Methods and materials for assessing and treating ovarian cancer

Abstract

Methods and materials involved in assessing and / or treating a mammal having cancer (e.g., ovarian cancer). For example, methods and materials that can be used to determine if a mammal (e.g., a human) has cancer (e.g., ovarian cancer, such as early-stage ovarian cancer), and if so, to determine if a mammal having cancer (e.g., ovarian cancer) has advanced-stage cancer, high-grade cancer, or serous cancer are provided herein. Additionally, methods and materials that can be used to determine if a mammal having cancer (e.g., ovarian cancer) is likely to respond to cancer treatment are provided herein. Methods and materials for treating a mammal having cancer (e.g., ovarian cancer) also are provided.

Description

[0001] METHODS AND MATERIALS FOR ASSESSING AND TREATING OVARIAN CANCER

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims priority to U.S. Patent Application No. 63 / 463,221, filed May 1, 2023, which is incorporated herein by reference in its entirety.

[0004] STATEMENT OF FEDERALLY SPONSORED RESEARCH

[0005] This invention was made with government support under CA136393 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0006] SEQUENCE LISTING

[0007] This application also incorporates by reference the material in the ST.26 XML file titled Sequence_Listing_108150_6.xml which was created on March 14, 2024 and is 4,464 bytes.

[0008] TECHNICAL FIELD

[0009] This document relates to methods and materials involved in assessing and / or treating a mammal having cancer (e.g., ovarian cancer). For example, methods and materials provided herein can be used to determine if a mammal (e.g., a human) has cancer (e.g., ovarian cancer) or is likely to respond to cancer treatment. Methods and materials provided herein also can be used to assess the severity (e.g., early stage vs. late stage, or low-grade vs. high grade) of cancer (e.g., ovarian cancer) in a mammal, and to aid in the selection of a cancer treatment for a mammal having cancer (e.g., ovarian cancer), based on an analysis of that mammal’s microbiome (e.g., the microbiome of the mammal’s reproductive system and / or the microbiome of the mammal’s omentum, ascites / peritoneal fluid, urine, or stool). BACKGROUND

[0010] Ovarian cancer (OC) is the second most common gynecological malignancy and the fifth leading cause of death due to cancer in women in the United States, mainly due to the often late-stage diagnosis and poor prognosis of OC (Sehouli and Grabowski, Cancer 125:4598-4601 (2019); Siegel et al., Ca Cancer J Clin 69:7-34 (2019); and Guleria et al., Cancer Causes Control Ccc 31 :25-31 (2019)). OC consists of two major types of tumors: Type I (30%) and Type II (70%) (Shih and Kurman, Am J Pathol 164: 1511-1518 (2004)). Type I tumors generally are slow growing low-grade serous, mucinous, endometrioid, or clear cell, while Type II tumors usually are aggressive highgrade serous, malignant mixed mesodermal, undifferentiated, or clear cell carcinomas. Only about 20% of all OC incidence is explained by host genetic factors, mainly through germline mutations in the BRCA1 and BRCA2 genes (Risch et al., J Natl Cancer Inst 98: 1694-1706 (2006); Konstantinopoulos et al., Cancer Discov 5: 1137-1154 (2015); and Matulonis et al., Nat Rev Dis Primers 2: 16061 (2016)). Efforts to elucidate the cause of the remaining 80% of cases have been focused on reproductive and environmental factors such as age, age at menarche, parity, breast feeding, hormone replacement therapy (HRT), and oral contraceptive use (see, e.g., Adami et al., Am J Epidemiol 132:446-452 (1990); Wentzensen et al., J Clin Oncol 34:2888-2898 (2016); Whittmore et al., Am J Epidemiol 136: 1184-1203 (1992); Zhou et al., Gynecol Oncol 108:641-651 (2008); Collaborative Group on Epidemiological Studies of Ovarian Cancer, Lancet 385: 1835- 1842 (2015); and Sopik et al., Gynecol Oncol 138:741-749 (2015)).

[0011] SUMMARY

[0012] This document is based, at least in part, on the identification of microbiome markers that can aid in early detection and diagnosis of OC. As demonstrated herein, a distinct OC microbiome was identified, with general enrichment of several microbial taxa in the OC cohort in all tested tissue samples. At least some of these taxa were, however, depleted in advanced- stage and high-grade OC patients compared to early-stage and low- grade OC patients, suggesting decreased accumulation in advanced disease. Accumulation of these taxa also was observed in OC patients with adverse treatment outcomes compared to those without adverse events. Thus, the microbiome markers described herein can be used as indicators for early detection of OC and for screening for OC, and for predicting patients’ response to treatment. In some cases, the microbiome markers described herein can be used to triage patients to particular treatment options (e.g., established treatment options or experimental treatment options).

[0013] This document provides methods and materials for assessing and / or treating mammals (e.g., humans) having cancer or at risk of having cancer (e.g., OC). For example, the quantity or relative level of some microbes identified in a mammal’s microbiome can be used to determine if the mammal has cancer (e.g., OC), to determine the stage, grade, or histology of a cancer (e.g., OC), to determine whether a cancer (e.g., OC) is likely to respond to cancer treatment, and / or to determine the prognosis for a mammal having cancer (e.g., OC). In some cases, a microbiome of a mammal can be used to determine whether that mammal has cancer (e.g., OC). For example, a sample (e.g., an ovarian tissue sample or a lower reproductive tract tissue sample) obtained from a mammal can be assessed to determine if the mammal has cancer (e.g., OC) based, at least in part, on the microbiome of the sample. In some cases, a microbiome of a mammal having cancer (e.g., OC) can be used to determine if the cancer is an early-stage cancer or an advanced-stage cancer, or if the cancer is a low-grade cancer or a high-grade cancer, or if the cancer is a serous cancer or is a cancer with a non-serous histology. For example, a sample (e.g., a uterine tissue sample, lower reproductive tract tissue sample, or omentum tissue sample) obtained from a mammal having cancer (e.g., OC) can be assessed to determine the stage, grade, or histology of the cancer based, at least in part, on the microbiome of the sample. In some cases, a microbiome of a mammal having cancer (e.g., OC) can be used to determine if that mammal is likely to respond to treatment and / or is more susceptible to that cancer. For example, a sample (e.g., an ascites sample or a lower reproductive tract tissue sample) obtained from a mammal having cancer (e.g., OC) can be assessed to determine if the mammal is likely to respond to cancer treatment and / or if the mammal is likely to survive without adverse events based, at least in part, on the microbiome of the sample. As described herein, mammals (e.g., humans) determined to have a reduced level of Microbacterium lacus in the ovaries as compared to controls (e.g., controls known to have benign gynecologic conditions, such as benign uterine gynecologic conditions) can be identified as having, or as being likely to have, OC. In some cases, mammals (e.g., humans) determined to have an elevated level of Corynebacterium tuber col ostearicum in the lower reproductive tract (LRT), an elevated level of Facklamia hominis in the LRT, and / or an elevated level of Ruminococcus faecis in the LRT, as compared to controls (e g., controls known to have benign gynecologic conditions, such as benign uterine gynecologic conditions), can be identified as having, or as being likely to have, OC. In some cases, mammals (e.g., humans) determined to have an elevated level of Peptoniphilus koenoeneniae in the LRT, an elevated level of Facklamia hominis in the LRT, an elevated level of Ruminococcus faecis in the LRT, and / or an elevated level of Fenollaria massiliensis in the LRT, as compared to controls (e.g., controls known to have benign gynecologic conditions, such as benign uterine gynecologic conditions) can be identified as having, or as being likely to have, early-stage OC.

[0014] In some cases, mammals having cancer (e.g., OC) and determined to have a reduced level of Corynebacterium tuberculostearicum in the uterus and / or a reduced level of Roseateles depolymerans in the uterus, as compared to controls (e.g., controls known to have early-stage OC), can be identified as having, or as being likely to have, advanced-stage OC. In some cases, mammals having cancer (e.g., OC) and determined to have a reduced level of Corynebacterium sp. in the LRT and / or a reduced level of Dialister sp. in the LRT, as compared to controls (e.g., controls know to have early-stage OC), can be identified as having, or as being likely to have, advanced-stage OC. In some cases, mammals having cancer (e.g., OC) and determined to have a reduced level of Roseateles depolymerans in the uterus, as compared to controls (e.g., controls known to have low-grade OC), can be identified as having, or as being likely to have, high-grade OC. In some cases, mammals having cancer (e.g., OC) and determined to have a reduced level of Mobiluncus curtisii in the LRT, a reduced level of Porphyromonas bennonis in the LRT, and / or a reduced level of Atopobium deltae in the LRT, as compared to controls (e g., controls known to have low-grade OC), can be identified as having, or as being likely to have, high-grade OC. In some cases, mammals having cancer (e.g., OC) and determined to have a reduced level of Angelakisella massiliensis in the omentum and / or a reduced level of Lachnospira eligens in the omentum, as compared to controls (e.g., controls known to have non-serous OC), can be identified as having, or as being likely to have, serous OC.

[0015] In some cases, mammals (e.g., humans) having cancer (e.g., OC) and determined to have a reduced level of Anaerococcus tetradius in ascites / peritoneal fluid as compared to controls (e.g., controls having treatment-resistant OC) can be identified as being likely to respond to treatment with, for example, debulking, immunotherapy, chemotherapy (e.g., with metformin and / or platinum / taxane), radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof. In some cases, a mammal (e.g., a human) having cancer (e.g., OC) and determined to have a reduced level of Lactobacillus iners in the LRT, a reduced level of Fenollaria massiliensis in the LRT, a reduced level of Ezakiella coagulans in the LRT, and / or a reduced level of Campylobacter ureolyticus in the LRT as compared to controls (e.g., controls known to have OC with adverse events or shorter survival) can be identified as being unlikely to have a poor outcome and / or as being likely to have a longer cancer free survival than a comparable mammal that, for example, does not have a reduced level of Lactobacillus iners, Fenollaria massiliensis, Ezakiella coagulans, and Campylobacter ureolyticus in the LRT.

[0016] This document also provides methods and materials for treating a mammal having cancer (e g., OC). For example, a mammal (e.g., a human) having cancer (e.g., OC) and determined to have a reduced level of Anaerococcus tetradius in ascites / peritoneal fluid as compared to controls (e.g., controls having treatment-resistant OC) can be treated with, for example, debulking, immunotherapy, chemotherapy (e.g., with metformin and / or platinum / taxane), radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof. In another example, a mammal (e.g., a human) having cancer (e.g., OC) and determined to have a reduced level of Corynebacterium tuberculostearicum and / or a reduced level of Roseateles depolymerans in the uterus, as compared to controls (e g., controls known to have early-stage OC) can be treated more aggressively than a mammal having the cancer (e.g., OC) but not having, for example, a reduced level of Corynebacterium tuberculostearicum and a reduced level of Roseateles depolymerans in the uterus.

[0017] Due to its largely asymptomatic nature during its early stages, more than two- thirds of OC patients initially present with advanced-stage disease (Sipos et al., Mol Med 27:33 (2021)). Having the ability to assess and / or treat mammals having cancer as described herein can allow clinicians to identify patients having cancer (e.g., OC) at an earlier stage, and can allow clinicians and patients to achieve longer survival times (e.g., cancer-free survival times) for the patients.

[0018] In a first aspect, this document features a method for classifying a mammal having ovarian cancer as having early-stage ovarian cancer or advanced stage ovarian cancer. The method includes: (a) quantifying one or more microorganisms selected from the group consisting of Peptoniphilus koenoeneniae , Facklamia hominis, Ruminococcus facets, Fenollaria massiliensis, Corynebacterium sp., Dialister sp., Corynebacterium tuberculostearicum, Roseateles depolymerans,' (b) comparing the quantity of the one or more microorganisms to a reference level; (c) identifying the mammal as having early- stage ovarian cancer if the mammal has, relative to the reference level: (1) an elevated level of Peptoniphilus koenoeneniae within the mammal’s lower reproductive tract (“LRT”) microbiome, (2) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, (3) an elevated level of Ruminococcus faecis within the mammal’s LRT microbiome, or (4) an elevated level of Fenollaria massiliensis in the mammal’s LRT microbiome; and (d) identifying the mammal as having advanced- stage ovarian cancer if the mammal has, relative to the reference level: (1) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome, (2) a reduced level of Dialister sp. within the mammal’s LRT microbiome, (3) a reduced level of Corynebacterium tuberculostearicum within the mammal’s uterine microbiome, or (4) a reduced level of Roseateles depolymerans within the mammal’s uterine microbiome.

[0019] In another aspect, this document features a method for classifying a mammal as having ovarian cancer. The method can include, consist of, or consist essentially of (a) identifying the mammal as having the presence of (i) an elevated level of Corynebacterium tubercolostearicum within the mammal’s lower reproductive tract (LRT) microbiome, (ii) an elevated level of Fcicklamia hominis within the mammal’s LRT microbiome, or (iii) an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome; and (b) classifying the mammal as having the ovarian cancer. The mammal can be a human. The method can include identifying the mammal as having the presence of the elevated level of Corynebacterium tubercolostearicum. The elevated level of Corynebacterium tubercolostearicum can be as compared to a reference level present in controls known to have a benign gynecologic condition. The method can include identifying the mammal as having the presence of the elevated level of Facklamia hominis. The elevated level of Facklamia hominis is as compared to a reference level present in controls known to have a benign gynecologic condition. The method can include identifying the mammal as having the presence of the elevated level of Ruminococcus faecis. The elevated level of Ruminococcus faecis can be as compared to a reference level present in controls known to have a benign gynecologic condition.

[0020] In another aspect, this document features a method for classifying a mammal as having ovarian cancer, where the method includes, consists of, or consists essentially of (a) identifying the mammal as having the presence of (i) a reduced level of Microbacterium lacus within the mammal’s ovarian microbiome, (ii) an elevated level of Corynebacterium tubercolostearicum within the mammal’s lower reproductive tract (LRT) microbiome, (iii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, or (iv) an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome; and (b) classifying the mammal as having the ovarian cancer. The mammal can be a human. The method can include identifying the mammal as having the presence of the reduced level of Microbacterium lacus. The reduced level of Microbacterium lacus can be as compared to a reference level present in controls known to have a benign gynecologic condition. The method can include identifying the mammal as having the presence of the elevated level of Corynebacterium tubercolostearicum. The elevated level of Corynebacterium tubercolostearicum can be as compared to a reference level present in controls known to have a benign gynecologic condition. The method can include identifying the mammal as having the presence of the elevated level of Facklamia hominis. The elevated level of Facklamia hominis can be as compared to a reference level present in controls known to have a benign gynecologic condition. The method can include identifying the mammal as having the presence of the elevated level of Ruminococcus faecis. The elevated level of Ruminococcus faecis can be as compared to a reference level present in controls known to have a benign gynecologic condition.

[0021] In another aspect, this document features a method for classifying a mammal as having early-stage ovarian cancer. The method can include, consist of, or consist essentially of (a) identifying the mammal as having the presence of (i) an elevated level of Peptoniphilus koenoeneniae within the mammal’s LRT microbiome, (ii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, (iii) an elevated level of Ruminococcus faecis within the mammal’s LRT microbiome, or (iv) an elevated level of Fenollaria massiliensis in the mammal’s LRT microbiome; and (b) classifying the mammal as having the early-stage ovarian cancer. The mammal can be a human. The method can include identifying the mammal as having the presence of the elevated level of Peptoniphilus koenoeneniae. The elevated level of Peptoniphilus koenoeneniae can be as compared to a reference level in controls known to have a benign gynecologic condition. The method can include identifying the mammal as having the presence of the elevated level of Facklamia hominis. The elevated level of Facklamia hominis can be as compared to a reference level in controls known to have a benign gynecologic condition. The method can include identifying the mammal as having the presence of the elevated level of Ruminococcus faecis. The elevated level of Ruminococcus faecis can be as compared to a reference level in controls known to have a benign gynecologic condition. The method can include identifying the mammal as having the presence of the elevated level of Fenollaria massiliensis. The elevated level of Fenollaria massiliensis can be as compared to a reference level in controls known to have a benign gynecologic condition.

[0022] In another aspect, this document features a method for classifying a mammal having ovarian cancer as having advanced-stage ovarian cancer. The method can include, consist of, or consist essentially of (a) identifying the mammal as having the presence of (i) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome, or (ii) a reduced level of Dialister sp. within the mammal’s LRT microbiome; and (b) classifying the mammal as having the advanced- stage ovarian cancer. The mammal can be a human. The method can include identifying the mammal as having the presence of the reduced level of Corynebacterium sp. The reduced level of Corynebacterium sp. can be as compared to a reference level in controls known to have early-stage ovarian cancer. The method can include identifying the mammal as having the presence of the reduced level of Dialister sp. The reduced level of Dialister sp. can be as compared to a reference level in controls known to have early-stage ovarian cancer.

[0023] In another aspect, this document features a method for classifying a mammal having ovarian cancer as having advanced- stage ovarian cancer, where the method includes, consists of, or consists essentially of (a) identifying the mammal as having the presence of (i) a reduced level of Corynebacterium tubercidostearicum within the mammal’s uterine microbiome, (ii) a reduced level of Roseateles depolymerans within the mammal’s uterine microbiome, (iii) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome, or (iv) a reduced level of Dialister sp. within the mammal’s LRT microbiome; and (b) classifying the mammal as having the advanced- stage ovarian cancer. The mammal can be a human. The can include identifying the mammal as having the presence of the reduced level of Corynebacterium tuberculostearicum . The reduced level of Corynebacterium tuberculostearicum can be as compared to a reference level in controls known to have early-stage ovarian cancer. The method can include identifying the mammal as having the presence of the reduced level of Roseateles depolymerans. The reduced level of Roseateles depolymerans can be as compared to a reference level in controls known to have early-stage ovarian cancer. The method can include identifying the mammal as having the presence of the reduced level of Corynebacterium sp. The reduced level of Corynebacterium sp. can be as compared to a reference level in controls known to have early-stage ovarian cancer. The method can include identifying the mammal as having the presence of the reduced level of Dialister sp. The reduced level of Dialister sp. can be as compared to a reference level in controls known to have early-stage ovarian cancer.

[0024] In another aspect, this document features a method for classifying a mammal having ovarian cancer as having high-grade ovarian cancer. The method can include, consist of, or consist essentially of (a) identifying the mammal as having the presence of (i) a reduced level of Mobihincus curtisii within the mammal’s LRT microbiome, (ii) a reduced level of Porphyromonas bennonis within the mammal’s LRT microbiome, or (iii) a reduced level of Atopobium deltae within the mammal’s LRT microbiome; and (b) classifying the mammal as having the high-grade ovarian cancer. The mammal can be a human. The method can include identifying the mammal as having the presence of the reduced level of Mobihincus curtisii. The reduced level of Mobihincus curtisii can be as compared to a reference level in controls known to have low-grade ovarian cancer. The method can include identifying the mammal as having the presence of the reduced level of Porphyromonas bennonis. The reduced level of Porphyromonas bennonis can be as compared to a reference level in controls known to have low-grade ovarian cancer. The method can include identifying the mammal as having the presence of the reduced level of Atopobium deltae. The reduced level of Atopobium deltae can be as compared to a reference level in controls known to have low-grade ovarian cancer.

[0025] In still another aspect, this document features a method for classifying a mammal having ovarian cancer as having high-grade ovarian cancer, where the method includes, consists of, or consists essentially of (a) identifying the mammal as having the presence of (i) a reduced level of Roseateles depolymerans within the mammal’s uterine microbiome, (ii) a reduced level of Mobihincus curtisii within the mammal’s LRT microbiome, (iii) a reduced level of Porphyromonas bennonis within the mammal’s LRT microbiome, or (iv) a reduced level of Atopobium deltae within the mammal’s LRT microbiome; and (b) classifying the mammal as having the high-grade ovarian cancer. The mammal can be a human. The method can include identifying the mammal as having the presence of the reduced level of Roseateles depolymerans. The reduced level of Roseateles depolymerans can be as compared to a reference level in controls known to have low-grade ovarian cancer. The method can include identifying the mammal as having the presence of the reduced level of Mobihincus curtisii. The reduced level of Mobihincus curtisii can be as compared to a reference level in controls known to have low-grade ovarian cancer. The method can include identifying the mammal as having the presence of the reduced level of Porphyromonas bennonis. The reduced level of Porphyromonas bennonis can be as compared to a reference level in controls known to have low-grade ovarian cancer. The method can include identifying the mammal as having the presence of the reduced level of Atopobium deltae. The reduced level of Atopobium deltae can be as compared to a reference level in controls known to have low- grade ovarian cancer.

[0026] This document also features a method for classifying a mammal having ovarian cancer as having serous ovarian cancer. The method can include, consist of, or consist essentially of (a) identifying the mammal as having the presence of (i) a reduced level of Angelakisella massiliensis within the mammal’s omentum microbiome, or (ii) a reduced level of Lachnospira eligens within the mammal’s omentum microbiome; and (b) classifying the mammal as having the serous ovarian cancer. The mammal can be a human. The method can include identifying the mammal as having the presence of the reduced level of Angelakisella massiliensis. The reduced level of Angelakisella massiliensis can be as compared to a reference level in controls known to have non- serous OC. The method can include identifying the mammal as having the presence of the reduced level of Lachnospira eligens. The reduced level of Lachnospira eligens can be as compared to a reference level in controls known to have non-serous OC.

[0027] In another aspect, this document features a method for classifying a mammal having ovarian cancer as being likely to respond to treatment. The method can include, consist of, or consist essentially of (a) identifying the mammal as having the presence of a reduced level of Anaerococcus tetradhis within the mammal’s ascites or peritoneal fluid microbiome; and (b) classifying the mammal as being likely to respond to treatment. The mammal can be a human. The treatment can include debulking, immunotherapy, chemotherapy, or any combination thereof. The reduced level of Anaerococcus tetradius can be as compared to a reference level in controls known to have treatment-resistant ovarian cancer.

[0028] In another aspect, this document features a method for classifying a mammal having ovarian cancer as being likely to have a prolonged cancer-free survival time. The method can include, consist of, or consist essentially of (a) identifying the mammal as having the presence of (i) a reduced level of Lactobacillus iners within the mammal’s LRT microbiome, (ii) a reduced level of Fenollaria massiliensis within the mammal’s LRT microbiome, (iii) a reduced level of Ezakiella coagulans within the mammal’s LRT microbiome, or (iv) a reduced level of Campylobacter ureolyticus within the mammal’s LRT microbiome; and (b) classifying the mammal as being likely to have the prolonged cancer-free survival time. The mammal can be a human. The method can include identifying the mammal as having the presence of the reduced level of Lactobacillus iners. The reduced level of Lactobacillus iners can be as compared to a reference level in controls known to have ovarian cancer with shortened survival. The method can include identifying the mammal as having the presence of the reduced level of Fenollaria massiliensis. The reduced level of Fenollaria massiliensis can be as compared to a reference level in controls known to have ovarian cancer with shortened survival. The method can include identifying the mammal as having the presence of the reduced level of Ezakiella coagulans. The reduced level of Ezakiella coagulans can be as compared to a reference level in controls known to have ovarian cancer with shortened survival. The method can include identifying the mammal as having the presence of the reduced level of Campylobacter ureolyticus. The reduced level of Campylobacter ureolyticus can be as compared to a reference level in controls known to have ovarian cancer with shortened survival. The prolonged cancer-free survival time can be as compared to the cancer-free survival time of comparable mammals lacking the presence of (i), (ii), (iii), and (iv).

[0029] In another aspect, this document features a method for classifying a mammal having ovarian cancer as being unlikely to have a prolonged cancer-free survival time. The method can include, consist of, or consist essentially of (a) identifying the mammal as having the absence of (i) a reduced level of Lactobacillus iners within the mammal’s LRT microbiome, (ii) a reduced level of Fenollaria massiliensis within the mammal’s LRT microbiome, (iii) a reduced level of Ezakiella coagulans within the mammal’s LRT microbiome, or (iv) a reduced level of Campylobacter ureolyticus within the mammal’s LRT microbiome; and (b) classifying the mammal as being unlikely to have the longer cancer-free survival time. The mammal can be a human. The method can include identifying the mammal as having the absence of the reduced level of Lactobacillus iners. The reduced level of Lactobacillus iners can be as compared to a reference level in controls known to have ovarian cancer with shortened survival. The method can include identifying the mammal as having the absence of the reduced level of Fenollaria massiliensis. The reduced level of Fenollaria massiliensis can be as compared to a reference level in controls known to have ovarian cancer with shortened survival. The method can include identifying the mammal as having the absence of the reduced level of Ezakiella coagulans. The reduced level of Ezakiella coagulans can be as compared to a reference level in controls known to have ovarian cancer with shortened survival. The method can include identifying the mammal as having the absence of the reduced level of Campylobacter ureolyticus. The reduced level of Campylobacter ureolyticus can be as compared to a reference level in controls known to have ovarian cancer with shortened survival. The prolonged cancer-free survival time can be as compared to the cancer-free survival time of comparable mammals lacking the presence of (i), (ii), (iii), or (iv).

[0030] In another aspect, this document features a method for treating a mammal having ovarian cancer. The method can include, consist of, or consist essentially of (a) identifying the mammal as having the presence of (i) an elevated level of Corynebacterium tubercolostearicum within the mammal’s lower reproductive tract (LRT) microbiome, (ii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, or (iii) an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome; and (b) administering to the mammal a treatment for the ovarian cancer, wherein the method is effective to improve survival of the mammal. The mammal can be a human. The treatment can include debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof. The elevated level of Corynebacterium tubercolostearicum , the elevated level of Facklamia hominis, or the elevated level of Ruminococcus faecis can be as compared to a reference level present in controls known to have a benign gynecologic condition.

[0031] In another aspect, this document features a method for treating a mammal having ovarian cancer, where the method includes, consists of, or consists essentially of (a) identifying the mammal as having the presence of (i) a reduced level of Microbacterium lacus within the mammal’s ovarian microbiome, (ii) an elevated level of Corynebacterium tubercolostearicum within the mammal’s lower reproductive tract (LRT) microbiome, (iii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, or (iv) an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome; and (b) administering to the mammal a treatment for the ovarian cancer, wherein the method is effective to improve survival of the mammal. The mammal can be a human. The treatment can include debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof. The reduced level of Microbacterium lacus, the elevated level of Corynebacterium tubercolostearicum4the elevated level of Facklamia hominis or the elevated level of Ruminococcus faecis can be as compared to a reference level present in controls known to have a benign gynecologic condition.

[0032] In another aspect, this document features a method for treating a mammal having early-stage ovarian cancer. The method can include, consist of, or consist essentially of (a) identifying the mammal as having the presence of (i) an elevated level of Peptoniphilus koenoeneniae within the mammal’s LRT microbiome, (ii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, (iii) an elevated level of Ruminococcus faecis within the mammal’s LRT microbiome, or (iv) an elevated level of Fenollaria massiliensis in the mammal’s LRT microbiome; and (b) administering to the mammal a treatment for the early-stage ovarian cancer, wherein the method is effective to improve survival of the mammal. The mammal can be a human. The treatment can include debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof. The elevated level of Peptoniphilus koenoeneniae, the elevated level of Facklamia hominis, the elevated level of Ruminococcus faecis, or the elevated level of Fenollaria massiliensis can be as compared to a reference level in controls known to have a benign gynecologic condition.

[0033] In yet another aspect, this document features a method for treating a mammal having advanced-stage ovarian cancer. The method can include, consist of, or consist essentially of (a) identifying the mammal as having the presence of (i) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome, or (ii) a reduced level of Dialister sp. within the mammal’s LRT microbiome; and (b) administering to the mammal a treatment for the advanced-stage ovarian cancer, wherein the method is effective to improve survival of the mammal. The mammal can be a human. The treatment can include debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof. The reduced level of Corynebacterium sp. or the reduced level of Dialister sp. can be as compared to a reference level in controls known to have early-stage ovarian cancer.

[0034] In another aspect, this document features a method for treating a mammal having advanced-stage ovarian cancer, where the method includes, consists of, or consists essentially of (a) identifying the mammal as having the presence of (i) a reduced level of Corynebacterium tuberculostearicum within the mammal’s uterine microbiome, (ii) a reduced level of Roseateles depolymerans within the mammal’s uterine microbiome, (iii) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome, or (iv) a reduced level of Dialister sp. within the mammal’s LRT microbiome; and (b) administering to the mammal a treatment for the advanced-stage ovarian cancer, wherein the method is effective to improve survival of the mammal. The mammal can be a human. The treatment can include debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof. The reduced level of Corynebacterium tuberculostearicum, the reduced level of Roseateles depolymerans, the reduced level of Corynebacterium sp., or the reduced level of Dialister sp. can be as compared to a reference level in controls known to have early-stage ovarian cancer.

[0035] In another aspect, this document features a method for treating a mammal having high-grade ovarian cancer. The method can include, consist of, or consist essentially of (a) identifying the mammal as having the presence of (i) a reduced level of Mobiluncus curtisii within the mammal’s LRT microbiome, (ii) a reduced level of Porphyromonas bennonis within the mammal’s LRT microbiome, or (iii) a reduced level of Atopobium deltae within the mammal’s LRT microbiome; and (b) administering to the mammal a treatment for the high-grade ovarian cancer, wherein the method is effective to improve survival of the mammal. The mammal can be a human. The treatment can include debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof. The reduced level of Mobiluncus curtisii, the reduced level of Porphyromonas bennonis, or the reduced level of Atopobium deltae can be as compared to a reference level in controls known to have low-grade ovarian cancer.

[0036] In another aspect, this document features a method for treating a mammal having high-grade ovarian cancer. The method can include, consist of, or consist essentially of (a) identifying the mammal as having the presence of (i) a reduced level of Roseateles depolymerans within the mammal’s uterine microbiome, (ii) a reduced level of Mobiluncus curtisii within the mammal’s LRT microbiome, (iii) a reduced level of Porphyromonas bennonis within the mammal’s LRT microbiome, or (iv) a reduced level of Atopobium deltae within the mammal’s LRT microbiome; and (b) administering to the mammal a treatment for the high-grade ovarian cancer, wherein the method is effective to improve survival of the mammal. The mammal can be a human. The treatment can include debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof. The reduced level of Roseateles depolymerans, the reduced level of Mobiluncus curtisii, the reduced level of Porphyromonas bennonis, or the reduced level of Atopobium deltae can be as compared to a reference level in controls known to have low-grade ovarian cancer.

[0037] In another aspect, this document features a method for treating a mammal having serous ovarian cancer. The method can include, consist of, or consist essentially of (a) identifying the mammal as having the presence of (i) a reduced level of Angelaki sella massiliensis within the mammal’s omentum microbiome, or (ii) a reduced level of Lachnospira eligens within the mammal’s omentum microbiome; and (b) administering to the mammal a treatment for the serous ovarian cancer, wherein the method is effective to improve survival of the mammal. The mammal can be a human. The treatment can include debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof. The reduced level of Angelakisella massiliensis or the reduced level of Lachnospira eligens can be as compared to a reference level in controls known to have non-serous OC.

[0038] In another aspect, this document features a method for treating a mammal having ovarian cancer. The method can include, consist of, or consist essentially of (a) identifying the mammal as having the presence of a reduced level of Anaerococcus tetradius within the mammal’s ascites / peritoneal fluid microbiome; and (b) administering to the mammal a treatment for the ovarian cancer, wherein the method is effective to improve survival of the mammal. The mammal can be a human. The treatment can include debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof. The reduced level of Anaerococcus tetradius can be as compared to a reference level in controls known to have treatment-resistant ovarian cancer.

[0039] In still another aspect, this document features a method for treating a mammal having ovarian cancer, where the method includes, consists of, or consists essentially of administering a treatment for the ovarian cancer to a mammal that was identified as having the presence of (i) an elevated level of C orynebacterium tubercolostearicum within the mammal’s lower reproductive tract (LRT) microbiome, (ii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, or (iii) an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome, wherein the method is effective to improve survival of the mammal. The mammal can be a human. The treatment can include debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof. The elevated level of Corynebacterium tubercolostearicum , the elevated level of Facklamia hominis, or the elevated level of Ruminococcus faecis can be as compared to a reference level present in controls known to have a benign gynecologic condition.

[0040] In another aspect, this document features a method for treating a mammal having ovarian cancer, where the method includes, consists of, or consists essentially of administering a treatment for the ovarian cancer to a mammal that was identified as having the presence of (i) a reduced level of Microbacterium lacus within the mammal’s ovarian microbiome, (ii) an elevated level of Corynebacterium tubercolostearicum within the mammal’s lower reproductive tract (LRT) microbiome, (iii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, or (iv) an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome, wherein the method is effective to improve survival of the mammal. The mammal can be a human. The treatment can include debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof. The reduced level of Microbacterium lacus, the elevated level of Corynebacterium tubercolostearicum , the elevated level of Facklamia hominis, or the elevated level of Ruminococcus faecis can be as compared to a reference level present in controls known to have a benign gynecologic condition.

[0041] In another aspect, this document features a method for treating a mammal having early-stage ovarian cancer. The method can include, consist of, or consist essentially of administering a treatment for the ovarian cancer to a mammal that was identified as having the presence of (i) an elevated level of Peptoniphilus koenoeneniae within the mammal’s LRT microbiome, (ii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, (iii) an elevated level of Ruminococcus faecis within the mammal’s LRT microbiome, or (iv) an elevated level of Fenollaria massiliensis in the mammal’s LRT microbiome, wherein the method is effective to improve survival of the mammal. The mammal can be a human. The treatment can include debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof. The elevated level of Peptoniphilus koenoeneniae, the elevated level of Facklamia hominis, the elevated level of Ruminococcus faecis, or the elevated level of Fenollaria massiliensis can be as compared to a reference level in controls known to have a benign gynecologic condition.

[0042] In another aspect, this document features a method for treating a mammal having advanced-stage ovarian cancer. The method can include, consist of, or consist essentially of administering a treatment for the ovarian cancer to a mammal that was identified as having the presence of (i) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome, or (ii) a reduced level of Dialister sp. within the mammal’s LRT microbiome, wherein the method is effective to improve survival of the mammal. The mammal can be a human. The treatment can include debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof. The reduced level of Corynebacterium sp. or the reduced level of Dialister sp. can be as compared to a reference level in controls known to have early- stage ovarian cancer.

[0043] In another aspect, this document features a method for treating a mammal having advanced-stage ovarian cancer. The method can include, consist of, or consist essentially of administering a treatment for the ovarian cancer to a mammal that was identified as having the presence of (i) a reduced level of Corynebacterium tuberculostearicum within the mammal’s uterine microbiome, (ii) a reduced level of Roseateles depofymerans within the mammal’s uterine microbiome, (iii) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome, or (iv) a reduced level of Dialister sp. within the mammal’s LRT microbiome, wherein the method is effective to improve survival of the mammal. The mammal can be a human. The treatment can include debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof. The reduced level of Corynebacterium tuberculostearicum, the reduced level of Roseateles depofymerans, the reduced level of Corynebacterium sp., or the reduced level of Dialister sp. can be as compared to a reference level in controls known to have early-stage ovarian cancer.

[0044] In yet another aspect, this document features a method for treating a mammal having high-grade ovarian cancer. The method can include, consist of, or consist essentially of administering a treatment for the ovarian cancer to a mammal that was identified as having the presence of (i) a reduced level of Mobiluncus curtisii within the mammal’s LRT microbiome, (ii) a reduced level of Porphyromonas bennonis within the mammal’s LRT microbiome, or (iii) a reduced level oiAtopobium deltae within the mammal’s LRT microbiome, wherein the method is effective to improve survival of the mammal. The mammal can be a human. The treatment can include debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof. The method of any one of claims 151 to 153, wherein the reduced level of Mobiluncus curtisii, the reduced level of Porphyromonas bennonis, or the reduced level of Atopobium deltae can be as compared to a reference level in controls known to have low-grade ovarian cancer. In another aspect, this document features a method for treating a mammal having high-grade ovarian cancer, where the method can include, consist of, or consist essentially of administering a treatment for the ovarian cancer to a mammal that was identified as having the presence of (i) a reduced level of Roseateles depolymerans within the mammal’s uterine microbiome, (ii) a reduced level of Mobiluncus curtisii within the mammal’s LRT microbiome, (iii) a reduced level of Porphyromonas bennonis within the mammal’s LRT microbiome, or (iv) a reduced level of Atopobium deltae within the mammal’s LRT microbiome, wherein the method is effective to improve survival of the mammal. The mammal can be a human. The treatment can include debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof. The reduced level of Roseateles depolymerans, the reduced level of Mobiluncus curtisii, the reduced level of Porphyromonas bennonis, or the reduced level of Atopobium deltae can be as compared to a reference level in controls known to have low-grade ovarian cancer.

[0045] In another aspect, this document features a method for treating a mammal having serous ovarian cancer. The method can include, consist of, or consist essentially of administering a treatment for the ovarian cancer to a mammal that was identified as having the presence of (i) a reduced level of Angelakisella massiliensis within the mammal’s omentum microbiome, or (ii) a reduced level of Lachnospira eligens within the mammal’s omentum microbiome, wherein the method is effective to improve survival of the mammal. The mammal can be a human. The treatment can include debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof. The reduced level of Angelakisella massiliensis or the reduced level of Lachnospira eligens can be as compared to a reference level in controls known to have non-serous OC.

[0046] In another aspect, this document features a method for treating a mammal having ovarian cancer, where the method can include, consist of, or consist essentially of administering a treatment for the ovarian cancer to a mammal that was identified as having the presence of a reduced level of Anaerococcus tetradius within the mammal’s ascites / peritoneal fluid microbiome, wherein the method is effective to improve survival of the mammal. The mammal can be a human. The treatment can include debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof. The reduced level of Anaerococcus tetradius can be as compared to a reference level in controls known to have treatment-resistant ovarian cancer.

[0047] In another aspect, a method for treating a mammal having ovarian cancer comprises: (a) identifying said mammal as having, as compared to a reference level present in controls, the presence of (i) an elevated level of Corynebacterium tubercolostearicum within the mammal’s lower reproductive tract (LRT) microbiome or a reduced level of Corynebacterium tuber culosteari cum within the mammal’s uterine microbiome, (ii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, (iii) an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome, (iv) a reduced level of Microbacterium lacus within the mammal’s ovarian microbiome, (v) an elevated level of Peptoniphilus koenoeneniae within the mammal’s LRT microbiome, (vi) an elevated level of Fenollaria massiliensis in the mammal’s LRT microbiome, (vii) a reduced level of Roseate les depolymerans within the mammal’s uterine microbiome, (viii) a reduced level of Mobiluncus curtisii within the mammal’s LRT microbiome, (ix) a reduced level of Porphyromonas bennonis within the mammal’s LRT microbiome, (x) a reduced level of Atopobium deltae within the mammal’s LRT microbiome, (xi) a reduced level of Angelakisella massiliensis within the mammal’s omentum microbiome, (xii) a reduced level of Lachnospira eligens within the mammal’s omentum microbiome, or (xiii) a reduced level of Anaerococcus tetradius within the mammal’s ascites / peritoneal fluid microbiome; and (b) administering to said mammal a treatment for said ovarian cancer, wherein said method is effective to improve survival of said mammal.

[0048] In embodiments, the mammal is a human. In embodiments, the treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof. In embodiments, the ovarian cancer is early-stage ovarian cancer and the controls are known to have a benign gynecologic condition. In embodiments, the ovarian cancer is advanced-stage ovarian cancer and the controls are known to have early-stage ovarian cancer. In embodiments, the ovarian cancer is high-grade ovarian cancer and the controls are known to have low- grade ovarian cancer. In embodiments, the ovarian cancer is serous ovarian cancer and the controls are known to have non-serous ovarian cancer.

[0049] In another aspect, a method for treating a mammal having advanced- stage ovarian cancer comprises administering a treatment for said ovarian cancer to a mammal that was identified as having, as compared to a reference level in controls known to have early- stage ovarian cancer, the presence of (i) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome, or (ii) a reduced level of Dialister sp. within the mammal’s LRT microbiome, wherein said method is effective to improve survival of said mammal.

[0050] In embodiments, the mammal is a human. In embodiments, the treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

[0051] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0052] The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.

[0053] DESCRIPTION OF DRAWINGS

[0054] FIGS. 1A-1I are genus-level microbial community composition (relative abundance) plots for patients with or without OC. FIG. 1A, vagina; FIG. IB, cervix; FIG. 1C, uterus; FIG. ID, Fallopian tubes; FIG. IE, ovary; FIG. IF, ascites / peritoneal fluid; FIG. 1G, omentum; FIG. 1H, urine; FIG. II; stool. Only microbial taxa present at a minimum of 1% relative frequency in at least one participant are shown.

[0055] FIGS. 2A-2O show bacterial community a- and P-diversities between patients with and without OC. Both a- (Observed ASVs) and P-diversity measures were compared. For a-diversity, a Wald statistical test was performed and Observed ASVs was reported. For P-diversity, Bray-Curtis (BC) and unweighted UniFrac distance metrics were reported. The most significant metric is shown in each ordination plot. FIG. 2A, Lower reproductive tract (cervix and vagina; LRT), Benign vs OC, a-diversity, p = 0.049. FIG. 2B, LRT, Benign vs OC, P-diversity, unweighted UniFrac, p = 0.052. FIG. 2C, uterus, Benign vs OC, a-diversity, p = 0.907. FIG. 2D, uterus, Benign vs OC, P-diversity, p = 0.004. FIG. 2E, Fallopian tube, Benign vs OC, a-diversity, p = 0.201. FIG. 2F, Fallopian tube, Benign vs OC, P-diversity, p = 0.025. FIG. 2G, ovaries, Benign vs OC, a- diversity, / ? = 0.766. FIG. 2H, ovaries, Benign vs OC, P-diversity, p = 0.088. FIG. 21, ascites / peritoneal fluid, Benign vs OC, a-diversity, p = 0.882. FIG. 2J, ascites / peritoneal fluid, Benign vs OC, P-diversity, p = 0.007. FIG. 2K, urine, Benign vs OC, a-diversity, p = 0.382. FIG. 2L, urine, Benign vs OC, P-diversity, p = 0.047. FIGS. 2M-2O are heatmaps showing the effect size (Log2 Fold Change) of the differentially abundant microbial taxa. White boxes reflect no fold change at FDR < 0.10. Analysis was adjusted for menopause status and BM1. Samples were rarefied prior to analysis. *Groups are significantly different.

[0056] FIGS. 3A-3O show bacterial community a- and P-diversities among patients with and without different stages of Ovarian Cancer (OC). Both a- and P-diversity measures were compared. For a-diversity, a Wald statistical test was performed and Observed ASVs, Shannon Index, and Inverse Simpson were reported. For P-diversity, Bray-Curtis (BC), unweighted, weighted, and generalized UniFrac distance metrics were reported. The most significant metric is shown in each ordination plot. FIG. 3A, LRT, a-diversity: Benign vs Early stage (p = 0.019), Advanced stage (p = 0.025). FIG. 3B, LRT, P- diversity: Benign vs Early stage (p = 0.061), Advanced stage (p = 0.059), Early vs Advanced stage ( ? = 0.065). FIG. 3C, uterus, a-diversity: Benign vs Early stage (p = 0.461), Advanced stage (p = 0.105). FIG. 3D, uterus, P-diversity: Benign vs Early stage (p = 0.002), Advanced stage (p = 0.006), Early vs Advanced stage (p = 0.284). FIG. 3E, Fallopian tube, a-diversity: Benign vs Early stage (p = 0.384), Advanced stage (p = 0.196). FIG. 3F, Fallopian tube, -diversity: Benign vs Early stage (p = 0.127), Advanced stage (p = 0.127), Early vs Advanced stage (p = 0.078). FIG. 3G, ovaries, a- diversity: Benign vs Early stage (p = 0.872), Advanced stage (p = 0.447). FIG. 3H, ovaries, P-diversity: Benign vs Early stage (p = 0.433), Advanced stage (p = 0.240), Early vs Advanced stage (p = 0.039). FIG. 31, ascites / peritoneal fluid, a-diversity: Benign vs Early stage (p = 0.054), Advanced stage (p = 0.010). FIG. 3J, ascites / peritoneal fluid, P- diversity: Benign vs Early stage (p = 0.166), Advanced stage (p = 0.028), Early vs Advanced stage ( ? = 0.091). FIG. 3K, urine, a-diversity: Benign vs Early stage (p = 0.310), Advanced stage (p = 0.380). FIG. 3L, urine, P-diversity: Benign vs Early stage (p = 0.175), Advanced stage (p = 0.086), Early vs Advanced stage (p = 0.566). FIG. 3M, stool, a-diversity: Benign vs Advanced stage (p = 0.302). FIG. 3N, stool, P- diversity: Early vs Advanced stage (p = 0.042). FIG. 30 includes heatmaps showing the effect size (Log2 Fold Change) of the differentially abundant microbial taxa. White boxes reflect no fold change at FDR < 0.10. Analysis was adjusted for menopause status and BMI. Samples rarefied prior to analysis. Wald statistical test with Q value cutoff = 0.1. ^Groups are significantly different, and boxplots with different letters are significantly different.

[0057] FIGS. 4A-4K show bacterial community a- and P-diversity among patients with and without different grades of OC. Both a- and P-diversities measures were compared. For a-diversity, a Wald statistical test was performed and Observed ASVs was reported. For P-diversity, Bray-Curtis (BC), unweighted, and generalized UniFrac distance metrics were reported. The most significant metric is shown in each ordination plot. FIG. 4A, LRT, a-diversity: Benign vs Low grade (p = 0.221), High grade (p = 0.997). FIG. 4B, LRT, P-diversity: Benign vs Low grade (p = 0.195), High grade (p = 0.087), Low grade vs High grade (p = 0.406). FIG. 4C, uterus, a-diversity: Benign vs Low grade (p = 0.400), High grade (p = 0.159). FIG. 4D, uterus, P-diversity: Benign vs Low grade (p = 0.023), High grade (p = 0.014), Low grade vs High grade (p = 0.019). FIG. 4E, ovaries, a-diversity: Benign vs Low grade (p = 0.972), High grade (p = 0.552). FIG. 4F, ovaries, P-diversity: Benign vs Low grade (p = 0.350), High grade (p = 0.067), Low grade vs High grade (p = 0.045). FIG. 4G, ascites / peritoneal fluid, a-diversity: Benign vs High grade (p = 0.536). FIG. 4H, ascites / peritoneal fluid, P-diversity: Benign vs High grade (p = 0.016). FIG. 41, urine, a-diversity: Benign vs Low grade (p = 0.490), High grade (p = 0.534). FIG. 4J, urine, P-diversity: Benign vs Low grade (p = 0.615), High grade (p = 0.056), Low grade vs High grade (p= 0.717). FIG. 4K includes heatmaps showing the effect size (Log2 Fold Change) of the differentially abundant microbial taxa. White boxes reflect no fold change at FDR < 0. 10. Analysis was adjusted for menopause status and BMI. Samples were rarefied prior to analysis. Wald statistical test with Q value cutoff = 0.1. ^Groups are significantly different.

[0058] FIGS. 5A-5M show bacterial community a- and P-diversities among patients with and without different histology of OC. Both a- and P-diversities measures were compared. For a-diversity, a Wald statistical test was performed and Observed ASVs was reported. For P-diversity, Bray-Curtis (BC), unweighted, and generalized UniFrac distance metrics were reported. The most significant metric is shown in each ordination plot. FIG. 5A, LRT, a-diversity: Benign vs serous (p = 0.021), others (p = 0.859). FIG. 5B, LRT, P-diversity: Benign vs serous (p = 0.038), others (p = 0.238), serous vs others (p = 0.275). FIG. 5C, uterus, a-diversity: Benign vs serous (p = 0.767), others (p = 0.459). FIG. 5D, uterus, P-diversity: Benign vs serous (p = 0.002), others (p = 0.123), serous vs others (p = 0.400). FIG. 5E, ovaries, a-diversity: Benign vs serous (p = 0.918), others (p = 0.234). FIG. 5F, ovaries, P-diversity: Benign vs serous (p = 0.051), others (p = 0.433), serous vs others (p = 0.138). FIG. 5G, ascites / peritoneal fluid, a-diversity: Benign vs serous (p = 0.636), others (p = 0.807). FIG. 5H, ascites / peritoneal fluid, P- diversity: Benign vs serous (p = 0.019), others (p = 0.667), serous vs others (p = 0.571). FIG. 51, omentum, a-diversity: Serous vs others (p = 0.377). FIG. 5J, omentum, P- diversity: serous vs others (p = 0.003). FIG. 5K, urine, a-diversity: Benign vs serous (p = 0.360), others (p = 0.911). FIG. 5L, urine, P-diversity: Benign vs serous (p = 0.329), others (p = 0.048), serous vs others (p = 0.129). FIG. 5M includes heatmaps showing the effect size (Log2 Fold Change) of the differentially abundant microbial taxa. White boxes reflect no fold change at FDR < 0.10. Analysis was adjusted for menopause status and BMI. Samples were rarefied prior to analysis. Wald statistical test with Q value cutoff = 0.1. ^Groups are significantly different, and boxplots with different letters are significantly different.

[0059] FIGS. 6A-6L show comparison of P-diversity measures, with unweighted, and weighted, UniFrac distance metrics were reported. The most significant metric is shown in each ordination plot. FIGS. 6A-6D show bacterial community P-diversity between OC patients with sensitive vs other (resistant / refractory) tumor response. FIG. 6A, Fallopian tube, P-diversity: sensitive vs other (p = 0.003). FIG. 6B, ovaries, P-diversity: sensitive vs other (p = 0.073). FIG. 6C, ascites, P-diversity: sensitive vs other (p = 0.021). FIG. 6D, urine, P-diversity: sensitive vs other (p = 0.015). FIGS. 6E-6I show bacterial community P-diversity among OC patients with different status two years post-diagnosis. FIG. 6E, ovaries, P-diversity: Alive, no event vs alive, event (p = 0.073), Alive, no event vs dead (p = 0.761), Alive, event vs dead, (p = 0.437). FIG. 6F, ascites, P-diversity: Alive, no event vs alive, event (p = 0.573), Alive, no event vs dead (p = 0.029), Alive, event vs dead (p = 0.250). FIG. 6G, omentum, P-diversity: Alive, no event vs alive, event (p = 0.273), Alive, no event vs dead (p = 0.350), Alive, event vs dead (p = 0.010). FIG. 6H, urine, P-diversity: Alive, no event vs alive, event (p = 0.088), Alive, no event vs dead (p = 0.347), Alive, event vs dead (p = 0.356). FIG. 61, stool, P-diversity: Alive, no event vs alive, event (p = 0.063), Alive, no event vs dead (p = 0.601), Alive, event vs dead (p = 0.050). FIG. 6J shows bacterial community P-diversity among OC patients with different status four years post-diagnosis. LRT, P-diversity: Alive, no event vs alive, event (p = 0.017), Alive, no event vs dead (p = 0.568), Alive, event vs dead (p = 0.058). FIGS. 6K and 6L are heatmaps showing the effect size (Log2 Fold Change) of the differentially abundant microbial taxa. White boxes reflect no fold change at FDR < 0.10. Analysis was adjusted for menopause status and BMI. Samples were rarefied prior to analysis. Wald statistical test with Q value cutoff = 0.1. *Groups are significantly different.

[0060] FIGS. 7A-7E show genus-level microbial community composition (Abundance and relative abundance) plots of patients with or without OC and controls. FIG. 7A is a microbial taxa abundance plot of all samples, including controls. FIG. 7B is another microbial taxa relative abundance plot of all samples, including controls. FIG. 7C is a microbial taxa abundance plot of only controls. FIG. 7D is another microbial taxa relative abundance plot of only controls. FIG. 7E is a key indicating microbial taxa for FIGS. 7A-7D. PCR-NTC: PCR negative control; PCR-NTC-GEO: PCR negative control with Geobacillus,' TE-GEO: TE with Geobacillus. Only microbial taxa present at a minimum of 1 % relative frequency in at least one sample are shown for graphical clarity.

[0061] FIGS. 8A-8F are graphs plotting bacterial community a-diversity between patients with and without OC. A Wald statistical test was performed and Observed ASVs, Shannon Index (left graph in each panel), and Inverse Simpson (right graph in each panel) were reported. FIG. 8A, lower reproductive tract (cervix and vagina; LRT); FIG. 8B, uterus; FIG. 8C, Fallopian tubes; FIG. 8D, ovaries; FIG. 8E, ascites / peritoneal fluid; FIG. 8F, urine. The analysis was adjusted for menopause status, and BMI.

[0062] FIGS. 9A-9F are graphs plotting bacterial community P-diversity between patients with and without OC. Bray-Curtis, unweighted (left graph in each panel), generalized UniFrac (center graph in each panel), and weighted (right graph in each panel) distance metrics were reported. FIG. 9A, LRT; FIG. 9B, uterus; FIG. 9C, Fallopian tubes; FIG. 9D, ovaries; FIG. 9E, ascites / peritoneal fluid; FIG. 9F, urine. Analysis was adjusted for menopause status and BMI. ^Groups are significantly different.

[0063] FIGS. 10A-10G include graphs plotting bacterial community a-diversity between patients with and without different stages of OC. A Wald statistical test was performed and Observed ASVs (upper graph in each panel), Shannon Index and Inverse Simpson (lower graph in each panel) were reported. FIG. 10A, LRT; FIG. 10B, uterus; FIG. IOC, Fallopian tubes; FIG. 10D, ovaries; FIG. 10E, ascites / peritoneal fluid; FIG. 10F, urine; FIG. 10G, stool. Analysis was adjusted for menopause status, and BMI. Boxplots with different letters are significantly different.

[0064] FIGS. 11A-11G are graphs plotting bacterial community P-diversity between patients with and without different stages of OC. Bray-Curtis, unweighted, weighted, and generalized UniFrac distance metrics were reported as indicated above each graph. FIG. HA, LRT; FIG. 11B, uterus; FIG. 11C, Fallopian tubes; FIG. 11D, ovaries; FIG. HE, ascites / peritoneal fluid; FIG. 11F, urine; FIG. 11G, stool. Analysis was adjusted for menopause status and BMI. *Groups are significantly different.

[0065] FIGS. 12A-12H are graphs plotting bacterial community a-diversity between patients with and without different grades of OC. A Wald statistical test was performed and Observed AS Vs, Shannon Index (top graph in each panel) and Inverse Simpson (bottom graph in each panel)were reported. FIG. 12A, LRT; FIG. 12B, uterus; FIG. 12C, Fallopian tubes; FIG. 12D, ovaries; FIG. 12E, ascites / peritoneal fluid; FIG. 12F, omentum; FIG. 12G, urine; FIG. 12H, stool. Analysis was adjusted for menopause status and BMI. Boxplots with different letters are significantly different.

[0066] FIGS. 13A-13H are graphs plotting bacterial community P-diversity between patients with and without different grades of OC. Bray-Curtis, unweighted, weighted, and generalized UniFrac distance metrics were reported as indicated above the graphs. FIG. 13A, LRT; FIG. 13B, uterus; FIG. 13C, Fallopian tubes; FIG. 13D, ovaries; FIG. 13E, ascites / peritoneal fluid; FIG. 13F, omentum; FIG. 13G, urine; FIG. 13H, stool. Analysis was adjusted for menopause status and BMI.

[0067] FIGS. 14A-14H are graphs plotting bacterial community a-diversity between patients with and without different histologies of OC. A Wald statistical test was performed and Observed AS Vs, Shannon Index (top graph in each panel) and Inverse Simpson (bottom graph in each panel) were reported. FIG. 14A, LRT; FIG. 14B, uterus; FIG. 14C, Fallopian tubes; FIG. 14D, ovaries; FIG. 14E, ascites / peritoneal fluid; FIG. 14F, omentum; FIG. 14G, urine; FIG. 14H, stool. Analysis was adjusted for menopause status and BMI. Boxplots with different letters are significantly different.

[0068] FIGS. 15A-15G are graphs plotting bacterial community P-diversity between patients with and without different histologies of OC. Bray-Curtis, unweighted, weighted, and generalized UniFrac distance metrics were reported as indicate above each graph. FIG. 15A, LRT; FIG. 15B, uterus; FIG. 15C, Fallopian tubes; FIG. 15D, ovaries; FIG. 15E, ascites / peritoneal fluid; FIG. 15F, omentum; FIG. 15G, urine; FIG. 15H, stool. Analysis was adjusted for menopause status and BMI. ^Groups are significantly different. FIGS. 16A-16H are graphs plotting bacterial community a-diversity between OC patients with different tumor responses to treatment. A Wald statistical test was performed and Observed ASVs (left graph in each panel), Shannon Index (center graph in each panel), and Inverse Simpson (right graph in each panel) were reported. FIG. 16A, LRT; FIG. 16B, uterus; FIG. 16C, Fallopian tubes; FIG. 16D, ovaries; FIG. 16E, ascites / peritoneal fluid; FIG. 16F, omentum; FIG. 16G, urine; FIG. 16H, stool. Analysis was adjusted for menopause status and BMI. *Groups are significantly different.

[0069] FIGS. 17A-17H are graphs plotting bacterial community P-diversity between OC patients with different tumor responses to treatment. Bray -Curtis, unweighted, weighted, and generalized UniFrac distance metrics were reported as indicated above the graphs. FIG. 17A, LRT; FIG. 17B, uterus; FIG. 17C, Fallopian tubes; FIG. 17D, ovaries; FIG. 17E, ascites / peritoneal fluid; FIG. 17F, omentum; FIG. 17G, urine; FIG. 17H, stool. Analysis was adjusted for menopause status and BMI. ^Groups are significantly different.

[0070] FIGS. 18A-18H are graphs plotting bacterial community a-diversity between OC patients with different statuses two years post-diagnosis. A Wald statistical test was performed and Observed ASVs (left graph in each panel), Shannon Index (center graph in each panel), and Inverse Simpson (right graph in each panel) were reported. FIG. 18A, LRT; FIG. 18B, uterus; FIG. 18C, Fallopian tubes; FIG. 18D, ovaries; FIG. 18E, ascites / peritoneal fluid; FIG. 18F, omentum; FIG. 18G, urine; FIG. 18H, stool. Analysis was adjusted for menopause status and BMI. *Groups are significantly different.

[0071] FIGS. 19A-19H are graphs plotting bacterial community P-diversity between OC patients with different statuses two years post-diagnosis. Bray-Curtis, unweighted, weighted, and generalized UniFrac distance metrics were reported as indicated above the graphs. FIG. 19A, LRT; FIG. 19B, uterus; FIG. 19C, Fallopian tubes; FIG. 19D, ovaries; FIG. 19E, ascites / peritoneal fluid; FIG. 19F, omentum; FIG. 19G, urine; FIG. 19H, stool. Analysis was adjusted for menopause status and BMI.

[0072] FIGS. 20A-20G are graphs plotting bacterial community a-diversity between OC patients with different statuses four years post-diagnosis. A Wald statistical test was performed and Observed ASVs (left graph in each panel), Shannon Index (center graph in each panel), and Inverse Simpson (right graph in each panel) were reported. FIG. 20A, LRT; FIG. 20B, uterus; FIG. 20C, Fallopian tubes; FIG. 20D, ovaries; FIG. 20E, ascites / peritoneal fluid; FIG. 20F urine; FIG. 20G, stool. Analysis was adjusted for menopause status and BMI. *Groups are significantly different.

[0073] FIGS. 21A-21G are graphs plotting bacterial community 0-diversity between OC patients with different statuses four years post-diagnosis. Bray-Curtis, unweighted, weighted, and generalized UniFrac distance metrics were reported as indicated above the graphs. FIG. 21A, LRT; FIG. 21B, uterus; FIG. 21C, Fallopian tubes; FIG. 21D, ovaries; FIG. 21E, ascites / peritoneal fluid; FIG. 21F, urine; FIG. 21G, stool. Analysis was adjusted for menopause status and BMI. *Groups are significantly different.

[0074] FIGS. 22A-22Q include tables summarizing the data discussed herein with regard to the bacterial strains found to be enriched or decreased in relation to various OC criteria. FIG. 22A, benign vs. OC; FIG. 22B, benign vs. early stage OC; FIG. 22C, benign vs. advanced stage OC; FIG. 22D, early stage vs. advanced stage OC; FIG. 22E, benign vs. low grade OC; FIG. 22F, benign vs. high grade OC; FIG. 22G, low grade vs. high grade OC; FIG. 22H, benign vs. serous OC; FIG. 221, benign vs. other OC histologies; FIG. 22J, serous vs. other OC histologies; FIG. 22K, tumor response - sensitive vs. other; FIG. 22L, two years post-diagnosis - alive, no event vs. alive, event; FIG. 22M, two years post-diagnosis - alive, no event vs. dead; FIG. 22N, two years post-diagnosis - alive, event vs. dead; FIG. 220, four years post-diagnosis - alive, no event vs. alive, event; FIG. 22P, four years post-diagnosis - alive, no event vs. dead; FIG. 22Q, four years post-diagnosis - alive, event vs. dead.

[0075] DETAILED DESCRIPTION

[0076] This document provides methods and materials for assessing and / or treating mammals (e.g., humans) having cancer (e.g., OC). The methods and materials are based, at least in part, on the presence, absence, or level of particular genera or species of bacteria within the microbiome of the mammals being assessed and / or treated.

[0077] In some cases, methods and materials provided herein can be used to determine if a mammal has cancer. For example, a microbiome of a mammal can be used to determine if that mammal has, or is likely to have, cancer (e.g., OC). For example, a sample (e.g., an ovarian sample or an LRT sample) obtained from a mammal can be assessed to determine if the mammal has, or is likely to have, cancer (e.g., OC), based at least in part on the microbiome of the sample. For example, an ovarian tissue sample obtained from a mammal can be assessed to determine if the mammal has, or is likely to have, cancer (e.g., OC), based at least in part on whether the ovarian tissue has a reduced level of Microbacterium lacus as compared to controls (e.g., controls known to have benign gynecologic conditions, such as benign uterine gynecologic conditions). In another example, an LRT (e.g., vaginal or cervical) sample obtained from a mammal can be assessed to determine if the mammal has, or is likely to have, cancer (e.g., OC), based at least in part on whether the LRT tissue has an elevated level of Corynebacterium tubercolostearicum, an elevated level of Facklamia hominis, and / or an elevated level of Ruminococcus faecis as compared to controls (e.g., controls known to have benign gynecologic conditions, such as benign uterine gynecologic conditions). The presence of such a reduced level of Microbacterium lacus in ovarian tissue, an elevated level of Corynebacterium tubercolostearicum in LRT tissue, an elevated level of Facklamia hominis in LRT tissue, and / or an elevated level of Ruminococcus faecis in LRT tissue can indicate that a mammal has cancer (e.g., OC), while the absence of such a reduced level of Microbacterium lacus in ovarian tissue, an elevated level of Corynebacterium tubercolostearicum in LRT tissue, an elevated level of Facklamia hominis in LRT tissue, and / or an elevated level of Ruminococcus faecis in LRT tissue can indicate that a mammal does not have cancer (e g., OC). In some cases, the presence of such a reduced level of Microbacterium lacus in ovarian tissue, an elevated level of Corynebacterium tubercolostearicum in LRT tissue, an elevated level of Facklamia hominis in LRT tissue, and / or an elevated level of Ruminococcus faecis in LRT tissue can indicate that a mammal has cancer (e.g., OC), while the absence of such a reduced level of Microbacterium lacus in ovarian tissue, an elevated level of Corynebacterium tubercolostearicum in LRT tissue, an elevated level of Facklamia hominis in LRT tissue, and an elevated level of Ruminococcus faecis in LRT tissue can indicate that a mammal does not have cancer (e.g., OC). In some cases, methods and materials provided herein can be used to determine if a mammal has an early-stage cancer. For example, a microbiome of a mammal can be used to determine if that mammal has, or is likely to have, an early-stage cancer (e.g., early-stage OC). For example, a sample (e g., an LRT sample) obtained from a mammal can be assessed to determine if the mammal has, or is likely to have, an early-stage cancer (e.g., early-stage OC), based at least in part on the microbiome of the sample. For example, an LRT (e.g., vaginal or cervical) tissue sample obtained from a mammal can be assessed to determine if the mammal has, or is likely to have, an early-stage cancer (e.g., early-stage OC), based at least in part on whether the LRT tissue has an elevated level of Peptoniphilus koenoeneniae. an elevated level of Facklamia hominis, an elevated level of Ruminococcus faecis, and / or an elevated level of Fenollaria massiliensis as compared to controls (e.g., controls known to have benign gynecologic conditions, such as benign uterine gynecologic conditions). The presence of such an elevated level of Peptoniphilus koenoeneniae in LRT tissue, an elevated level of Facklamia hominis in LRT tissue, an elevated level of Ruminococcus faecis in LRT tissue, and / or an elevated level of Fenollaria massiliensis in LRT tissue can indicate that a mammal has an early-stage cancer (e.g., early-stage OC), while the absence of such an elevated level of Peptoniphilus koenoeneniae in LRT tissue, an elevated level of Facklamia hominis in LRT tissue, an elevated level of Ruminococcus faecis in LRT tissue, and / or an elevated level of Fenollaria massiliensis in LRT tissue can indicate that the mammal has a benign gynecologic condition (e.g., a benign uterine gynecologic conditions) and does not have early-stage cancer (e.g., early-stage OC). In some cases, the presence of such an elevated level of Peptoniphilus koenoeneniae in LRT tissue, an elevated level of Facklamia hominis in LRT tissue, an elevated level of Ruminococcus faecis in LRT tissue, and / or an elevated level of Fenollaria massiliensis in LRT tissue can indicate that a mammal has an early-stage cancer (e.g., early-stage OC), while the absence of such an elevated level of Peptoniphilus koenoeneniae in LRT tissue, an elevated level of Facklamia hominis in LRT tissue, an elevated level of Ruminococcus faecis in LRT tissue, and an elevated level of Fenollaria massiliensis in LRT tissue can indicate that the mammal has a benign gynecologic condition and does not have early-stage cancer (e.g., early-stage OC). In some cases, methods and materials provided herein can be used to determine if a mammal has an advanced-stage cancer. For example, a microbiome of a mammal having cancer can be used to determine if that mammal has, or is likely to have, an advanced-stage cancer (e.g., advanced-stage OC). For example, a sample (e.g., a uterine sample or an LRT sample) obtained from a mammal can be assessed to determine if the mammal has, or is likely to have, an advanced-stage cancer (e.g., advanced-stage OC), based at least in part on the microbiome of the sample. For example, a uterine tissue sample obtained from a mammal can be assessed to determine if the mammal has, or is likely to have, an advanced-stage cancer (e.g., advanced- stage OC), based at least in part on whether the uterine tissue has a reduced level of Corynebacterium tuberculostearicum and / or a reduced level of Roseateles depolymerans as compared to controls (e.g., controls known to have early-stage OC). In another example, an LRT (e.g., vaginal or cervical) tissue sample obtained from a mammal can be assessed to determine if the mammal has, or is likely to have, an advanced-stage cancer (e.g., advanced- stage OC), based at least in part on whether the LRT tissue has a reduced level of Corynebacterium sp. and / or a reduced level of Dialister sp. as compared to controls (e.g., controls known to have early- stage OC). The presence of such a reduced level of Corynebacterium tuberculostearicum in uterine tissue, a reduced level of Roseateles depolymerans in uterine tissue, a reduced level of Corynebacterium sp. in LRT tissue, and / or a reduced level of Dialister sp. in LRT tissue can indicate that a mammal has advanced stage cancer (e.g., advanced stage OC), while the absence of such a reduced level of Corynebacterium tuberculostearicum in uterine tissue, a reduced level of Roseateles depolymerans in uterine tissue, a reduced level of Corynebacterium sp. in LRT tissue, and / or a reduced level of Dialister sp. in LRT tissue can indicate that a mammal does not have advanced-stage cancer (e.g., advanced-stage OC). In some cases, the presence of such a reduced level of Corynebacterium tuberculostearicum in uterine tissue, a reduced level of Roseateles depolymerans in uterine tissue, a reduced level of Corynebacterium sp. in LRT tissue, and / or a reduced level of Dialister sp. in LRT tissue can indicate that a mammal has advanced stage cancer (e.g., advanced stage OC), while the absence of such a reduced level of Corynebacterium tuberculostearicum in uterine tissue, a reduced level of Roseateles depolymerans in uterine tissue, a reduced level of Corynebacterium sp. in LRT tissue, and a reduced level of Dialister sp. in LRT tissue can indicate that a mammal does not have advanced-stage cancer (e.g., advanced-stage OC).

[0078] In some cases, methods and materials provided herein can be used to determine if a mammal has a low-grade cancer or a high-grade cancer. For example, a microbiome of a mammal can be used to determine if that mammal has, or is likely to have, a high-grade cancer (e.g., high-grade OC). For example, a sample (e.g., a uterine sample or an LRT sample) obtained from a mammal can be assessed to determine if the mammal has, or is likely to have, a high-grade cancer (e.g., high-grade OC), based at least in part on the microbiome of the sample. For example, a uterine tissue sample obtained from a mammal can be assessed to determine if the mammal has, or is likely to have, a high-grade cancer (e.g., high-grade OC), based at least in part on whether the uterine tissue has a reduced level of Roseateles depolymerans as compared to controls (e.g., controls known to have low-grade OC). In another example, an LRT (e.g., vaginal or cervical) sample obtained from a mammal can be assessed to determine if the mammal has, or is likely to have, a high-grade cancer (e.g., high-grade OC), based at least in part on whether the LRT tissue has a reduced level of Mobiluncus curtisii. a reduced level of Porphyromonas bennonis, and / or a reduced level of Atopobium deltas as compared to controls (e.g., controls known to have low-grade OC). The presence of such a reduced level of Roseateles depolymerans in uterine tissue, a reduced level of Mobiluncus curtisii in LRT tissue, a reduced level of Porphyromonas bennonis in LRT tissue, and / or a reduced level of Atopobium deltae in LRT can indicate that the mammal has a high-grade cancer (e.g., high-grade OC), while the absence of such a reduced level of Roseateles depolymerans in uterine tissue, a reduced level of Mobiluncus curtisii in LRT tissue, a reduced level of Porphyromonas bennonis in LRT tissue, and / or a reduced level of Atopobium deltae in LRT tissue can indicate that the mammal has a low-grade cancer (e.g., low-grade OC). In some cases, the presence of such a reduced level of Roseateles depolymerans in uterine tissue, a reduced level of Mobiluncus curtisii in LRT tissue, a reduced level of Porphyromonas bennonis in LRT tissue, and / or a reduced level of Atopobium deltae in LRT can indicate that the mammal has a high-grade cancer (e.g., high-grade OC), while the absence of such a reduced level of Roseateles depolymerans in uterine tissue, a reduced level of Mobiluncus curtisii in LRT tissue, a reduced level of Porphyromonas bennonis in LRT tissue, and a reduced level of Atopobium deltae in LRT tissue can indicate that the mammal has a low-grade cancer (e.g., low-grade OC).

[0079] In some cases, methods and materials provided herein can be used to determine if a mammal has a serous cancer, or a non-serous cancer. For example, a microbiome of a mammal can be used to determine if that mammal has, or is likely to have, a serous cancer (e g., serous OC). For example, a sample (e.g., an omentum sample) obtained from a mammal can be assessed to determine if the mammal has, or is likely to have, a serous cancer (e.g., serous OC), based at least in part on the microbiome of the sample. For example, an omentum tissue sample obtained from a mammal can be assessed to determine if the mammal has, or is likely to have, a serous cancer (e.g., serous OC), based at least in part on whether the omentum tissue has a reduced level of Angelakisella massiliensis and / or a reduced level of Lachnospira eligens as compared to controls (e.g., controls known to have non-serous OC). The presence of such a reduced level of Angelakisella massiliensis in omentum tissue and / or a reduced level of Lachnospira eligens in omentum tissue can indicate that the mammal has a serous cancer (e.g., serous OC), while the absence of such a reduced level of Angelakisella massiliensis in omentum tissue and / or a reduced level of Lachnospira eligens in omentum tissue can indicate that the mammal has a non-serous cancer (e.g., non-serous OC). In some cases, the presence of such a reduced level of Angelakisella massiliensis in omentum tissue and / or a reduced level of Lachnospira eligens in omentum tissue can indicate that the mammal has a serous cancer (e.g., serous OC), while the absence of such a reduced level of Angelakisella massiliensis in omentum tissue and such a reduced level of Lachnospira eligens in omentum tissue can indicate that the mammal has a non-serous cancer (e.g., non-serous OC).

[0080] In some cases, methods and materials provided herein can be used to determine if a mammal having cancer (e.g., OC) is likely to respond to treatment for the cancer. For example, a microbiome of a mammal having cancer (e.g., OC) can be used to determine if that mammal is likely to respond to cancer treatment. For example, a sample (e.g., an ascites sample) obtained from a mammal having cancer can be assessed to determine if the mammal is likely to respond to cancer treatment based, at least in part, on the microbiome of the sample. As described herein, a distinct ascites microbiome can be present in a mammal (e.g., a human) having cancer (e.g., OC) that is likely to respond to cancer treatment. In some cases, the presence of a reduced level of Anaerococcus tetradius in an ascites sample obtained from a mammal (e.g., a human) having cancer (e.g., OC) as compared to controls (e.g., controls having treatment-resistant OC) can be used to identify that mammal as being likely to respond to treatment, while the absence of such a reduced level of Anaerococcus tetradius in an ascites sample obtained from the mammal can be used to identify that mammal as not being likely to respond to treatment.

[0081] In some cases, methods and materials provided herein can be used to determine if a mammal having cancer (e.g., OC) is likely to experience shorter or longer survival (e.g., longer survival without adverse events). For example, a microbiome of a mammal can be used to determine if that mammal is likely to experience longer survival (e.g., longer survival without adverse events). For example, a sample (e.g., an LRT sample) obtained from a mammal can be assessed to determine if the mammal is likely to experience longer survival (e.g., longer survival without adverse events), based at least in part on the microbiome of the sample. For example, an LRT (e.g., vagina or cervix) sample obtained from a mammal can be assessed to determine if the mammal is likely to experience longer survival (e.g., longer survival without adverse events), based at least in part on whether the LRT tissue has a reduced level of Lactobacillus iners, a reduced level of Fenollaria massiliensis, a reduced level of Ezakiella coagulans, and / or a reduced level of Campylobacter ureolyticus as compared to controls (e g., controls having the cancer and known to have experienced shorter survival and / or adverse events). The presence of such a reduced level of Lactobacillus iners in LRT tissue, a reduced level of Fenollaria massiliensis in LRT tissue, a reduced level of Ezakiella coagulans in LRT tissue, and / or a reduced level of Campylobacter ureolyticus in LRT tissue can indicate that a mammal is likely to experience longer survival (e.g., longer survival without adverse events), while the absence of such a reduced level of Lactobacillus iners in LRT tissue, a reduced level of Fenollaria massiliensis in LRT tissue, a reduced level of Ezakiella coagulans in LRT tissue, and / or a reduced level of Campylobacter ureolyticus in LRT tissue can indicate that the mammal is not likely to experience longer survival (e.g., longer survival without adverse events). In some cases, the presence of such a reduced level of Lactobacillus iners in LRT tissue, a reduced level of Fenollaria massiliensis in LRT tissue, a reduced level of Ezakiella coagulans in LRT tissue, and / or a reduced level of Campylobacter ureolyliciis in LRT tissue can indicate that a mammal is likely to experience longer survival (e.g., longer survival without adverse events), while the absence of such a reduced level of Lactobacillus iners in LRT tissue, such a reduced level of Fenollaria massiliensis in LRT tissue, such a reduced level of Ezakiella coagulans in LRT tissue, and such a reduced level of Campylobacter ureolyticus in LRT tissue can indicate that the mammal is not likely to experience longer survival (e.g., longer survival without adverse events).

[0082] The term “elevated level” as used herein with respect to a level of a particular genus or species of bacteria in a biological sample (e g., a tissue sample, or a sample of urine, stool, or ascites / peritoneal fluid) refers to any level that is greater than a reference level of the genus or species of that bacteria.

[0083] The term “reduced level” as used herein with respect to a level of a particular genus or species of bacteria in a biological sample (e.g., a tissue sample, or a sample of urine, stool, or ascites / peritoneal fluid) refers to any level that is less than a reference level of the bacteria.

[0084] The term “reference level” as used herein with respect to a genus or species of bacteria in a biological sample from a mammal can refer to the level of the bacteria observed in a comparable biological sample (e g., a control sample) from one or more healthy mammals (e.g., humans) without cancer (e.g., OC), one or more mammals (e.g., humans) having a benign gynecologic condition (e.g., a benign uterine gynecologic condition), one or more mammals (e.g., humans) having early-stage OC, one or more mammals (e.g., humans) having low-grade OC, one or more mammals (e.g., humans) having serous OC, one or more mammals (e.g., humans) having non-serous OC, one or more mammals (e.g., humans) having OC that is not responsive to treatment, or one or more mammals (e.g., humans) having OC and having shorter survival and / or having adverse events post-diagnosis, depending on what criteria are being evaluated. For example, in a method for determining whether a mammal has cancer (e.g., OC), the reference level of a bacteria can be the level of the bacteria in one or more mammals known to have a benign gynecologic condition, such as benign uterine gynecologic conditions. For example, in a method for determining whether a mammal has early-stage cancer (e.g., early-stage OC), the reference level of a bacteria can be the level of the bacteria in one or more mammals known to have a benign gynecologic condition, such as benign uterine gynecologic conditions. For example, in a method for determining whether a mammal has advanced-stage cancer (e.g., advanced-stage OC), the reference level of a bacteria can be the level of the bacteria in one or more mammals known to have early-stage cancer (e.g., early-stage OC). For example, in a method for determining whether a mammal has a high-grade cancer (e.g., high-grade OC), the reference level of a bacteria can be the level of the bacteria in one or more mammals known to have a low- grade cancer (e.g., low-grade OC). For example, in a method for determining whether a mammal has a low-grade cancer (e.g., low-grade OC), the reference level of a bacteria can be the level of the bacteria in one or more mammals known to have a high-grade cancer (e.g., high-grade OC). For example, in a method for determining whether a mammal has a serous cancer (e.g., serous OC), the reference level of a bacteria can be the level of the bacteria in one or more mammals known to have a non-serous cancer (e.g., non-serous OC). For example, in a method for determining whether a mammal has a non- serous cancer (e.g., non-serous OC), the reference level of a bacteria can be the level of the bacteria in one or more mammals known to have a serous cancer (e.g., serous OC) . For example, in a method for determining whether a mammal has a cancer (e.g., OC) that is likely to be responsive to treatment, the reference level of a bacteria can be the level of the bacteria in one or more mammals known to have a cancer (e.g., OC) that is not responsive to treatment. For example, in a method for determining whether a mammal having cancer (e g., OC) is likely to experience longer survival (e.g., longer survival without adverse events), the reference level of a bacteria can be the level of the bacteria in one or more mammals known to have the cancer and to have experienced shorter survival and / or adverse events post-diagnosis. In some cases, an elevated level of a genus or species of a bacteria can be a level that is at least 2 (e.g., at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 35, or at least 50) fold greater than a reference level of the bacteria. In some cases, an elevated level of a particular genus or species of a bacteria can be a level that is greater than a particular number per 100,000 total microbes present in a sample (e.g., a urine sample, a stool sample, an ascites / peritoneal fluid sample, or a tissue sample, such as an LRT (e.g., vaginal or cervical) sample, an ovarian sample, a Fallopian tube sample, a uterine sample, or an omentum sample). For example, an elevated level of a particular genus or species of bacteria can be a level that is from about 100 per 100,000 total microbes to about 50,000 per 100,000 total microbes (e.g., from about 100 to about 1000 per 100,000 total microbes, from about 1000 to about 2500 per 100,000 total microbes, from about 2500 to about 5000 per 100,000 total microbes, from about 5000 to about 10,000 per 100,000 total microbes, from about 10,000 to about 25,000 per 100,000 total microbes, or from about 25,000 to about 50,000 per 100,000 total microbes) present in a sample. In some cases, an elevated level of a bacteria can be a level that is greater than 0.1% of the microbes present in a microbiome (e.g., a microbiome in a urine sample, a stool sample, an ascites / peritoneal fluid sample, or a tissue sample, such as an LRT (e.g., vaginal or cervical) sample, an ovarian sample, a Fallopian tube sample, a uterine sample, or an omentum sample). For example, an elevated level of a bacteria can be a level that is from about 0.1% of the microbes present in a microbiome to about 50% of the microbes present in the microbiome. In some cases, when control samples have undetectable levels a bacteria, an elevated level can be a detectable level of the bacteria. It will be appreciated that levels from comparable samples are used when determining whether or not a particular level is an elevated level.

[0085] In some cases, a reduced level of a genus or species of a bacteria can be a level that is at least 2 (e.g., at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, at least 35, or at least 50) fold less than a reference level of the bacteria. In some cases, a reduced level of a particular genus or species of bacteria can be a level that is less than about 1000 per 100,000 total microbes (e.g., less than about 900 per 100,000 total microbes, less than about 800 per 100,000 total microbes, less than about 700 per 100,000 total microbes, less than about 600 per 100,000 total microbes, less than about 500 per 100,000 total microbes, less than about 400 per 100,000 total microbes, less than about 300 per 100,000 total microbes, less than about 200 per 100,000 total microbes, or less than about 100 per 100,000 total microbes) present in a sample (e.g., a urine sample, a stool sample, an ascites / peritoneal fluid sample, or a tissue sample, such as an LRT (e.g., vaginal or cervical) sample, an ovarian sample, a Fallopian tube sample, a uterine sample, or an omentum sample). For example, a reduced level of a particular genus or species of bacteria can be a level that is from about 0 per 100,000 total microbes to about 1000 per 100,000 total microbes (e.g., from about 0 to about 10 per 100,000 total microbes, from about 10 to about 100 per 100,000 total microbes, from about 100 to about 250 per 100,000 total microbes, from about 250 to about 500 per 100,000 total microbes, or from about 500 to about 1000 per 100,000 total microbes) present in a sample. In some cases, a reduced level of a particular genus or species of bacteria can be a level that is less than 1% of the microbes present in a microbiome (e.g., a microbiome in a urine sample, a stool sample, an ascites / peritoneal fluid sample, or a tissue sample, such as an LRT (e.g., vaginal or cervical) sample, an ovarian sample, a Fallopian tube sample, a uterine sample, or an omentum sample). For example, a reduced level of a bacteria can be a level that is from about 0% of the microbes present in a microbiome to about 1% of the microbes present in the microbiome. It will be appreciated that levels from comparable samples are used when determining whether or not a particular level is a reduced level.

[0086] Any appropriate mammal can be assessed and / or treated as described herein. Examples of mammals that can be assessed and / or treated as described herein include, without limitation, humans, non-human primates (e.g., monkeys), dogs, cats, horses, cows, pigs, sheep, mice, and rats. In some cases, a mammal that can be assessed and / or treated as described herein can have cancer (e.g., OC) or can be at risk of having cancer (e g., OC). In some cases, the mammal can be a human. For example, a human having cancer or at risk of having cancer (e.g., OC) can be assessed and / or treated as described herein. Any appropriate sample can be assessed to determine a microbiome of a mammal (e.g., a human having cancer or a human without cancer). In some cases, a sample can be a biological sample. A sample can be a fresh sample or a frozen sample. For example, a biological sample such as a tissue sample (e.g., a vaginal tissue sample, cervical tissue sample, uterine tissue sample, ovarian tissue sample, Fallopian tube tissue sample, and omentum tissue sample), a stool sample, or a bodily fluid sample (e.g., a urine sample or an ascites / peritoneal fluid sample) can be obtained from a mammal and assessed to determine a microbiome of the mammal. In some cases, microbes (e.g., bacteria) can be isolated from a sample. For example, microbes (e.g., bacteria) can be isolated from a sample obtained from a mammal (e.g., a human) and can be used to determine a microbiome of the mammal. In some cases, one or more biological molecules can be isolated from microbes within a sample. For example, nucleic acid (e.g., RNA such as ribosomal RNA (rRNA)) can be isolated from microbes within a sample obtained from a mammal (e.g., a human) and can be used to determine a microbiome of the mammal. In some cases, microbes can be isolated from a tissue sample, a stool sample, or a bodily fluid sample obtained from a mammal (e.g., a human) and can be assessed to determine a microbiome of the mammal.

[0087] Any appropriate method can be used to detect the presence, absence, or level of one or more microbes within a sample (e.g., a tissue sample, a stool sample, or a bodily fluid sample) obtained from a mammal (e.g., a human having cancer or a human without cancer). In some cases, sequencing techniques (e.g., 16S rRNA-sequencing and nextgeneration sequencing), shotgun metagenomics, quantitative PCR, and / or DNA hybridization-based techniques such as fluorescence in situ hybridization (FISH) can be used to identify the presence, absence, or level of a microbe within a sample (e.g., a tissue sample, a stool sample, or a bodily fluid sample) obtained from a mammal and to determine the microbiome of the mammal. In some cases, the presence, absence, or level of one or more microbes (e.g., Microbacterium , Corynebacterium, Facklamia, Ruminococctis, Peptoniphilus, Fenollaria, Roseate les, Dialister, Mobiluncus, Porphyromonas, Atopobium, Angelakisella, Lachnospira, Anaerococcus, Lactobacillus, Ezakiella, and / or Campylobacter') within a sample (e.g., a tissue sample, a stool sample, or a bodily fluid sample) obtained from a mammal (e.g., a human having cancer or a human without cancer) can be determined as described in Example 1 herein.

[0088] In some cases, the methods described herein can include identifying a mammal (e.g., a human) as having cancer (e.g., OC). Any appropriate method can be used to identify a mammal as having cancer. For example, physical examination, laboratory testing (e.g., blood tests), imaging techniques (e.g., ultrasound, magnetic resonance imaging (MRI), bone scan, computerized tomography (CT) scan, and positron emission tomography (PET) scan), and biopsy techniques can be used to identify a mammal (e.g., a human) as having cancer.

[0089] In some cases, the methods and materials provided herein can be used to determine an outcome (e.g., to predict treatment response) of a mammal (e g., a human) having cancer (e.g., OC). For example, the particular microbiome (e.g., the presence, absence, or level of a microbe such as Anaerococcus tetradius) of a mammal (e.g., a human) having cancer (e.g., OC) can be used to determine if that mammal is likely to respond to cancer treatment or is more susceptible to that cancer. In some cases, the presence, absence, or level of a microbe such as A. tetradius within a sample (e.g., an ascites sample) obtained from a mammal (e.g., a human) having cancer (e.g., OC) can be used to determine if that mammal is likely to respond to cancer treatment or is more susceptible to that cancer. For example, a reduced level of A. tetradius in an ascites sample from a mammal (e.g., as compared to a reference level present within controls having treatment-resistant OC) can be used to determine that the mammal is likely to be sensitive to treatment for the cancer (e.g., treatment with debulking, immunotherapy, chemotherapy (e.g., with metformin and / or platinum / taxane), radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof).

[0090] In some cases, the presence, absence, or level of one or more microbes in a microbiome of a mammal (e.g., a human) having cancer (e.g., OC) can be used to predict survival of the mammal. In some cases, a mammal (e.g., a human) having cancer (e.g., OC) can be identified as being likely to experience longer survival (e.g., prolonged overall survival, prolonged event-free survival, and / or prolonged cancer-free survival) based, at least in part, on the presence of a reduced level of Lactobacillus iers, a reduced level of Fenollaria massiliensis, a reduced level of Ezakiella coagul ns, and / or a reduced level of Campylobacter ureofyticus in the mammal’s LRT microbiome (e.g., as compared to a reference level present within controls known to have OC with adverse events or shortened survival). For example, a mammal (e.g., a human) having cancer (e.g., OC) and having a reduced level of Lactobacillus iners, a reduced level of Fenollaria massiliensis, a reduced level of Ezakiella coagulans, and / or a reduced level of Campylobacter ureofyticus in a sample (e.g., an LRT sample) obtained from the mammal (e.g., as compared to a reference level present within controls known to have OC with adverse events or shortened survival) can be identified as being likely to experience longer survival (e.g., overall survival, event-free survival, and / or cancer-free survival). For example, a mammal (e.g., a human) having cancer (e.g., OC) and lacking a reduced level of Lactobacillus iners, a reduced level of Fenollaria massiliensis, a reduced level of Ezakiella coagulans, and / or a reduced level of Campylobacter ureofyticus in a sample (e.g., an LRT sample) obtained from the mammal (e.g., as compared to a reference level present within controls known to have OC with adverse events or shortened survival) can be identified as not being likely to experience longer survival (e.g., overall survival, event-free survival, and / or cancer-free survival).

[0091] In some cases, a mammal (e.g., a human) identified as having cancer (e.g., OC, early-stage OC, advanced stage OC, low-grade OC, high-grade OC, serous OC, non- serous OC, or OC that is likely to be sensitive to treatment) can be administered one or more cancer treatments. For example, a mammal (e.g., a human) identified as having OC based, at least in part, on the presence of a reduced level of Microbacterium lacus in the mammal’s ovarian microbiome, an elevated level of Corynebacterium tubercolostearicum in the mammal’s LRT microbiome, an elevated level of Facklamia hominis in the mammal’s LRT microbiome, and / or an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome (e.g., as compared to a reference level present within controls known to have benign gynecologic conditions, such as a benign uterine gynecologic condition) can be administered one or more (e.g., one, two, three, four, five, or more) cancer treatments. For example, a mammal (e.g., a human) identified as having early-stage OC based, at least in part, on the presence of an elevated level of Peptoniphilus koenoeneniae in the mammal’s LRT microbiome, an elevated level of Facklamia hominis in the mammal’s LRT microbiome, an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome, and / or an elevated level of Fenollaria massiliensis in the mammal’s LRT microbiome (e.g., as compared to a reference level present within controls known to have benign gynecologic conditions, such as benign uterine gynecologic conditions) can be administered one or more (e.g., one, two, three, four, five, or more) cancer treatments. For example, a mammal (e.g., a human) identified as having advanced- stage OC based, at least in part, on the presence of a reduced level of Corynebacterium tuberculostearicum in the mammal’s uterine microbiome, a reduced level of Roseateles depolymerans in the mammal’s uterine microbiome, a reduced level of Corynebacterium sp. in the mammal’s LRT microbiome, and / or a reduced level of Dialister sp. in the mammal’s LRT microbiome (e.g., as compared to a reference level present within controls known to have early-stage OC) can be administered one or more (e.g., one, two, three, four, five, or more) cancer treatments For example, a mammal (e.g., a human) identified as having high-grade OC based, at least in part, on the presence of a reduced level of Roseateles depolymerans in the mammal’s uterine microbiome, a reduced level of Mobiluncus curtisii in the mammal’s LRT microbiome, a reduced level of Porphyromonas bennonis in the mammal’s LRT microbiome, and / or a reduced level of Atopobium deltae in the mammal’s LRT microbiome (e.g., as compared to a reference level present within controls known to have low-grade OC) can be administered one or more (e.g., one, two, three, four, five, or more) cancer treatments For example, a mammal (e g., a human) identified as having serous OC based, at least in part, on the presence of a reduced level of a reduced level of Angelakisella massiliensis in the mammal’s omentum microbiome and / or a reduced level of Lachnospira eligens in the mammal’s omentum microbiome (e.g., as compared to a reference level present within controls known to have non-serous OC) can be administered one or more (e.g., one, two, three, four, five, or more) cancer treatments. For example, a mammal (e.g., a human) identified as having OC that is likely to be sensitive to treatment based, at least in part, on the presence of a reduced level of Anaerococcus tetradius in the mammal’s ascites / peritoneal fluid microbiome (e.g., as compared to a reference level present within controls known to be resistant to treatment) can be administered one or more (e.g., one, two, three, four, five, or more) cancer treatments

[0092] Any suitable agent or therapy used to treat cancer, combination of agents used to treat cancer, combination of therapies used to treat cancer, or combination of one or more agents used to treat cancer and one or more therapies used to treat cancer, can be administered to a mammal identified as having cancer (e.g., OC, early-stage OC, advanced stage OC, low-grade OC, high-grade OC, serous OC, non-serous OC, or OC that is likely to be sensitive to treatment). In some cases, an agent used to treat cancer as described herein can be an alkylating agent. In some cases, an agent used to treat cancer as described herein can be a corticosteroid. In some cases, an agent used to treat cancer as described herein can be a platinum drug. In some cases, an agent used to treat cancer as described herein can be a purine analog. In some cases, an agent used to treat cancer as described herein can be an anti-metabolite. In some cases, an agent used to treat cancer as described herein can be an anthracy cline. In some cases, an agent used to treat cancer as described herein can be a chemotherapeutic agent. In some cases, an agent used to treat cancer as described herein can be an immunotherapy (e.g., a monoclonal antibody, antibody-drug conjugate, radioactive antibody, and / or bispecific antibody). In some cases, an agent used to treat cancer as described herein can be an immune checkpoint inhibitor. In some cases, an agent used to treat cancer as described herein can be a signal transduction inhibitor. In some cases, an agent used to treat cancer as described herein can be a BTK inhibitor. Examples of agents (e.g., anti-cancer agents) that can be administered to mammal (e.g., a human) having cancer (e g., OC) to treat cancer as described herein include, without limitation, cyclophosphamide, chlorambucil, bendamustine, ifosfamide, prednisone, dexamethasone, cisplatin, carboplatin, oxaliplatin, fludarabine, pentostatin, cladribine (2-CdA), cytarabine (ara-C), gemcitabine, methotrexate, pralatrexate, doxorubicin (adriamycin), liposomal doxorubicin (caelyx), vincristine, mitoxantrone, etoposide (VP- 16), bleomycin, metformin, and any combination thereof. Examples of therapies that can be used to treat cancer as described herein include, without limitation, surgery (e.g., debulking), radiation therapies, bone marrow transplants, and cell therapies such as a chimeric antigen receptor (CAR)-T cell therapy.

[0093] In some cases, when treating a mammal (e.g., a human) having cancer (e.g., OC) as described herein, the treatment can be effective to improve survival of the mammal. For example, the methods and materials described herein can be used to improve event- free survival (e.g., cancer-free survival). For example, the methods and materials described herein can be used to improve overall survival. In some cases, the methods and materials described herein can be used to improve the survival of a mammal having cancer (e.g., OC) by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. For example, the methods and materials described herein can be used to improve the survival of a mammal having cancer (e.g., OC) by, for example, at least 6 months (e g., about 6 months, about 8 months, about 10 months, about 1 year, about 1.5 years, about 2 years, about 2.5 years, or about 3 years).

[0094] In some cases, when treating a mammal (e.g., a human) having cancer (e.g., OC) as described herein, the treatment can be effective to treat the cancer. For example, the number of cancer cells present within a mammal can be reduced using the methods and materials described herein. For example, the methods and materials described herein can be used to reduce the number of cancer cells present within a mammal having cancer by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. In some cases, the size (e.g., volume) of one or more tumors present within a mammal can be reduced using the methods and materials described herein. For example, the methods and materials described herein can be used to reduce the size of one or more tumors present within a mammal having cancer by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent. In some cases, the size (e.g., volume) of one or more tumors present within a mammal does not increase.

[0095] In some cases, when treating a mammal (e.g., a human) having cancer (e.g., OC) as described herein, the treatment can be effective to reduce one or more symptoms of the cancer. Examples of symptoms of OC include, without limitation, abdominal bloating or swelling, quickly feeling full when eating, weight loss, discomfort in the pelvic area, fatigue, back pain, changes in bowel habits (e g., constipation), and a frequent need to urinate. For example, the methods and materials described herein can be used to reduce one or more symptoms within a mammal having cancer (e.g., OC) by, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or more percent.

[0096] In certain instances, a course of treatment and the severity of one or more symptoms (e.g., cancer symptoms such as OC symptoms) can be monitored. For example, the severity of one or more OC symptoms can be monitored over the course of treatment to determine whether or not the treatment is effective and / or remains effective over time. Any appropriate method can be used to determine whether or not the severity of a symptom is reduced. In some cases, the severity of one or more cancer symptoms (e.g., OC symptoms) can be assessed at different time points. For example, the severity of one or more symptoms (e g., OC symptoms) can be monitored from about 7 days to about 24 weeks after the mammal has been administered one or more cancer treating agents or therapies, to determine whether or not the treatment is effective and / or remains effective over time. In some cases, when the treatment is determined to be effective, the treatment course can enter a rest period or can be ended. In some cases, where the treatment is determined not to be effective, the treatment course can be continued (e.g., with the same or a higher dose of the agent or therapy), or a different treatment can be initiated.

[0097] Aspects of the present disclosure can be described as embodiments in any of the following enumerated clauses. It will be understood that any of the described embodiments can be used in connection with any other described embodiments to the extent that the embodiments do not contradict one another.

[0098] 1. A method for classifying a mammal having ovarian cancer as having early-stage ovarian cancer or advanced stage ovarian cancer, wherein said method comprises:

[0099] (a) quantifying one or more microorganisms selected from the group consisting of Peptoniphilus koenoeneniae, Facklamia hominis, Ruminococcus faecis. Fenollaria massiliensis, Corynebacterium sp., Dialister sp., Corynebacterium tuberculostearicum, Roseateles depolymerans,'

[0100] (b) comparing the quantity of the one or more microorganisms to a reference level; (c) identifying the mammal as having early-stage ovarian cancer if the mammal has, relative to the reference level:

[0101] (1) an elevated level of Peptoniphilus koenoeneniae within the mammal’s lower reproductive tract (“LRT”) microbiome,

[0102] (2) an elevated level of Facklamia hominis within the mammal’s LRT microbiome,

[0103] (3) an elevated level of Ruminococcus faecis within the mammal’s LRT microbiome, or

[0104] (4) an elevated level of Fenollaria massiliensis in the mammal’s LRT microbiome; and

[0105] (d) identifying the mammal as having advanced-stage ovarian cancer if the mammal has, relative to the reference level:

[0106] (1) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome,

[0107] (2) a reduced level of Dialister sp. within the mammal’s LRT microbiome,

[0108] (3) a reduced level of Corynebacterium tuberculostearicum within the mammal’s uterine microbiome, or

[0109] (4) a reduced level of Roseateles depolymerans within the mammal’s uterine microbiome.

[0110] 2. The method of clause 1, wherein said mammal is a human.

[0111] 3. The method of clause 1 or clause 2, wherein said method comprises identifying said mammal as having the presence of said elevated level of Peptoniphilus koenoeneniae .

[0112] 4. The method of clause 3, wherein said elevated level of Peptoniphilus koenoeneniae is as compared to a reference level in controls known to have a benign gynecologic condition.

[0113] 5. The method of clause 1 or clause 2, wherein said method comprises identifying said mammal as having the presence of said elevated level of Facklamia hominis.

[0114] 6. The method of clause 5, wherein said elevated level of Facklamia hominis is as compared to a reference level in controls known to have a benign gynecologic condition. 7. The method of clause 1 or clause 2, wherein said method comprises identifying said mammal as having the presence of said elevated level of Ruminococcus faecis.

[0115] 8. The method of clause 7, wherein said elevated level of Ruminococcus faecis is as compared to a reference level in controls known to have a benign gynecologic condition.

[0116] 9. The method of clause 1 or clause 2, wherein said method comprises identifying said mammal as having the presence of said elevated level of Fenollaria massiliensis .

[0117] 10. The method of clause 9, wherein said elevated level of Fenollaria massiliensis is as compared to a reference level in controls known to have a benign gynecologic condition.

[0118] 11. The method of clause 1 or clause 2, wherein said method comprises identifying said mammal as having the presence of said reduced level of Corynebacterium sp.

[0119] 12. The method of clause 11, wherein said reduced level of Corynebacterium sp. is as compared to a reference level in controls known to have early-stage ovarian cancer.

[0120] 13. The method of clause 1 or clause 2, wherein said method comprises identifying said mammal as having the presence of said reduced level of Dialister sp.

[0121] 14. The method of clause 13, wherein said reduced level of Dialister sp. is as compared to a reference level in controls known to have early-stage ovarian cancer.

[0122] 15. The method of clause 1 or clause 2, wherein said method comprises identifying said mammal as having the presence of said reduced level of Corynebacterium tuberculostearicum .

[0123] 16. The method of clause 15, wherein said reduced level of Corynebacterium tuberculostearicum is as compared to a reference level in controls known to have early- stage ovarian cancer.

[0124] 17. The method of clause 1 or clause 2, wherein said method comprises identifying said mammal as having the presence of said reduced level of Roseateles depolymerans.

[0125] 18. The method of clause 17, wherein said reduced level of Roseateles depolymerans is as compared to a reference level in controls known to have early-stage ovarian cancer.

[0126] 19. A method for classifying a mammal as having ovarian cancer, wherein said method comprises: (a) identifying said mammal as having the presence of (i) an elevated level of Corynebacterium tubercolostearicum within the mammal’s lower reproductive tract (LRT) microbiome, (ii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, or (iii) an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome; and

[0127] (b) classifying said mammal as having said ovarian cancer.

[0128] 20. The method of clause 19, wherein said mammal is a human.

[0129] 21. The method of clause 19 or clause 20, wherein said method comprises identifying said mammal as having the presence of said elevated level of Corynebacterium tubercolostearicu .

[0130] 22. The method of clause 21, wherein said elevated level of Corynebacterium tubercolostearicum is as compared to a reference level present in controls known to have a benign gynecologic condition.

[0131] 23. The method of clause 19 or clause 20, wherein said method comprises identifying said mammal as having the presence of said elevated level of Facklamia hominis.

[0132] 24. The method of clause 23, wherein said elevated level of Facklamia hominis is as compared to a reference level present in controls known to have a benign gynecologic condition.

[0133] 25. The method of clause 19 or clause 20, wherein said method comprises identifying said mammal as having the presence of said elevated level of Ruminococcus faecis.

[0134] 26. The method of clause 25, wherein said elevated level of Ruminococcus faecis is as compared to a reference level present in controls known to have a benign gynecologic condition.

[0135] 27. A method for classifying a mammal as having ovarian cancer, wherein said method comprises:

[0136] (a) identifying said mammal as having the presence of (i) a reduced level of Microbacterium lacus within the mammal’s ovarian microbiome, (ii) an elevated level of Corynebacterium tubercolostearicum within the mammal’s lower reproductive tract (LRT) microbiome, (iii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, or (iv) an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome; and

[0137] (b) classifying said mammal as having said ovarian cancer.

[0138] 28. The method of clause 27, wherein said mammal is a human.

[0139] 29. The method of clause 27 or clause 28, wherein said method comprises identifying said mammal as having the presence of said reduced level of Microbacterium lacus.

[0140] 30. The method of clause 29, wherein said reduced level of Microbacterium lacus is as compared to a reference level present in controls known to have a benign gynecologic condition.

[0141] 31. The method of clause 27 or clause 28, wherein said method comprises identifying said mammal as having the presence of said elevated level of Corynebacterium tubercolostearicum .

[0142] 32. The method of clause 31, wherein said elevated level of Corynebacterium tubercolostearicum is as compared to a reference level present in controls known to have a benign gynecologic condition.

[0143] 33. The method of clause 27 or clause 28, wherein said method comprises identifying said mammal as having the presence of said elevated level of Facklamia hominis.

[0144] 34. The method of clause 33, wherein said elevated level of Facklamia hominis is as compared to a reference level present in controls known to have a benign gynecologic condition.

[0145] 35. The method of clause 27 or clause 28, wherein said method comprises identifying said mammal as having the presence of said elevated level of Ruminococcus faecis.

[0146] 36. The method of clause 35, wherein said elevated level of Ruminococcus faecis is as compared to a reference level present in controls known to have a benign gynecologic condition.

[0147] 37. A method for classifying a mammal as having early-stage ovarian cancer, wherein said method comprises:

[0148] (a) identifying said mammal as having the presence of (i) an elevated level of Peptoniphilus koenoeneniae within the mammal’s LRT microbiome, (ii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, (iii) an elevated level of Ruminococcus faecis within the mammal’s LRT microbiome, or (iv) an elevated level of Fenollaria massiliensis in the mammal’s LRT microbiome; and

[0149] (b) classifying said mammal as having said early-stage ovarian cancer.

[0150] 38. The method of clause 37, wherein said mammal is a human.

[0151] 39. The method of clause 37 or clause 38, wherein said method comprises identifying said mammal as having the presence of said elevated level of Peptoniphilus koenoenenia .

[0152] 40. The method of clause 39, wherein said elevated level of Peptoniphilus koenoeneniae is as compared to a reference level in controls known to have a benign gynecologic condition.

[0153] 41. The method of clause 37 or clause 38, wherein said method comprises identifying said mammal as having the presence of said elevated level of Facklamia hominis.

[0154] 42. The method of clause 41, wherein said elevated level of Facklamia hominis is as compared to a reference level in controls known to have a benign gynecologic condition.

[0155] 43. The method of clause 37 or clause 38, wherein said method comprises identifying said mammal as having the presence of said elevated level of Ruminococcus faecis.

[0156] 44. The method of clause 43, wherein said elevated level of Ruminococcus faecis is as compared to a reference level in controls known to have a benign gynecologic condition.

[0157] 45. The method of clause 37 or clause 38, wherein said method comprises identifying said mammal as having the presence of said elevated level of Fenollaria massiliensis.

[0158] 46. The method of clause 45, wherein said elevated level of Fenollaria massiliensis is as compared to a reference level in controls known to have a benign gynecologic condition.

[0159] 47. A method for classifying a mammal having ovarian cancer as having advanced- stage ovarian cancer, wherein said method comprises:

[0160] (a) identifying said mammal as having the presence of (i) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome, or (ii) a reduced level of Dialister sp. within the mammal’s LRT microbiome; and

[0161] (b) classifying said mammal as having said advanced- stage ovarian cancer.

[0162] 48. The method of clause 47, wherein said mammal is a human. 49. The method of clause 47 or clause 48, wherein said method comprises identifying said mammal as having the presence of said reduced level of Corynebacterium sp.

[0163] 50. The method of clause 49, wherein said reduced level of Corynebacterium sp. is as compared to a reference level in controls known to have early-stage ovarian cancer.

[0164] 51. The method of clause 47 or clause 48, wherein said method comprises identifying said mammal as having the presence of said reduced level of Dialister sp.

[0165] 52. The method of clause 51, wherein said reduced level of Dialister sp. is as compared to a reference level in controls known to have early-stage ovarian cancer.

[0166] 53. A method for classifying a mammal having ovarian cancer as having advanced- stage ovarian cancer, wherein said method comprises:

[0167] (a) identifying said mammal as having the presence of (i) a reduced level of Corynebacterium tuberculostearicum within the mammal’s uterine microbiome, (ii) a reduced level of Roseateles depolymerans within the mammal’ s uterine microbiome, (iii) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome, or (iv) a reduced level of Dialister sp. within the mammal’s LRT microbiome; and

[0168] (b) classifying said mammal as having said advanced- stage ovarian cancer.

[0169] 54. The method of clause 53, wherein said mammal is a human.

[0170] 55. The method of clause 53 or clause 54, wherein said method comprises identifying said mammal as having the presence of said reduced level of Corynebacterium tuberculostearicum .

[0171] 56. The method of clause 55, wherein said reduced level of Corynebacterium tuberculostearicum is as compared to a reference level in controls known to have early- stage ovarian cancer.

[0172] 57. The method of clause 53 or clause 54, wherein said method comprises identifying said mammal as having the presence of said reduced level of Roseateles depolymerans.

[0173] 58. The method of clause 57, wherein said reduced level of Roseateles depolymerans is as compared to a reference level in controls known to have early-stage ovarian cancer.

[0174] 59. The method of clause 53 or clause 54, wherein said method comprises identifying said mammal as having the presence of said reduced level of Corynebacterium sp. 60. The method of clause 59, wherein said reduced level of Corynebacterium sp. is as compared to a reference level in controls known to have early-stage ovarian cancer.

[0175] 61. The method of clause 53 or clause 54, wherein said method comprises identifying said mammal as having the presence of said reduced level of Dialister sp.

[0176] 62. The method of clause 61, wherein said reduced level of Dialister sp. is as compared to a reference level in controls known to have early-stage ovarian cancer.

[0177] 63. A method for classifying a mammal having ovarian cancer as having high-grade ovarian cancer, wherein said method comprises:

[0178] (a) identifying said mammal as having the presence of (i) a reduced level of Mobiluncus curtisii within the mammal’s LRT microbiome, (ii) a reduced level of Porphyromonas bennonis within the mammal’s LRT microbiome, or (iii) a reduced level of Atopobium deltas within the mammal’s LRT microbiome; and

[0179] (b) classifying said mammal as having said high-grade ovarian cancer.

[0180] 64. The method of clause 63, wherein said mammal is a human.

[0181] 65. The method of clause 63 or clause 64, wherein said method comprises identifying said mammal as having the presence of said reduced level of Mobiluncus curtisii.

[0182] 66. The method of clause 65, wherein said reduced level of Mobiluncus curtisii is as compared to a reference level in controls known to have low-grade ovarian cancer.

[0183] 67. The method of clause 63 or clause 64, wherein said method comprises identifying said mammal as having the presence of said reduced level of Porphyromonas bennonis.

[0184] 68. The method of clause 67, wherein said reduced level of Porphyromonas bennonis is as compared to a reference level in controls known to have low-grade ovarian cancer.

[0185] 69. The method of clause 63 or clause 64, wherein said method comprises identifying said mammal as having the presence of said reduced level of Atopobium deltae.

[0186] 70. The method of clause 69, wherein said reduced level of Atopobium deltae is as compared to a reference level in controls known to have low-grade ovarian cancer.

[0187] 71. A method for classifying a mammal having ovarian cancer as having high-grade ovarian cancer, wherein said method comprises:

[0188] (a) identifying said mammal as having the presence of (i) a reduced level of Roseateles depolymerans within the mammal’s uterine microbiome, (ii) a reduced level of Mobihmctis curtisii within the mammal’s LRT microbiome, (iii) a reduced level of Porphyromonas bennonis within the mammal’s LRT microbiome, or (iv) a reduced level oi Atopobium deltae within the mammal’s LRT microbiome; and

[0189] (b) classifying said mammal as having said high-grade ovarian cancer.

[0190] 72. The method of clause 71, wherein said mammal is a human.

[0191] 73. The method of clause 71 or clause 72, wherein said method comprises identifying said mammal as having the presence of said reduced level of Roseateles depolymerans .

[0192] 74. The method of clause 73, wherein said reduced level of Roseateles depolymerans is as compared to a reference level in controls known to have low-grade ovarian cancer.

[0193] 75. The method of clause 71 or clause 72, wherein said method comprises identifying said mammal as having the presence of said reduced level of Mobihincus curtisii.

[0194] 76. The method of clause 75, wherein said reduced level of Mobiluncus curtisii is as compared to a reference level in controls known to have low-grade ovarian cancer.

[0195] 77. The method of clause 71 or clause 72, wherein said method comprises identifying said mammal as having the presence of said reduced level of Porphyromonas bennonis.

[0196] 78. The method of clause 77, wherein said reduced level of Porphyromonas bennonis is as compared to a reference level in controls known to have low-grade ovarian cancer.

[0197] 79. The method of clause 71 or clause 72, wherein said method comprises identifying said mammal as having the presence of said reduced level of Atopobium deltae.

[0198] 80. The method of clause 79, wherein said reduced level of Atopobium deltae is as compared to a reference level in controls known to have low-grade ovarian cancer.

[0199] 81. A method for classifying a mammal having ovarian cancer as having serous ovarian cancer, wherein said method comprises:

[0200] (a) identifying said mammal as having the presence of (i) a reduced level of Angelakisella massiliensis within the mammal’s omentum microbiome, or (ii) a reduced level of Lachnospira eligens within the mammal’s omentum microbiome; and

[0201] (b) classifying said mammal as having said serous ovarian cancer.

[0202] 82. The method of clause 81, wherein said mammal is a human.

[0203] 83. The method of clause 81 or clause 82, wherein said method comprises identifying said mammal as having the presence of said reduced level of Angelakisella massiliensis. 84. The method of clause 83, wherein said reduced level of Angelakisella massiliensis is as compared to a reference level in controls known to have non-serous OC.

[0204] 85. The method of clause 81 or clause 82, wherein said method comprises identifying said mammal as having the presence of said reduced level of J chnospira eligens.

[0205] 86. The method of clause 85, wherein said reduced level of Lachnospira eligens is as compared to a reference level in controls known to have non-serous OC.

[0206] 87. A method for classifying a mammal having ovarian cancer as being likely to respond to treatment, wherein said method comprises: a) identifying said mammal as having the presence of a reduced level of Anaerococcus tetradius within the mammal’s ascites or peritoneal fluid microbiome; and

[0207] (b) classifying said mammal as being likely to respond to treatment.

[0208] 88. The method of clause 87, wherein said mammal is a human.

[0209] 89. The method of clause 87 or clause 88, wherein said treatment comprises debulking, immunotherapy, chemotherapy, or any combination thereof.

[0210] 90. The method of any one of clauses 87 to 89, wherein said reduced level of Anaerococcus tetradius is as compared to a reference level in controls known to have treatment-resistant ovarian cancer.

[0211] 91. A method for classifying a mammal having ovarian cancer as being likely to have a prolonged cancer-free survival time, wherein said method comprises:

[0212] (a) identifying said mammal as having the presence of (i) a reduced level of Lactobacillus iners within the mammal’s LRT microbiome, (ii) a reduced level of Fenollaria massiliensis within the mammal’s LRT microbiome, (iii) a reduced level of Ezakiella coagulans within the mammal’s LRT microbiome, or (iv) a reduced level of Campylobacter ureolyticus within the mammal’s LRT microbiome; and

[0213] (b) classifying said mammal as being likely to have said prolonged cancer-free survival time.

[0214] 92. The method of clause 91, wherein said mammal is a human.

[0215] 93. The method of clause 91 or clause 92, wherein said method comprises identifying said mammal as having the presence of said reduced level of Lactobacillus iners. 94. The method of clause 93, wherein said reduced level of Lactobacillus iners is as compared to a reference level in controls known to have ovarian cancer with shortened survival.

[0216] 95. The method of clause 91 or clause 92, wherein said method comprises identifying said mammal as having the presence of said reduced level of Fenollaria massiliensis.

[0217] 96. The method of clause 95, wherein said reduced level of Fenollaria massiliensis is as compared to a reference level in controls known to have ovarian cancer with shortened survival.

[0218] 97. The method of clause 91 or clause 92, said method comprising identifying said mammal as having the presence of said reduced level of Ezakiella coagulans.

[0219] 98. The method of clause 97, wherein said reduced level of Ezakiella coagulans is as compared to a reference level in controls known to have ovarian cancer with shortened survival.

[0220] 99. The method of clause 91 or clause 92, said method comprising identifying said mammal as having the presence of said reduced level of Campylobacter ureolyticus.

[0221] 100. The method of clause 99, wherein said reduced level of Campylobacter ureolyticus is as compared to a reference level in controls known to have ovarian cancer with shortened survival.

[0222] 101. The method of clause 91 or clause 92, wherein said prolonged cancer-free survival time is as compared to the cancer-free survival time of comparable mammals lacking the presence of (i), (ii), (iii), and (iv).

[0223] 102. A method for classifying a mammal having ovarian cancer as being unlikely to have a prolonged cancer-free survival time, wherein said method comprises:

[0224] (a) identifying said mammal as having the absence of (i) a reduced level of Lactobacillus iners within the mammal’s LRT microbiome, (ii) a reduced level of Fenollaria massiliensis within the mammal’s LRT microbiome, (iii) a reduced level of Ezakiella coagulans within the mammal’s LRT microbiome, or (iv) a reduced level of Campylobacter ureolyticus within the mammal’s LRT microbiome; and

[0225] (b) classifying said mammal as being unlikely to have said longer cancer-free survival time. 103. The method of clause 102, wherein said mammal is a human.

[0226] 104. The method of clause 102 or clause 103, wherein said method comprises identifying said mammal as having the absence of said reduced level of Lactobacillus iners.

[0227] 105. The method of clause 104, wherein said reduced level of Lactobacillus iners is as compared to a reference level in controls known to have ovarian cancer with shortened survival.

[0228] 106. The method of clause 102 or clause 103, wherein said method comprises identifying said mammal as having the absence of said reduced level of Fenollaria massiliensis.

[0229] 107. The method of clause 106, wherein said reduced level of Fenollaria massiliensis is as compared to a reference level in controls known to have ovarian cancer with shortened survival.

[0230] 108. The method of clause 102 or clause 103, said method comprising identifying said mammal as having the absence of said reduced level of Ezakiella coagulans.

[0231] 109. The method of clause 108, wherein said reduced level of Ezakiella coagulans is as compared to a reference level in controls known to have ovarian cancer with shortened survival.

[0232] 110. The method of clause 102 or clause 103, said method comprising identifying said mammal as having the absence of said reduced level of Campylobacter ureolyticus.

[0233] 111. The method of clause 110, wherein said reduced level of Campylobacter ureolyticus is as compared to a reference level in controls known to have ovarian cancer with shortened survival.

[0234] 112. The method of clause 102 or clause 103, wherein said prolonged cancer-free survival time is as compared to the cancer-free survival time of comparable mammals lacking the presence of (i), (ii), (iii), or (iv).

[0235] 113. A method for treating a mammal having ovarian cancer, wherein said method comprises:

[0236] (a) identifying said mammal as having the presence of (i) an elevated level of Corynebacterium tubercolostearicum within the mammal’s lower reproductive tract (LRT) microbiome, (ii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, or (iii) an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome; and

[0237] (b) administering to said mammal a treatment for said ovarian cancer, wherein said method is effective to improve survival of said mammal.

[0238] 114. The method of clause 113, wherein said mammal is a human.

[0239] 115. The method of clause 113 or clause 114, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

[0240] 116. The method of any one of clauses 113 to 115, wherein said elevated level of Corynebacterium tubercolostearicumssaid elevated level of Facklamia hominis, or said elevated level of Ruminococcus faecis is as compared to a reference level present in controls known to have a benign gynecologic condition.

[0241] 117. A method for treating a mammal having ovarian cancer, wherein said method comprises:

[0242] (a) identifying said mammal as having the presence of (i) a reduced level of Microbacterium lacus within the mammal’s ovarian microbiome, (ii) an elevated level of Corynebacterium tubercolostearicum within the mammal’s lower reproductive tract (LRT) microbiome, (iii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, or (iv) an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome; and

[0243] (b) administering to said mammal a treatment for said ovarian cancer, wherein said method is effective to improve survival of said mammal.

[0244] 118. The method of clause 117, wherein said mammal is a human.

[0245] 119. The method of clause 117 or clause 118, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

[0246] 120. The method of any one of clauses 117 to 119, wherein said reduced level of Microbacterium lacus, said elevated level of Corynebacterium tubercolostearicussaid elevated level of Facklamia hominis, or said elevated level of Ruminococcus faecis is as compared to a reference level present in controls known to have a benign gynecologic condition.

[0247] 121. A method for treating a mammal having early-stage ovarian cancer, wherein said method comprises:

[0248] (a) identifying said mammal as having the presence of (i) an elevated level of Peptoniphilus koenoeneniae within the mammal’s LRT microbiome, (ii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, (iii) an elevated level of Ruminococcus faecis within the mammal’s LRT microbiome, or (iv) an elevated level of Fenollaria massiliensis in the mammal’s LRT microbiome; and

[0249] (b) administering to said mammal a treatment for said early-stage ovarian cancer, wherein said method is effective to improve survival of said mammal.

[0250] 122. The method of clause 121, wherein said mammal is a human.

[0251] 123. The method of clause 121 or clause 122, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

[0252] 124. The method of any one of clauses 121 to 123, wherein said elevated level of Peptoniphilus koenoeneniae, said elevated level of Facklamia hominis, said elevated level of Ruminococcus faecis, or said elevated level of Fenollaria massiliensis is as compared to a reference level in controls known to have a benign gynecologic condition.

[0253] 125. A method for treating a mammal having advanced-stage ovarian cancer, wherein said method comprises:

[0254] (a) identifying said mammal as having the presence of (i) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome, or (ii) a reduced level of Dialister sp. within the mammal’s LRT microbiome; and

[0255] (b) administering to said mammal a treatment for said advanced-stage ovarian cancer, wherein said method is effective to improve survival of said mammal.

[0256] 126. The method of clause 125, wherein said mammal is a human.

[0257] 127. The method of clause 125 or clause 126, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof. 128. The method of any one of clauses 125 to 127, wherein said reduced level of Corynebacterium sp. or said reduced level of Dialister sp. is as compared to a reference level in controls known to have early-stage ovarian cancer.

[0258] 129. A method for treating a mammal having advanced-stage ovarian cancer, wherein said method comprises:

[0259] (a) identifying said mammal as having the presence of (i) a reduced level of Corynebacterium tuber cidostearicum within the mammal’s uterine microbiome, (ii) a reduced level of Roseateles depolymerans within the mammal’ s uterine microbiome, (iii) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome, or (iv) a reduced level of Dialister sp. within the mammal’s LRT microbiome; and

[0260] (b) administering to said mammal a treatment for said advanced-stage ovarian cancer, wherein said method is effective to improve survival of said mammal.

[0261] 130. The method of clause 129, wherein said mammal is a human.

[0262] 131. The method of clause 129 or clause 130, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

[0263] 132. The method of any one of clauses 129 to 130, wherein said reduced level of Corynebacterium tuberculostearicum, said reduced level of Roseateles depolymerans, said reduced level of Corynebacterium sp., or said reduced level of Dialister sp. is as compared to a reference level in controls known to have early-stage ovarian cancer.

[0264] 133. A method for treating a mammal having high-grade ovarian cancer, wherein said method comprises:

[0265] (a) identifying said mammal as having the presence of (i) a reduced level of Mobiluncus curtisii within the mammal’s LRT microbiome, (ii) a reduced level of Porphyromonas bennonis within the mammal’s LRT microbiome, or (iii) a reduced level of Atopobium deltae within the mammal’s LRT microbiome; and

[0266] (b) administering to said mammal a treatment for said high-grade ovarian cancer, wherein said method is effective to improve survival of said mammal.

[0267] 134. The method of clause 133, wherein said mammal is a human. 135. The method of clause 133 or clause 134, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

[0268] 136. The method of any one of clauses 133 to 135, wherein said reduced level of Mobiluncus curtisii, said reduced level of Porphyronionas bennonis, or said reduced level o Atopobium deltae is as compared to a reference level in controls known to have low- grade ovarian cancer.

[0269] 137. A method for treating a mammal having high-grade ovarian cancer, wherein said method comprises:

[0270] (a) identifying said mammal as having the presence of (i) a reduced level of Roseateles depolymerans within the mammal’s uterine microbiome, (ii) a reduced level of Mobiluncus curtisii within the mammal’s LRT microbiome, (iii) a reduced level of Porphyronionas bennonis within the mammal’s LRT microbiome, or (iv) a reduced level of Atopobium deltae within the mammal’s LRT microbiome; and

[0271] (b) administering to said mammal a treatment for said high-grade ovarian cancer, wherein said method is effective to improve survival of said mammal.

[0272] 138. The method of clause 137, wherein said mammal is a human.

[0273] 139. The method of clause 137 or clause 138, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

[0274] 140. The method of any one of clauses 137 to 139, wherein reduced level of Roseateles depolymerans, said reduced level of Mobiluncus curtisii, said reduced level of Porphyronionas bennonis, or said reduced level of Atopobium deltae is as compared to a reference level in controls known to have low-grade ovarian cancer.

[0275] 141. A method for treating a mammal having serous ovarian cancer, wherein said method comprises:

[0276] (a) identifying said mammal as having the presence of (i) a reduced level of Angelakisella massiliensis within the mammal’s omentum microbiome, or (ii) a reduced level of Lachnospira eligens within the mammal’s omentum microbiome; and (b) administering to said mammal a treatment for said serous ovarian cancer, wherein said method is effective to improve survival of said mammal.

[0277] 142. The method of clause 141, wherein said mammal is a human.

[0278] 143. The method of clause 141 or clause 142, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

[0279] 144. The method of any one of clauses 141 to 143, wherein said reduced level of Angelakisella massiliensis or said reduced level of Lachnospira eligens is as compared to a reference level in controls known to have non-serous OC.

[0280] 145. A method for treating a mammal having ovarian cancer, wherein said method comprises:

[0281] (a) identifying said mammal as having the presence of a reduced level of Anaerococcus tetradius within the mammal’s ascites / peritoneal fluid microbiome; and

[0282] (b) administering to said mammal a treatment for said ovarian cancer, wherein said method is effective to improve survival of said mammal.

[0283] 146. The method of clause 145, wherein said mammal is a human.

[0284] 147. The method of clause 145 or clause 146, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

[0285] 148. The method of any one of clauses 145 to 147, wherein said reduced level of Anaerococcus tetradius is as compared to a reference level in controls known to have treatment-resistant ovarian cancer.

[0286] 149. A method for treating a mammal having ovarian cancer, wherein said method comprises administering a treatment for said ovarian cancer to a mammal that was identified as having the presence of (i) an elevated level of Corynebacterium tubercolostearicum within the mammal’s lower reproductive tract (LRT) microbiome, (ii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, or (iii) an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome, wherein said method is effective to improve survival of said mammal.

[0287] 150. The method of clause 149, wherein said mammal is a human. 151. The method of clause 149 or clause 150, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

[0288] 152. The method of any one of clauses 149 to 151, wherein said elevated level of Corynebacterium tubercolostearicum , said elevated level of Facklamia hominis, or said elevated level of Ruminococcus faecis is as compared to a reference level present in controls known to have a benign gynecologic condition.

[0289] 153. A method for treating a mammal having ovarian cancer, wherein said method comprises administering a treatment for said ovarian cancer to a mammal that was identified as having the presence of (i) a reduced level of Microbacterium lacus within the mammal’s ovarian microbiome, (ii) an elevated level of Corynebacterium tubercolostearicum within the mammal’s lower reproductive tract (LRT) microbiome,

[0290] (iii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, or

[0291] (iv) an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome, wherein said method is effective to improve survival of said mammal.

[0292] 154. The method of clause 153, wherein said mammal is a human.

[0293] 155. The method of clause 153 or clause 154, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

[0294] 156. The method of any one of clauses 153 to 155, wherein said reduced level of Microbacterium lacus, said elevated level of Corynebacterium tubercolostearicumssaid elevated level of Facklamia hominis, or said elevated level of Ruminococcus faecis is as compared to a reference level present in controls known to have a benign gynecologic condition.

[0295] 157. A method for treating a mammal having early-stage ovarian cancer, wherein said method comprises administering a treatment for said ovarian cancer to a mammal that was identified as having the presence of (i) an elevated level of Peptoniphilus koenoeneniae within the mammal’s LRT microbiome, (ii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, (iii) an elevated level of Ruminococcus faecis within the mammal’s LRT microbiome, or (iv) an elevated level of Fenollaria massiliensis in the mammal’s LRT microbiome, wherein said method is effective to improve survival of said mammal.

[0296] 158. The method of clause 157, wherein said mammal is a human.

[0297] 159. The method of clause 157 or clause 158, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

[0298] 160. The method of any one of clauses 157 to 159, wherein said elevated level of Peptoniphilus koenoeneniae said elevated level of Facklamia hominis, said elevated level of Ruminococcus faecis, or said elevated level of Fenollaria massiliensis is as compared to a reference level in controls known to have a benign gynecologic condition.

[0299] 161. A method for treating a mammal having advanced-stage ovarian cancer, wherein said method comprises administering a treatment for said ovarian cancer to a mammal that was identified as having the presence of (i) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome, or (ii) a reduced level of Dialister sp. within the mammal’s LRT microbiome, wherein said method is effective to improve survival of said mammal.

[0300] 162. The method of clause 161, wherein said mammal is a human.

[0301] 163. The method of clause 161 or clause 162, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

[0302] 164. The method of any one of clauses 161 to 163, wherein said reduced level of Corynebacterium sp. or said reduced level of Dialister sp. is as compared to a reference level in controls known to have early-stage ovarian cancer.

[0303] 165. A method for treating a mammal having advanced-stage ovarian cancer, wherein said method comprises administering a treatment for said ovarian cancer to a mammal that was identified as having the presence of (i) a reduced level of Corynebacterium tuberculostearicum within the mammal’s uterine microbiome, (ii) a reduced level of Roseateles depolymerans within the mammal’s uterine microbiome, (iii) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome, or (iv) a reduced level of Dialister sp. within the mammal’s LRT microbiome, wherein said method is effective to improve survival of said mammal.

[0304] 166. The method of clause 165, wherein said mammal is a human.

[0305] 167. The method of clause 165 or clause 166, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

[0306] 168. The method of any one of clauses 165 to 167, wherein said reduced level of Corynebacterium tuber culostearicum, said reduced level of Roseateles depofymerans, said reduced level of Corynebacterium sp., or said reduced level of Dialister sp. is as compared to a reference level in controls known to have early-stage ovarian cancer.

[0307] 169. A method for treating a mammal having high-grade ovarian cancer, wherein said method comprises administering a treatment for said ovarian cancer to a mammal that was identified as having the presence of (i) a reduced level of Mobiluncus curtisii within the mammal’s LRT microbiome, (ii) a reduced level of Porphyromonas bennonis within the mammal’s LRT microbiome, or (iii) a reduced level of Atopobium deltae within the mammal’s LRT microbiome, wherein said method is effective to improve survival of said mammal.

[0308] 170. The method of clause 169, wherein said mammal is a human.

[0309] 171. The method of clause 169 or clause 170, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

[0310] 172. The method of any one of clauses 169 to 171, wherein said reduced level of Mobiluncus curtisii, said reduced level of Porphyromonas bennonis, or said reduced level of Atopobium deltae is as compared to a reference level in controls known to have low- grade ovarian cancer.

[0311] 173. A method for treating a mammal having high-grade ovarian cancer, wherein said method comprises administering a treatment for said ovarian cancer to a mammal that was identified as having the presence of (i) a reduced level of Roseateles depofymerans within the mammal’s uterine microbiome, (ii) a reduced level of Mobiluncus curtisii within the mammal’s LRT microbiome, (iii) a reduced level of Porphyromonas bennonis within the mammal’s LRT microbiome, or (iv) a reduced level of Atopobium deltae within the mammal’s LRT microbiome, wherein said method is effective to improve survival of said mammal.

[0312] 174. The method of clause 173, wherein said mammal is a human.

[0313] 175. The method of clause 173 or clause 174, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

[0314] 176. The method of any one of clauses 173 to 175, wherein said reduced level of Roseateles depolymerans, said reduced level of Mobiluncus curtisii, said reduced level of Porphyromonas bennonis, or said reduced level of Atopobium deltae is as compared to a reference level in controls known to have low-grade ovarian cancer.

[0315] 177. A method for treating a mammal having serous ovarian cancer, wherein said method comprises administering a treatment for said ovarian cancer to a mammal that was identified as having the presence of (i) a reduced level of Angelakisella massiliensis within the mammal’s omentum microbiome, or (ii) a reduced level of Lachnospira eligens within the mammal’s omentum microbiome, wherein said method is effective to improve survival of said mammal.

[0316] 178. The method of clause 177, wherein said mammal is a human.

[0317] 179. The method of clause 177 or clause 178, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

[0318] 180. The method of any one of clauses 177 to 179, wherein said reduced level of Angelakisella massiliensis or said reduced level of Lachnospira eligens is as compared to a reference level in controls known to have non-serous OC.

[0319] 181. A method for treating a mammal having ovarian cancer, wherein said method comprises administering a treatment for said ovarian cancer to a mammal that was identified as having the presence of a reduced level of Anaerococcus tetradius within the mammal’s ascites / peritoneal fluid microbiome, wherein said method is effective to improve survival of said mammal.

[0320] 182. The method of clause 181, wherein said mammal is a human. 183. The method of clause 181 or clause 182, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

[0321] 184. The method of any one of clauses 181 to 183, wherein said reduced level of Anaerococcus tetradius is as compared to a reference level in controls known to have treatment-resistant ovarian cancer.

[0322] 185. A method for treating a mammal having ovarian cancer, wherein said method comprises:

[0323] (a) identifying said mammal as having, as compared to a reference level present in controls, the presence of

[0324] (i) an elevated level of Corynebacterium tuber col ostearicum within the mammal’s lower reproductive tract (LRT) microbiome or a reduced level of Corynebacterium tuberculostearicum within the mammal’s uterine microbiome,

[0325] (ii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome,

[0326] (iii) an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome,

[0327] (iv) a reduced level of Microbacterium lacus within the mammal’s ovarian microbiome,

[0328] (v) an elevated level of Peptoniphilus koenoeneniae within the mammal’s LRT microbiome,

[0329] (vi) an elevated level of Fenollaria massiliensis in the mammal’s LRT microbiome,

[0330] (vii) a reduced level of Roseateles depolymerans within the mammal’s uterine microbiome,

[0331] (viii) a reduced level o Mobiluncus curtisii within the mammal’s LRT microbiome,

[0332] (ix) a reduced level of Porphyromonas bennonis within the mammal’s LRT microbiome, (x) a reduced level of Atopobium deltae within the mammal’s LRT microbiome,

[0333] (xi) a reduced level of Angelakisella massiliensis within the mammal’s omentum microbiome,

[0334] (xii) a reduced level of Lachnospira eligens within the mammal’s omentum microbiome, or

[0335] (xiii) a reduced level of Anaerococcus tetradius within the mammal’s ascites / peritoneal fluid microbiome; and

[0336] (b) administering to said mammal a treatment for said ovarian cancer, wherein said method is effective to improve survival of said mammal.

[0337] 186. The method of clause 185, wherein said mammal is a human.

[0338] 187. The method of clause 185, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

[0339] 188. The method of clause 185, wherein said ovarian cancer is early-stage ovarian cancer and the controls are known to have a benign gynecologic condition.

[0340] 189. The method of clause 185, wherein said ovarian cancer is advanced- stage ovarian cancer and the controls are known to have early-stage ovarian cancer.

[0341] 190. The method of clause 185, wherein said ovarian cancer is high-grade ovarian cancer and the controls are known to have low-grade ovarian cancer.

[0342] 191. The method of clause 185, wherein said ovarian cancer is serous ovarian cancer and the controls are known to have non-serous ovarian cancer.

[0343] 191. A method for treating a mammal having advanced-stage ovarian cancer, wherein said method comprises administering a treatment for said ovarian cancer to a mammal that was identified as having, as compared to a reference level in controls known to have early-stage ovarian cancer, the presence of (i) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome, or (ii) a reduced level of Dialister sp. within the mammal’s LRT microbiome, wherein said method is effective to improve survival of said mammal.

[0344] 192. The method of clause 191, wherein said mammal is a human. 193. The method of clause 191, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

[0345] The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.

[0346] EXAMPLES

[0347] Example 1 - Diagnostic and Prognostic Potential of the Microbiome in OC Materials and Methods

[0348] Patient enrollment: A total of 64 women who were 18 years of age or older and undergoing hysterectomy for OC (N=34) or a benign gynecologic condition (N=30) requiring hysterectomy by standard surgical procedures were included in this study (TABLE 1). The indication for hysterectomy was an inclusion criterion, and most of the patients also received salpingo-oophorectomy. Women were excluded if they were pregnant or nursing, had antibiotic treatment in the two weeks preceding surgery, or if morcellation was used during the hysterectomy for any reason (e.g., size of the uterus). Patients provided stool samples the day preceding or the day of the surgery, and urine specimens were collected through a catheter in the operating room (OR). Vaginal and cervical samples were collected by the surgeon in the OR immediately preceding the betadine vaginal scrub. Ascites / peritoneal fluid was collected shortly after incision by the surgical team. The remaining samples (uterine, Fallopian tubes, ovarian, and omental) were collected in the Pathology Laboratory within minutes of surgical extraction, using aseptic technique.

[0349] TABLE 1 Treatment response data collection: Since samples for this study were collected from treatment-naive patients, the role of the microbiome on treatment response also was investigated. Various treatment outcome data were collected for all patients, including tumor response to treatment and patient status at approximately two years and four years post-diagnosis (TABLE 2). For samples with primary debulking / completion staging followed by platinum / taxane treatment, the following definitions for tumor response were used:

[0350] 1) Refractory: recurrence while receiving the chemotherapy or within four weeks of the last dose of therapy or Persistent Disease = “yes”; 2) Resistant: recurrence from 4 weeks to 6 months after the last dose of chemotherapy; and

[0351] 3) Sensitive: no recurrence or recurrence more than 6 months after last dose of chemotherapy.

[0352] Regarding status post-diagnosis, patients were either alive (with or without any adverse event such as cancer recurrence) or deceased after suffering adverse event(s).

[0353] TABLE 2: Treatment outcome data

[0354]

[0355] Operating room sample collection: Vaginal, cervical, urine, and ascites / peritoneal lavage samples were collected as described elsewhere (Walther- Ant onio et al., Genome Medicine 8: 122 (2016)). Briefly, vaginal, and cervical swabs were collected using two sterile Dacron swabs by the surgeon (with guidance on site by the research team) immediately after anesthesia administration but before the standard pre-operative betadine scrub. Samples were placed in sterile Tris-EDTA and transported on dry ice to storage at -80°C. Urine was obtained during the surgery through a catheter. Ascites was obtained during surgical aspiration following incision, immediately after ascites sample collection for diagnostic cytology procedures. If no ascites was present, sterile saline was flushed into the abdominal cavity as standard surgical procedure. That clinical waste aspirate was collected for research use and microbiome analysis.

[0356] Pathology laboratory collection: Uterine, Fallopian tube, ovarian, and omentum samples were collected as described elsewhere (Wai th er- Ant onio et al., supra). Briefly, the uterus, Fallopian tube, ovaries, and omentum were transported (under 2 minutes) in a sterile bag at room temperature to the pathology lab for processing under sterile conditions. The organs were processed at the grossing station by the research team after sterilization. Following the bilateral cut and splaying of the uterus, whole uterine swabs (Dacron) and scrapes (sterilized pap smear spatulas) were collected. Samples necessary for diagnosis were then collected, followed by collection of research dedicated biopsies immediately after diagnostic procedures were complete.

[0357] Stool samples: Patients were requested to provide a stool sample collected within a 24 hour period before their scheduled surgery. When received, samples were stored at - 80°C until processing.

[0358] Sample processing and genomic DNA extraction: Samples were processed and genomic DNA sequenced as described elsewhere (Walther- Antonio et al., supra). Briefly, the swab and scrape samples were thawed and vortexed to mix any settled material, and then centrifuged to pellet bacterial cells. A sterile pestle was used to macerate the biopsy samples. Genomic DNA was extracted from about 100 mg of tissue using the MoBio POWERSOIL® DNA Isolation Kit (MoBio Laboratories, Inc.; Carlsbad, CA) according to the manufacturer’s protocol. The MP FASTPREP™ (MP BIOMEDICALS™; Solon, OH) was used for 60 seconds at 6.0 m / s to obtain a more effective and rapid lysis of the cells. The DNA concentration was measured using High Sensitivity QUBIT™ (Life Technologies Corporation; Carlsbad, CA). In addition to the samples, controls (Blank, PCR negative control, PCR positive control Geobacillus, and TE Geobacillus) of the DNA extraction were performed.

[0359] Sequencing : Samples were sequenced as described elsewhere (Walsh et al., Scientific Reports 9: 19213 (2019)). Briefly, the V3-V5 region of the 16S rRNA gene was amplified by a two-step polymerase chain reaction (PCR) protocol using universal forward primer V3 357F (5'-GTCCTACGGGAGGCAGCAG-3'; SEQ ID NO: 1) and reverse primer V5 926R (5'-CCGTCAATTCMTTTRAGT-3'; SEQ ID NO:2) (Yu and Morrison, Appl Environ Microb 70:4800-4806 (2004)) followed by the addition of Illumina flow cell adaptors containing indices (Gohl et al., Nat Biotechnol 34:942-949 (2016)). Following the primary PCR, the products were diluted (1: 100) in PCR grade water for secondary PCR reactions using the V3 357F and V5 926R primers modified with Nextera adaptors developed in collaboration with the University of Minnesota Genomic Center (Minneapolis, MN). The nucleotide sequence of the V3_341F_Nextera primer was 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGA GGCAGCAG-3' (SEQ ID NO:3), and the nucleotide sequence of the V5_926R_Nextera primer was 5'- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCGTCAAT TCMTTTRAGT-3' (SEQ ID NO:4).

[0360] A detailed procedure for both primary and secondary PCR is described elsewhere (Walsh et al., supra). Secondary PCR reactions were followed by dilution, normalization, and pooling of the PCR products, which were then concentrated and cleaned up using 1.8X AMPureAP beads (Beckman Coulter; Brea, CA). After quantification using a QUANT-IT™ dsDNA HS assay kit (Thermo Fisher Scientific Inc.; Waltham, MA), the sequence pool was assessed for purity and the presence of 725 bp peak (± 20%) using a 2200 TapeStation system and D1000 Screen tape / reagents (Agilent Technologies; Santa Clara, CA). The pooled 16S amplicons were sequenced using the MiSeq 600 cycle v3 kit (Illumina; San Diego, CA) and MCS v2.6.1 after quantification using a KAPA SYBR® FAST qPCR kit (KAPA Biosystems; Woburn, MA), dilution and denaturing.

[0361] Sequence analysis and outcome: The sequenced reads were processed using the quantitative insights into microbial ecology (QIIME2) as follows: Using sample-specific barcodes assigned during sequencing, all reads were demultiplexed in QIIME2™ 2020.11 (Bolyen et al., Nat Biotechnol 37:852-857 (2019)). This was followed by quality control, denoising, chimera removal and amplicon sequence variants (ASVs) generation for each sequence run using the Divisive Amplicon Denoising Algorithm (DADA2) (Callahan et al., Nat Methods 13:581-583 (2016)) within QIIME2. Taxonomy was then assigned at 99% similarity based on the SILVA taxonomy and reference database (SILVA_132_QIIME_release) (Quast et al., Nucleic Acids Res 4LD590-D596 (2013)) and a rooted phylogenetic tree built using the “align-to-tree-mafft-fasttree” pipeline from QIIME2. To rigorously exclude potential contaminants, the QIIME2 output fdes were imported into R (R software, version 4.0.3, www.r-project.org), and taxa more abundant in the negative controls than samples were fdtered out using the R package decontam version 1.10.0. This was followed with further removal of any taxon that appeared in more than one negative control. A total of 11,603,589 sequence reads were obtained across 751 samples (mean of 15,369 ± 54,686 reads) after quality control and further processing for visualization was performed using QIIME2 and R. a-diversity and / i-diversity analysis: The results of the QIIME2 analysis were imported into R (R software, version 4.0.3, www.r-project.org) for further analysis using the standard ecological measures of microbial diversity for the number of unique taxa per sample (a-diversity) and similarity in composition between samples (P-diversity). Several metrics were calculated for both a- (within-sample) diversity (observed ASV, Shannon and inverse Simpson indices) and - (between-sample) diversity (Bray-Curtis, weighted, unweighted, and generalized UniFrac) after rarefaction, and the metric was reported with significant p-values. The various metrics were used measure microbial community diversity in different ways. For instance, while observed ASV qualitatively measures the microbial community richness, both Shannon and inverse Simpson indices consider both the number of taxa present as well as the abundance of each taxon in the community. In case of P-diversity, Bray-Curtis quantitatively measures of community dissimilarity without incorporating phylogenetic relationships between the taxa as is done in the various UniFrac metrics (Lozupone and Knight, Appl Environ Microb 71:8228-8235 (2005)). While the unweighted UniFrac only considers taxa present, thereby giving weight to rare taxa, weighted UniFrac assigns weight to the dominant taxa and generalized UniFrac equally favors taxa of varying abundance (Lozupone and Knight, supra, and Chen et al., Bioinformatics 28:2106-2113 (2012)).

[0362] To assess the association with a-diversity, a linear regression model (“Im” function in R “stats” package v4.1.2) was fitted and statistical significance was determined using the t-statistic. Using the permutational multivariate analysis of variance (PERMANOVA), a distance-based analysis of variance method based on permutation (999 permutations, “adonis” function in the R “vegan” package 2.5-7), the association between the various factors of interest (e.g., group, stage, grade, and histology of OC) and P-diversity measures was tested after rarefying the data. Adjustments also were made for significantly different covariates (TABLE 1 : batch, age, BMI, and menopausal status) and then ordination plots were generated using classic multi-dimensional scaling (MDS) as implemented in R (“cmdscale” function in the R “stats” package v4.1.2). A permutation test that takes the minimum p-values of individual P-diversity measures as the test statistic (omnibus test) was used to combine multiple sources of association evidence provided by different P-diversity measures and an overall association p-value was reported (“PermanovaG” function in the R “GUniFrac” package vl .4).

[0363] Differential abundance analysis: Differential analysis was completed at the species level, filtering rare taxa prevalent at less than 10% of samples or taxa with a maximum proportion (relative abundance) less than 0.2% to reduce the number of necessary tests. This analysis utilized the R package LinDA (linear models for differential abundance analysis), a linear regression framework for differential abundance analysis that fits linear regression models on centered log-ratio transformed data, identifies a bias term due to the transformation and compositional effect, and corrects the bias using the mode of the regression coefficient (Zhou et al., Genome Biol 23:95 (2022)). p-values were computed based on the bias-corrected regression coefficients and the Benjamini -Hochberg procedure used to control the false discovery rate (FDR).

[0364] Statistical significance was assessed, with FDR-adjusted p-values less than 0.10 considered.

[0365] Covariate Adjustment: Covariates that were differentially present between comparison groups and that showed a significant microbiome impact after a PERMANOVA analysis (batch, age, BMI, menopausal status, history of hypertension, stage, grade, histology and debulking status) were adjusted for.

[0366] Results

[0367] To determine the impact of OC on the microbiome, women undergoing hysterectomy for OC or a benign gynecologic condition requiring hysterectomy were recruited, and the microbiomes of patients with and without OC were compared. Following that analysis, the focus was shifted to patients with OC in order to assess the prognostic potential of the microbiome. This impact was examined using various oc- (Inverse Simpson, and Shannon indices and observed ASVs) and P- (weighted, unweighted, and generalized UniFrac distances and Bray-Curtis) measures, as well as differential abundance analysis.

[0368] Patient Demographics

[0369] Microbiome samples were collected from a total of 64 women undergoing hysterectomy for either OC (n = 30) or a benign gynecologic condition (n = 34) (TABLE 1). The women with benign gynecologic conditions were used as controls to characterize the microbiome specific to OC. The age (p = 0.672), menopausal state (p = 0.251) and body mass index (BMI) (p = 0.353) distributions were similar between both cohorts, as shown in TABLE 1. The results of tumor response to treatment, as well as patient status two years and four years post-diagnosis, are shown in TABLE 2.

[0370] The microbiome associated with OC vs. benign uterine gynecologic conditions Samples from the female reproductive tract (vagina, cervix, uterus, Fallopian tubes, and ovaries), as well as ascites or peritoneal fluid, omentum (OC cohort only), urine, and stool samples (OC cohort only), were obtained to characterize the microbiomes of patients with OC or a benign gynecologic condition. While the lack of omental and stool samples in the benign cohort did not allow for comparisons between the two cohorts in these sample types, analysis of these samples in the OC cohort focusing on the impact of stage, grade, histology, and treatment response were included. The high throughput sequencing of the V3-V5 region of the 16S rRNA gene of all the 751 samples collected, including controls, yielded a total of 7,076 ASVs. The decontamination process (filtering out microbial taxa more abundant in the negative controls as well as taxa that were present in more than one negative control) resulted in the removal of potential contaminants, as shown in the abundance and relative abundance plots in FIGS. 7A-7E. The results of the taxonomic analysis showed that the microbiomes from the same body site of both benign and OC cohorts were generally dominated by the same microbial taxa to varying amounts (FIGS. 1A-1I). For instance, the relative abundance of Lactobacillus in the vagina was only -15% in the OC cohort compared to -30% in the benign cohort (FIG. 1A) Several of these microbial taxa were also dominant across body sites. For example, Lactobacillus appeared to be a dominant species in OC (vagina, cervix, uterus, Fallopian tubes, ovaries, and omentum) and benign (vagina, cervix, and urine) cohorts. Ezakiella also appeared to be dominant across multiple sites (uterus, Fallopian tubes, urine, stool) in both the OC and benign cohorts (FIGS. 1C, ID, 1H, and II). While Peptoniphilus was dominant in the cervix and ovaries of the benign cohort, Porphyromonas was particularly dominant in the Fallopian tubes and ovaries of the benign cohort and the stool of the OC cohort (FIGS. IB, ID, IE, and II). Dominant levels of Bacteroides also were observed in the uterus, Fallopian tubes, ovary, ascites, and stool of the OC cohort (FIGS. 1C, ID, IE, IF, and 1H). In addition, Prevotella and Streptococcus were dominant in the vagina and uterus of both the OC and benign cohorts (FIGS. 1A and 1C) The Distinguishing Potential of the Microbiome in Ovarian Cancer Microbiome compositions of ovarian cancer patients differed significantly from those of patients with benign gynecologic conditions

[0371] To further investigate the microbiome associated with OC, the differences in the microbiome composition between patients with or without OC were summarized using various oc- (within-sample richness and evenness) and 0- (between-sample) diversity measures. After adjusting for batch differences where necessary as described above, the vaginal and cervical samples were compared. The results showed no significant differences (unweighted UniFrac: p = 0.814) between vaginal and cervical samples, in agreement with results described elsewhere (Walsh, supra, and 23. Kawahara et al., Sci Rep-uk 11 :2156 (2021)). The vaginal and cervical samples (lower reproductive tract, LRT) were therefore combined by adding sequence reads from both body sites for each patient in the rest of the analysis. The results revealed statistically significantly higher a- diversity in the LRT of the OC cohort compared to the benign cohort (FIG. 2A, Observed ASVs: p = 0.049; see, FIG. 8A for other metrics). This was not seen in the other body sites (uterus: FIG. 2C, Fallopian tubes: FIG. 2E, ovaries: FIG. 2G, and urine: FIG. 2K). Statistically significant 0-diversity differences also were observed in the uterus (FIG. 2D, unweighted UniFrac: p = 0.004; FIG. 9B, weighted UniFrac: p = 0.028), Fallopian tube (FIG. 2F, Bray-Curtis: p = 0.025), and urine (FIG. 2L, Bray- Curtis, p = 0.047) between the benign and OC cohorts. Of note, differences in the 0- diversity of the LRT (FIG. 2B, unweighted UniFrac: p = 0.052) and ovarian (FIG. 2H, Bray-Curtis, p = 0.088) microbiomes also were observed between the benign and OC cohorts that aligned with other organs but did not reach statistical significance. These differences resulted in general enrichment of several taxa, including Corynebacterium tuber culostearicum, Facklamia hominis and Ruminococcus faecis in the LRT and Methylorubrum extorquens in ascites, and the depletion of Microbacterium lacus in the ovaries of the OC cohort (FIGS. 2M-2O and TABLES 3A, 3B, and FIG. 22A). Ovarian Cancer Microbiome according to Stage. Grade and Histology Following the general characterization of the microbiome from both OC and benign cohorts, the focus was shifted to characterizing the microbiome associated with the stage, grade, and histology of OC (TABLE 2).

[0372] Significant association between stage and the microbiome

[0373] The studies described herein demonstrated significant associations between OC stage and various measures of diversity. Specifically, a significant association between OC stage and a-diversity was observed across several sampling sites (FIGS. 3A-3O and 10A-10G). The results also showed a statistically significant association of stage with the a-diversity of the LRT microbiome (FIG. 3A, Shannon, p = 0.034; and FIG. 10A). The benign cohort had significantly lower a-diversity than the OC cohort at the early-stage (Shannon, / ? = 0.019), and higher a-diversity than the OC cohort at the advanced-stage (Shannon, / ? = 0.019). In addition, significant association of stage with the -diversity was found in multiple organs (FIGS. 3D, 3H, 3N, and 11A-11G). These included benign vs. early-stage (FIG. 3D, uterus: unweighted UniFrac, / ? = 0.002), benign vs. advanced- stage (FIG. 3D, uterus: unweighted UniFrac, / ? = 0.006), and early- vs. advanced-stage (FIG. 3H, ovaries: unweighted UniFrac, / ? = 0.039; FIG. 3N, stool: Bray-Curtis, / ? = 0.042). Differences trending toward significant also were observed in the LRT (benign vs. early-stage: unweighted UniFrac, / ? = 0.061; benign vs. advanced-stage: unweighted UniFrac, / ? = 0.059; early- vs. advanced-stage: unweighted UniFrac, / ? = 0.065), Fallopian tube (early- vs. advanced-stage: Bray-Curtis, / ? = 0.078), and urine (benign vs. advanced- stage: Bray-Curtis, / ? = 0.086) (FIGS. 3B, 3F, and 3L). Differential abundance analysis results revealed general enrichment of several taxa in the LRT (Peptoniphilus koenoeneniae, Facklamia hominis, Ruminococcus faecis, and Fenollaria massiliensis') and urine (Dialister propionicifaciens and Anaeroglobus geminatus) of patients in both early- and advanced-stages of OC compared to the benign cohort (FIGS. 30, 22B, and 22C, and TABLES 3A and 3B). However, general depletion of microbial taxa was observed in the LRT (Corynebacterium sp. and Dialister spf uterus (Corynebacterium tuberculostearicum and Roseateles depolymerans). urine (Prevotella bergensis, Dialister propionicifaciens and Anaeroglobus geminatus) and stool (Peptoniphilus duerdenii, Prevotella buccalis, Mobiluncus curt i si z, Porphyromonas bennonis and Alistipes shahii) of advanced-stage OC patients in comparison to early-stage OC patients (FIGS. 30 and 22D, and TABLES 3A and 3B)

[0374] Association between grade and the microbiome

[0375] While no significant association of grade with a-diversity was observed (FIGS. 4A, 4C, 4E, 4G, 41, and 12A-12H), the results of the studies described herein revealed significant association of grade with 0-diversity in the uterine and ovarian microbiomes (FIGS. 4D, 4F, 13B, and 13D) These included significant differences between benign vs. low-grade (FIG. 4D, uterus: generalized UniFrac, p = 0.023), benign vs. high-grade (FIG. 4D, uterus: generalized UniFrac, / ? = 0.014), and low- vs. high-grade (FIG. 4D, uterus: generalized UniFrac, ? = 0.019; FIG. 4F, ovaries: Bray-Curtis, / ? = 0.045) OC patients. Differences that were not quite significant also were observed between benign and high-grade OC patients in the LRT (FIG. 4B, unweighted UniFrac, p = 0.087), ovaries (FIG. 4F, Bray-Curtis, ? = 0.067) and urine (FIG. 4J, Bray-Curtis, p = 0.056). The results of the differential abundance analysis revealed general enrichment of several taxa in the LRT of both low- and high-grade patients compared to the benign cohort (FIG. 4K and TABLES 3A and 3B, and FIGS. 22E and 22F) The enriched taxa included Streptococcus infant is, Fusobacterium nticlealum, Varibaculum cambriense, Escherichia coll, Faecalibacterium prausnitzii, and Bacteroides fragilis. Comparing the LRT microbiome of low-grade OC patients to that of high-grade OC patients, however, revealed the depletion of these microbial taxa in the high-grade OC patients (FIGS. 4K and 22G, and TABLES 3A and 3B). Similar trends were observed in the urinary microbiome, with general depletion of microbial taxa in the high-grade OC patients compared to the low-grade OC patients. Examples of the depleted taxa included Peptostreptococcus anaerobius. Mobiluncus curtisii, Dialister propionicifaciens, Peptoniphilus bennonis, and Atopobium deltae (FIGS. 4K and 22G, and TABLES 3A and 3B). Association between histology and the microbiome

[0376] Consistent with the results obtained from staging, histological features of OC were significantly associated with both a-diversity and -diversity in multiple body sites (FIGS. 5A-5M, 14A-14H, and 15A-15G) There was a significant overall association of histology with the a-diversity of the LRT microbiome (FIG. 5A, Shannon, / ? = 0.045), with a significantly lower a-diversity in the benign cohort compared to other OC histologies (Shannon, / ? = 0.015). The ^-diversity analysis results showed significant differences between the patients with benign lesions and serous OC (FIG. 5B, LRT : unweighted UniFrac, / ? = 0.038; FIG. 5D, uterus: unweighted UniFrac; p = 0.002), between patients with benign conditions and other histologies (FIG. 5L, urine: generalized UniFrac, / ? = 0.048), and between serous and other histologies (FIG. 5J, omentum: generalized UniFrac). Differences also were observed between the microbiota of ovaries from patients with benign lesions vs. serous OC that aligned with other organs but did not reach statistical significance (Bray-Curtis, / ? = 0.051). Results from the differential abundance analysis revealed general enrichment of several microbial taxa in the LRT, Fallopian tube, omentum, and urine of OC patients with serous and other histologies compared to the benign cohort (FIGS. 5M, 22H, and 221, and TABLES 3A and 3B). These enriched microbial taxa included Facklamia hominis, Anaerococcus senegalensis, Lactobacillus iners, and Actinomyces turicensis. Within the OC patient cohort, results of the differential abundant analysis also showed enrichment of microbial taxa including Lactobacillus iners Fusobacterium nucleatum Prevotella buccalis, and Dialister propionicifaciens in patients with other OC histologies in comparison to the serous OC patients (FIGS. 5M and 22J, and TABLES 3A and 3B).

[0377] Microbiome Prognostic Potential for Ovarian Cancer Treatment The ovarian cancer microbiome is prognostic of treatment response

[0378] Because the microbiome samples were collected from treatment-naive patients, the role of microbiome in treatment response was investigated to better understand the prognostic potential of the microbiome at the time of hysterectomy. Outcome data were evaluated, including tumor response and patients’ status two years and four years post- diagnosis (TABLE 2). This analysis revealed significant association of the tumor response with both a-diversity and P-diversity in multiple body sites (FIGS. 6A-6L, 16A-16H, and 17A-17H) In addition, a significantly lower a-diversity (Inverse Simpson, / ? = 0.044) was found in the omental microbiome of patients who had chemotherapy sensitive OCs in comparison to those who did not (FIG. 16F). The P- diversity results also showed significant differences between patients with chemotherapy sensitive OCs (Fallopian tube: unweighted UniFrac, / ? = 0.003; urine: unweighted UniFrac, / ? = 0.015) compared to refractory / resistant (other) OCs (FIGS. 6A, 6D, 17C, and 17G) These differences, however, did not result in differentially abundant microbial taxa between the two groups (FIG. 22K, and TABLES 3A and 3B).

[0379] The potential of the microbiome to predict patients’ status two years and four years post-diagnosis (TABLE 2) was further analyzed. This analysis revealed significant differences in both a-diversity and P-diversity in multiple body sites (FIGS. 6E-6J, and 18A-18H, 19A-19H, 20A-20G, and 21A-21G). For example, significantly higher a- diversity (uterus: Shannon, / ? = 0.038) was found in patients who were alive with no adverse events after two years as compared to those who were deceased (FIGS. ISA- 1811). These differences also were seen in the P-diversity results (FIGS. 6 and 19), with significant differences between patients who were alive but experienced adverse events and those who were deceased two years post-diagnosis (FIG. 6G, omentum: unweighted UniFrac, / ? = 0.010; FIG. 61, stool: unweighted UniFrac, / ? = 0.050). Significant differences also were observed in the P-diversity of patients who were alive with no adverse events and those who experienced adverse events (FIG. 6 J, LRT: unweighted UniFrac, / ? = 0.017; FIGS. 20A-20G and 21A-21G) four years post-diagnosis. While not statistically significant, differences between patients who were alive with adverse events and those who were deceased also were observed (FIG. 6 J, LRT: unweighted UniFrac, / ? = 0.058). The differential abundance analysis identified several differentially enriched microbial taxa in the urine and stool of patients who were alive but experienced adverse events and those who were deceased, compared to those who were alive with no adverse events two years post-diagnosis (FIGS. 6K and 22L-22N, and TABLES 3A and 3B). Examples included Lactobacillus gasser i, Diasliter invisus. Blautia pseudococcoides Veillonella nakazawae, Bacteroides ovatus, Butyricicoccus faecihominis and Sutterella wadsworthensis, (FIGS. 6K and 22L-22N, and TABLES 3A and 3B). The LRT microbiomes of patients who were alive with adverse events had generally enriched taxa (l ctobacillus iners, Fenollaria massiliensis, Ezakiella coagulans, and Campylobacter ureolyticus, and Actinomyces urogenitalis) in comparison to those who were alive without event four years post-diagnosis (FIGS. 6L and 220, and TABLES 3A and 3B). General depletion of Prevotella bucalis also was observed in patients who were deceased compared to those who were alive with or without adverse events (FIGS. 6L, 22P, and 22Q, and TABLES 3A and 3B)

[0380] Microbiome composition of malignant versus benign peritoneal fluid

[0381] The volume of ascites at initial surgery of epithelial OC has been shown to be an important clinical parameter in the prognosis of the disease (Quan et al., J Obstet Gynaecol Res 47(4): 1527-1535 (2021)). The peritoneal fluid microbiomes of patients with or without OC were therefore compared to characterize the microbiome composition associated with ascites. This taxonomic analysis showed that in addition to both the benign cohort and OC cohort having peritoneal fluid microbiomes dominated by Methylobacterium, Anaerococcus, and Stenotrophomonas, the OC cohort also was dominated by Bacteroides Finegoldia, Lactobacillus, and Peptoniphilus, while the benign cohort by also was dominated by Tumebacillus, Micrococcus, and Prevotella (FIG. IF). While this did not result in significant differences in the a-diversity (FIG. 21) between these two cohorts, the results showed significant differences in P-diversity in the peritoneal fluid between patients with OC and those without (FIG. 2J, Bray-Curtis, / ? = 0.007). These differences reflected the enrichment of Methylorubrum extorquens in the OC cohort (FIGS. 2 and 22A, and TABLES 3A and 3B). Following these analyses, the peritoneal fluid microbiomes associated with the stage, grade, and histology of OC compared to the benign conditions at the time of hysterectomy were characterized (TABLE 2). Significant differences in both a-diversity and P-diversity were observed in malignant ascites versus peritoneal fluid from patients with benign conditions. These included significant differences in a-diversity between samples from patients with benign conditions vs. advanced-stage OC patients (FIG. 31; Bray-Curtis, / ? = 0.014) with enriched M. extorquens in the OC patients (TABLES 3A and 3B, and FIG. 22C). The results also showed significant differences in 0-diversity between patients with benign conditions and high-grade OC patients (FIG. 4H; Bray-Curtis, p = 0.016). Significant differences also were observed in the 0-diversity between the patients with benign conditions vs. serous OC patients (FIG. 4; Bray-Curtis, / ? = 0.019), with enriched M. extorquens in the OC patients (TABLES 3A and 3B, and FIG. 22H).

[0382] Finally, the prognostic potential of the peritoneal fluid in treatment response was explored (FIGS. 6F, 22K, and 22L, and TABLES 3A and 3B). The results revealed significant differences in the P-diversity of patients with sensitive tumor response compared to others (FIG. 6F; unweighted UniFrac, p = 0.022), with enriched Anaerococcus tetradius in patients who did not experience sensitive tumor response (FIGS. 6M and 22K, and TABLES 3A and 3B). Significant differences in the P- diversity of the patients who were alive without adverse events vs. those who were deceased two years post-diagnosis also were observed (FIG. 6F; Bray-Curtis, / ? = 0.029). A few microbial taxa, including A. tetradius, Peptoniphilus harei, Methyl obacter him radiotolerans, and Lactobacullus passer i, also were found to be enriched in patients who were alive with adverse events compared those who were alive with no adverse events two years post-diagnosis (FIGS. 6M and 22L, and Tables 3A and 3B).

[0383] Taken together, the studies described herein revealed a distinct microbiome signature in patients with OC compared to patients with benign gynecologic conditions, as summarized in TABLE 4. Several differentially abundant microbial taxa between the benign cohort versus early- and advanced-stage OC patients were identified; these could play vital roles in early detection of and screening for OC. In addition, with differentially abundant microbial taxa, the microbiome of patients before treatment may be useful to predict response to treatment.

[0384]

[0385]

[0386]

[0387]

[0388]

[0389]

[0390] B: benign, OC: ovarian cancer, ES: early-stage, AS: advanced-stage, LG: low grade, HG: high grade, S: serous and O: other

[0391] * Significant results

[0392]

[0393]

[0394]

[0395]

[0396]

[0397]

[0398] S: sensitive, O: other, ANE: alive; no event, AE: alive; event, and D: dead

[0399] * Significant results TABLE 4 Example 2 - Assessing Humans for OC

[0400] An ovarian sample and / or an LRT sample is obtained from a female human. The obtained ovarian sample is used to identify the ovarian microbiome of the human and / or the obtained LRT sample is used to identify the LRT microbiome of the human. In some cases, a 16S RNA sequencing assay is performed to identify the ovarian microbiome and / or the LRT microbiome of the human.

[0401] If a reduced level of Microbacterium lacus is identified in the ovarian microbiome of the human, an elevated level of Corynebacterium tubercolostearicum is identified in the LRT microbiome of the human, an elevated level of Facklamia hominis is identified in the LRT microbiome of the human, and / or an elevated level of Ruminococcus faecis is identified in the LRT microbiome of the human (e.g., as compared to controls known to have a benign gynecologic condition, such as a benign uterine gynecologic condition), the human is identified as being likely to have OC. If a reduced level of Microbacterhim lacus is not identified in the ovarian microbiome of the human, an elevated level of Corynebacterium tubercolostearicum is not identified in the LRT microbiome of the human, an elevated level of Facklamia hominis is not identified in the LRT microbiome of the human, and / or an elevated level of Ruminococcus faecis is not identified in the LRT microbiome of the human (e.g., as compared to controls known to have a benign gynecologic condition, such as a benign uterine gynecologic condition), the human is identified as not being likely to have OC.

[0402] Example 3 - Assessing Humans for OC

[0403] An LRT sample is obtained from a female human. The obtained sample is used to identify the LRT microbiome of the human. In some cases, a 16S RNA sequencing assay is performed to identify the LRT microbiome of the human.

[0404] If an elevated level of Peptoniphilus koenoeneniae, an elevated level of Facklamia hominis, an elevated level of Ruminococcus faecis, and / or an elevated level of Fenollaria massiliensis is identified in the LRT microbiome of the human (e.g., as compared to controls known to have a benign uterine gynecologic condition, such as a benign uterine gynecologic condition), the human is identified as being likely to have early-stage OC. If an elevated level of Peptoniphilus koenoeneniae, an elevated level of Facklamia hominis, an elevated level of Ruminococcus faecis, and / or an elevated level of Fenollaria massiliensis in the LRT is not identified in the LRT microbiome of the human (e.g., as compared to controls known to have a benign uterine gynecologic condition, such as a benign uterine gynecologic condition), the human is identified as not being likely to have early-stage OC.

[0405] Example 4 - Assessing Humans Having OC

[0406] A uterine sample and / or an LRT sample is obtained from a female human having OC. The obtained uterine sample is used to identify the uterine microbiome of the human and / or the obtained LRT sample is used to identify the LRT microbiome of the human. In some cases, a 16S RNA sequencing assay is performed to identify the uterine microbiome and / or the LRT microbiome of the human.

[0407] If a reduced level of Corynebacterium tuberculostearicum is identified in the uterine microbiome of the human, a reduced level of Roseateles depolymerans is identified in the uterine microbiome of the human, a reduced level of Corynebacterium sp. is identified in the LRT microbiome of the human, and / or a reduced level of Dialister sp. is identified in the LRT microbiome of the human (e.g., as compared to controls known to have early-stage OC), the human is identified as being likely to have advanced- stage OC. If a reduced level of Corynebacterium tuberculostearicum is not identified in the uterine microbiome of the human, a reduced level of Roseateles depolymerans is not identified in the uterine microbiome of the human, a reduced level of Corynebacterium sp. is not identified in the LRT microbiome of the human, and / or a reduced level of Dialister sp. is not identified in the LRT microbiome of the human (e.g., as compared to controls known to have early-stage OC), the human is identified as not being likely to have advanced-stage OC.

[0408] Example 5 - Assessing Humans Having OC

[0409] A uterine sample and / or an LRT sample is obtained from a female human having OC. The obtained uterine sample is used to identify the uterine microbiome of the human and / or the obtained LRT sample is used to identify the LRT microbiome of the human. In some cases, a 16S RNA sequencing assay is performed to identify the uterine microbiome and / or the LRT microbiome of the human.

[0410] If a reduced level of Roseateles depolymerans is identified in the uterine microbiome of the human, a reduced level of Mobiluncus curtisii is identified in the LRT microbiome of the human, a reduced level of Porphyromonas bennonis is identified in the LRT microbiome of the human, and / or a reduced level of Atopobium deltae is identified in the LRT microbiome of the human (e.g., as compared to controls known to have low-grade OC), the human is identified as being likely to have high-grade OC. If a reduced level of Roseateles depolymerans is not identified in the uterine microbiome of the human, a reduced level of Mobiluncus curtisii is not identified in the LRT microbiome of the human, a reduced level of Porphyromonas bennonis is not identified in the LRT microbiome of the human, and / or a reduced level of Atopobium deltae is not identified in the LRT microbiome of the human (e.g., as compared to controls known to have low-grade OC), the human is identified as not being likely to have high-grade OC.

[0411] Example 6 - Assessing Humans Having OC

[0412] An omentum sample is obtained from a female human. The obtained sample is used to identify the omentum microbiome of the human. In some cases, a 16S RNA sequencing assay is performed to identify the omentum microbiome of the human.

[0413] If a reduced level of Angelaki sella massiliensis is identified in the omentum microbiome of the human and / or a reduced level of Lachnospira eligens is identified in the omentum microbiome of the human (e.g., as compared to controls known to have non-serous OC), the human is identified as being likely to have serous OC. If a reduced level of Angelakisella massiliensis is not identified in the omentum microbiome of the human and / or a reduced level of Lachnospira eligens is not identified in the omentum microbiome of the human (e.g., as compared to controls known to have non-serous OC), the human is identified as not being likely to have serous OC. Example 7 - Assessing Humans Having OC

[0414] An ascites / peritoneal fluid sample is obtained from a female human. The obtained sample is used to identify the ascites / peritoneal fluid microbiome of the human. In some cases, a 16S RNA sequencing assay is performed to identify the ascites / peritoneal fluid microbiome of the human.

[0415] If a reduced level of Anaerococcus tetradius is identified in the ascites / peritoneal fluid microbiome of the human (e.g., as compared to controls known to be resistant to treatment), the human is identified as having OC that likely is sensitive to treatment. If a reduced level of Anaerococcus tetradius is not identified in the ascites / peritoneal fluid microbiome of the human (e.g., as compared to controls known to be resistant to treatment), the human is identified as having OC that likely is not sensitive to treatment.

[0416] Example 8 - Assessing Humans Having OC

[0417] An LRT sample is obtained from a human having OC. The obtained sample is used to identify the LRT microbiome of the human having OC. In some cases, a 16S RNA sequencing assay is performed to identify the LRT microbiome of the human having OC.

[0418] If a reduced level of Lactobacillus iners, a reduced level of Fenollaria massiliensis, a reduced level of Ezakiella coagulans, and / or a reduced level of Campylobacter ureolyticus is identified in the LRT microbiome of the human having OC (e.g., as compared to controls known to have shorter survival and / or adverse events), the human having OC is identified as being likely to have a longer survival (e.g., longer event-free survival or longer cancer-free survival) as compared to a human having OC and not having a reduced level of Lactobacillus iners, a reduced level of Fenollaria massiliensis, a reduced level of Ezakiella coagulans, and / or a reduced level of Campylobacter ureolyticus.

[0419] If a reduced level of Lactobacillus iners, a reduced level of Fenollaria massiliensis, a reduced level of Ezakiella coagulans, and / or a reduced level of Campylobacter ureolyticus is not identified in the LRT microbiome of the human having OC (e.g., as compared to controls known to have shorter survival and / or adverse events), the human having OC is identified as being unlikely to have a longer survival (e.g., longer event-free survival or longer cancer-free survival) as compared to a human having OC and having a reduced level of Lactobacillus iners, a reduced level of Fenollaria massiliensis, a reduced level of Ezakiella coagulans, and / or a reduced level of Campylobacter ureolyticus.

[0420] Example 9 - Treating Humans Having OC

[0421] A female human identified as having a reduced level of Microbacterium lacus in the ovarian microbiome, an elevated level of Corynebacterium tubercolostearicum in the LRT microbiome, an elevated level of Facklamia hominis in the LRT microbiome, and / or an elevated level of Ruminococcus faecis in the LRT microbiome is treated by administering one or more OC treatments (e.g., chemotherapies, immunotherapies, radiation therapies, bone marrow transplants, and / or cell therapies such as a CAR-T cell therapies). The treatment improves survival (e.g., cancer free survival) of the human having OC.

[0422] Example 10 - Treating Humans Having OC

[0423] A female human identified as having an elevated level of Peptoniphilus koenoeneniae, an elevated level of Facklamia hominis, an elevated level of Ruminococcus faecis, and / or an elevated level of Fenollaria massiliensis in the LRT microbiome is treated by administering one or more OC treatments (e.g., chemotherapies, immunotherapies, radiation therapies, bone marrow transplants, and / or cell therapies such as a CAR-T cell therapies). The treatment improves survival (e g., cancer free survival) of the human having OC.

[0424] Example 11 - Treating Humans Having OC

[0425] A female human having OC and identified as having a reduced level of Corynebacterium tuberculostearicum in the uterine microbiome, a reduced level of Roseateles depolymerans in the uterine microbiome, a reduced level of Corynebacterium sp. in the LRT microbiome, and / or a reduced level of Dialister sp. in the LRT microbiome is treated by administering one or more OC treatments (e.g., chemotherapies, immunotherapies, radiation therapies, bone marrow transplants, and / or cell therapies such as a CAR-T cell therapies). The treatment improves survival (e.g., cancer free survival) of the human having OC.

[0426] Example 12 - Treating Humans Having OC

[0427] A female human having OC and identified as having a reduced level of Roseateles depolymerans in the uterine microbiome, a reduced level of Mobiluncus curtisii in the LRT microbiome, a reduced level of Porphyromonas bennonis in the LRT microbiome, and / or a reduced level of Atopobium deltae in the LRT microbiome is treated by administering one or more OC treatments (e g., chemotherapies, immunotherapies, radiation therapies, bone marrow transplants, and / or cell therapies such as a CAR-T cell therapies). The treatment improves survival (e.g., cancer free survival) of the human having OC.

[0428] Example 13 - Treating Humans Having OC

[0429] A female human having OC and identified as having a reduced level of Angelakisella massiliensis in the omentum microbiome and / or a reduced level of Lachnospira eligens in the omentum microbiome is treated by administering one or more OC treatments (e.g., chemotherapies, immunotherapies, radiation therapies, bone marrow transplants, and / or cell therapies such as a CAR-T cell therapies). The treatment improves survival (e.g., cancer free survival) of the human having OC.

[0430] Example 14 - Treating Humans Having OC

[0431] A female human having OC and identified as having a reduced level of Anaerococcus tetradius in the ascites / peritoneal fluid microbiome is treated by administering one or more OC treatments (e.g., chemotherapies, immunotherapies, radiation therapies, bone marrow transplants, and / or cell therapies such as a CAR-T cell therapies). The treatment improves survival (e.g., cancer free survival) of the human having OC. Example 15 - Treating Humans Having OC

[0432] A female human having OC and identified as having a reduced level of Lactobacillus iners, a reduced level of Fenollaria massiliensis, a reduced level of Ezakiella coagulans, and / or a reduced level of Campylobacter ureolyticus in the LRT microbiome is treated by administering one or more OC treatments (e.g., chemotherapies, immunotherapies, radiation therapies, bone marrow transplants, and / or cell therapies such as a CAR-T cell therapies). The treatment improves survival (e.g., cancer free survival) of the human having OC.

[0433] OTHER EMBODIMENTS

[0434] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

WHAT IS CLAIMED IS:

1. A method for classifying a mammal having ovarian cancer as having early-stage ovarian cancer or advanced stage ovarian cancer, wherein said method comprises:(a) quantifying one or more microorganisms selected from the group consisting of Peptoniphilus koenoeneniae, Facklamia hominis, Ruminococcus faecis. Fenollaria massiliensis, Corynebacterium sp., Dialister sp., Corynebacterium tuberculostearicum , Roseateles depolymerans,(b) comparing the quantity of the one or more microorganisms to a reference level;(c) identifying the mammal as having early-stage ovarian cancer if the mammal has, relative to the reference level:(1) an elevated level of Peptoniphilus koenoeneniae within the mammal’s lower reproductive tract (“LRT”) microbiome,(2) an elevated level of Facklamia hominis within the mammal’s LRT microbiome,(3) an elevated level of Ruminococcus faecis within the mammal’s LRT microbiome, or(4) an elevated level of Fenollaria massiliensis in the mammal’s LRT microbiome; and(d) identifying the mammal as having advanced-stage ovarian cancer if the mammal has, relative to the reference level:(1) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome,(2) a reduced level of Dialister sp. within the mammal’s LRT microbiome,(3) a reduced level of Corynebacterium tuber culostearicum within the mammal’s uterine microbiome, or(4) a reduced level of Roseateles depolymerans within the mammal’s uterine microbiome.

2. The method of claim 1, wherein said mammal is a human.

3. The method of claim 1 or claim 2, wherein said method comprises identifying said mammal as having the presence of said elevated level of Peptoniphilus koenoeneniae.

4. The method of claim 3, wherein said elevated level of Peptoniphilus koenoeneniae is as compared to a reference level in controls known to have a benign gynecologic condition.

5. The method of claim 1 or claim 2, wherein said method comprises identifying said mammal as having the presence of said elevated level of Facklamia hominis.

6. The method of claim 5, wherein said elevated level of Facklamia hominis is as compared to a reference level in controls known to have a benign gynecologic condition.

7. The method of claim 1 or claim 2, wherein said method comprises identifying said mammal as having the presence of said elevated level of Ruminococcus faecis.

8. The method of claim 7, wherein said elevated level of Ruminococcus faecis is as compared to a reference level in controls known to have a benign gynecologic condition.

9. The method of claim 1 or claim 2, wherein said method comprises identifying said mammal as having the presence of said elevated level of Fenollaria massiliensis .

10. The method of claim 9, wherein said elevated level of Fenollaria massiliensis is as compared to a reference level in controls known to have a benign gynecologic condition.

11. The method of claim 1 or claim 2, wherein said method comprises identifying said mammal as having the presence of said reduced level of Corynebacterium sp.

12. The method of claim 11, wherein said reduced level of Corynebacterium sp. is as compared to a reference level in controls known to have early-stage ovarian cancer.

13. The method of claim 1 or claim 2, wherein said method comprises identifying said mammal as having the presence of said reduced level of Dialister sp.

14. The method of claim 13, wherein said reduced level of Dialister sp. is as compared to a reference level in controls known to have early-stage ovarian cancer.

15. The method of claim 1 or claim 2, wherein said method comprises identifying said mammal as having the presence of said reduced level of Corynebacterium tuberculostearicum .

16. The method of claim 15, wherein said reduced level of Corynebacterium tuberculostearicum is as compared to a reference level in controls known to have early- stage ovarian cancer.

17. The method of claim 1 or claim 2, wherein said method comprises identifying said mammal as having the presence of said reduced level of Roseateles depolymerans .

18. The method of claim 17, wherein said reduced level of Roseateles depolymerans is as compared to a reference level in controls known to have early-stage ovarian cancer.

19. A method for classifying a mammal as having ovarian cancer, wherein said method comprises:(a) identifying said mammal as having the presence of (i) an elevated level of Corynebacterium tubercolostearicum within the mammal’s lower reproductive tract (LRT) microbiome, (ii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, or (iii) an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome; and(b) classifying said mammal as having said ovarian cancer.

20. The method of claim 19, wherein said mammal is a human.

21. The method of claim 19 or claim 20, wherein said method comprises identifying said mammal as having the presence of said elevated level of Corynebacterium tubercolostearicum .

22. The method of claim 21, wherein said elevated level of Corynebacterium tubercolostearicum is as compared to a reference level present in controls known to have a benign gynecologic condition.

23. The method of claim 19 or claim 20, wherein said method comprises identifying said mammal as having the presence of said elevated level of Facklamia hominis.

24. The method of claim 23, wherein said elevated level of Facklamia hominis is as compared to a reference level present in controls known to have a benign gynecologic condition.

25. The method of claim 19 or claim 20, wherein said method comprises identifying said mammal as having the presence of said elevated level of Ruminococcus faecis.

26. The method of claim 25, wherein said elevated level of Ruminococcus faecis is as compared to a reference level present in controls known to have a benign gynecologic condition.

27. A method for classifying a mammal as having ovarian cancer, wherein said method comprises:(a) identifying said mammal as having the presence of (i) a reduced level of Microbacterium lacus within the mammal’s ovarian microbiome, (ii) an elevated level of Corynebacterium tubercolostearicum within the mammal’s lower reproductive tract (LRT) microbiome, (iii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, or (iv) an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome; and(b) classifying said mammal as having said ovarian cancer.

28. The method of claim 27, wherein said mammal is a human.

29. The method of claim 27 or claim 28, wherein said method comprises identifying said mammal as having the presence of said reduced level of Microbacterium lacus.

30. The method of claim 29, wherein said reduced level of Microbacterium lacus is as compared to a reference level present in controls known to have a benign gynecologic condition.

31. The method of claim 27 or claim 28, wherein said method comprises identifying said mammal as having the presence of said elevated level of Corynebacterium tubercolostearicum .

32. The method of claim 31, wherein said elevated level of Corynebacterium tubercolostearicum is as compared to a reference level present in controls known to have a benign gynecologic condition.

33. The method of claim 27 or claim 28, wherein said method comprises identifying said mammal as having the presence of said elevated level of Facklamia hominis.

34. The method of claim 33, wherein said elevated level of Facklamia hominis is as compared to a reference level present in controls known to have a benign gynecologic condition.Il l35. The method of claim 27 or claim 28, wherein said method comprises identifying said mammal as having the presence of said elevated level of Ruminococcus faecis.

36. The method of claim 35, wherein said elevated level of Ruminococcus faecis is as compared to a reference level present in controls known to have a benign gynecologic condition.

37. A method for classifying a mammal as having early-stage ovarian cancer, wherein said method comprises:(a) identifying said mammal as having the presence of (i) an elevated level of Peptoniphilus koenoeneniae within the mammal’s LRT microbiome, (ii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, (iii) an elevated level of Ruminococcus faecis within the mammal’s LRT microbiome, or (iv) an elevated level of Fenollaria massiliensis in the mammal’s LRT microbiome; and(b) classifying said mammal as having said early-stage ovarian cancer.

38. The method of claim 37, wherein said mammal is a human.

39. The method of claim 37 or claim 38, wherein said method comprises identifying said mammal as having the presence of said elevated level of Peptoniphilus koenoeneniae .

40. The method of claim 39, wherein said elevated level of Peptoniphilus koenoeneniae is as compared to a reference level in controls known to have a benign gynecologic condition.

41. The method of claim 37 or claim 38, wherein said method comprises identifying said mammal as having the presence of said elevated level of Facklamia hominis.

42. The method of claim 41, wherein said elevated level of Facklamia hominis is as compared to a reference level in controls known to have a benign gynecologic condition.

43. The method of claim 37 or claim 38, wherein said method comprises identifying said mammal as having the presence of said elevated level of Ruminococcus faecis.

44. The method of claim 43, wherein said elevated level of Ruminococcus faecis is as compared to a reference level in controls known to have a benign gynecologic condition.

45. The method of claim 37 or claim 38, wherein said method comprises identifying said mammal as having the presence of said elevated level of Fenollaria massiliensis.

46. The method of claim 45, wherein said elevated level of Fenollaria massiliensis is as compared to a reference level in controls known to have a benign gynecologic condition.

47. A method for classifying a mammal having ovarian cancer as having advanced- stage ovarian cancer, wherein said method comprises:(a) identifying said mammal as having the presence of (i) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome, or (ii) a reduced level of Dialister sp. within the mammal’s LRT microbiome; and(b) classifying said mammal as having said advanced- stage ovarian cancer.

48. The method of claim 47, wherein said mammal is a human.

49. The method of claim 47 or claim 48, wherein said method comprises identifying said mammal as having the presence of said reduced level of Corynebacterium sp.

50. The method of claim 49, wherein said reduced level of Corynebacterium sp. is as compared to a reference level in controls known to have early-stage ovarian cancer.

51. The method of claim 47 or claim 48, wherein said method comprises identifying said mammal as having the presence of said reduced level of Dialister sp.

52. The method of claim 51, wherein said reduced level of Dialister sp. is as compared to a reference level in controls known to have early-stage ovarian cancer.

53. A method for classifying a mammal having ovarian cancer as having advanced- stage ovarian cancer, wherein said method comprises:(a) identifying said mammal as having the presence of (i) a reduced level of Corynebacterium tuberculostearicum within the mammal’s uterine microbiome, (ii) a reduced level of Roseateles depolymerans within the mammal’s uterine microbiome, (iii) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome, or (iv) a reduced level of Dialister sp. within the mammal’s LRT microbiome; and(b) classifying said mammal as having said advanced- stage ovarian cancer.

54. The method of claim 53, wherein said mammal is a human.

55. The method of claim 53 or claim 54, wherein said method comprises identifying said mammal as having the presence of said reduced level of Corynebacterium tuberculostearicum .

56. The method of claim 55, wherein said reduced level of Corynebacterium tuberculostearicum is as compared to a reference level in controls known to have early- stage ovarian cancer.

57. The method of claim 53 or claim 54, wherein said method comprises identifying said mammal as having the presence of said reduced level of Roseateles depolymerans .

58. The method of claim 57, wherein said reduced level of Roseateles depolymerans is as compared to a reference level in controls known to have early-stage ovarian cancer.

59. The method of claim 53 or claim 54, wherein said method comprises identifying said mammal as having the presence of said reduced level of Corynebacterium sp.

60. The method of claim 59, wherein said reduced level of Corynebacterium sp. is as compared to a reference level in controls known to have early-stage ovarian cancer.

61. The method of claim 53 or claim 54, wherein said method comprises identifying said mammal as having the presence of said reduced level of Dialister sp.

62. The method of claim 61, wherein said reduced level of Dialister sp. is as compared to a reference level in controls known to have early-stage ovarian cancer.

63. A method for classifying a mammal having ovarian cancer as having high-grade ovarian cancer, wherein said method comprises:(a) identifying said mammal as having the presence of (i) a reduced level of Mobiluncus curtisii within the mammal’s LRT microbiome, (ii) a reduced level of Porphyromonas bennonis within the mammal’s LRT microbiome, or (iii) a reduced level o Atopobium deltae within the mammal’s LRT microbiome; and(b) classifying said mammal as having said high-grade ovarian cancer.

64. The method of claim 63, wherein said mammal is a human.

65. The method of claim 63 or claim 64, wherein said method comprises identifying said mammal as having the presence of said reduced level of Mobiluncus curtisii.

66. The method of claim 65, wherein said reduced level of Mobiluncus curtisii is as compared to a reference level in controls known to have low-grade ovarian cancer.

67. The method of claim 63 or claim 64, wherein said method comprises identifying said mammal as having the presence of said reduced level of Porphyromonas bennonis.

68. The method of claim 67, wherein said reduced level of Porphyromonas bennonis is as compared to a reference level in controls known to have low-grade ovarian cancer.

69. The method of claim 63 or claim 64, wherein said method comprises identifying said mammal as having the presence of said reduced level of Atopobium deltae.

70. The method of claim 69, wherein said reduced level of Atopobium deltae is as compared to a reference level in controls known to have low-grade ovarian cancer.

71. A method for classifying a mammal having ovarian cancer as having high-grade ovarian cancer, wherein said method comprises:(a) identifying said mammal as having the presence of (i) a reduced level of Roseateles depofymerans within the mammal’s uterine microbiome, (ii) a reduced level of Mobiluncus curtisii within the mammal’s LRT microbiome, (iii) a reduced level of Porphyromonas bennonis within the mammal’s LRT microbiome, or (iv) a reduced level of Atopobium deltae within the mammal’s LRT microbiome; and(b) classifying said mammal as having said high-grade ovarian cancer.

72. The method of claim 71, wherein said mammal is a human.

73. The method of claim 71 or claim 72, wherein said method comprises identifying said mammal as having the presence of said reduced level of Roseateles depofymerans.

74. The method of claim 73, wherein said reduced level of Roseateles depofymerans is as compared to a reference level in controls known to have low-grade ovarian cancer.

75. The method of claim 71 or claim 72, wherein said method comprises identifying said mammal as having the presence of said reduced level of Mobiluncus curtisii.

76. The method of claim 75, wherein said reduced level of Mobiluncus curtisii is as compared to a reference level in controls known to have low-grade ovarian cancer.

77. The method of claim 71 or claim 72, wherein said method comprises identifying said mammal as having the presence of said reduced level of Porphyromonas bennonis.

78. The method of claim 77, wherein said reduced level of Porphyromonas bennonis is as compared to a reference level in controls known to have low-grade ovarian cancer.

79. The method of claim 71 or claim 72, wherein said method comprises identifying said mammal as having the presence of said reduced level of Atopobium deltae.

80. The method of claim 79, wherein said reduced level of Atopobium deltae is as compared to a reference level in controls known to have low-grade ovarian cancer.

81. A method for classifying a mammal having ovarian cancer as having serous ovarian cancer, wherein said method comprises:(a) identifying said mammal as having the presence of (i) a reduced level of Angelakisella massiliensis within the mammal’s omentum microbiome, or (ii) a reduced level of Lachnospira eligens within the mammal’s omentum microbiome; and(b) classifying said mammal as having said serous ovarian cancer.

82. The method of claim 81, wherein said mammal is a human.

83. The method of claim 81 or claim 82, wherein said method comprises identifying said mammal as having the presence of said reduced level of Angelakisella massiliensis.

84. The method of claim 83, wherein said reduced level of Angelakisella massiliensis is as compared to a reference level in controls known to have non-serous OC.

85. The method of claim 81 or claim 82, wherein said method comprises identifying said mammal as having the presence of said reduced level of Lachnospira eligens.

86. The method of claim 85, wherein said reduced level of Lachnospira eligens is as compared to a reference level in controls known to have non-serous OC.

87. A method for classifying a mammal having ovarian cancer as being likely to respond to treatment, wherein said method comprises: a) identifying said mammal as having the presence of a reduced level of Anaerococcus tetradius within the mammal’s ascites or peritoneal fluid microbiome; and(b) classifying said mammal as being likely to respond to treatment.

88. The method of claim 87, wherein said mammal is a human.

89. The method of claim 87 or claim 88, wherein said treatment comprises debulking, immunotherapy, chemotherapy, or any combination thereof.

90. The method of any one of claims 87 to 89, wherein said reduced level of Anaerococcus tetradius is as compared to a reference level in controls known to have treatment-resistant ovarian cancer.

91. A method for classifying a mammal having ovarian cancer as being likely to have a prolonged cancer-free survival time, wherein said method comprises:(a) identifying said mammal as having the presence of (i) a reduced level of Lactobacillus iners within the mammal’s LRT microbiome, (ii) a reduced level of Fenollaria massiliensis within the mammal’s LRT microbiome, (iii) a reduced level of Ezakiella coagulans within the mammal’s LRT microbiome, or (iv) a reduced level of Campylobacter ureolyticus within the mammal’s LRT microbiome; and(b) classifying said mammal as being likely to have said prolonged cancer-free survival time.

92. The method of claim 91, wherein said mammal is a human.

93. The method of claim 91 or claim 92, wherein said method comprises identifying said mammal as having the presence of said reduced level of Lactobacillus iners.

94. The method of claim 93, wherein said reduced level of Lactobacillus iners is as compared to a reference level in controls known to have ovarian cancer with shortened survival.

95. The method of claim 91 or claim 92, wherein said method comprises identifying said mammal as having the presence of said reduced level of Fenollaria massiliensis.

96. The method of claim 95, wherein said reduced level of Fenollaria massiliensis is as compared to a reference level in controls known to have ovarian cancer with shortened survival.

97. The method of claim 91 or claim 92, said method comprising identifying said mammal as having the presence of said reduced level of Ezakiella coagulans.

98. The method of claim 97, wherein said reduced level of Ezakiella coagulans is as compared to a reference level in controls known to have ovarian cancer with shortened survival.

99. The method of claim 91 or claim 92, said method comprising identifying said mammal as having the presence of said reduced level of Campylobacter ureolyticus.

100. The method of claim 99, wherein said reduced level of Campylobacter ureolyticus is as compared to a reference level in controls known to have ovarian cancer with shortened survival.

101. The method of claim 91 or claim 92, wherein said prolonged cancer-free survival time is as compared to the cancer-free survival time of comparable mammals lacking the presence of (i), (ii), (iii), and (iv).

102. A method for classifying a mammal having ovarian cancer as being unlikely to have a prolonged cancer-free survival time, wherein said method comprises:(a) identifying said mammal as having the absence of (i) a reduced level of Lactobacillus iners within the mammal’s LRT microbiome, (ii) a reduced level of Fenollaria massiliensis within the mammal’s LRT microbiome, (iii) a reduced level of Ezakiella coagulans within the mammal’s LRT microbiome, or (iv) a reduced level of Campylobacter ureolyticus within the mammal’s LRT microbiome; and(b) classifying said mammal as being unlikely to have said longer cancer-free survival time.

103. The method of claim 102, wherein said mammal is a human.

104. The method of claim 102 or claim 103, wherein said method comprises identifying said mammal as having the absence of said reduced level of Lactobacillus iners.

105. The method of claim 104, wherein said reduced level of Lactobacillus iners is as compared to a reference level in controls known to have ovarian cancer with shortened survival.

106. The method of claim 102 or claim 103, wherein said method comprises identifying said mammal as having the absence of said reduced level of Fenollaria massiliensis.

107. The method of claim 106, wherein said reduced level of Fenollaria massiliensis is as compared to a reference level in controls known to have ovarian cancer with shortened survival.

108. The method of claim 102 or claim 103, said method comprising identifying said mammal as having the absence of said reduced level of Ezakiella coagulans.

109. The method of claim 108, wherein said reduced level of Ezakiella coagulans is as compared to a reference level in controls known to have ovarian cancer with shortened survival.

110. The method of claim 102 or claim 103, said method comprising identifying said mammal as having the absence of said reduced level of Campylobacter ureolyticus.

111. The method of claim 110, wherein said reduced level of Campylobacter ureolyticus is as compared to a reference level in controls known to have ovarian cancer with shortened survival.

112. The method of claim 102 or claim 103, wherein said prolonged cancer-free survival time is as compared to the cancer-free survival time of comparable mammals lacking the presence of (i), (ii), (iii), or (iv).

113. A method for treating a mammal having ovarian cancer, wherein said method comprises:(a) identifying said mammal as having the presence of (i) an elevated level of Corynebacterium tubercolostearicum within the mammal’s lower reproductive tract (LRT) microbiome, (ii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, or (iii) an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome; and(b) administering to said mammal a treatment for said ovarian cancer, wherein said method is effective to improve survival of said mammal.

114. The method of claim 113, wherein said mammal is a human.

115. The method of claim 113 or claim 114, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

116. The method of any one of claims 113 to 115, wherein said elevated level of Corynebacterium tubercolostearicum , said elevated level of Facklamia hominis, or said elevated level of Ruminococcus faecis is as compared to a reference level present in controls known to have a benign gynecologic condition.

117. A method for treating a mammal having ovarian cancer, wherein said method comprises:(a) identifying said mammal as having the presence of (i) a reduced level of Microbacterium lacus within the mammal’s ovarian microbiome, (ii) an elevated level of Corynebacterium tubercolostearicum within the mammal’s lower reproductive tract(LRT) microbiome, (iii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, or (iv) an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome; and(b) administering to said mammal a treatment for said ovarian cancer, wherein said method is effective to improve survival of said mammal.

118. The method of claim 117, wherein said mammal is a human.

119. The method of claim 117 or claim 118, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

120. The method of any one of claims 117 to 119, wherein said reduced level of Microbacterium locus, said elevated level of Corynebacterium tubercolostearicumssaid elevated level of Facklamia hominis, or said elevated level of Ruminococcus faecis is as compared to a reference level present in controls known to have a benign gynecologic condition.

121. A method for treating a mammal having early-stage ovarian cancer, wherein said method comprises:(a) identifying said mammal as having the presence of (i) an elevated level of Peptoniphilus koenoeneniae within the mammal’s LRT microbiome, (ii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, (iii) an elevated level of Ruminococcus faecis within the mammal’s LRT microbiome, or (iv) an elevated level of Fenollaria massiliensis in the mammal’s LRT microbiome; and(b) administering to said mammal a treatment for said early-stage ovarian cancer, wherein said method is effective to improve survival of said mammal.

122. The method of claim 121, wherein said mammal is a human.

123. The method of claim 121 or claim 122, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

124. The method of any one of claims 121 to 123, wherein said elevated level of Peptoniphilus koenoeneniae, said elevated level of Facklamia hominis, said elevatedlevel of Ruminococcus faecis, or said elevated level of Fenollaria massiliensis is as compared to a reference level in controls known to have a benign gynecologic condition.

125. A method for treating a mammal having advanced-stage ovarian cancer, wherein said method comprises:(a) identifying said mammal as having the presence of (i) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome, or (ii) a reduced level of Dialister sp. within the mammal’s LRT microbiome; and(b) administering to said mammal a treatment for said advanced-stage ovarian cancer, wherein said method is effective to improve survival of said mammal.

126. The method of claim 125, wherein said mammal is a human.

127. The method of claim 125 or claim 126, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

128. The method of any one of claims 125 to 127, wherein said reduced level of Corynebacterium sp. or said reduced level of Dialister sp. is as compared to a reference level in controls known to have early-stage ovarian cancer.

129. A method for treating a mammal having advanced-stage ovarian cancer, wherein said method comprises:(a) identifying said mammal as having the presence of (i) a reduced level of Corynebacterium tuberculostearicum within the mammal’s uterine microbiome, (ii) a reduced level of Roseateles depolymerans within the mammal’s uterine microbiome, (iii) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome, or (iv) a reduced level of Dialister sp. within the mammal’s LRT microbiome; and(b) administering to said mammal a treatment for said advanced- stage ovarian cancer, wherein said method is effective to improve survival of said mammal.

130. The method of claim 129, wherein said mammal is a human.

131. The method of claim 129 or claim 130, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

132. The method of any one of claims 129 to 130, wherein said reduced level of Corynebacterium tuber culostearicum, said reduced level of Roseateles depolymerans, said reduced level of Corynebacterium sp., or said reduced level of Dialister sp. is as compared to a reference level in controls known to have early-stage ovarian cancer.

133. A method for treating a mammal having high-grade ovarian cancer, wherein said method comprises:(a) identifying said mammal as having the presence of (i) a reduced level of Mobiluncus curtisii within the mammal’s LRT microbiome, (ii) a reduced level of Porphyromonas bennonis within the mammal’s LRT microbiome, or (iii) a reduced level of Atopobium deltae within the mammal’s LRT microbiome; and(b) administering to said mammal a treatment for said high-grade ovarian cancer, wherein said method is effective to improve survival of said mammal.

134. The method of claim 133, wherein said mammal is a human.

135. The method of claim 133 or claim 134, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

136. The method of any one of claims 133 to 135, wherein said reduced level of Mobiluncus curtisii, said reduced level of Porphyromonas bennonis, or said reduced level of Atopobium deltae is as compared to a reference level in controls known to have low- grade ovarian cancer.

137. A method for treating a mammal having high-grade ovarian cancer, wherein said method comprises:(a) identifying said mammal as having the presence of (i) a reduced level of Roseateles depolymerans within the mammal’s uterine microbiome, (ii) a reduced level of Mobiluncus curtisii within the mammal’s LRT microbiome, (iii) a reduced level of Porphyromonas bennonis within the mammal’s LRT microbiome, or (iv) a reduced level of Atopobium deltae within the mammal’s LRT microbiome; and(b) administering to said mammal a treatment for said high-grade ovarian cancer, wherein said method is effective to improve survival of said mammal.

138. The method of claim 137, wherein said mammal is a human.

139. The method of claim 137 or claim 138, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

140. The method of any one of claims 137 to 1 9, wherein reduced level of Roseateles depolymerans said reduced level of Mobiluncus curtisii said reduced level of Porphyromonas bennonis, or said reduced level of Atopobium deltae is as compared to a reference level in controls known to have low-grade ovarian cancer.

141. A method for treating a mammal having serous ovarian cancer, wherein said method comprises:(a) identifying said mammal as having the presence of (i) a reduced level of Angelakisella massiliensis within the mammal’s omentum microbiome, or (ii) a reduced level of Lachnospira eligens within the mammal’s omentum microbiome; and(b) administering to said mammal a treatment for said serous ovarian cancer, wherein said method is effective to improve survival of said mammal.

142. The method of claim 141, wherein said mammal is a human.

143. The method of claim 141 or claim 142, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

144. The method of any one of claims 141 to 143, wherein said reduced level of Angelakisella massiliensis or said reduced level of Lachnospira eligens is as compared to a reference level in controls known to have non-serous OC.

145. A method for treating a mammal having ovarian cancer, wherein said method comprises:(a) identifying said mammal as having the presence of a reduced level of Anaerococcus tetradius within the mammal’s ascites / peritoneal fluid microbiome; and(b) administering to said mammal a treatment for said ovarian cancer, wherein said method is effective to improve survival of said mammal.

146. The method of claim 145, wherein said mammal is a human.

147. The method of claim 145 or claim 146, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

148. The method of any one of claims 145 to 147, wherein said reduced level of Anaerococcus tetradius is as compared to a reference level in controls known to have treatment-resistant ovarian cancer.

149. A method for treating a mammal having ovarian cancer, wherein said method comprises administering a treatment for said ovarian cancer to a mammal that was identified as having the presence of (i) an elevated level of Corynebacterium tubercolostearicum within the mammal’s lower reproductive tract (LRT) microbiome, (ii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, or (iii) an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome, wherein said method is effective to improve survival of said mammal.

150. The method of claim 149, wherein said mammal is a human.

151. The method of claim 149 or claim 150, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

152. The method of any one of claims 149 to 151, wherein said elevated level of Corynebacterium tubercolostearicum , said elevated level of Facklamia hominis, or said elevated level of Ruminococcus faecis is as compared to a reference level present in controls known to have a benign gynecologic condition.

153. A method for treating a mammal having ovarian cancer, wherein said method comprises administering a treatment for said ovarian cancer to a mammal that was identified as having the presence of (i) a reduced level of Microbacterium lacus within the mammal’s ovarian microbiome, (ii) an elevated level of Corynebacterium tubercolostearicum within the mammal’s lower reproductive tract (LRT) microbiome,(iii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, or(iv) an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome, wherein said method is effective to improve survival of said mammal.

154. The method of claim 153, wherein said mammal is a human.

155. The method of claim 153 or claim 154, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

156. The method of any one of claims 153 to 155, wherein said reduced level of Microbacterium lacus, said elevated level of Corynebacterium tubercolostearicu , said elevated level of Facklamia hominis, or said elevated level of Ruminococcus faecis is as compared to a reference level present in controls known to have a benign gynecologic condition.

157. A method for treating a mammal having early-stage ovarian cancer, wherein said method comprises administering a treatment for said ovarian cancer to a mammal that was identified as having the presence of (i) an elevated level of Peptoniphilus koenoeneniae within the mammal’s LRT microbiome, (ii) an elevated level of Facklamia hominis within the mammal’s LRT microbiome, (iii) an elevated level of Ruminococcus faecis within the mammal’s LRT microbiome, or (iv) an elevated level of Fenollaria massiliensis in the mammal’s LRT microbiome, wherein said method is effective to improve survival of said mammal.

158. The method of claim 157, wherein said mammal is a human.

159. The method of claim 157 or claim 158, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

160. The method of any one of claims 157 to 159, wherein said elevated level of Peptoniphilus koenoeneniae, said elevated level of Facklamia hominis, said elevated level of Ruminococcus faecis, or said elevated level of Fenollaria massiliensis is as compared to a reference level in controls known to have a benign gynecologic condition.

161. A method for treating a mammal having advanced-stage ovarian cancer, wherein said method comprises administering a treatment for said ovarian cancer to a mammal that was identified as having the presence of (i) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome, or (ii) a reduced level of Dialister sp. within the mammal’s LRT microbiome, wherein said method is effective to improve survival of said mammal.

162. The method of claim 161, wherein said mammal is a human.

163. The method of claim 161 or claim 162, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

164. The method of any one of claims 161 to 163, wherein said reduced level of Corynebacterium sp. or said reduced level of Dialister sp. is as compared to a reference level in controls known to have early-stage ovarian cancer.

165. A method for treating a mammal having advanced-stage ovarian cancer, wherein said method comprises administering a treatment for said ovarian cancer to a mammal that was identified as having the presence of (i) a reduced level of Corynebacterium tuberculostearicum within the mammal’s uterine microbiome, (ii) a reduced level of Roseateles depolymerans within the mammal’s uterine microbiome, (iii) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome, or (iv) a reduced level of Dialister sp. within the mammal’s LRT microbiome, wherein said method is effective to improve survival of said mammal.

166. The method of claim 165, wherein said mammal is a human.

167. The method of claim 165 or claim 166, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

168. The method of any one of claims 165 to 167, wherein said reduced level of Corynebacterium tuberculostearicum, said reduced level of Roseateles depolymerans, said reduced level of Corynebacterium sp., or said reduced level of Dialister sp. is as compared to a reference level in controls known to have early-stage ovarian cancer.

169. A method for treating a mammal having high-grade ovarian cancer, wherein said method comprises administering a treatment for said ovarian cancer to a mammal that was identified as having the presence of (i) a reduced level of Mobiluncus curtisii within the mammal’s LRT microbiome, (ii) a reduced level of Porphyromonas bennonis within the mammal’s LRT microbiome, or (iii) a reduced level of Atopobium deltae within the mammal’s LRT microbiome, wherein said method is effective to improve survival of said mammal.

170. The method of claim 169, wherein said mammal is a human.

171. The method of claim 169 or claim 170, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

172. The method of any one of claims 169 to 171, wherein said reduced level of Mobiluncus curtisii. said reduced level of Porphyromonas bennonis, or said reduced level of Atopobium deltae is as compared to a reference level in controls known to have low- grade ovarian cancer.

173. A method for treating a mammal having high-grade ovarian cancer, wherein said method comprises administering a treatment for said ovarian cancer to a mammal that was identified as having the presence of (i) a reduced level of Roseateles depolymerans within the mammal’s uterine microbiome, (ii) a reduced level of Mobiluncus curtisii within the mammal’s LRT microbiome, (iii) a reduced level of Porphyromonas bennonis within the mammal’s LRT microbiome, or (iv) a reduced level of Atopobium deltae within the mammal’s LRT microbiome, wherein said method is effective to improve survival of said mammal.

174. The method of claim 173, wherein said mammal is a human.

175. The method of claim 173 or claim 174, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

176. The method of any one of claims 173 to 175, wherein said reduced level of Roseateles depolymerans, said reduced level of Mobiluncus curtisii, said reduced level of Porphyromonas bennonis, or said reduced level of Atopobium deltae is as compared to a reference level in controls known to have low-grade ovarian cancer.

177. A method for treating a mammal having serous ovarian cancer, wherein said method comprises administering a treatment for said ovarian cancer to a mammal that was identified as having the presence of (i) a reduced level of Angelakisella massiliensis within the mammal’s omentum microbiome, or (ii) a reduced level of Lachnospira eligens within the mammal’s omentum microbiome, wherein said method is effective to improve survival of said mammal.

178. The method of claim 177, wherein said mammal is a human.

179. The method of claim 177 or claim 178, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

180. The method of any one of claims 177 to 179, wherein said reduced level of Angelakisella massiliensis or said reduced level of Lachnospira eligens is as compared to a reference level in controls known to have non-serous OC.

181. A method for treating a mammal having ovarian cancer, wherein said method comprises administering a treatment for said ovarian cancer to a mammal that was identified as having the presence of a reduced level of Anaerococcus tetradius within the mammal’s ascites / peritoneal fluid microbiome, wherein said method is effective to improve survival of said mammal.

182. The method of claim 181, wherein said mammal is a human.

183. The method of claim 181 or claim 182, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

184. The method of any one of claims 181 to 183, wherein said reduced level of Anaerococcus tetradius is as compared to a reference level in controls known to have treatment-resistant ovarian cancer.

185. A method for treating a mammal having ovarian cancer, wherein said method comprises:(a) identifying said mammal as having, as compared to a reference level present in controls, the presence of(i) an elevated level of Corynebacterium tubercolostearicum within the mammal’s lower reproductive tract (LRT) microbiome or a reduced level of Corynebacterium tuber cidoslean cum within the mammal’s uterine microbiome,(ii) an elevated level of F acklamia hominis within the mammal’s LRT microbiome,(iii) an elevated level of Ruminococcus faecis in the mammal’s LRT microbiome,(iv) a reduced level of Microbacterium lacus within the mammal’s ovarian microbiome,(v) an elevated level of Peptoniphilus koenoeneniae within the mammal’s LRT microbiome,(vi) an elevated level of Fenollaria massiliensis in the mammal’s LRT microbiome,(vii) a reduced level of Roseateles depolymerans within the mammal’s uterine microbiome,(viii) a reduced level of Mobiluncus curtisii within the mammal’s LRT microbiome,(ix) a reduced level of Porphyromonas bennonis within the mammal’s LRT microbiome,(x) a reduced level of Atopobium deltae within the mammal’s LRT microbiome,(xi) a reduced level of Angelakisella massiliensis within the mammal’s omentum microbiome,(xii) a reduced level of Lachnospira eligens within the mammal’s omentum microbiome, or(xiii) a reduced level of Anaerococcus tetradius within the mammal’s ascites / peritoneal fluid microbiome; and(b) administering to said mammal a treatment for said ovarian cancer, wherein said method is effective to improve survival of said mammal.

186. The method of claim 185, wherein said mammal is a human.

187. The method of claim 185, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

188. The method of claim 185, wherein said ovarian cancer is early-stage ovarian cancer and the controls are known to have a benign gynecologic condition.

189. The method of claim 185, wherein said ovarian cancer is advanced- stage ovarian cancer and the controls are known to have early-stage ovarian cancer.

190. The method of claim 185, wherein said ovarian cancer is high-grade ovarian cancer and the controls are known to have low-grade ovarian cancer.

191. The method of claim 185, wherein said ovarian cancer is serous ovarian cancer and the controls are known to have non-serous ovarian cancer.

191. A method for treating a mammal having advanced-stage ovarian cancer, wherein said method comprises administering a treatment for said ovarian cancer to a mammal that was identified as having, as compared to a reference level in controls known to have early-stage ovarian cancer, the presence of (i) a reduced level of Corynebacterium sp. within the mammal’s LRT microbiome, or (ii) a reduced level of Dialister sp. within the mammal’s LRT microbiome, wherein said method is effective to improve survival of said mammal.

192. The method of claim 191, wherein said mammal is a human.

193. The method of claim 191, wherein said treatment comprises debulking, immunotherapy, chemotherapy, radiation therapy, chimeric antigen receptor (CAR)-T cell therapy, or any combination thereof.

Images