 5' TCGTCGTTTTCGGCGCGCGCCG 3' (SEQ ID NO: 22), or
[0350] 5' TCGTCGTTTTCGGCGGCCGCCG 3' (SEQ ID NO: 23), or
[0351] 5' TCGTCGTTTTACGGCGCCGTGCCG 3' (SEQ ID NO: 24), or
[0352] 5' TCGTCGTTTTCGGCGCGCGCCGT 3' (SEQ ID NO: 25).
[0353] In any of these sequences, all linkages may be phosphorothioate linkages. In another embodiment, in any of these sequences, one or more linkages may be phosphodiester linkages, preferably between the "C" and "G" of the CpG motif, making the motif a semi-soft CpG oligonucleotide.
[0354] Some non-limiting examples of class C oligonucleotides include:
[0355] 5' (SEQ ID NO: 26), or
[0356] (SEQ ID NO: 27), or
[0357] ID NO: 28), or
[0358] (SEQ ID NO: 29), or
[0359] (SEQ ID NO: 30), or
[0360] (SEQ ID NO: 31), or
[0361] (SEQ ID NO: 32), or
[0362] (SEQ ID NO: 33), or
[0363] (SEQ ID NO: 34), or
[0364] (SEQ ID NO: 35), or
[0365] (SEQ ID NO: 36), or
[0366] 3' (SEQ ID NO: 37), or
[0367] (SEQ ID NO: 38)
[0368] where “*” refers to phosphorothioate linkage and “ ” refers to phosphodiester linkage.
[0369] In any of these sequences, the 5' T may be replaced with ethyluridine or a halogen; examples of halogen substitutions include, but are not limited to, substitutions with bromuridine or iodouridine.[037 0] In one embodiment of the present invention, the vaccine formulations as described herein comprise a class P CpG oligonucleotide. In one embodiment, the CpG oligonucleotide for use in the present invention is a class P CpG oligonucleotide comprising a 5' TLR activation domain and at least two palindromic regions, wherein one palindromic region is a 5' palindromic region of at least 6 nucleotides in length and is connected to a 3' palindromic region of at least 8 nucleotides in length either directly or via a spacer, wherein the oligonucleotide comprises at least one YpR dinucleotide. In one embodiment, said oligonucleotide is not (SEQ ID NO: 27). In one embodiment, the class P CpG oligonucleotide comprises at least one unmethylated CpG dinucleotide. In another embodiment, the TLR activation domain is TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG, UUCG, UUUCG, TTT, or TTTT. In another embodiment, the TLR activation domain is in the 5' palindromic region. In another embodiment, the TLR activation domain is immediately 5' to the 5' palindromic region.
[0371] In one embodiment, the "P class" CpG oligonucleotides of the invention have the following nucleic acid sequence: 5' TCGTCGACGATCGGCGCGCGCCG 3' (SEQ ID NO: 39).
[0372] In the indicated sequences, all linkages may be phosphorothioate linkages. In another embodiment, one or more linkages may be phosphodiester linkages, preferably between the "C" and "G" of the CpG motif, forming a semi-soft CpG oligonucleotide. In any of these sequences, the 5' T may be replaced with ethyluridine or a halogen; examples of halogen substitutions include, but are not limited to, substitutions with bromuridine or iodouridine.
[0373] Non-limiting examples of class P oligonucleotides include:
[0374] (SEQ ID NO: 40),
[0375] where “*” refers to phosphorothioate linkage and “_” refers to phosphodiester linkage.
[0376] In one embodiment, the oligonucleotide comprises at least one phosphorothioate linkage. In another embodiment, all internucleotide linkages of the oligonucleotide are phosphorothioate linkages. In another embodiment, the oligonucleotide comprises at least one phosphodiester-like linkage. In another embodiment, the phosphodiester-like linkage is a phosphodiester linkage. In another embodiment, a lipophilic group is conjugated to the oligonucleotide. In one embodiment, the lipophilic group is cholesterol.
[0377] In one embodiment, all internucleotide linkages of the CpG oligonucleotides described herein are phosphodiester linkages ("soft" oligonucleotides as described in WO 2007 / 026190). In another embodiment, the CpG oligonucleotides of the invention are rendered resistant to degradation (e.g., stabilized). A "stabilized oligonucleotide" refers to an oligonucleotide that is relatively resistant to degradation in vivo (e.g., by exo- or endonucleases). Nucleic acid stabilization can be achieved through backbone modifications. Oligonucleotides having phosphorothioate linkages provide maximum activity and protect the oligonucleotide from degradation by intracellular exo- and endonucleases.
[0378] Immunostimulatory oligonucleotides may have a chimeric backbone that has combinations of phosphodiester and phosphorothioate linkages. For the purposes of the present invention, a chimeric backbone refers to a partially stabilized backbone in which at least one internucleotide linkage is a phosphodiester or phosphodiester-like linkage, and in which at least one other internucleotide linkage is a stabilized internucleotide linkage, in which at least one phosphodiester or phosphodiester-like linkage and at least one stabilized linkage are different. When the phosphodiester linkage is preferentially located in a CpG motif, such molecules are called "semi-soft," as described in WO 2007 / 026190.
[0379] Other modified oligonucleotides include combinations of phosphodiester, phosphorothioate, methylphosphonate, methylphosphorothioate, phosphorodithioate and / or p-ethoxy linkages.[038 0] A modified mixed backbone ODN can be synthesized as described in WO 2007 / 026190.
[0381] The size of the CpG oligonucleotide (i.e., the number of nucleotide residues along the length of the oligonucleotide) can also contribute to the stimulatory activity of the oligonucleotide. To facilitate cellular uptake, the CpG oligonucleotide of the invention preferably has a minimum length of 6 nucleotide residues. Oligonucleotides of any size greater than 6 nucleotides (even those many kb in length) are capable of inducing an immune response if sufficient immunostimulatory motifs are present, since larger oligonucleotides are degraded within cells. In some embodiments, CpG oligonucleotides have a length of 6 to 100 nucleotides, preferably 8 to 30 nucleotides. In important embodiments, the nucleic acids and oligonucleotides of the invention are not plasmids or expression vectors.
[0382] In one embodiment, the CpG oligonucleotide described herein includes substitutions or modifications, for example, in bases and / or sugars, as described in paragraphs 134-147 of WO 2007 / 026190.
[0383] In one embodiment, the CpG oligonucleotide of the present invention is chemically modified. Examples of chemical modifications are known to those skilled in the art and are described, for example, in Uhlmann et al. (1990) Chem. Rev. 90:543; S. Agrawal, Ed., Humana Press, Totowa, USA 1993; Crooke et al. (1996) Annu. Rev. Pharmacol. Toxicol. 36:107-129; and Hunziker et al. (1995) Mod. Synth. Methods 7:331-417. The oligonucleotide according to the invention may have one or more modifications, where each modification is located in a specific phosphodiester internucleoside bridge and / or in a specific BD-ribose unit and / or in a specific position of the natural nucleoside base compared to an oligonucleotide with the same sequence, which consists of natural DNA or RNA.
[0384] In some embodiments of the invention, nucleic acids containing CpG can be simply mixed with immunogenic carriers according to methods known to those skilled in the art (see, for example, WO 03 / 024480).
[0385] In a specific embodiment of the present invention, any of the vaccine formulations described herein comprises from 2 μg to 100 mg of a CpG oligonucleotide. In a specific embodiment of the present invention, the vaccine formulations of the invention comprise from 0.1 mg to 50 mg of a CpG oligonucleotide, preferably from 0.2 mg to 10 mg of a CpG oligonucleotide, more preferably from 0.3 mg to 5 mg of a CpG oligonucleotide. In a specific embodiment of the present invention, the vaccine formulations of the invention comprise from 0.3 mg to 5 mg of a CpG oligonucleotide. Even more preferably, the vaccine formulations of the invention may comprise from 0.5 to 2 mg of a CpG oligonucleotide. Most preferably, the vaccine formulations of the invention may comprise from 0.75 to 1.5 mg of a CpG oligonucleotide. In a preferred embodiment, any of the vaccine formulations described herein may contain approximately 1 mg of a CpG oligonucleotide. Liposomal adjuvants
[0386] In one embodiment, the adjuvant comprises liposomes. As used herein, "liposomes" refer to closed bilayer membranes containing an enclosed aqueous volume. Liposomes can also be unilamellar vesicles, having a single membrane bilayer, or multilamellar vesicles with multiple membrane bilayers, each separated from the next by an aqueous layer. The structure of the resulting membrane bilayer is such that the hydrophobic (non-polar) tails of the lipid are oriented toward the center of the bilayer, while the hydrophilic (polar) heads are oriented toward the aqueous phase.Suitable hydrophilic polymers for surrounding liposomes include, but are not limited to, PEG, polyvinylpyrrolidone, polyvinyl methyl ether, polymethyloxazoline, polyethyloxazoline, polyhydroxypropyloxazoline, polyhydroxypropyl methacrylamide, polymethacrylamide, polydimethylacrylamide, polyhydroxypropyl methacrylate, polyhydroxyethyl acrylate, hydroxymethylcellulose, hydroxyethylcellulose, polyethyleneglycol, polyaspartamide, and hydrophilic peptide sequences as described in U.S. Patents 6,316,024; 6,126,966; 6,056,973; and 6,043,094. Liposomes can be prepared without hydrophilic polymers. Thus, liposomal adjuvants may or may not contain hydrophilic polymers. Liposomes can contain any lipid or combination of lipids known in the art.For example, the vesicle-forming lipids can be naturally occurring or synthetic lipids, including phospholipids such as phosphatidylcholine, phosphatidylethanolamine, phosphatidic acid, phosphatidylserine, phosphatidylglycerol, phosphatidylinositol, and sphingomyelin, as described in U.S. Patent Nos. 6,056,973 and 5,874,104.
[0387] A liposomal adjuvant contains liposomes. When a liposomal adjuvant is used in a vaccine formulation, water-soluble antigens such as proteins, peptides, nucleic acids, or carbohydrates are encapsulated within the aqueous interior of the liposomes (See Tretiakova et al. Liposomes as Adjuvants and Vaccine Delivery Systems. Biochem (Mosc) Suppl Ser A Membr Cell Biol. 2022; 16(1):1-20). Alternatively, when a liposomal adjuvant is combined with lipophilic / amphiphilic substances such as lipopeptides and glycolipids, these agents are enclosed within a lipid bilayer (ibid.). Depending on the type of molecule combined with the liposomal adjuvant, additional interactions may include association with the liposome surface via adsorption and covalent binding (ibid.). Thus, in some embodiments, the liposomal adjuvant contains water-soluble antigens, and the antigens are encapsulated within the aqueous interior of the liposomes.In some embodiments, water-soluble antigens are proteins, peptides, nucleic acids, or carbohydrates. In some embodiments, the liposomal adjuvant is combined with lipophilic or amphiphilic molecules, and these molecules are embedded in a lipid bilayer. In some embodiments, the lipophilic or amphiphilic molecules embedded in the liposome lipid bilayer comprise cholesterol, fatty acids, or lipids. In some embodiments, the lipophilic or amphiphilic molecules embedded in the lipid bilayer are lipidated.
[0388] The present invention contemplates the use of any liposomal adjuvant. In one embodiment, the liposomal adjuvant is AS01. AS01 contains 3-O-deacylated monophosphoryl lipid A (3D-MPL) and QS21 in a "quenched form" with cholesterol (see U.S. Patent No. 1,0039,823). In AS01, the lipid layer consists of a neutral lipid that is "non-crystalline" at room temperature, such as dioleoylphosphatidylcholine, cholesterol, MPLA, and QS-21 (see U.S. Patent No. 1,0039,823 and WO 19 96 / 033739). During the production of AS01, small unilamellar liposomal vesicles (SUVs) are first created, and then purified QS-21 is added to the SUVs. QS-21 imparts unique properties because it binds to liposomal cholesterol, where it creates perforations (holes) or other permanent structural changes in liposomes (see, e.g., Paepenmuller et al., 2014, Int. J. Pharm., 475: 138–46).The reduced amount of free QS-21 is believed to result in a reduction in injection site pain often caused by free QS-21 (see, e.g., Waite et al., 2001, Vaccine, 19: 3957-67; Mbawuike et al., 2007, Vaccine, 25: 3263-69). In some embodiments, AS01 comprises cholesterol (sterol) in a molar percentage concentration of from about 1 to about 50% (mol / mol), preferably from about 20 to about 25% (mol / mol) (see U.S. Patent No. 10,039,823). In some embodiments, AS01 (including, for example, AS01A, AS01B, AS01C, AS01D, AS01E, and AS015) comprises dioleoylphosphatidylcholine (DOPC), cholesterol, MPLA, such as 3D-MPL, and QS-21. In further embodiments, the liposomal adjuvant is selected from the group consisting of AS01A, AS01B, AS01C, AS01D, AS01E, and AS015. In one embodiment, the liposomal adjuvant is AS01A.In some embodiments, AS01A comprises 3D-MPL, a toll-like receptor 4 agonist, and QS-21. In one embodiment, the liposomal adjuvant is AS01B. In some embodiments, AS01B comprises 1000 μg per dose of DOPC, 250 μg per dose of cholesterol, 50 μg per dose of 3D-MPL, 50 μg per dose of QS21, phosphate-NaCl buffer, and water to a volume of 0.5 ml (see U.S. Patent No. 10,039,823). In one embodiment, the liposomal adjuvant is AS01E. In some embodiments, AS01E comprises the same components as AS01B, but at a lower concentration. In some embodiments, AS01E comprises 500 mcg per dose of dioleoylphosphatidylcholine (DOPC), 125 mcg per dose of cholesterol, 25 mcg per dose of 3D-MPL, 25 mcg per dose of QS21, phosphate-NaCl buffer, and water to a volume of 0.5 ml (see U.S. Patent No. 10,039,823). In one embodiment, the liposomal adjuvant is AS015.In some embodiments, AS015 comprises dioleoylphosphatidylcholine (DOPC), cholesterol, 3D-MPL, QS-21, and CpG.
[0389] In one embodiment, the liposomal adjuvant is LiNA-1. In some embodiments, LiNA-1 comprises MPLA and saponin. In some embodiments, LiNA-1 comprises MPLA and QS-21. In other embodiments, LiNA-1 comprises phosphorylated hexaacyl disaccharide (PHAD) ® ) (i.e. monophosphoryl lipid A (synthetic), available from Avanti ® polar lipids) and QS-21. In another specific embodiment, LiNA-1 comprises PHAD ® , QS-21, cholesterol and DOPC. In another specific embodiment, LiNA-1 comprises 3D-PHAD ® , QS-21, cholesterol and DOPC. In another specific embodiment, LiNA-1 contains the following components per 0.5 ml dose: (i) 50 μg MPLA (i.e., 3D-PHAD ®), (ii) 250 mcg cholesterol, (iii) 50 mcg QS-21 and (iv) 1000 mcg DOPC. In another specific embodiment, LiNA-1 contains the following components per 0.5 ml dose: (i) 50 mcg MPLA (i.e., PHAD ® ), (ii) 250 μg cholesterol, (iii) 50 μg QS-21, and (iv) 1000 μg DOPC. In some embodiments, the LiNA-1 formulations may be LiNA-1 at a concentration of 0.0625X (0.0625XLiNA-1), LiNA-1 at a concentration of 0.125X (0.125XLiNA-1), LiNA-1 at a concentration of 0.25X (0.25XLiNA-1), LiNA-1 at a concentration of 0.5X (0.5XLiNA-1), LiNA-1 at a concentration of IX (1XLiNA-1), LiNA-1 at a concentration of 2X (2XLiNA-1), LiNA-1 at a concentration of 3X (3XLiNA-1), or LiNA-1 at a concentration of 4X (4XLiNA-1).
[0390] In a specific embodiment, the liposomal adjuvant is ALFQ. In some embodiments, ALFQ comprises MPLA and saponin (see U.S. Patent No. 10,434,167). In some embodiments, ALFQ comprises a lipid bilayer comprising phospholipids in which the hydrocarbon chains have a melting point in water of ≥23°C. In further embodiments, ALFQ comprises cholesterol in a molar percentage concentration of greater than about 50% (mol / mol). In certain embodiments, ALFQ comprises from about 55% to about 71% (mol / mol) cholesterol. In specific embodiments, ALFQ comprises about 55% (mol / mol) cholesterol. In some embodiments, ALFQ comprises MPLA and QS-21. In other embodiments, ALFQ comprises monophosphoryl 3-deacyl lipid A phosphorylated hexaacyl disaccharide (3D-PHAD ® ) (i.e., monophosphoryl 3-deacyl lipid A (synthetic), available from Avanti ®polar lipids) and saponin. In another specific embodiment, ALFQ comprises 3D-PHAD ® , QS-21, dimyristoylphosphatidylcholine (DMPC), dimyristoylphosphatidylglycerol (DMPG) and cholesterol. In another specific embodiment, ALFQ comprises (i) 7.0 mg / mL DMPC, (ii) 0.78 mg / mL DMPG, (iii) 5.4 mg / mL cholesterol, (iv) 0.2 mg / mL MPLA (3D-PHAD ® ) and (v) 0.1 mg / ml QS-21.
[0391] In a specific embodiment, the liposomal adjuvant is LiNA-2. In some embodiments, LiNA-2 comprises MPLA and saponin. In some embodiments, LiNA-2 comprises a lipid bilayer comprising phospholipids in which the hydrocarbon chains have a melting point in water of ≥23°C. In further embodiments, LiNA-2 comprises cholesterol at a molar percentage concentration of greater than about 50% (mol / mol). In certain embodiments, LiNA-2 comprises from about 55% to about 71% (mol / mol) cholesterol. In specific embodiments, LiNA-2 comprises about 55% (mol / mol) cholesterol. In some embodiments, LiNA-2 comprises MPLA and QS-21. In other embodiments, LiNA-2 comprises monophosphoryl 3-deacyl lipid A phosphorylated hexaacyl disaccharide (3D-PHAD ® ) and saponin. In another specific embodiment, LiNA-2 comprises 3D-PHAD ®, QS-21, dimyristoylphosphatidylcholine (DMPC), dimyristoylphosphatidylglycerol (DMPG) and cholesterol.
[0392] In some embodiments, the LiNA-2 adjuvant comprises a phosphate buffer. In some embodiments, the LiNA-2 adjuvant comprises a phosphate buffer at a concentration of about 1 mM to about 100 mM. In some embodiments, the LiNA-2 adjuvant comprises a phosphate buffer at a concentration of about 1 mM to 10 mM. In some embodiments, the LiNA-2 adjuvant comprises a phosphate buffer at a concentration of about 5 mM, about 10 mM, about 15 mM, about 20 mM, about 25 mM, about 30 mM, about 35 mM, about 40 mM, about 45 mM, or about 50 mM. In a specific embodiment, the LiNA-2 adjuvant comprises a phosphate buffer at a concentration of about 10 mM. In another specific embodiment, the LiNA-2 adjuvant comprises 3D-PHAD ®, QS-21, DMPC, DMPG, cholesterol, and phosphate buffer. In a further specific embodiment, the LiNA-2 adjuvant comprises 3D-PHAD ® , QS-21, DMPC, DMPG, cholesterol and 10 mM phosphate buffer.
[0393] In some embodiments, the LiNA-2 adjuvant comprises sodium chloride. In some embodiments, the LiNA-2 adjuvant comprises from about 50 mM to about 500 mM sodium chloride. In other embodiments, the LiNA-2 adjuvant comprises about 25 mM, about 50 mM, about 75 mM, about 100 mM, about 125 mM, about 150 mM, about 175 mM, about 200 mM, about 225 mM, or about 250 mM sodium chloride. In a particular aspect, the LiNA-2 adjuvant comprises about 150 mM sodium chloride. In one embodiment, the LiNA-2 adjuvant comprises 3D-PHAD ®, QS-21, DMPC, DMPG, cholesterol, sodium chloride, and phosphate buffer. In a further specific embodiment, the LiNA-2 adjuvant comprises 3D-PHAD ® , QS-21, DMPC, DMPG, cholesterol, 150 mM sodium chloride and 10 mM phosphate buffer.
[0394] In one embodiment, the adjuvant formulation is 0.5XLiNA-2 (also known as ALFQ), wherein 0.5XLiNA-2 may be homogeneous or heterogeneous, comprising (i) 7.0 mg / mL DMPC, (ii) 0.78 mg / mL DMPG, (iii) 5.4 mg / mL cholesterol, (iv) 0.2 mg / mL MPLA (3D-PHAD ® ), and (v) 0.1 mg / ml QS-21. In another embodiment, the adjuvant formulation is 1XLiNA-2, wherein 1XLiNA-2 may be homogeneous or heterogeneous, comprising (i) 14±7 mg / ml DMPC, (ii) 1.6±0.8 mg / ml DMPG, (iii) 11±6 mg / ml cholesterol, (iv) 0.40±0.20 mg / ml MPLA (3D-PHAD ®), and (v) 0.20±0.10 mg / ml QS-21. In a further embodiment, the adjuvant formulation is 2XLiNA-2, wherein 2XLiNA-2 may be homogeneous or heterogeneous, comprising (i) 28±14 mg / ml DMPC, (ii) 3.2±1.6 mg / ml DMPG, (iii) 22±11 mg / ml cholesterol, (iv) 0.80±0.40 mg / ml MPLA (3D-PHAD ® ), and (v) 0.40±0.20 mg / mL QS-21. In some embodiments, the homogeneous or heterogeneous LiNA-2 adjuvant formulations may be LiNA-2 at a concentration of 0.0625X (0.0625XLiNA-2), LiNA-2 at a concentration of 0.125X (0.125XLiNA-2), LiNA-2 at a concentration of 0.25X (0.25XLiNA-2), LiNA-2 at a concentration of 0.5X (0.5XLiNA-2), LiNA-2 at a concentration of 1X (1XLiNA-2), LiNA-2 at a concentration of 2X (2XLiNA-2), LiNA-2 at a concentration of 3X (3XLiNA-2), or LiNA-2 at a concentration of 4X (4XLiNA-2).
[0395] In some embodiments, the liposomal adjuvant is CAF09 (See Korsholm et al. Induction of CD8+ T-cell responses against subunit antigens by the novel cationic liposomal CAF09 adjuvant, Vaccine, Volume 32, Issue 31, 2014, Pages 3927-3935). In some embodiments, the liposomal adjuvant CAF09 comprises dimethyldioctadecylammonium (DDA), monomycolylglycerol (MMG)-1, and polyinosinic-polycytidylic acid (poly I:C).
[0396] Phospholipid phosphatidylcholine (PC) / phospholipid phosphatidylglycerol (PG): in one embodiment, where the adjuvant comprises liposomes, the liposomes comprise phosphatidylcholine phospholipid (PC). In some embodiments, PC is selected from the group consisting of dimyristoylphosphatidylcholine (DMPC), dipalmitoylphosphatidylcholine (DPPC), and distearylphosphatidylcholine (DSPC). In one embodiment, where the adjuvant comprises liposomes, the liposomes comprise phospholipid phosphatidylglycerol (PG). In some embodiments, PG is selected from the group consisting of: dimyristoylphosphatidylglycerol (DMPG), dipalmitoylphosphatidylglycerol (DPPG), and distearylphosphatidylglycerol (DSPG).In a further embodiment, the adjuvant comprises a combination of (i) a phosphatidylcholine (PC) phospholipid selected from the group consisting of: dimyristoylphosphatidylcholine (DMPC), dipalmitoylphosphatidylcholine (DPPC) and distearylphosphatidylcholine (DSPC) and (ii) a phosphatidylglycerol phospholipid (PG) selected from the group consisting of: dimyristoylphosphatidylglycerol (DMPG), dipalmitoylphosphatidylglycerol (DPPG) and distearylphosphatidylglycerol (DSPG). In some embodiments, the liposomal adjuvant composition has a PC to PG ratio (mol / mol) of about 0.5:1, about 1:1, about 2:1, about 3:1, about 4:1, about 5:1, about 6:1, about 7:1, about 8:1, about 9:1, about 10:1, about 11:1, about 12:1, about 13:1, about 14:1, or about 15:1.In a particular embodiment, the liposomal adjuvant composition comprises PC and PG, wherein PC is dimyristoylphosphatidylcholine (DMPC) and PG is dimyristoylphosphatidylglycerol (DMPG), having a molar ratio of PC to PG (mol / mol) of approximately 9:1.
[0397] Cholesterol: In some embodiments where the adjuvant comprises liposomes, the liposomes of the adjuvant comprise cholesterol. In one embodiment, the liposomal composition of the adjuvant formulation comprises cholesterol in a molar percentage concentration of greater than 50% (mol / mol), for example, from about 55% to about 71% (mol / mol). In a specific embodiment, the adjuvant comprises liposomes that contain approximately 55% (mol / mol) cholesterol.
[0398] Cholesterol and phospholipids: In some embodiments, wherein the adjuvant comprises liposomes, the liposomes of the adjuvant comprise cholesterol and phospholipids. In some embodiments, the molar ratio of cholesterol (b) to phospholipids (a) is from about 55:45 to about 71:29. In one embodiment, the molar ratio of cholesterol (b) to phospholipids (a) is about 55:50, about 55:45, about 55:40, about 55:35, or about 55:30. In a specific embodiment, the molar ratio of cholesterol (b) to phospholipids (a) is about 55:45.
[0399] Vesicle types: in some embodiments, where the adjuvant comprises liposomes, the liposomes comprise multilamellar vesicles (MLVs) or small unilamellar vesicles (SUVs), where the small unilamellar vesicles have a diameter of about 50 to about 100 nm and where the multilamellar vesicles have a diameter of about 1 to about 4 μm.
[0400] MPLA: In another embodiment, where the adjuvant comprises liposomes, the liposomal composition comprises lipid A. In another embodiment, where the adjuvant comprises liposomes, the liposomal composition comprises monophosphoryl lipid A (MPLA). In one embodiment, the liposomal composition comprises penta-acylated MPLA (P-MPLA). In another embodiment, the liposomal composition comprises monophosphoryl lipid A phosphorylated hexaacyl disaccharide (PHAD) ® ). In a specific embodiment, MPLA is monophosphoryl 3-deacyl lipid A phosphorylated hexaacyl disaccharide (3D-PHAD)® ). In one embodiment, the liposomal composition comprises about 5 mg or less, about 4 mg or less, about 3 mg or less, about 2 mg or less, about 1 mg or less, about 0.9 mg or less, about 0.8 mg or less, about 0.7 mg or less, about 0.6 mg or less, about 0.5 mg or less, about 0.4 mg or less, about 0.3 mg or less, about 0.2 mg or less, about 0.1 mg or less, about 0.09 mg or less, about 0.08 mg or less, about 0.07 mg or less, about 0.06 mg or less, about 0.05 mg or less, about 0.04 mg or less, about 0.03 mg or less, about 0.02 mg or less, or about 0.01 mg or less of MPLA, PHAD ® or 3D-PHAD ® etc. (total mass per ml of liposomal suspension).
[0401] MPLA and phospholipids: In one embodiment, where the adju...
Claims
1. A composition for the protection or treatment of a person susceptible to pneumococcal infection, containing: (i) at least 21 different glycoconjugates; (ii) a succinate buffer having a pH in the range of 5.0 to 7.5; (iii) sodium chloride; (iv) sodium phosphate (iv) a surfactant; and (v) adjuvant.
2. The composition according to claim 1, wherein the composition contains 25 different glycoproteins.
3. The composition according to claim 1 or 2, wherein the glycoconjugates are pneumococcal polysaccharide glycoconjugates.
4. The composition according to any one of claims 1 to 3, wherein the glycoconjugates comprise at least one glycoconjugate derived from a serotype of S. pneumoniae selected from the group consisting of serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35BS. pneumoniae and combinations thereof.
5. The composition of any one of claims 1 to 4, wherein the glycoconjugates comprise diphtheria cross-reactive material (CRM197), diphtheria toxin (DT), tetanus toxoid (TT), sterol transfer protein (SCP), protein D (PD) of H. influenzae or rhizavidin (CP1).
6. The composition according to any one of claims 1 to 5, wherein the at least 21 glycoconjugates include at least glycoconjugates derived from serotypes 4, 6B, 9V, 14, 18C, 19F and 23FS. pneumoniae.
7. The composition according to claim 6, wherein the S. pneumoniae serotypes are conjugated with CRM197.
8. The composition of claim 6, wherein at least 25 glycoconjugates further comprise glycoconjugates derived from S. pneumoniae serotypes 1, 5, and 7F.
9. The composition according to claim 8, wherein serotypes 1, 4, 5, 7F, 9V and / or 23FS. pneumoniae are conjugated with PD, serotype 18CS. pneumoniae is conjugated with TT and serotype 19FS. pneumoniae is conjugated with DT.
10. The composition of claim 6, wherein at least 25 glycoconjugates further comprise glycoconjugates derived from S. pneumoniae serotypes 1, 3, 5, 6A, 7F and 19A.
11. The composition according to claim 10, wherein the S. pneumoniae serotypes are conjugated with CRM197.
12. The composition of claim 6, wherein at least 25 glycoconjugates further comprise glycoconjugates derived from S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 19A, 22F and 33F.
13. The composition according to claim 12, wherein the S. pneumoniae serotypes are conjugated with CRM197.
14. The composition of claim 6, wherein the at least 25 glycoconjugates further comprise glycoconjugates derived from S. pneumoniae serotypes 1, 3, 5, 6A, 7F, 8, 10A, 11A, 12F, 15B, 19A, 22F, and 33F.
15. The composition according to claim 14, wherein the S. pneumoniae serotypes are conjugated with CRM197.
16. The composition of claim 6, wherein the at least 25 glycoconjugates further comprise glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 5, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F, and 33F.
17. The composition of claim 6, wherein at least 25 glycoconjugates further comprise glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 17F, 19A, 20, 22F and 33F.
18. The composition according to claim 17, wherein the S. pneumoniae serotypes are conjugated with CRM197.
19. The composition of claim 6, wherein the at least 25 glycoconjugates further comprise glycoconjugates derived from S. pneumoniae serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F, and 35B.
20. The composition according to claim 19, wherein the S. pneumoniae serotypes are conjugated with CRM197.
21. The composition according to claim 19, wherein serotypes 1, 2, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15A, 15B, 19A, 22F, 23A, 23B, 24F, 33F and 35BS. pneumoniae are conjugated with CRM197 and serotype 3S. pneumoniae is conjugated with SCP.
22. The composition of claim 6, wherein the at least 25 glycoconjugates further comprise glycoconjugates derived from serotypes 1, 3, 5, 6A, 7F, 8, 9N, 10A, 11A, 12F, 15B, 18C, 19A, 22F and 33FS. pneumoniae.
23. The composition of claim 22, wherein at least two serotypes of S. pneumoniae are conjugated with TT.
24. The composition of claim 23, wherein at least two TT-conjugated S. pneumoniae serotypes are selected from the group consisting of serotypes 1, 3, 5, 15B, and 22FS. pneumoniae.
25. The composition of claim 23, wherein at least 17 of the S. pneumoniae serotypes are conjugated with CRM197.
26. The composition of claim 23, wherein at least 17 serotypes of S. pneumoniae conjugated with CRM197 are selected from the group consisting of serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F 22F, 23F and 33FS. pneumoniae.
27. The composition according to any one of claims 1 to 5, wherein the pneumococcal glycoconjugates are selected from the group consisting of glycoconjugates derived from serotype 1S. pneumoniae conjugated with CRM197, serotype 3S. pneumoniae conjugated with CRM197, serotype 4S. pneumoniae conjugated with CRM197, serotype 5S. pneumoniae conjugated with CRM197, serotype 6AS. pneumoniae conjugated with CRM197, serotype 6BS. pneumoniae conjugated with CRM197, serotype 7FS. pneumoniae conjugated with CRM197, serotype 8S. pneumoniae conjugated with CRM197, serotype 9VS. pneumoniae conjugated with CRM197, serotype 10AS. pneumoniae conjugated with CRM197, serotype 11AS. pneumoniae conjugated with CRM197, serotype 12FS. pneumoniae conjugated with CRM197, serotype 14S. pneumoniae conjugated with CRM197, serotype 15AS. pneumoniae conjugated with CRM197, serotype 15BS. pneumoniae conjugated with CRM197, serotype 18CS. pneumoniae conjugated with CRM197, serotype 19AS.pneumoniae conjugated with CRM197, serotype 19FS. pneumoniae conjugated with CRM197, serotype 22FS. pneumoniae conjugated with CRM197, serotype 23AS. pneumoniae conjugated with CRM197, serotype 23BS. pneumoniae conjugated with CRM197, serotype 23FS. pneumoniae conjugated with CRM197, serotype 24FS. pneumoniae conjugated with CRM197, serotype 33FS. pneumoniae conjugated with CRM197, serotype 35BS. pneumoniae conjugated with CRM197, and combinations thereof.
28. The composition according to any one of claims 1-27, wherein the total concentration of glycoconjugate is in the range of 1-100 μg.
29. The composition according to any one of claims 1-28, wherein the concentration of each polysaccharide-protein conjugate is in the range of 1-10 μg.
30. The composition according to any one of paragraphs 1-27, wherein the concentration of sodium chloride is 1-300 mM.
31. The composition according to any one of claims 1-30, wherein the concentration of sodium phosphate is 1-50 mM.
32. The composition according to any one of claims 1 to 30, wherein the surfactant is a polysorbate or poloxamer having a molecular weight in the range of 1100 Da to 17400 Da.
33. The composition according to any one of claims 1-32, wherein the surfactant is polysorbate 80.
34. The composition according to any one of paragraphs 1-33, wherein the concentration of surfactant is in the range from 0.001% to 1%.
35. The composition according to any one of claims 1-34, wherein the adjuvant is aluminum phosphate.
36. The composition according to any one of paragraphs 1-35, wherein the concentration of the adjuvant is in the range from 0.01% to 0.1%.
37. The composition of claim 1, wherein the composition contains 25 glycoconjugates, 5 mM succinate pH 5.8, 40 mM sodium phosphate, 245 mM sodium chloride, 0.02% polysorbate 80 and 0.25 mg / ml aluminum phosphate.
38. The composition of claim 37, wherein the 25 glycoconjugates include glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15A, 15B, 18C, 19A, 19F, 22F, 23A, 23B, 23F, 24F, 33F, 35B and combinations thereof.
39. The composition according to claim 1, wherein the concentration of succinate varies from 1 mM to 50 mM.
40. The composition according to claim 39, wherein the concentration of succinate varies from 1 mM to 30 mM.
41. The composition according to claim 39, wherein the concentration of succinate varies from 1 mM to 10 mM.
42. The composition according to claim 39, wherein the concentration of succinate varies from 5 mM to 9 mM.
43. The composition according to claim 39, wherein the concentration of succinate is 5 mM.
44. The composition according to claim 39, wherein the concentration of NaCl varies from 1 mM to 300 mM.
45. The composition according to claim 44, wherein the concentration of NaCl varies from 50 mM to 300 mM.
46. The composition according to claim 44, wherein the concentration of NaCl varies from 100 mM to 300 mM.
47. The composition according to claim 44, wherein the concentration of NaCl varies from 150 mM to 250 mM.
48. The composition according to claim 44, wherein the concentration of NaCl varies from 200 mM to 300 mM.
49. The composition according to claim 44, wherein the NaCl concentration is 245 mM.
50. The composition according to claim 44, wherein the concentration of sodium phosphate varies from 1 mM to 50 mM.
51. The composition according to claim 50, wherein the concentration of sodium phosphate varies from 20 mM to 50 mM.
52. The composition according to claim 50, wherein the concentration of sodium phosphate varies from 30 mM to 50 mM.
53. The composition according to claim 50, wherein the concentration of sodium phosphate varies from 35 mM to 45 mM.
54. The composition according to claim 50, wherein the concentration of sodium phosphate is 40 mM.
55. The composition according to any one of paragraphs 39-54, wherein the pH of said composition is in the range from pH 5.5 to pH 7.
5.
56. The composition according to claim 55, wherein the pH of said composition is in the range from pH 5.5 to pH 6.
0.
57. The composition according to claim 55, wherein the pH of said composition is in the range from pH 5.6 to pH 7.
0.
58. The composition according to claim 55, wherein the pH of said composition is in the range from pH 5.8 to pH 6.
0.
59. The composition according to claim 55, wherein the pH of said composition is 5.
8.
60. The composition according to any one of paragraphs 39-59, wherein said surfactant is polysorbate 20 or polysorbate 80.
61. The composition according to claim 60, wherein the concentration of said surfactant is from 0.001% to 1%.
62. The composition of any one of claims 39-61, wherein each of said glycoconjugates comprises a capsular polysaccharide from a separate serotype of S. pneumoniae, and the concentration of capsular polysaccharide of each serotype per dose is from 1.5 mcg to 5.0 mcg.
63. The composition according to claim 62, wherein the concentration of capsular polysaccharide of each serotype per dose is 2.2 mcg or 4.4 mcg.
64. The composition according to claim 62, wherein the dose volume is 0.5 ml.
65. The composition according to any one of paragraphs 39-47, wherein said adjuvant is an aluminum salt.
66. The composition according to claim 65, wherein said adjuvant is aluminum phosphate.
67. The composition according to claim 66, wherein the concentration of aluminum phosphate varies from 0.1 mg / ml to 1.0 mg / ml.
68. The composition according to any one of claims 66-67, wherein said adjuvant forms a precipitate that is in equilibrium with the liquid phase of said composition, 2-5 hours after the start of precipitation.
69. The composition of any one of paragraphs 39-68, wherein after storage in a pre-filled syringe for 1 month at a temperature of from 2°C to 8°C, said composition can be resuspended with 1-10 shakings.
70. The composition of any one of claims 39 to 69, wherein the sedimentation rate of said composition is higher than that of a control composition comprising capsular polysaccharide of S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F, each of which is individually conjugated with CRM197, 5 mM succinate (pH 5.8), 150 mM NaCl, 0.02% polysorbate 80 and 0.25 mg / ml aluminum as aluminum phosphate.
71. The composition according to any one of claims 39-70, wherein said composition comprises a capsular polysaccharide of at least one serotype of S. pneumoniae selected from the group consisting of serotypes 15A, 23A, 23B, 24F and 35B.
Citation Information
Patent Citations
IMMUNOGENIC POLYSACCHARIDE-PROTEIN CONJUGATES CONTAINING POLYSACCHARIDE DERIVED FROM GROUP B STREPTOCOCCUS (GBS)
RU2019113795A
Multivalent Pneumococcal Glycoconjugate Vaccines Containing Emerging Serotype 24F
US20220040283A1
Multivalent pneumococcal polysaccharide-protein conjugate compositions and methods of using the same
US20220265803A1