Methods and compositions for integration deficient viral vectors

Abstract

The present disclosure relates generally to compositions and methods comprising recombinant integration deficient retroviral vectors where the expression of cargo(s) of interest is dependent upon a PRE in the absence of an exogenous promoter.

Description

METHODS AND COMPOSITIONS FOR INTEGRATION DEFICIENTVIRAL VECTORSCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority to U.S. Patent Application Serial No. 63 / 509,673, filed on June 22, 2023. The disclosure of the above-referenced application is herein expressly incorporated by reference in its entirety, including any drawings.INCORPORATION OF THE SEQUENCE LISTING

[0002] This application contains a Sequence Listing. The material in the accompanying Sequence Listing is hereby incorporated by reference into this application. The accompanying Sequence Listing XML file, named “2024-06-21 Sequence_Listing_ST26 062389- 501001WO.xml,” was created on June 21, 2024, and is 1,184,724 bytes.BACKGROUND

[0003] With the increase in knowledge of the genome of humans and other species, intervention in the expression of genes for therapeutic or other purposes has become a common goal in human and animal medicine. Various diseases are known or postulated to be caused by deleterious mutations in specific genes. Other diseases result from over-expression or other aberrant expression of particular genes. Treatment of such diseases by correcting, complementing or otherwise affecting gene expression frequently involves delivering nucleic acids into a target cell in vivo. Various approaches have been proposed for in vivo delivery.

[0004] Existing methods for delivery of nucleic acids fall into two general categories: viral vectors or non-viral vectors. One class of viral vectors that have been used for in vitro gene transfer are retroviral vectors. Retroviruses include, for example, human immunodeficiency virus (HIV). They have been shown to mediate highly efficient transgene expression in a variety of animal tissues. However, the process of vector integration into host cell chromosomes carries with it the chance of causing insertional mutagenesis. Insertional mutagenesis can be avoided by the use of gene therapy vectors that do not integrate.

[0005] Therefore, a key challenge for clinical therapies based on retroviral vectors is to achieve stable transgene expression whilst minimizing insertional mutagenesis. Retroviruses and retroviral vectors can be rendered integration-defective by mutations in the integrase codingsequence. Unfortunately, direct administration of non-integrating vectors based on human immunodeficiency virus (HIV) or feline immunodeficiency virus (FIV) has not previously resulted in significant expression in vivo. This is, in part, due to gene silencing that occurs with integration deficient vectors. This is an even larger problem with respect to vectors carrying large cargo.

[0006] The disclosure provided here provides solutions to the problems existing with previous attempts to utilize integration deficient retroviral vectors for transfer of large nucleic acid cargo and offers improved methods and compositions for the same.SUMMARY

[0007] The present disclosure relates generally to improved recombinant integration deficient retroviral vectors designed to enable efficient transfer of large cargo into cells. In particular, the present disclosure provides recombinant integration deficient retroviral vectors which do not contain exogenous promoters driving the cargo of interest, but do contain a post-transcriptional regulatory element (PRE). As shown herein, such vectors that do not contain an exogenous promoter but do contain a PRE exhibit unexpected and superior cargo expression as compared to vectors that have both an exogenous promoter and a PRE. In another aspect, the present disclosure relates to compositions and methods of using recombinant integration deficient retroviral vectors. The foregoing summary is illustrative only and is not intended to be in any way limiting. In addition to the illustrative embodiments and features described herein, further aspects, embodiments, objects and features of the disclosure will become fully apparent from the drawings and the detailed description and the claims.

[0008] In one aspect, the present disclosure provides a recombinant integration deficient retroviral vector comprising one or more virus-derived long terminal repeats (LTR), a viral packaging signal, a nucleic acid sequence encoding a cargo of interest, and a post-transcriptional response element. The integration deficient retroviral vector does not comprise an exogenous promoter.

[0009] In some embodiments, the recombinant integration deficient retroviral vector includes one or more virus-derived LTRs derived from murine leukemia virus (MLV), Bovine leukemia virus (BLV), Human T-lymphotropic virus 1 (HTLV 1), Human T-lymphotropic virus 2 (HTLV 2), Gibbon ape leukemia virus (GALV), Feline leukemia virus (FeLV), Porcine endogenous retroviruses (PERV), Feline Foamy Virus (FeFV), Bovine foamy virus (BFV), Mouse mammarytumor virus (MMTV), Jaagsiekte sheep retrovirus (JSRV), Mason-Pfizer monkey virus (MPMV), Avian sarcoma leukosis virus (ALV), Rous sarcoma virus (RSV), Human Endogenous Retrovirus-W (HERV-W), and Human endogenous retrovirus K (HERV-K).

[0010] In some embodiments, the vector is derived from murine leukemia virus (MLV), Bovine leukemia virus (BLV), Human T-lymphotropic virus 1 (HTLV 1), Human T- lymphotropic virus 2 (HTLV 2), Gibbon ape leukemia virus (GALV), Feline leukemia virus (FeLV), Porcine endogenous retroviruses (PERV), Feline Foamy Virus (FeFV), Bovine foamy virus (BFV), Mouse mammary tumor virus (MMTV), Jaagsiekte sheep retrovirus (JSRV), Mason-Pfizer monkey virus (MPMV), Avian sarcoma leukosis virus (ALV), Rous sarcoma virus (RSV), Human Endogenous Retrovirus-W (HERV-W), and Human endogenous retrovirus K (HERV-K).

[0011] In some embodiments, the vector is a simple retroviral vector.

[0012] In some embodiments, the vector is a complex retroviral vector.

[0013] In some embodiments, the one or more virus-derived LTRs are derived from MLV, GALV, FeLV, PERV, BFV, MMTV, JSRV, MPMV, ALV, or RSV.

[0014] In some embodiments, the one or more virus-derived LTRs are derived from HIV-1, FIV, EIAV, HIV-2, SIV, HERV-W, HERV-K, BLV, HTLV-1, or HTLV-2.

[0015] In some embodiments, the one or more virus-derived LTRs are self-inactivating (SIN) LTRs.

[0016] In some embodiments, the vector is derived from HIV.

[0017] In some embodiments, the vector further comprises a nucleic acid sequence encoding HIV Tat and / or Rev.

[0018] In some embodiments, the post-transcriptional response element is selected from the group consisting of Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) and Hepatitis B Virus Posttranscriptional Regulatory Element (HPRE).

[0019] In some embodiments, the cargo of interest is selected from the group consisting of gene-editing nucleases, endonuclease deficient Cas, endonuclease deficient Cas effectors, endonuclease deficient Cas enzymes, engineered DNA binding proteins, base editors, prime editors, RNA interference (RNAi), RNA targeting systems, CRISPR DNA binding proteins, CRISPR nickases, recombinases, integrases, programmable integrases, transposons, retrotransposons, DNA polymerases, reverse transcriptases, transposases, chimeric antigenreceptors (CAR), transcription factors, caspases, natural proteases, programmable proteases, reporter genes, and selection markers.

[0020] In some embodiments, the gene-editing nuclease is selected from the group consisting of zinc finger nucleases (ZFNs), Transcription Activator-Like Effector Nucleases (TALENs), and nucleases of the CRISPR / Cas system. In some embodiments, the gene-editing nuclease is Cas9.

[0021] The present disclosure also provides a cell comprising the recombinant integration deficient retroviral vector as disclosed herein.

[0022] In another aspect, the present disclosure provides a composition comprising the recombinant integration deficient retroviral vector as described herein or the cell as described herein.

[0023] The present disclosure also provides a recombinant integration deficient retroviral particle comprising a nucleic acid sequence comprising one or more virus-derived long terminal repeats (LTR), a viral packaging signal, a nucleic acid sequence encoding one or more cargos of interest, and a post-transcriptional response element. The integration deficient retroviral vector does not comprise an exogenous promoter. In some embodiments, the nucleic acid comprises the following elements in 5’ to 3’ order: a first virus-derived long terminal repeat (LTR), a viral packaging signal, a nucleic acid sequence encoding one or more cargos of interest, a post- transcriptional response element, and a second virus-derived long terminal repeat (LTR). In some embodiments, the nucleic acid sequence encodes two polypeptide cargos of interest, which coding sequences are separated by an IRES or P2A sequence.

[0024] In some embodiments, the one or more virus-derived LTRs are derived from murine leukemia virus (MLV), Bovine leukemia virus (BLV), Human T-lymphotropic virus 1 (HTLV 1), Human T-lymphotropic virus 2 (HTLV 2), Gibbon ape leukemia virus (GALV), Feline leukemia virus (FeLV), Porcine endogenous retroviruses (PERV), Feline Foamy Virus (FeFV), Bovine foamy virus (BFV), Mouse mammary tumor virus (MMTV), Jaagsiekte sheep retrovirus (JSRV), Mason-Pfizer monkey virus (MPMV), Avian sarcoma leukosis virus (ALV), Rous sarcoma virus (RSV), Human Endogenous Retrovirus-W (HERV-W), or Human endogenous retrovirus K (HERV-K).

[0025] In some embodiments, the viral particle is derived from murine leukemia virus (MLV), Bovine leukemia virus (BLV), Human T-lymphotropic virus 1 (HTLV 1), Human T-lymphotropic virus 2 (HTLV 2), Gibbon ape leukemia virus (GALV), Feline leukemia virus (FeLV), Porcine endogenous retroviruses (PERV), Feline Foamy Virus (FeFV), Bovine foamy virus (BFV), Mouse mammary tumor virus (MMTV), Jaagsiekte sheep retrovirus (JSRV), Mason-Pfizer monkey virus (MPMV), Avian sarcoma leukosis virus (ALV), Rous sarcoma virus (RSV), Human Endogenous Retrovirus-W (HERV-W), or Human endogenous retrovirus K (HERV-K).

[0026] In some embodiments, the viral particle is derived from a simple retrovirus.

[0027] In some embodiments, the viral particle is derived from a complex retrovirus.

[0028] In some embodiments, the one or more virus-derived LTRs are derived from MLV, GALV, FeLV, PERV, BFV, MMTV, JSRV, MPMV, ALV, or RSV.

[0029] In some embodiments, the one or more virus-derived LTRs are derived from HIV-1, FIV, EIAV, HIV-2, SIV, HERV-W, HERV-K, BLV, HTLV-1, or HTLV-2.

[0030] In some embodiments, the one or more virus-derived LTRs are self-inactivating (SIN) LTRs.

[0031] In some embodiments, the viral particle is derived from HIV.

[0032] In some embodiments, the nucleic acid further comprises a nucleic acid sequence encoding HIV Tat and / or Rev.

[0033] In some embodiments, the post-transcriptional response element is selected from the group consisting of Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) and Hepatitis B Virus Posttranscriptional Regulatory Element (HPRE).

[0034] In some embodiments, the cargo of interest is selected from the group consisting of gene-editing nucleases, endonuclease deficient Cas, endonuclease deficient Cas effectors, endonuclease deficient Cas enzymes, engineered DNA binding proteins, base editors, prime editors, RNA interference (RNAi), RNA targeting systems, CRISPR DNA binding proteins, CRISPR nickases, recombinases, integrases, programmable integrases, transposons, retrotransposons, DNA polymerases, reverse transcriptases, transposases, chimeric antigen receptors (CAR), transcription factors, caspases, natural proteases, programmable proteases, reporter genes, and selection markers.

[0035] In some embodiments, the gene-editing nuclease is selected from the group consisting of zinc finger nucleases (ZFNs), Transcription Activator-Like Effector Nucleases (TALENs),and nucleases of the CRISPR / Cas system. In some embodiments, the gene-editing nuclease is Cas9.

[0036] In another aspect, the present disclosure provides a system comprising a first recombinant integration deficient retroviral vector comprising one or more virus-derived long terminal repeats (LTR), a viral packaging signal, a nucleic acid sequence encoding one or more cargos of interest, and a post-transcriptional response element, wherein the integration deficient retroviral vector does not comprise an exogenous promoter. The system also includes at least one second vector comprising one or more nucleic acid sequences required for virus assembly.

[0037] In another aspect, the present disclosure provides a method of editing a gene in a cell of interest. The method comprises administering the recombinant integration deficient retroviral vector of the present disclosure to a cell of interest under conditions effective to edit a gene within said cell.

[0038] In another aspect, the present disclosure provides a recombinant integration deficient retroviral vector comprising one or more virus-derived long terminal repeats (LTR), a viral packaging signal, a nucleic acid sequence encoding one or more cargos of interest, a post- transcriptional response element, a pol Ill-based promoter, and a nucleic acid sequence encoding a guide RNA. The pol Ill-based promoter is the only exogenous promoter in the vector.BRIEF DESCRIPTION OF THE DRAWINGS

[0039] The features of the present disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings.

[0040] FIG. 1 shows the vector design of modified integration deficient retroviral vectors.

[0041] FIG. 2 shows GFP expression in Jurkat cells for each retroviral vector design.

[0042] FIG. 3 shows the vector design of modified integration deficient lentiviral vectors.

[0043] FIG. 4 shows GFP expression in Jurkat cells for each lentiviral vector design.

[0044] FIG. 5 shows the vector design of modified integration deficient retroviral vectors.

[0045] FIG. 6 shows GFP expression in HeLa cells for each retroviral vector design.DETAILED DESCRIPTION OF THE DISCLOSURE

[0046] The present disclosure relates generally to improved recombinant integration deficient retroviral vectors designed to enable efficient transfer and expression of large cargo into cells. In particular, the present disclosure provides recombinant integration deficient retroviral vectors which do not contain exogenous promoters driving the cargo of interest, but do contain a post- transcriptional regulatory element. As described herein, this results in enhanced gene expression over traditional integration deficient retroviral vectors that include exogenous promoters with or without a post-transcriptional regulatory element.

[0047] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0048] Although various features of the disclosure can be described in the context of a single embodiment, the features can also be provided separately or in any suitable combination. Conversely, although the present disclosure can be described herein in the context of separate embodiments for clarity, the present disclosure can also be implemented in a single embodiment.DEFINITIONS

[0049] Unless otherwise defined, all terms of art, notations, and other scientific terms or terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this application pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art. Many of the techniques and procedures described or referenced herein are well understood and commonly employed using conventional methodology by those skilled in the art.

[0050] The singular form “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a cell” includes one or more cells, comprising mixtures thereof. “A and / or B” is used herein to include all of the following alternatives: “A”, “B”, “A or B”, and “A and B”.

[0051] The terms “administration” and “administering”, as used herein, refer to the delivery of a retroviral vector composition or formulation by an administration route comprising, but not limited to, intranasal, transdermal, intravenous, intra-arterial, intramuscular, intranodal, intraperitoneal, subcutaneous, intramuscular, oral, intravaginal, and topical administration, orcombinations thereof. The term includes, but is not limited to, administering by a medical professional and self-administering.

[0052] The term “vector” is used in accordance with its conventional meaning in the art. For example, herein, a vector can refer to a modified retrovirus as a means of transmitting nucleic acid information from one cell to another cell.

[0053] The term “retroviral vector” refers to a vector containing structural and functional genetic elements that are primarily derived from a retrovirus.

[0054] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.

[0055] Certain ranges are presented herein with numerical values being preceded by the term “about.” The term “about” is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number. If the degree of approximation is not otherwise clear from the context, “about” means either within plus or minus 10% of the provided value, or rounded to the nearest significant figure, in all cases inclusive of the provided value. In some embodiments, the term “about” indicates the designated value ± up to 10%, up to ± 5%, or up to ± 1%.

[0056] The term “pharmaceutically acceptable excipient” as used herein refers to any suitable substance that provides a pharmaceutically acceptable carrier, additive, or diluent for administration of a compound(s) of interest to a subject. As such, “pharmaceutically acceptable excipient” can encompass substances referred to as pharmaceutically acceptable diluents, pharmaceutically acceptable additives, and pharmaceutically acceptable carriers. As used herein, the term “pharmaceutically acceptable carrier” includes, but is not limited to, saline, solvents,dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. Supplementary active compounds (e.g., antibiotics and additional therapeutic agents) can also be incorporated into the compositions.

[0057] As used herein, a “subject” or an “individual” includes animals, such as human (e.g., human individuals) and non-human animals. In some embodiments, a “subject” or “individual” is a patient under the care of a physician. Thus, the subject can be a human patient or an individual who has, is at risk of having, or is suspected of having a health condition of interest and / or one or more symptoms of the health condition. The subject can also be an individual who is diagnosed with a risk of the health condition of interest at the time of diagnosis or later. The term “non-human animals” includes all vertebrates, e.g., mammals, e.g., rodents, e.g., mice, non- human primates, and other mammals, such as e.g., sheep, dogs, cows, chickens, and nonmammals, such as amphibians, reptiles, etc.

[0058] It is understood that aspects and embodiments of the disclosure described herein include "comprising", "consisting", and "consisting essentially of aspects and embodiments. As used herein, "comprising" is synonymous with "including", "containing", or "characterized by", and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. As used herein, "consisting of excludes any elements, steps, or ingredients not specified in the claimed composition or method. As used herein, "consisting essentially of does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claimed composition or method. Any recitation herein of the term "comprising", particularly in a description of components of a composition or in a description of steps of a method, is understood to encompass those compositions and methods consisting essentially of and consisting of the recited components or steps.

[0059] All genes, gene names, and gene products disclosed herein are intended to correspond to homologs from any species for which the compositions and methods disclosed herein are applicable. Thus, the terms include, but are not limited to genes and gene products from humans and mice. It is understood that when a gene or gene product from a particular species is disclosed, this disclosure is intended to be exemplary only, and is not to be interpreted as a limitation unless the context in which it appears clearly indicates. Thus, for example, for the genes or gene products disclosed herein, which in some embodiments relate to mammaliannucleic acid and amino acid sequences, are intended to encompass homologous and / or orthologous genes and gene products from other animals including, but not limited to other mammals, fish, amphibians, reptiles, and birds. In some embodiments, the genes, nucleic acid sequences, amino acid sequences, peptides, polypeptides and proteins are human. The term “gene” is also intended to include variants thereof.

[0060] It is appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination. All combinations of the embodiments pertaining to the disclosure are specifically embraced by the present disclosure and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub-combinations of the various embodiments and elements thereof are also specifically embraced by the present disclosure and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein.Retroviruses

[0061] The term “retrovirus” refers to any known retrovirus (e.g., type c retroviruses, such as Moloney murine sarcoma virus (MoMSV), Harvey murine sarcoma virus (HaMuSV), murine mammary tumor virus (MuMTV), gibbon ape leukemia virus (GaLV), feline leukemia virus (FLV), spumavirus, Friend, Murine Stem Cell Virus (MSCV) and Rous Sarcoma Virus (RSV)). “Retroviruses” also include human T cell leukemia viruses, HTLV-1 and HTLV-2, and the lentiviral family of retroviruses, such as Human Immunodeficiency Viruses, HIV-1, HIV-2, simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), equine immunodeficiency virus (EIV), and other classes of retroviruses. Other examples include, murine leukemia virus (MLV), mouse mammary tumour virus (MMTV), Fujinami sarcoma virus (FuSV), Moloney murine leukemia virus (Mo-MLV), FBR murine osteosarcoma virus (FBR MSV), Abelson murine leukemia virus (A-MLV), Avian myelocytomatosis virus-29 (MC29), Avian erythroblastosis virus (AEV), and Foamy virus (FMV). A detailed list of retroviruses may be found in Coffin et al. (1997) “Retroviruses”, Cold Spring Harbor Laboratory Press Eds: J M Coffin, S M Hughes, H E Varmus pp 758-763.

[0062] Retroviruses may be broadly divided into two categories: namely, “simple” and “complex”. Retroviruses may even be further divided into seven groups.

[0063] Retroviruses are RNA viruses that utilize reverse transcriptase during their replication cycle. The retroviral genomic RNA is converted into double-stranded DNA by reverse transcriptase. This double-stranded DNA form of the virus is capable of being integrated into the chromosome of the infected cell; once integrated, it is referred to as a “provirus.” The provirus serves as a template for RNA polymerase II and directs the expression of RNA molecules which encode the structural proteins and enzymes needed to produce new viral particles.

[0064] At each end of the provirus are structures called “long terminal repeats” or “LTRs.” The term “long terminal repeat (LTR)” refers to domains of base pairs located at the ends of retroviral DNAs which, in their natural sequence context, are direct repeats and contain U3, R and U5 regions. LTRs generally provide functions fundamental to the expression of retroviral genes (e.g., promotion, initiation, and polyadenylation of gene transcripts) and to viral replication. The LTR contains numerous regulatory signals including transcriptional control elements, polyadenylation signals and sequences needed for replication and integration of the viral genome. The viral LTR is divided into three regions called U3, R and U5. The U3 region contains the enhancer and promoter elements. The U5 region is the sequence between the primer binding site and the R region and contains the polyadenylation sequence. The R (repeat) region is flanked by the U3 and U5 regions. The LTR composed of U3, R and U5 regions, appears at both the 5' and 3' ends of the viral genome. For the integration defective vectors of the disclosure, promoters that are naturally present in LTRs (and are maintained in its natural LTR sequence context) are not considered to be exogenous promoters.Simple Retroviral Vectors

[0065] Retroviruses can be divided into two groups: simple and complex retroviruses. Simple retroviruses are characterized by the presence of one coding region in addition to those encoding the common virion proteins encoded by gag, pro, pol, and env. Simple retroviruses do not encode additional proteins that directly and specifically affect viral RNA synthesis or processing. This simple pattern of RNA regulation is correlated with a simple pattern of mRNA splicing; most of the simple retroviruses make only one spliced mRNA (for env). There are no simple retrovirus that make multiply spliced mRNAs. Retroviruses which fall into this group of simpleretroviruses include, for example, MLV, GALV, FeLV, PERV, BFV, MMTV, JSRV, MPMV, ALV, and RSV.Complex Retroviral Vectors

[0066] Complex retroviruses, however, have multiple splice donors in the genome which gives rise to complex patterns of mRNA and a greater variety of gene products (up to six in addition to the gag, pro, pol, and env proteins in HIV and SIV), at least one of which has a virusspecific Zra / / .s-activating function. Retroviruses which fall into this group of complex retroviruses include, for example, HIV-1, FIV, EIAV, HIV-2, SIV, HERV-W, HERV-K, BLV, HTLV-1, HTLV-2.Integration Deficient Retroviral Vectors

[0067] Integration deficient / defective retroviral vectors (IDRVs) can be produced, for example, by introducing one or more mutations that disable the integrase protein itself or to alter the integrase recognition sequences (att) in the viral LTR (see e.g., Yanez-Munoz et al. (2006) Nat Med 12(3):348-353; Nightingale et al. (2006) Mol Ther 13(6): 1121-1 132). Without being bound by any particular theory, IDRVs can mediate stable transduction in non-dividing cells and allow for measurable levels of transgene expression (see e.g., Yanez-Munoz et al. (2006) Nat Med 12(3):348-353; Nightingale et al. (2006) Mol Ther 13(6): 1121-1132); Suwanmannee et al. (2014) Mol Ther 22(3):567-74). Therefore, the high efficiency of gene transfer mediated by retroviruses can be harnessed (e.g., in vivo) without a requirement for vector integration. This can reduce the likelihood of insertional mutagenesis associated with integrating vectors.COMPOSITIONS OF THE DISCLOSURE

[0068] As described in greater detail below, one aspect of the present disclosure relates to a recombinant integration deficient retroviral vector that includes one or more virus-derived long terminal repeats (LTR), a viral packaging signal, a nucleic acid sequence encoding one or more cargos of interest, and a post-transcriptional regulatory element. In some embodiments, the integration deficient retroviral vector does not comprise an exogenous promoter. In some embodiments, the integration deficient retroviral vector does not comprise a promoter between the end of the 5’ LTR and the beginning of the cargo or gene of interest to be expressed. In some embodiments, the integration deficient retroviral vector does not comprise an exogenouspromoter between the end of the 5’ LTR and the beginning of the cargo or gene of interest to be expressed. Also provided are cells comprising the recombinant integration deficient retroviral vector, recombinant integration deficient retroviral particles, and compositions thereof.Nucleic acid constructs

[0069] As described in greater detail below, one aspect of the present disclosure relates to recombinant integration deficient retroviral vector that includes one or more virus-derived long terminal repeats (LTR), a viral packaging signal, a nucleic acid sequence encoding one or more cargos of interest, and a post-transcriptional regulatory element. In some embodiments, the integration deficient retroviral vector does not comprise an exogenous promoter. For example, although the 5’ LTRs in vectors # 3 of Figure 1 and Figure 3 can have an endogenous promoter (such as a naturally occurring promoter of the LTR), these vectors do not comprise an exogenous promoter.

[0070] The terms "nucleic acid molecule" and "polynucleotide" are used interchangeably herein, and refer to both RNA and DNA molecules, including nucleic acid molecules comprising cDNA, genomic DNA, synthetic DNA, and DNA or RNA molecules containing nucleic acid analogs. A nucleic acid molecule can be double-stranded or single-stranded (e.g., a sense strand or an antisense strand). A nucleic acid molecule may contain unconventional or modified nucleotides. The terms “polynucleotide sequence” and “nucleic acid sequence” as used herein interchangeably refer to the sequence of a polynucleotide molecule. The nomenclature for nucleotide bases as set forth in 37 CFR §1.822 is used herein.

[0071] Nucleic acid molecules of the present disclosure can be of any length, including for example, between about 1.5 Kb and about 20 Kb, between about 2 Kb and about 15 Kb, between about 5 Kb and about 10 Kb, between about 7 Kb and about 9 Kb, or between about 8 Kb and about 9 Kb.

[0072] The retroviral vector can be based on any suitable retrovirus which is able to deliver genetic information to eukaryotic cells. For example, the retroviral vector may be an alpharetroviral vector, a gammaretroviral vector, a lentiviral vector or a spumaretroviral vector. In some embodiments, the retroviral vector is derived from a simple retrovirus. Simple retroviruses are described in more detail above and include, without limitation, MLV, GALV, FeLV, PERV, BFV, MMTV, JSRV, MPMV, ALV, and RSV. In some embodiments, the retroviral vector of the present disclosure is derived from MLV.

[0073] In some embodiments, the retroviral vector is derived from a complex retrovirus. Complex retroviruses are described in more detail above and include, without limitation, HIV-1, FIV, EIAV, HIV-2, SIV, HERV-W, HERV-K, BLV, HTLV-1, HTLV-2. In some embodiments, the retroviral vector of the present disclosure is derived from Bovine leukemia virus (BLV), Human T-lymphotropic virus 1 (HTLV 1), Human T-lymphotropic virus 2 (HTLV 2), Gibbon ape leukemia virus (GALV), Feline leukemia virus (FeLV), Porcine endogenous retroviruses (PERV), Feline Foamy Virus (FeFV), Bovine foamy virus (BFV), Mouse mammary tumor virus (MMTV), Jaagsiekte sheep retrovirus (JSRV), Mason-Pfizer monkey virus (MPMV), Avian sarcoma leukosis virus (ALV), Rous sarcoma virus (RSV), Human Endogenous Retrovirus-W (HERV-W), or Human endogenous retrovirus K (HERV-K). In some embodiments, the retroviral vector of the present disclosure is derived from HIV.

[0074] A nucleic acid may be made by any technique known to one of ordinary skill in the art. Non-limiting examples of synthetic nucleic acid, particularly a synthetic oligonucleotide, include a nucleic acid made by in vitro chemical synthesis using phosphotriester, phosphite or phosphorami dite chemistry and solid phase techniques such as described in EP 266,032, incorporated herein by reference, or via deoxynucleoside H-phosphonate intermediates as described by Froehler et al., 1986, and U.S. Pat. No. 5,705,629, each incorporated herein by reference. A non-limiting example of enzymatically produced nucleic acid include one produced by enzymes in amplification reactions such as PCR™ (see for example, U.S. Pat. No. 4,683,202 and U.S. Pat. No. 4,682,195, each incorporated herein by reference), or the synthesis of oligonucleotides described in U.S. Pat. No. 5,645,897, incorporated herein by reference. A nonlimiting example of a biologically produced nucleic acid includes recombinant nucleic acid production in living cells (see for example, Sambrook et al. 1989, incorporated herein by reference).

[0075] A nucleic acid may be purified on polyacrylamide gels, cesium chloride centrifugation gradients, or by any other means known to one of ordinary skill in the art (see for example, Sambrook et al. 1989, incorporated herein by reference).

[0076] The nucleic acid(s) of the present disclosure, regardless of the length of the sequence itself, may be combined with other nucleic acid sequences, including but not limited to, enhancers, polyadenylation signals, restriction enzyme sites, multiple cloning sites, coding segments, and the like, to create one or more nucleic acid construct(s). The overall length mayvary considerably between nucleic acid constructs. Thus, a nucleic acid segment of almost any length may be employed, with the total length preferably being limited by the ease of preparation or use in the intended recombinant nucleic acid protocol.

[0077] Vectors of the present disclosure are retroviral based as described above and in other parts of the specification. The nucleic acid molecules of the disclosure encode cargos of interest.

[0078] The term “expression vector” refers to any type of genetic construct comprising a nucleic acid coding for an RNA capable of being transcribed. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of guide RNAs, antisense molecules or ribozymes. Expression vectors can contain a variety of “control sequences,” which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host cell. In addition to control sequences that govern transcription and translation, expression vectors may contain nucleic acid sequences that serve other functions as well and are described below.Long Terminal Repeats

[0079] As described herein, the retroviral vectors include one or more LTRs. An LTR can be, for example, a sequence of about 100 to 1400 base pairs, which is repeatedly present at both ends of a provirus DNA of a retrovirus, a retrotransposon or the like. Functional LTR sequences less than 100 or greater than 1400 may also be used. The LTR is composed of U3, R, and U5 regions which are involved in transcription of a viral gene, reverse transcription from a viral genome, and integration of a double-stranded DNA synthesized via the reverse transcription into a host DNA. IR sequences (inverted repeat regions) located at the 5' and 3' ends of the provirus are 4 to 20 base pairs in length. The U3 region contains an enhancer sequence and a promoter sequence for transcription. Herein, promoters that naturally occur in LTRs are not considered to be “exogenous” promoters in the vector constructs of the disclosure that comprise one or more LTRs but no exogenous promoters.

[0080] The one or more LTR sequences used in the present disclosure can include any sequence as long as they are derived from retrovirus and capable of producing a retrovirus that contains an RNA having these sequences as a genome. These sequences may be derived from the same virus, or may be derived from different viruses to the extent that virus particles can be formed. Exemplary LTR sequences that can be used in the compositions herein include, withoutlimitation, LTR sequences derived from Bovine leukemia virus (BLV), Human T-lymphotropic virus 1 (HTLV 1), Human T-lymphotropic virus 2 (HTLV 2), Gibbon ape leukemia virus (GALV), Feline leukemia virus (FeLV), Porcine endogenous retroviruses (PERV), Feline Foamy Virus (FeFV), Bovine foamy virus (BFV), Mouse mammary tumor virus (MMTV), Jaagsiekte sheep retrovirus (JSRV), Mason-Pfizer monkey virus (MPMV), Avian sarcoma leukosis virus (ALV), Rous sarcoma virus (RSV), Human Endogenous Retrovirus-W (HERV-W), and Human endogenous retrovirus K (HERV-K). In some embodiments, the one or more LTRs are derived from MLV. In some embodiments, the one or more LTRs are derived from HIV.

[0081] In some embodiments, LTR sequences comprising a mutation(s) can also be used. A retroviral vector thus obtained in which the U3 region of the 3' LTR sequence is mutated is called a self-inactivating (SIN) vector. The term “self-inactivating vector” refers to vectors in which the right (3') LTR enhancer-promoter region, known as the U3 region, has been modified (e.g., by deletion or substitution) to prevent viral transcription beyond the first round of viral replication. Consequently, the vectors are capable of infecting and then integrating into the host genome only once, and cannot be passed further. This is because the right (3') LTR U3 region is used as a template for the left (5') LTR U3 region during viral replication and, thus, the viral transcript cannot be made without the U3 enhancer-promoter. If the viral transcript is not made, it cannot be processed or packaged into virions, hence the life cycle of the virus ends.Accordingly, SIN vectors greatly reduce risk of creating unwanted replication-competent virus since the right (3') LTR U3 region has been modified to prevent viral transcription beyond the first round of replication, hence eliminating the ability of the virus to be passed.

[0082] In some embodiments, only a portion of one or more LTRs is used. For example, a portion of an LTR sequence can include at least about 20%, for example, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95% of the full length LTR sequence. In some embodiments, the portion of the LTR that is used comprises a naturally occurring promoter of the LTR. Naturally occurring promoters of LTRs are known to the person of ordinary skill in the art. For example, the HIV-1 LTR core promoter consists of a series of three tandem Spl binding sites, a non-canonical TATA box element, and an initiator element.

[0083] Exemplary LTR sequences are shown below.Human Immunodeficiency Virus 1 (HIV-1) LTRTGGAAGGGCTAATTTGGTCCCAAAAAAGACAAGAGATCCTTGATCTGTGGATCTACCACACACAAGGCTACTTCCCTGATTGGCAGAACTACACACCAGGGCCAGGGATCAGATATCCACTGACCTTTGGATGGTGCTTCAAGTTAGTACCAGTTGAACCAGAGCAAGTAGAAGAGGCCAAATAAGGAGAGAAGAACAGCTTGTTACACCCTATGAGCCAGCATGGGATGGAGGACCCGGAGGGAGAAGTATTAGTGTGGAAGTTTGACAGCCTCCTAGCATTTCGTCACATGGCCCGAGAGCTGCATCCGGAGTACTACAAAGACTGCTGACATCGAGCTTTCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGTGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATGCTACATATAAGCAGCTGCTTTTTGCCTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTCAAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCA (SEQ IDNO: 1)Moloney Murine Leukemia Virus (MLV) LTRAATGAAAGACCCCACCTGTAGGTTTGGCAAGCTAGCTTAAGTAACGCCATTTTGCAAGGCATGGAAAAATACATAACTGAGAATAGAGAAGTTCAGATCAAGGTCAGGAACAGATGGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGTCCCCAGATGCGGTCCAGCCCTCAGCAGTTTCTAGAGAACCATCAGATGTTTCCAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGTTCGCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCACAACCCCTCACTCGGCGCGCCAGTCCTCCGATTGACTGAGTCGCCCGGGTACCCGTGTATCCAATAAACCCTCTTGCAGTTGCATCCGACTTGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTACCCGTCAGCGGGGGTCTTTCA(SEQ ID NO: 2)Bovine leukemia virus (BLV) LTRTGTATGAAAGATCATGCCGACCTAGGAGCCGCCACCGCCCCGTAAACCAGACAGAGACGTCAGCTGCCAGAAAAGCTGGTGACGGCAGCTGGTGGCTAGAATCCCCGTACCTCCCCAACTTCCCCTTTCCCGAAAAATCCACACCCTGAGCTGCTGACCTCACCTGCTGATAAATTAATAAAATGCCGGCCCTGTCGAGTTAGCGGCACCAGAAGCGTTCTTCTCCTGAGACCCTCGTGCTCAGCTCTCGGTCCCGAGCTCTCTTGCTCCCGAGACCTTCTGGTCGGCTATCCGGCAGCGGTCAGGTAAGGCAAGCCACGGTTTGGAGGGTGGTTCTCGGCTGAGACCACCGCGAGCTCTATCTCCGGTCCTCTGACCGTCTCCACGTGGACTCTCTCCTTTGCCTCCTGACCCCGCGCTCCAAGGGCGTCTGGCTTGCACCCGCGTTTGTTTCCTGTCTTACTTTCTGTTTCTCGCGGCCCGCGCTCTCTCCTTCGGCGCCCTCTAGCGGCCAGGAGAGACCGGCAAACA (SEQ ID NO: 3)Human T-lymphotropic virus 1 (HTLV-1) LTRTGACAATGACCATGAGCCCCAAATATCCCCCGGGGGCTTAGAGCCTCCCAGTGAAAAACATTTCCGAGAAACAGAAGTCTGAAAAGGTCAGGGCCCAGACTAAGGCTCTGACGTCTCCCCCCGGAGGGACAGCTCAGCACCGGCTCAGGCTAGGCCCTGACGTGTCCCCCTGAAGACAAATCATAAGCTCAGACCTCCGGGAAGCCACCGGAACCACCCATTTCCTCCCCATGTTTGTCAAGCCGCCCTCAGGCGTTGACGACAACCCCTCACCTCAAAAAACTTTTCATGGCACGCATATGGCTGAATAAACTAACAGGAGTCTATAAAAGCGTGGAGACAGTTCAGGAGGGGGCTCGCATCTCTCCTTCACGCGCCCGCCGCCCTACCTGAGGCCGCCATCCACGCCGGTTGAGTCGCGTTCTGCCGCCTCCCGCCTGTGGTGCCTCCTGAACTGCGTCCGCCGTCTAGGTAAGTTTAGAGCTCAGGTTGAGACCGGGCCTTTGTCCGGCGCTCCCTTGGAGCCTACCTAGACTCAGCCTGCTCTCCACGCTTTGCCTGACCCTGCTTGCTCAACTCTGCGTCTTTGTTTCGTTTTCTGTTCTGCGTCGCTACAGATCGAAAGTTCCACCCCTTTCCCTTTCATTCACGACTGACTGCCGGCTTGGCCCACGGCCAAGTACCGGCGACTCCGTTGGCTCGGAGCCAGCGACAGCCCATTCTATAGCACTCTCCAGGAGAGAAACTTAGTACACA (SEQ ID NO: 4)Human T-lymphotropic virus 2 (HTLV-2) LTRTGACAATGGCGACTAGCCTCCCGAGCCAGCCACCCAGGGCGAGTCATCGACCCAAAAGGTCAGACCGTCTCACACAAACAATCCCAAGTAAAGGCTCTGACGTCTCCCCCTTTTTTTAGGAACTGAAACCACGGCCCTGACGTCCCTCCCCCCCAGGAACCAGGAACAGCTCTCCAGAAAAATAGACCTCACCCTTACCCACTTCCCCTAGCGCTGAAAAACAAGGCTCTGACGATTACCCCCTGCCCATAAAATTTGCCTAGTCAAAATAAAAGATGCCGAGTCTATAAAAGCGCAAGGACAGTTCAGGAGGTGTCTCGCTCCCTCACCGACCCTCTGGTCACGGAGACTCACCTTGGGGATCCATCCTCTCCAAGCGGCCTCGGTTGAGACGCCTTCCGTGGGACCGTCTCCCGGCCTCGGCACCTCCTGAACTGCTCCTCCCAGGGTAAGTCTCCTCTCAGGTCGAGCTCGGCTGCCCCTTAGGTAGTCGCTCCCCGAGGGTCTTTAGAGACACCCGGGTTTCCGCCTGCGCTCGGCTAGACTCTGCCTTAAACTTCACTTCCGCGTTCTTGTCTCGTTCTTTCCTCTTCGCCGTCACTGAAAACGAAACCTCAACGCCGCCCTCCTGACAGGCTTGGCCCGGGGCCAACATACTGCCGTGGAGGCGCAGCAAGGGCTAGGGCTTCCTGAACCTCTCCGGGAGAGGTCTATTGCTATAGGCAGGCCCGCCCCAGGAGCATTTGTCTTCCCGGGGAAGACAAACA (SEQ ID NO: 5)Gibbon ape leukemia virus (GALV) LTRTGAAAGAAGTGTTTTTTTTTAGCCAACTGCAGTAACGCCATTTTGCTAGGCACACCTAAAGGATAGGAAAAATACAGCTAAGAACAGGGCCAAACAGGATATCTGTGGTCATGCACCTGGGCCCCGGCCCCAGGCCAAGGACAGAGGGTTCCCAGAAATAGATGAGTCAACAGCAGTTTCCAGGGTGCCCCTCAACCGTTTCAAGGACTCCCATGACCGGGAATTCACCCCTGGCCTTATTTGAACTAACCAATTACCTTGCCTCTCGCTTCTGTACCCGCGCTTTTTGCTATAAAATAAGCTCAGAAACTCCACCCGGCGCGCCAGTCCTTAGAGAGACTGAGCCGCCCGGGTACCCGTGTGTCCAATAAAACCTCTTGCTGATTGCATCCGGAGCCGTGGTCTCGTTGTTCCTTGGGAGGGTTTCTCCTAACTATTGACCGCCCACTTCGGGGGTCTCACA (SEQ ID NO: 6)Feline leukemia virus (FeLV) LTRTGAAAGACCCCCTACCCCAAAATTTAGCCAGCTATTGCAGTAATGCCATTTCACAAGGCATGGAAAATTACCCAAGCATGTTCCCATGAGATATAAGGAAGTCAGAGGCTAAAACAGGATATCTGTGGTTAAGCACCTGGGCCCCGGCTTGAGGCCAAGAACAGTTAAGCCTCGGATATAGCTGAAACAGCAGAAGTTTCAAGGCCACTGCCAGCAGTCTCCAGGCTCCCCAGTTGACCAGAGTCCGACCTTCCGCCTCATTTAAACTAACCAATCCCTACGCCTCTCGCTTCTGTGCGCGCGCTTTCTGCTATAAAACGAGCCATCAGCCCCCAACCGGCGCGCAAGTCTTTGCTGAGACTTGACCGCCCCGGGTACCCGTGTACGAATAAACCTCTTGCTGTTTGCATCTGACTCGTGGTCTCGGTGTTCTGTGGGCACGGGGTCTCATCGCCGAGGAAGACCTAGTTTGGGGGTCTTTCAT (SEQ ID NO: 7)Porcine endogenous retroviruses (PERV) LTRTGAAATGGAGTTTTAACTAAAGAACAACCCCCCCCCCCCTTGGCTAAGAAGGCAGCTGCAAGCCTTTCCAACTGTGCTAATCACTATGCCACCCTTCTTGTAATAACATAACAACTGTGTGCTCTCTGTCCAAGCCAGCAGCCCTGCTAATTAGGTACCCAGCATTGCTTATCAGTTCTGCTTCTGTAACCTTGCTTGCTCAATTTCTTAGGGAGGAACACTGTCTGCTTGGGGATGGGGGAGGTCCAGGATGCTTACATGGGAAAATCAAGACCTTGTAGTGTATAAAAGTTACTGAGAACAAAGACCTGGTGCTCAGACTCTGGAGGTGACTCCTCTGAGCCCACACCAGTGCTGAATAAACCTTGCTTTTCCATATCTCTGAGTGCTGTTTGTCTCCTTCTGTTGCCACAGTTTTTGTGGTTTCTGCAACA (SEQ ID NO: 8)Feline Foamy Virus (FeFV) LTRTGTCATGGGCCAAAGAGAATTCTCACAGAGGAGAATACTCTCTGCTGCCATCTAGTGACGATGAGGAAGAAGAAATGTCAGAAAGAGAGGAATTATTGTGCCATATAAATCAGTGTCAACAAAAGCTCTTTTATCCCGGAGGGACGACTGATGTCCTTGGAATGGAAAGCAATGTTTGGCTCACTAAATTTGTTAATATTAAATTTCCTAAAGGAACAAAAGTGATACTTCCTGATGGAAGAAAATTCATAGCCTGTGATCCTGAGCTAAAACCATTATTGCAGGAATTGAAATTCTTGGATAGGGCAACATCTGAGTCATCTGACTCTGAATAGAAAGCCTGAATTTACCTGGATTATGCAACTTTGTCCGAGGTGGCAGAGTGGTTATGTATCTGTCATACTCGGGGAAAGTTTTGTCTTTACATGTTCAAGACATATAAAGGGTGGAAAAATATATTCCTGACTAAACTTCCTGGGGACTAGAGGTGTGGAAACTTTGCTGCCTCTGCTTCACGGGAAGTTTTTGGTTCGAATCCTTTTTTAGGTACTTAGTTAAGATAAGTAGTGAATAAATTACTCTCGTTCATGTATTCATATCGAAACTATGTATCCTTTAAAACCATGTATTCTTTAGTCATCTAGATACTTAGAGTATGAAAAAAGAAACTGCAATAGTAACTATCAATGTTAGTAAATAAAGTACAGCTTAGTCATCTGATGATGTCACGAGAAAAGAACCTAGAAGAGAAGAACAACTTTCGGCATGCAACAGAGCGGGAGCTTGGTGTAGGAGCTAAGTCACCGTCTTACATCTAGAGCCTACTCTTCTTGAACTGTTCGAATCCTATTTTTGGAACTCTTACATCACCTTTAAGAGACTGAAAAGCATGACTCGTGCACAGGAAGCTCCTTTAGGGTAGAGGAAATGTTCTAATCTCCTATCTTAAAGGGTTGCTTCATTTAAGGTTCGAAACTGTGTACTGGAAGTAGATTTTGCATAACTTTAAACTTTTAGTTGCATGTTTCTGCTATTAGCAGCATATAAAAGGGTTATGGTAGATTGTACGGGAGCTCTTCTCACAGACTTGGCTGCGTCCAGGGTGAGATTGAGACTCTCCAGCTTGGGTAAGATTTTGATATGTATTTTGCTTGAATATTATTTGCCTTGCTCAAAATTAAATAAATTGGCTTTTCTTTCACTCAATTGAAGCTTCATATAATTATATTATTGTCTGAAGCCAGAACTCACATGAGTGGTGTTTCTCTATTCTTGGGGAAAAGTGTTCTTCTATTTGAAAGTGTTAGAGCTACTAAGTGAAGAACTAATCTATCCCAGGTATAGGCCACGACA (SEQ ID NO: 9)Bovine foamy virus (BFV) LTRTGTGGTGGGAAGACCACCCGGAAATAAGCAAGGGCCAGCCCCCCTTTACTTGCCCGGAGGATTGGCTGGAGTGTGAGGAAGATAGTGAGAATGAGGAACTCAGTGTTTCTCCCCTCACAGGCTGGGAGCCTCATAGAGACTTAAAAAAGTGGGTAAATTTCGCCCTACCTTATGGATGGAGCCTTATGGACCCGCTAGGTAATCGTTTCAGGTCCCAGAGGAAAGATGATTCCGATGAATCCACTAGTACGGATTCTGAAGAGGAGTTACAAGAAATACAGCAGATCAACCCCGCTGAAGTAGGGCCAAGCAGGCCTCCCGGCGGGTACTCTAAGCTGCGCAGGCGCCGTCGGGTTCCAGCTGCTCGACTTTACGCAACTACAGACAGTAGTGAAGAAGACCTGGATCTGAAGACATCTCAATAAGGAGCTGGACTGTTTGAGATCTGTGTGTGATTACATTGTATTAAGATAGCCTGTTACTGGGGTTCGGAGGATGGCTCATCAAGCTAGTAAGGAGCTCCCTGAAGCCATATCCGAGGCTCAGTAGAAAGACAGTACCTCGCCTGTGTGGGTTCGAGGTCAGGCGGTATGCTTTCTACTTTTTAGATGTATAACTAGAAGAATAAGGTTAAGGAGATGCTTTTTAAATAGATAGCTTAGGGAGTAAGTTAGATAGCTTAAAGAACAAGTTAACTGCAAGTATCGCTTATGCTCAGAATCAGGAAGTAGCTTGCGTCACCAGTTATAGAGAAATAAGAGCTTGAAAGTTAACCGCAACATAGGATGTGAGTCATAGCTATTTTAGTAAGTTAGCGCTTGGGAACTGAGAGAACAAGGTTCGGATCCCATATCATTATAATAAAATATATCTTGTATAAGTAGTTAGCTTACTGTAAAAGGGGGGAATTATTGGGAATCCCATATTGTAGGAAAAGTCAGTTGGATAAGGATATAAAACCCTTAGACTGTAAGGAAGGAGGAGCTCTTGAATCGGCTGCGCCCGTGAGAGATCTGACTTCCAGGCTGTGGTAAGACCTAATTTGGACTTGACTCTCTTAACTCGCTCTGCTTAGAACAAGCTTGTTTTTAATATTATGAGATTATAATGCCTGTAATGTTAATCAATAAATGGTGAAGGAAACTCGAGAATCTCCATCTCTATTATTGTTATCCCTATACTCCGAGTGAGTGGGAACCTGTCTCCAACCTGGGCTTACCTTCCAGATCACTAATAAGGGTGGTATCTACTGGAACCTTATAGAGTTATCTGGAATCCACTAAAGATTGGAGAAGGTCACAACAA (SEQ IDNO: 10)Mouse mammary tumor virus (MMTV) LTRTGCCGCGCCTGCAGCAGAAATGGTTGAACTCCCGAGAGTGTCCTACACTTAGGAGAGAAGCAGCCAAGGGGTTGTTTCCCACCAAGGACGACCCGTCTGCGTGCACGCGGATGAGCCCATCAGACAAAGACATACTCATTCTCTGCTGCAAACTTGGCATAGCTCTGCTTTGCCTGGGGCTATTGGGGGAAGTTGCGGTTCGTGCTCGCAGGGCTCTCACCCTTGATTCTTTTAATAACTCTTCCGTGCAAGATTACAATCTAAACGATTCGGAGAACTCGACCTTCCTCCTGGGGCAAGGACCACAGCCAACTTCCTCTTACAAGCCACACCGACTTTGTCCTTCAGAAATAGAAATAAGAATGCTTGCTAAAAATTATATTTTTACCAATGAGACCAATCCAATAGGTCGATTATTAATCATGATGTTAAGAAATGAATCTTTGTCTTTTAGCACTATATTTACTCAAATTCAAAGGTTAGAAATGGGAATAGAAAATAGAAAGAGACGCTCAACCTCAGTTGAAGAACAGGTGCAAGGACTAAGGGCCTCAGGCCTAGAAGTAAAAAGGGGAAAGAGGAGTGCGCTTGTCAAAATAGGAGACAGGTGGTGGCAACCAGGGACTTATAGGGGACCTTACATCTACAGACCAACAGACGCCCCGCTACCATATACAGGAAGATATGATTTAAATTTTGATAGGTGGGTCACAGTCAACGGCTATAAAGTGTTATACAGATCCCTCCCCTTTCGTGAAAGGCTCGCCAGAGCTAGACCTCCTTGGTGTGTGTTGTCTCAAGAAGAAAAAGACGACATGAAACAACAGGTACATGATTATATTTATCTGGGGACAGGAATGATACATTGGAAAGTATTTTATAACAGTAGAGAGGAGGCCAAAAGACATATAATAGAACATATTAAGGCATTGCCCTTAGCTTTCTAAAGTTTGCTTGCGGCTCCCAAGGTTTAAGTAAGTTCATGGTCACAAACTGTTCTTAAAACAAGGATGTGAGACAAGTGGTTTCCTGACTTGGTTTGGTATCAAATGTTTTGATCTAAGCTCTGAATGTTCTATTCTCCTATGTTCTTTTGGAACTTATCCAAGTCTTATGTAAATGCTTATGTAAACCATGATATAAAAGAGTGCTGATTTTTTGAGTAAACTTGCAACAGTCCTAACATACACGTCTCGTGTGTTTGTGTCTGTTCGCCATCCCGTCTCCGCTCGTCACTTATCCTTCACTTTCCAGAGGGTCCCCCCGCAGACCCCGGTGACCCTCAGGTCGGCCGACTGCGGCA (SEQ ID NO: 11)Jaagsiekte sheep retrovirus (JSRV) LTRTGGGAGCTCTTTGGCAAAAGCCAAAGCCTAGGACAAGTACCTAAGCTCCCTGTCCCGCCACCCTCAAGAATTTTTAAAAGCTCTTAAGGCTCGGATGTTTGCTTTTGGCACTGCTTCACAGAAATATCAGGAAATCTGATTATATAAGAATCCGGTGATTGTGTAAGAATCCGGTGGGTGTAAGTGAATAATGAATAAACAAGTTATGTTGTGTACTTTATAAATATAGCATTGTAATAAAGCAGAGTATCAGCCATTTTGGTCTGATCCTCTCAACCCCATCTTTTGTCTCTCTCTTATTTTCTTAGCGAAGACGCTCCGTTCTCTCCCTGTGCAGGTGCGACTCTTGCTTGTGCTGGCCGCGGCAGG(SEQ ID NO: 12)Mason-Pfizer monkey virus (MPMV) LTRTGTCCGGAGCCGTGCTGCCCGGATGATGTCTTGGCCTCTGTTTGCTCTAGCTCCATGTTATGAATTTAAGATGGCGTATTTCCTGGTTCTTCTCCGTCTTACTTTCCCGCCGGCGCGAATGTTTCCCGCTCTTGGGCTTACGTGGCTTTCCTTGCTCTGCTACTGAGCATGCGC CCAGTATCTTTCCCCTCCCACTTGCTGCCTGTGTATATAAGGCAACACATTGCCACCA TTAAATGAGACTTGATCAGAACACTGTCTTGTCTCCATTTCTTGTGTCTCTTGTTCCC TTCAATTCCCACTCCCTCCTCCAGGTTCCTACTGTTGATCCCGCGGGTCGGGACAGT (SEQ IDNO: 13)Avian sarcoma leukosis virus (ALV) LTRTGTAGTCTTATGCAATACTCTTGTAGTCTTGCAACATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGG TACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGACGAAC CACTGAATTCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACAATAAACGCCATTTGACCAT (SEQ ID NO: 14)Rous sarcoma virus (RSV) LTRTGTAGTCTTATGCAATACTCCTGTAGTCTTGCAACATGCTTATGTAACGATGAGTTAGCAATATGCCTTACAAGGAAAGAAAAGGCACCGTGCATGCCGATTGGTGGTAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGTATCAGACGGGTCTAACATGGATTGGACGAACCACTGAATTCCGCATCGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACAAT AAACGCCATTTTACCATTCACCACATTGGTGTGCACCTGGGTTGATGGCCGGACCGT CGATTCCCTAACGATTGCGAACACCTGAATGAAGCAGAAGGCTTCATT (SEQ ID NO:15)Human Endogenous Retrovirus-W (HERV-W) LTRTGTTGAGATGGGGGACTGAGAGACAGGACTAGTTGGATTTCCTAGGCCGACTAAGAATCCCTAAGCCTAGCTGGGAAGGTGACTGCATCTACCTTTAAACACGGGGCTTGCAACTTAGCTCACACCCGACCAATCAGTAAAGAGAGCTCACTAAAAATCTAATTAGGCA AAAACAGGAGGTAAAGAAATAGCCAATCATCTAATGCCTGAGAGCACAGTGGGAG GGACGATGATTGGGATATAAACCCAGGCATTCGAGCCGGCAACAGCAACCCTCTTT GGGTCCCCTCCCTTTGTATGGGATCTCTGTTTTCACTCTATTTCACTCTTTTGCAACTG CACTCTT (SEQ ID NO: 16)Human endogenous retrovirus K (HERV-K) LTR TGTGGGGAAAAGCAAGAGAGATCAGATTGTTACTATGTCTGTGTAGAAAGAAGTAG ACATAGGAGACTCCATTTTGTTCTGTACTAAGAAAAATTCTTCTGCCTTGAGGTTCTG TTAAACTATGACCTTACCCCCAACCCCGTGCTCTCTGAAATATGTGCTGTGTCAAACT CAGGGTTAAATGGACTAAGTGTTGTGCAAGATGTGCTTTTTAAACAGATGCTTGAAG GCAGCATGCTCCTTAAGAGTCATCACCACTCCCTAATCTCAAGTACTCAGGGACACA AAAACTGCGGAAGGCCGCAGGGACCTCTGCCTAGGAAAGCCAGGTATTGTCCAAGG TTTCTCCCCATGGGATAGTTTGAAATATGGCCTCGTGGGAAGGGAAAGACCTGATTG TCCCCCAGCCTGACACCTGTAAATGGTCTGTGCTGAGGAGGATTAGTATAAGAGGA AGGCATGCCTCTTGCAGTTGAGACAAGAGGAAGGCATCTGTCTCCTGCCCGTCCATG GGCAATGGAATGTCTCGGTATAAAACCCGATTGTACGTTCCATCTACTGAGATAGGG AAAAACCGCCTTAGGGCTGGAGGTGGGACATGCGGGCAGCAATACTGCTTTGTAAA GCATTGAGATGTTTATGTGTATGCATATCTAAAAGCACAGCACTTGATTCTTTACCTT GTCTATGATGCAAAGACCTTTGTTCACGTGTTTGTCTGCTGACCCTCTCCCCACTATT GTCTTATGACCCTGACACATCACCCTCTCGGAGAAACACCCACAAATGATCAATAAA TACTAAGGGAACTCAGAGGCTGGCGGGATCCTCCATATGCTGAACGCTGGTTCCCTG GGTCCCCTTATTTCTTTCTCTATACTTTGTCTCTGTGTCTTTTTATTTTCCAAGTCTCTC GTTCCACCTAATGAGAAACACCCACAGGTGTGGAGGGGCAACCCACCCCTTCA (SEQ ID NO: 17)

[0084] In some embodiments, the one or more LTRs or virus-derived LTRs comprises a nucleotide sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a sequence set forth in any one of SEQ ID NOs: 1-17.

[0085] In some embodiments, the nucleic acid constructs of the disclosure include one or more LTR sequences having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence of SEQ ID NO: 1 or SEQ ID NO: 2.Packaging Signals

[0086] As described herein, the integration deficient retroviral vectors of the present disclosure include a viral packaging signal. As used herein, the term “viral packaging signal”, "packagingsignal" or "packaging sequence" refers to a sequence that can be a sequence located within the retroviral genome required for insertion of viral RNA into a viral capsid or particle.

[0087] In some embodiments, the packaging signal is a minimal packaging signal.

[0088] In some embodiments, the packaging signal is a psi [T] sequence.

[0089] Exemplary packaging signals include, without limitation, packaging signals derived from HIV-1, MLV, BLV, HTLV 1, HTLV 2, FeLV, PERV, MMTV, MPMV, ALV, and RSV. Exemplary sequences of viral packaging signals are shown below.Human Immunodeficiency virus 1 (HIV-1) packaging sequence CTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCG GCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATG GGTGCGAGAGCGTC (SEQ ID NO: 18)Moloney murine leukemia virus (MLV) packaging sequenceAAGCTGGCCAGCAACTTATCTGTGTCTGTCCGATTGTCTAGTGTCTATGACTGATTTT ATGCGCCTGCGTCGGTACTAGTTAGCTAACTAGCTCTGTATCTGGCGGACCCGTGGT GGAACTGACGAGTTCGGAACACCCGGCCGCAACCCTGGGAGACGTCCCAGGGACTT CGGGGGCCGTTTTTGTGGCCCGACCTGAGTCCAAAAATCCCGATCGTTTTGGACTCT TTGGTGCACCCCCCTTAGAGGAGGGATATGTGGTTCTGGTAGGAGACGAGAACCTA AAACAGTTCCCGCCTCCGTCTGAATTTTTGCTTTCGGTTTGGGACCGAAGCCGCGCC GCGCGTCTTGTCTGCTG (SEQ ID NO: 19)Bovine leukemia virus (BLV) packaging sequenceTTGATCACCCCGGAACCCTAACAACTCTCTGGACCCACCCCCTCGGCGGCATTTTGG GTCTCTCCTTCAAATTATATCATGGGAAATTCCTCCTCCTATAACCCCCCCGCTGGTA TCTCCCCCTCAGACTGGCTCAACCTTCTGCAAAGCGCGCAAAGGCTCAATCCGCGAC CCTCTCCTAGCGATTTTACCGATTTAAAGAATTACATCCATTGGTTTCATAAGACCCA GAAAAAACCATGGACTTTCACTTCTGGTGGCCCCACCTCATGTCCACCCGGGAGATT CGGCCGGGTTCCCCTTGTCTTGGCCACCCTAAACGAAGTGCTCTCAAACGAAGGGGG CGCCCCGGGTGCATCGGCCCCAGAAGAACAACCCCCCCCTTATGACCCCCCCGCCGT TTTGCCAATCATATCTGAAGGGAATCGCAACCGCCATCGTGCTTGGGCACTCCGAGAATTACAAGATATCAAAAAAGAAATTGAAAATAAGGCACCGGGTTCGCAAGTATGGATACAAACACTACGACTTGCAATCCTGCAGGCCGACCCTACTCCGGCTGACCTAGAACAACTTTGCCAATATATTGCTTCCCCGGTCGACCAAACGG(SEQ ID NO: 20)Human T-lymphotropic virus 1 (HTLV 1) packaging sequence GCAATGGGCCAAATCTTTTCCCGTAGCGCTAGCCCTATCCCGCGGCCGCCCCGGGGG CTGGCCGCT (SEQ ID NO: 21)Human T-lymphotropic virus 2 (HTLV 2) packaging sequence TATGGGACAAATCCACGGGCTTTCCCCAACTCCAATACCCAAAGCCCC (SEQ ID NO: 22)Feline leukemia virus (FeLV) packaging sequence GCGCAAGTCTTTGCTGAGACTTGACCGCCCCGGGTACCCGTGTATGAATAAACCTCT TGCTGTTTGCATCTGACTCGTGGTCTCGGTGTTCTGTGGGCACGGGGTCTCATCGCCGAGGAAGACCTAGCTCAGGGGTCTTTCATTTGGGGACTCGTCCGGGATAGAGACCCCCAACCCCCGGGACCACCGACCCACCATCAGGAGGTAAGCTGGCCGGCGATCATATCT GTTGTCCTTGTATGAGTGTCTCTGTCATTTGATCTGATTTTGGCGGTGGAGCCGAAGG AGCTGACGAGCTCGTACTTCGCCCCCGCAACCCTGGAAGACGTTCCACGGGTGTCTGATGTCTGGAGCCACTAGTGGGACAGCCATTGGGGCTCATCTGTTTGGGGTCTCACCT GAATACAGGGTGTTGATCGGAGACGAGGGAGCCGGACCCTCAAAGTCTCTTTCTGA GGTTTCA (SEQ ID NO: 23)Porcine endogenous retroviruses (PERV) packaging sequenceTTTTGGTGCATTGGCTGGGAAGCCGACAACCGAGCTGGCCTCTTGTGCCACCGTTGT CTGGGAACTGGGGGAGGCCACGGTCACCGGCCTGGTGACAGGTGGATAGCACACAC CGGCCATTTTGCCGGATCCAGACCCTCACTTGGGCCATGGCCTTGGCCACACCGCTTCCCGAATGGACTCAGAAGGAGAGTGGAAACAGGTTCCTGGACAGGACGTCAGACTGGTGAGTGCCCCGGGGACATCTGCCCAAGTCAGGACCCACCATATGGTGAAGGAGAG ACTGATCACCTCTCAGTGACCAAAGGGTCACTCAGGTCAGGGTTTGCTCCGTTGGCA TCGGGAGGCTTGTCAATTCTGGTGTGTGTGTGTGAGTGACTGGAGAGAACAAGAGCCCATGCTCCACCATCTTTGGACTACGGAGTCAGAGTGAGTCCTAACCTGCAGTTCCATGGCGACCCTCATGCGGCTTATGGTGGCCCTCTTCAGGGGGATCCTGATGTTGGGGTTTATACAGTCCCACCTATGCTAAGAGGCGCCTGAAATATCTCCTCCAGGGGAGAGGTCAGACGGACGAAGAGATTGTTCGTCTTGCGTCACCGGCACAGGGTGGGACTTCACACAATGGGTAAATCGGCTTCCAAGCCCACTGTCTTAGAGCATATGGTTAAGAATTTTAAGAAAGGATTTTCTAGAGATTATGGTGTTAAACTGAGTCCTGGAAAACTGTGTACCC TCTGTACC (SEQ ID NO: 24)Mouse mammary tumor virus (MMTV) packaging sequenceGCAACAGTCCTAACATTCACCTCTCGTGTGTTTGTGTCTGTTCGCCATCCCGTCTCCGCTCGTCACTTATCCTTCACTTTCCAGAGGGTCCCCCCGCAGACCCCGGTGACCCTCAGGTCGGCCGACTGCGGCAGCTGGCGCCCGAACAGGGACCCTCGGATAAGTGACCCTTGTCTCTATTTCTACTATTTTGTGTTCGTCTTGTTTTGTCTCTATCTTATCTGGCTATTATCACAAGAGCGGAACGGACTCACCACAGGGAACTGCAGTCTCGCCTACAGAGAAGAGGTAGGTTACGGTGAGCCATTGGAAATGGGGGTCTCGGGATCAAAAGGGCAGAAACTCTTTGTTTCTGTTCTACAAAGACTCCTCTCAGAGAGGGGTCTTCATGTGAAAGAGAGCAGTGCAATAGAGTTTTATCAGTTCCTAATA (SEQ ID NO: 25)Mason-Pfizer monkey virus (MPMV) packaging sequenceGCCACCATTAAATGAGACTTGATCAGAACACTGTCTTGTCTCCATTTCTTGTGTCTCTTGTTCCCTTCAATTCCCACTCCCTCCTCCAGGTTCCTACTGTTGATCCCGCGGGTCGGGACAGTTGGCGCCCAACGTGGGGCACGAACCCACGACCCTGGGATTAAGAGTCCCATGCTCTACCGACTGGATGATGTCTTGGCCTCTGTTTGCTCTAGCTCCATGTTATGAATTTAAGATGGCGTATTTCCTGGTTCTTCTCCGTCTTACTTTCCCGCCGGCGCGAATGTTTCCCGCTCTTGGGCTTACGTGGCTTTCCTTGCTCTGCTACTGAGCATGCGCCCAGTATCTTTCCCCTCCCACTTGCTGCCTGTGTATATAAGGCAACACATTGCCACCATTAAATGAGACTTGATCAGAACACTGTCTTGTCTCCATTTCTTGTGTCTCTTGTTCCCTTCAATTCCCACTCCCTCCTCCAGGTTCCTACTGTTGATCCCGCGGGTCGGGACAGTTGGCGCCCAACGTGGGGCTGGATACGAGGGAATTTCGTGAGGAAGACGACGCGTTCGCCGGCCGGCGATTAAAAGTGAAAGTAAACTCTCTTGGCCGCCGCGGGAACCTGCCGCGTTGGACCTGAAAGTAAGTGTTGCGCTCGGATATGGGGCAAGAATTAAGCCAGCATGAACGTTATGTAGAACAATTGAAGCAGGCTTTAAAGACACGGGGAGTAAAGGTTAAATATGCTGATCTTTTGAAATTTTTTGATTTTGTGAAGGAT (SEQ ID NO: 26)Avian sarcoma leukosis virus (ALV) packaging sequence GCCATTTTACCTCCCACCACATTGGTGTGCACCTGGGTTGATGGCCGGACCGTCGAT TCCCTGACGACTACGAGCACCTGAATGAAGCAGAAGGCTTCATCTGGTGACCCCGA CGTGATAGTTAGGGAATAGTGGTCGGCCACAGACGGCGTGGCGATCCTGTCCTCATC CGTCTCGCTTATTCGGGGAGCGGGCGATGACCCTAGTAGAGGGGGCTGCGGCTTAG GAGGGCAGAAGCTGAGTGGCGTCGGAGGGAGCTCTACTGCAGGGAGCCCACGTACC CTACCGAGAACTCAGAGAGTCGTTGGAAGACGGGAAGGAAGCCCGACGACTGAGC GGTCCGCCCCAGACGTGGTTCTGGTTGCCTGGAGGATCAAGTATGGAAGCCGTCATA AAGGTGATTTCGTCCGCGTGTAAAACCTATTGCGGGAAAACCTCTCCTTCTAAGAAG GAAATAGGGGCCATGCTGTCCCTGCTACAAAAGGAAGGGTTGCTTGCGTCTCCCTCA GACTTGTACTCCCCGGGGTCCTGGGATCCCATTACCGCGGCGCTCTCCCAGCGAACA ATGGTACTTGGAAAATCGGGGGAGTTAAAAACCTGGGGATTGGTTTTGGGGGCACT GAAGG (SEQ ID NO: 27)Rous sarcoma virus (RSV) packaging sequence GATCCTGCCCTCATCCGTCTCGCTTATTCGGGGAGCGGACGATGACCCTAGTAGAGG GGGCTGCGGCTTAGGAGGGCAGAAGCTGAGTGGCGTCGGAGGGAGCTCTACTGCAG GGAGCCCAGATACCCTACCGAGAACTCAGAGAGTCGTTGGAAGACGG (SEQ ID NO: 28)

[0090] In some embodiments, the packaging signal is located downstream of the 5’ LTR. In some embodiments, the packaging signal is located downstream of the 5’ LTR and upstream of the cargo of interest. In some embodiments, the viral packaging signal comprises a nucleotide sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence set forth in any one of SEQ ID NOs: 18-28.

[0091] In some embodiments, the nucleic acid constructs of the disclosure include a packaging signal having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, atleast 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence of SEQ ID NO: 18 or SEQ ID NO: 19.Post-transcriptional Regulatory Element

[0092] As described herein, in some embodiments, the integration deficient retroviral vectors of the present disclosure include a post-transcriptional regulatory element. In some embodiments, the integration deficient retroviral vectors of the present disclosure can include more than one post-transcriptional regulatory element. Post-transcriptional regulatory elements (PRE), as used herein, refer to exogenous nucleic acid sequences that can enhance expression of a cargo of interest. In some embodiments, PREs do not include any nucleic acid sequences derived from naturally occurring LTR elements that can enhance expression of a cargo of interest. Furthermore, in some embodiments, a PRE element is in the same 5’ to 3’ orientation relative to the 5’ to 3’ orientation of the one or more LTRs and the cargo of interest. In some embodiments, the PRE element is positioned upstream of the one or more cargos of interest. In some embodiments, the PRE element is positioned downstream of the one or more cargos of interest.

[0093] One type of PRE is an intron positioned within the expression cassette, which can stimulate gene expression. However, introns can be spliced out during the life cycle events of a retrovirus.

[0094] Posttranscriptional regulatory elements that do not rely on splicing events can offer the advantage of not being removed during the viral life cycle. Some examples are the posttranscriptional processing element of herpes simplex virus, the posttranscriptional regulatory element of the hepatitis B virus (HPRE) and the woodchuck hepatitis virus (WPRE). The WPRE is characterized and described in U.S. Pat. No. 6,136,597, incorporated herein by reference. WPRE is a tripartite regulatory element with gamma, alpha, and beta components. HPRE shares two domains with WPRE (PREa and PREP) but is missing the PREgamma domain found in WPRE. As demonstrated in the Examples presented herein, the WPRE element can be a useful tool for stimulating and enhancing gene expression of desired transgenes in the context of integration deficient retroviral vectors.

[0095] In some embodiments, the post-transcriptional regulatory element comprises a WPRE. In some embodiments, the WPRE is a tripartite WPRE (i.e., comprising the alpha, beta, and gamma components). In some embodiments, the WPRE comprises only the alpha component. Insome embodiments, the WPRE comprises only the beta component. Tn some embodiments, the WPRE comprises only the gamma component. In some embodiments, the WPRE comprises any combination of two different components selected from the alpha, beta, and gamma components. In some embodiments, the WPRE comprises multiple copies of one or more of the alpha, beta, and gamma components. In some embodiments, any combination of alpha, beta, and / or gamma, whether as a single copy or multiple copies of each component.

[0096] In some embodiments, the post-transcriptional regulatory element comprises the nucleotide sequence of the alpha component of a WPRE (e.g., SEQ ID NO. 29), and lacks the nucleotide sequence of the beta component of a WPRE (e g., SEQ ID NO: 30) and the nucleotide sequence of the gamma component of a WPRE (e.g., SEQ ID NO: 31). In some embodiments, the post-transcriptional regulatory element comprises the nucleotide sequence of the beta component of a WPRE (e.g., SEQ ID NO. 30), and lacks the nucleotide sequence of the alpha component of a WPRE (e g., SEQ ID NO: 29) and the nucleotide sequence of the gamma component of a WPRE (e.g., SEQ ID NO: 31). In some embodiments, the post-transcriptional regulatory element comprises the nucleotide sequence of the gamma component of a WPRE (e.g., SEQ ID NO. 31), and lacks the nucleotide sequence of the alpha component of a WPRE (e.g., SEQ ID NO: 29) and the nucleotide sequence of the beta component of a WPRE (e.g., SEQ ID NO: 30).

[0097] The alpha component of WPRE has a nucleic acid sequence corresponding to SEQ ID NO: 29 below.GGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACC TGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACT CATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGAC AATTCCGTGGTGTTGTCGGGGAAGCTGACGTCCTTTCCAT

[0098] The beta component of WPRE has a nucleic acid sequence corresponding to SEQ ID NO: 30 below.GGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGT CCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTG CGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGG CCGCCTCCCCGC

[0099] The gamma component of WPRE has a nucleic acid sequence corresponding to SEQ ID NO: 31 below.AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTT GCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTT CCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAG GAGTTGTGGCCCGTTGTCAGGCAACGTGGCGT

[0100] In some embodiments, the WPRE comprises a nucleic acid sequence as shown in SEQ ID NO: 32 below:AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATG TTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATT GCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTT TATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTG CTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGG GACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTG CCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTC GGGGAAGCTGACGTCCTTTCCATGGCTGCTCGCCTGTGTTGCCACCTGGATTCTG CGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTT CCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCA GACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTG

[0101] In some embodiments, the PRE comprises a nucleotide sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of the sequences of SEQ ID NOs: 29, 30, 31, or a combination thereof. In some embodiments, the PRE comprises a nucleotide sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of the sequences of SEQ ID NOs: 29, 30, 31, 32 or 33.

[0102] In some embodiments, the nucleic acid constructs of the disclosure include a WPRE having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence of SEQ ID NO: 29, 30, 31, or 32.

[0103] In some embodiments, the post-transcriptional regulatory element comprises an HPRE. In some embodiments, the HPRE comprises only the alpha component. In some embodiments, the HPRE comprises only the beta component. In some embodiments, the HPRE comprises multiple copies of one or more of the alpha and beta components. In some embodiments, the HPRE comprises a nucleic acid sequence as shown in SEQ ID NO: 33 below (single underline indicates the HPRE alpha component sequence; the remainder is the HPRE beta component sequence):TTGCTCGGCAACGGCCTGGTCTGTGCCAAGTGTTTGCTGACGCAACCCCCACTGGTT GGGGCTTGGCCATAGGCCATCAGCGCATGCGTGGAACCTTTGTGTCTCCTCTGCCGA TCCATACTGCGGAACTCCTAGCCGCTTGTTTTGCTCGCAGCAGGTCTGGAGCAAACC TCATCGGGACCGACAATTCTGTCGTACTCTCCCGCAAGTATACATCGTTTCCATGGCT GCTAGGCTGTGCTGCCAACTGGATCCTGCGCGGGACGTCCTTTGTTTACGTCCCGTC GGCGCTGAATCCCGCGGACGACCCCTCCCGGGGCCGCTTGGGGCTCTACCGCCCGCT TCTCCGTCTGCCGTACCGTCCGACCACGGGGCGCACCTCTCTTTACGCGGACTCCCC GTCTGTGCCTTCTCATCTGCCGGACCGTGTGCACTTCGCTTCACCTCTGCACGTCGCA TGGAGACCACCGTGAACGCCCACCGGAACCTGCCCAAGGTCTTGCATAAGAGGACT CTTGGACTTTCAGCAATGTC

[0104] In some embodiments, the nucleic acid constructs of the disclosure include an HPRE having at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the sequence of SEQ ID NO : 33.

[0105] The PRE can be located at any position relative to the other elements in the nucleic acid construct. In some embodiments, the PRE is located 3’ to the cargo of interest. In some embodiments, the PRE is located between the cargo of interest and the 3’ LTR. In some embodiments, the PRE is located 3’ to the cargo of interest and the PRE is part of the 3’ untranslated region (3’ UTR) of the transcript of the cargo of interest. In some embodiments, the PRE is comprised of alpha, beta, and / or gamma components from both WPRE and HPRE. As used herein, a PRE is not considered an exogenous promoter.

[0106] Potential PRE elements with sequence homology to the full WPRE or HPRE sequences (SEQ ID NO:32 or 33, respectively) or to portions thereof (e.g., alpha and / or beta components for WPRE or HPRE, or alpha, beta, and / or gamma components for WPRE) can be functionallytested to confirm that the potential element can provide expression of one or more cargos of interest in the absence of an exogenous promoter. The functional testing can be as described for reporter gene expression as in Figures 1-6. Potential PRE elements with sequence homology to WPRE or HPRE (full and portions thereof) are provided in Tables 1-7 below. The query sequence is indicated in the title of the Tables, i.e., the WPRE alpha, beta, gamma, or full-length sequence (SEQ ID NO:29, 30, 31, or 32, respectively) or the HPRE alpha, beta, or full-length sequence (SEQ ID NO:33 or alpha / beta portion thereof). The potential PRE sequences with homology to the query sequences are listed in the Tables under the column “Hit Sequence.” The source of the Hit Sequence can be determined by searching the Genbank database of the National Center for Biotechnology Information via its accession number listed in the Tables. The potential PRE sequences may include IUPAC single letter codes to indicate that more than one type of nucleotide can be present at a position (B = C or G or T; D = A or G or T; H = A or C or T; K = G or T; M = A or C; N = A or C or G or T; R = A or G; S = C or G; V = A or C or G; W = A or T; Y = C or T). Thus, in some embodiments, the PRE element comprises a sequence listed in Tables 1-7.

[0107] TABLE 1: QUERY WITH WPRE-ALPHA SEQUENCE - POTENTIAL PRE SEQUENCES WITH HOMOLOGY TO WPRE-ALPHA

[0108] TABLE 2: QUERY WITH WPRE-BETA SEQUENCE - POTENTIAL PRE SEQUENCES WITH HOMOLOGY TO WPRE-BETA

[0109] TABLE 3: QUERY WITH WPRE-GAMMA SEQUENCE - POTENTIAL PRE SEQUENCES WITH HOMOLOGY TO WPRE-GAMMA

[0110] TABLE 4 : QUERY WITH WPRE (FULL) SEQUENCE - POTENTIAL PRE SEQUENCES WITH HOMOLOGY TO WPRE (FULL)GTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGC (SEQ ID NO: 351)CCTTCGGCCCTCAATCCAGCGGACCTCCCTTCCCGCGGCCTGCTGCCGGTTCTGCGGCCTCTTCCACGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGC (SEQ ID NO: 354)CCTTCGGCCCTCAATCCAGCGGACCTCCCTTCCCGCGGCCTGCTGCCGGTTCTGCGGCCTCTTCCACGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGC (SEQ ID NO: 357)GTCCTTTCCATGGCTGCTCGCCTGTGTTGCCAACTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTCCCTTCCCGCGGCCTGCTGCCGGTGCTGCGGCCTCTTCCACGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTGCCTTTGGGCCGCCTCCCCGC (SEQ ID NO: 360)GTCCTTTCCATGGCTGCTCGCCTGTGTTGCCAACTGGATCCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCTCTCAATCCAGCGGACCTCCCTTCCCGAGGCCTTCTGCCGGTTCTGCGGCCTCTCCCGCGTCTTCGCTTTCGGCCTCCGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGC (SEQ ID NO: 363)GTCTTCGCTTTCGGCCTCCGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGC (SEQ ID NO: 366)CGTCTTCGCTTTCGGCCTCCGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGC (SEQ ID NO:369)CGTCCTTTCCATGGCTGCTCGCCTGTGTTGCCAACTGGATCCTACGCGGGACGTCCTTCTGCTACGTCCCTTCAGCTCTCAATCCAGCGGACCTCCCTTCCCGAGGCCTTCTGCCGGTTCTGCGGCCTCTCCCGCGTCTTCGCTTTCGGCCTCCGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGC (SEQ ID NO: 372)CGTCCTTTCCATGGCTGCTCGCCTGTGTTGCCAACTGGATCCTACGCGGGACGTCCTTCTGCTACGTCCCTTCAGCTCTCAATCCAGCGGACCTCCCTTCCCGAGGCCTTCTGCCGGTTCTGCGGCCTCTCCCGCGTCTTCGCTTTCGGCCTCCGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGC (SEQ ID NO: 375)CCCTTCAGCTCTCAATCCAGCGGACCTCCCTTCCCGAGGCCTTCTGCCGGTTCTGCGGCCTCTCCCGCGTCTTCGCTTTCGGCCTCCGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGC (SEQ ID NO: 378)CGTCCTTTCCATGGCTGCTCGCCTGTGTTGCCAACTGGATCCTACGCGGGACGTCCTTCTGCTACGTCCCTTCAGCTCTCAATCCAGCGGACCTCCCTTCCCGAGGCCTTCTGCCGGTTCTGCGGCCTCTCCCGCGTCTTCGCTTTCGGCCTCCGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGC (SEQ ID NO: 381)CGTCCTTTCCATGGCTGCTCGCCTGTGTTGCCAACTGGATCCTACGCGGGACGTCCTTCTGCTACGTCCCTTCAGCTCTCAATCCAGCGGACCTCCCTTCCCGAGGCCTTCTGCCGGTTCTGCGGCCTCTCCCGCGTCTTCGCTTTCGGCCTCCGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGC (SEQ ID NO: 384)CCTCCGCGGACAACCCAGCGGACCTTCCGTCTCGGGGACTTCTGCCGGCTCTCCGTCCTCTGCCGCTTCTGCGTTTTCGTCCGGTCACCAAGCGGATATCCCTGTGGGCCGCCTCCCCGC (SEQ ID NO: 387)ATACATCCTTTCCATGGCTGCTAGGCTGTGCTGCCAACTGGATCCTGCGCGGGACGTCCTTTGTTTACGTCCCGTCGGCGCTGAATCCCGCGGACGACCCTTCCCGGGGCC-GCTTGGGGCTCTACCGC- —CCGCTTCTCCGCCT (SEQ ID NO: 390)GCTTGGGGCTCTACCGCCCGCTTCTCCGTCT—GCCGTACCGTCCGACCACGGGGCGCACCTCTCTTTACGCGGACTCCCCG (SEQ ID NO: 393)CCGCTTCTCCGCCT (SEQ ID NO: 396)GCCCCTTTTACGCAATGTGGATATCCTGCTTTAATGCCTTTATATGCATG-TATACAGGCCAAACAGGCTTTTACTTTCTCGCCAACTTACAAGGCCT—TTCTAAGTAAACAGTATCTGAACCTTTACCCCGTTGCTCGGCAACG-GCCTGGTCTGTGCCAAGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCTTGGCCATAGGCCTTCAGCGCATGCGTGGAACCTTTGTGTCTCCTCTGCCGATCCATACTGCGGAACTCCTAGCCGCTTGTTTTGCTCGCAGCAGGTCTGGGGCAAAGCTCATCGGGACTGACAATTCTGTCGTGCTCTCCCGCAAGTATACATCCTTTCCATGGCTGCTAGGCTGTGCTGCCAACTGGATCCTGCGCGGGACGTCCTTTGTTTACOM66966 GTCCCGTCGGCGCTGAATCCCGCGGACGACCCCTCCCGGGGCC-GCTTGGGGCTCTACCGC- —4 CCGCTTCTCCGCCT (SEQ ID NO: 400)TACATCCTTTCCATGGCTGCTAGGCTGTGCTGCCAACTGGATCCTGCGCGGGACGTCCTTTGTTTACGTCCCGTCGGCGCTGAATCCCGCGGACGACCCCTCCCGGGGCC-GCTTGGGGCTCTACCGC- —CCGCTTCTCCGCCT (SEQ ID NO: 406)ACATCCTTTCCATGGCTGCTAGGCTGTGCTGCCAACTGGATCCTGCGCGGGACGTCCTTTGTTTACGTCCCGTCGGCGCTGAATCCCGCGGACGACCCCTCCCGGGGCC-GCTTGGGGCTCTACCGC- — CCGCTTCTCCGCCTGTTGTACCGACCTTCCACGGGGCGCACCTCTCTTTACGCGGCCTCCCCG (SEQID NO: 410)CCGCTTCTCCGCCT (SEQ ID NO: 413)CCGCTTCTCCGCCT (SEQ ID NO: 416)CCGCTTCTCCGCCT (SEQ ID NO: 419)GCTCGCAGCAGGTCTGGGGCAAAACTCATCGGGACTGACAATTCTGTCGTGCTCTCCCGAAAGTATACATCCTTTCCATGGCTGCTAGGCTGTGCTGCCAACTGGATCCTGCGCGGGACGTCCTTTGTTTACGTCCCGTCGGCGCTGAATCCCGCGGACGACCCCTCCCGGGGCC-GCTTGGGGCTCTACCGC- —CCGCTTCTCCGCCT (SEQ ID NO: 426)CCGCTTCTCCGCCT (SEQ ID NO: 429)GTCCCGTCGGCGCTGAATCCCGCGGACGACCCCTCACGGGGCC-GCTTGGGGCTCTACCGCCCGCTTCTCCGCCT (SEQ ID NO: 445)

[0111] TABLE 5 : QUERY WITH HPRE-ALPHA SEQUENCE - POTENTIAL PRE SEQUENCES WITH HOMOLOGY TO HPRE-ALPHAIll

[0113] TABLE 7: QUERY WITH HPRE (FULL) SEQUENCE - POTENTIAL PRE SEQUENCES WITH HOMOLOGY TO HPRE (FULL)Promoters

[0114] As demonstrated in the Examples provided herein, in some embodiments, the compositions of the present disclosure do not include an exogenous promoter. As used herein, a promoter is referred to in its traditional sense as a sequence that allows a polymerase complex to initiate transcription of a target (e.g., cargo) gene. In standard retroviral vector production, a strong, exogenous, heterologous promoter can be positioned upstream of the cargo of interest in order to drive expression of the cargo. For example, in many instances, exogenous promoters including, but not limited to, CMV, EFla, SV40, PGK1, and Ubc are positioned upstream of a cargo of interest.

[0115] An exogenous promoter can be a promoter that does not naturally occur in the retroviral genome. For example, a promoter exogenous to the retroviral genome can be a promoter from a different species or a different organism. A promoter exogenous to the retroviral genome can be a eukaryotic promoter (i.e., promoters functional in a eukaryotic cell). An exogenous promoter can comprise a synthetic promoter sequence which does not naturally occur in any organism.

[0116] An endogenous promoter can be a promoter that naturally occurs in the retroviral genome. An example of such an endogenous promoter in the retroviral genome can be the naturally occurring promoter in an LTR region.

[0117] The present disclosure shows the surprising discovery that, in the context of integration deficient retroviral vectors, constructs with a PRE and lacking the traditional exogenous promoter upstream of the cargo of interest exhibit enhanced gene expression.

[0118] Thus, in some embodiments, the compositions described herein contain no promoter at all. In some embodiments, the only promoter in the compositions described herein is a naturallyoccurring promoter in an LTR. In some embodiments, the compositions contain no promoter element in between the end of the 5’ LTR and the cargo of interest. The person of ordinary skill knows how to determine the “end of the 5’ LTR” as retroviral LTR sequences are well characterized. For example, both 5’ and 3’ LTRs sometimes end with the dinucleotide “CA.” Accordingly, in some embodiments, the compositions described herein contain no promoter between the 5’ LTR dinucleotide and the cargo of interest. This includes both endogenous (e.g., a naturally occurring promoter in an LTR) and exogenous promoters in between the end of the 5’ LTR and the cargo of interest as well as any promoter elements taken out of their natural sequence context (such as a portion of an LTR). Thus, in some embodiments, the only promoter sequence present in the compositions of the disclosure is the endogenous, naturally occurring promoter in an LTR, where the promoter is maintained in its natural sequence context of the LTR.

[0119] A person of ordinary skill in the art will understand that the LTRs themselves contain promoter sequences. However, in this context, such promoters represent endogenous promoters located within the LTR itself. In some embodiments, the recombinant integration defective retroviral vector of the present disclosure does not contain an exogenous LTR promoter.Cargos of Interest

[0120] As used herein, a “cargo” includes one or more nucleic acid sequences of interest and refers to a nucleic acid that is transcribed. In some embodiments, where the cargo comprises two different nucleic acid sequences that are to be translated as separate protein molecules, the two different nucleic acid sequences are separated by an internal ribosomal entry site (IRES) sequence such that the cargo is transcribed as a single molecule but translated into two different protein molecules.

[0121] In some embodiments, the cargo of interest is selected from a gene-editing nuclease, a gene-editing nickase, endonuclease deficient Cas, endonuclease deficient Cas effectors, endonuclease deficient Cas enzymes, Cas nuclease fusion proteins, Cas nickase fusion proteins, endonuclease deficient Cas fusion proteins, engineered DNA binding protein, base editor, prime editor, RNA interference (RNAi), RNA targeting system, CRISPR DNA binding protein, CRISPR nickase, recombinase, programmable integrase, transposons, retrotransposons, transposase, chimeric antigen receptor (CAR), transcription factor, caspase, natural protease, programmable protease, reporter gene, and selection marker.

[0122] Gene-editing nucleases are well known in the art. Any gene-editing nuclease as is known in the art can be encoded in the vectors of the present disclosure including, without limitation, zinc finger nucleases (ZFNs), Transcription Activator-Like Effector Nucleases (TALENs), nucleases of the CRISPR / Cas system.

[0123] By way of example, CRISPR-based endonucleases include RNA-guided endonucleases that comprise at least one nuclease domain and at least one domain that interacts with a guide RNA. As known to the art, a guide RNA directs the CRISPR-based endonucleases to a targeted site in a nucleic acid at which site the CRISPR-based endonucleases cleaves at least one strand of the targeted nucleic acid sequence. As the guide RNA provides the specificity for the targeted cleavage, the CRISPR-based endonuclease is universal and can be used with different guide RNAs to cleave different target nucleic acid sequences. CRISPR-based endonucleases are RNA- guided endonucleases derived from CRISPR / Cas systems. In an embodiment, a disclosed CRISPR-based endonuclease can be derived from a CRISPR / Cas type I, type II, type III, type V, or type VI system. Non-limiting examples of suitable CRISPR / Cas proteins include Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8al, Cas8a2, Cas8b, Cas8c, Cas9, CaslO, CaslOd, Cast 2 (including subtypes Cast 2a (formerly Cpfl), Cast 2b (previously C2C1), and Casl2f (also known as Casl4)), Cas 13 (including subtypes Casl3a (aka C2c2), Casl3b, Casl3c, and Cast 3d), CasF, CasG, CasH, Csyl, Csy2, Csy3, Csel (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Cszl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cul966. All of these nuclease enzymes can be rendered nickases or endonuclease deficient DNA binding proteins by mutation of one / both endonuclease domains. Further, all of these nuclease enzymes can be in the form of a fusion protein.

[0124] In some embodiments, the integration deficient retroviral vector of the disclosure carries cargo comprising both a CRISPR endonuclease and a guide RNA (gRNA). In some of such embodiments, the minimal elements of an IDRV construct are: a 5’ LTR, a packaging signal, a coding sequence for a CRISPR endonuclease (including endonuclease deficient Cas proteins, Cas fusion proteins, or any wild-type or engineered Cas protein that associates with gRNA), a PRE, an RNA pol Ill-based promoter(s), and the coding sequence for a guide RNA. This construct can further minimally comprise a 3’ LTR downstream of the coding sequence for the guide RNA. Further, this construct contains no promoter between the end of the 5’ LTR andthe beginning of the coding sequence for the CRISPR endonuclease; the only exogenous or ectopic promoter is the RNA pol Ill-based promoter(s) for guide RNA expression.

[0125] Endonuclease deficient Cas proteins are also contemplated for use herein. An exemplary, endonuclease deficient Cas includes dCas9 (Xu et al., “CRISPR / Cas Derivatives and Novel Gene Modulating Tools: Possibilities and In Vivo Applications,” Int J Mol Sci 21(():3038 (2020).

[0126] Further contemplated for use herein are endonuclease deficient Cas effectors and endonuclease deficient Cas enzymes. Examples include, without limitation, CRISPR activation (CRISPRa), CRISPR interference (CRISPRi), CRISPRoff, and CRISPRon.

[0127] As described above, engineered DNA binding proteins are also contemplated as cargo for use herein. Exemplary engineered DNA binding proteins include, without limitation, ZFPs, TALEs, and engineered Cas9 endonucleases. A ZFP, or zinc finger protein, is a protein, or a domain within a larger protein, that binds DNA in a sequence-specific manner through one or more zinc fingers, which are regions of amino acid sequence within the binding domain whose structure is stabilized through coordination of a zinc ion. Engineered DNA binding proteins can be fusion proteins to impart additional protein functions.

[0128] A "TALE DNA binding domain" or "TALE" is a polypeptide comprising one or more TALE repeat domains / units. The repeat domains are involved in binding of the TALE to its cognate target DNA sequence. A single "repeat unit" (also referred to as a "repeat") is typically 33-35 amino acids in length and exhibits at least some sequence homology with other TALE repeat sequences within a naturally occurring TALE protein. See, e.g., U.S. Patent Publication No. 20110301073, incorporated by reference herein in its entirety. Engineered TALE proteins can be fusion proteins to impart additional protein functions.

[0129] An engineered Cas9 endonuclease includes those that are engineered to have altered PAM specificity (Walton et al., “Unconstrained Genome Targeting with Near-PAMless Engineered CRISPR-Cas9 Variants,” Science 368(6488):290-296 (2020). Engineered Cas proteins can be fusion proteins to impart additional protein functions.

[0130] Zinc finger and TALE binding domains can be "engineered" to bind to a predetermined nucleotide sequence, for example via engineering (altering one or more amino acids) of the recognition helix region of a naturally occurring zinc finger. Similarly, TALEs can be "engineered" to bind to a predetermined nucleotide sequence, for example by engineering of theamino acids involved in DNA binding (the repeat variable diresidue or RVD region). Therefore, engineered DNA binding proteins (zinc fingers or TALEs) are proteins that are non-naturally occurring. Non- limiting examples of methods for engineering DNA-binding proteins are design and selection. A designed DNA binding protein is a protein not occurring in nature whose design / composition results principally from rational criteria. Rational criteria for design include application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP and / or TALE designs and binding data. See, for example, U.S. Patents 6, 140,081;6, 453, 242; and 6,534,261; see also WO 98 / 53058; WO 98 / 53059; WO 98 / 53060; WO 02 / 016536 and WO 03 / 016496 and U.S. Publication Nos. 201 10301073, 20110239315 and 20119145940.

[0131] Base editors can also be used as cargo of interest in the vectors of the disclosure. Base editors are described in Kantor et al., “CRISPR-Cas9 DNA Base-Editing and Prime Editing,” International Journal of Molecular Sciences 21 :6240 (2020).

[0132] Prime editors for use as cargo in the vectors of the present disclosure include, without limitation, components of the twin prime editing system (Anzalone et al., “Programmable Deletion, Replacement, Integration and Inversion of Large DNA Sequences with Twin Prime Editing,” Nature Biotechnology 40:731-740 (2022). Prime editing is also described in Scholefield et al., “Prime Editing - an Update on the Field,” Gene Therapy 28:396-401 (2021) and Kantor et al., “CRISPR-Cas9 DNA Base-Editing and Prime Editing,” International Journal of Molecular Sciences 21 :6240 (2020).

[0133] DNA polymerase editors can be used as cargo of interest in the vectors of the disclosure. DNA polymerase editors are described in Liu et al., “Targeted genome editing with a DNA-dependent DNA polymerase and exogenous DNA-containing templates” DOI:10.1038 / s41587-023-01947-w.

[0134] Bridge editors can be used as cargo of interest in the vectors of the disclosure. Bridge editors are described in Durrant et al., “Bridge RNAs direct modular and programmable recombination of target and donor DNA,” https: / / www.biorxiv.Org / content / 10.l 101 / 2024.01.24.577089vl.

[0135] Epigenome editors, including but not limited to CRISPRoff and CRISPRon, can be used as cargo of interest in the vectors of the disclosure. CRISPRoff and CRISPRon are described in Nunez et al., “Genome-wide programmable transcriptional memory by CRISPR-based epigenome editing,” Cell 184(9):2503-2519 (2021). Epigenome editors can be also be composed of zinc fingers or TALEs as described in Cappelluti et al. “Durable and efficient gene silencing in vivo by hit-and-run epigenome editing” Nature 627, pages416-423 (2024).

[0136] Also contemplated for use as cargo of interest is RNA interference (RNAi). RNAi is achieved by exposing the cellular messenger RNA (mRNA) molecules produced by the target gene to double-stranded RNA (dsRNA) molecules that contain sequences complementary to a short portion of the mRNA molecule. Inside the cell, the double-stranded RNA molecules are cleaved to produce short (21-23 nucleotides long) single and double- stranded fragments which can bind to the target mRNA molecules. Such binding leads to the cleavage or translation disruption of the target mRNA by nucleases, thus resulting in a reduction in the expression levels of the target gene.

[0137] RNA targeting systems for use as cargo in the vectors of the present disclosure include, without limitation, RNAse proficient Casl3 (e.g., Casl3d), RNAse deficient Casl3 (e.g., dCasl3d), CSM (Colognori et al., “Precise Transcript Targeting by CRISPR-Csm Complexes,” Nature Biotechnology 2023), and RADARs (Jiang et al., “Programmable Eukaryotic Protein Synthesis with RNA Sensors by Harnessing ADAR,” Nature Biotechnology 41 :698-707).

[0138] CRISPR DNA binding proteins are also contemplated for use in the vectors of the present disclosure. These proteins include, without limitation, any of the dCas enzymes (e.g., dCas9, dCasl2) or natural CRISPR DNA binding proteins without nuclease domains including without limit Casl2c. In some embodiments, the cargo comprises dCas9. CRISPR DNA binding proteins can be fusion proteins to impart additional protein function. Examples, without limitation include, fusions composed of CRISPR DNA binding proteins and recombinases, integrases, transposases, enzymes, protein scaffolds, retrotransposases, deaminases, reverse transcriptases, DNA polymerases.

[0139] Additional cargos for use in the vectors of the present disclosure include recombinases. Recombinases for use as cargo in the vectors of the present disclosure include, without limitation, large serine recombinases (Durrant, et al. Systematic discovery of recombinases for efficient integration of large DNA sequences into the human genome. Nat Biotechnol 41, 488- 499 (2023) https: / / doi.org / 10.1038 / s41587-022-01494-w) and CRE.

[0140] Additional cargos for use in the vectors of the present disclosure include transposons, transposases, and retrotransposons. Retrotransposons for use as cargo in the vectors of thepresent disclosure include, without limitation, human LI retrotransposon as described in Wang et al. “CRISPR-Enabled Autonomous Transposable Element (CREATE) for RNA-based gene editing and delivery” doi: https: / / doi.org / 10.1101 / 2024.01.29.577809.

[0141] Programmable integrases for use as cargo in the vectors of the present disclosure include, without limitation, Programmable Addition via Site-specific Targeting Element (PASTE) (Yamall et al., Drag-and-drop genome insertion of large sequences without doublestrand DNA cleavage using CRISPR-directed integrases,” Nature Biotechnology 41(4):500-512 (2023).

[0142] Exemplary CRISPR nickases include, without limitation, CRISPR nickases are derived from CRISPR nucleases by inactivation of one of the nuclease domains. In specific embodiments, the CRISPR nickase can be derived from a type II CRISPR nuclease. For example, the type II CRISPR nuclease can be a Cas9 protein. Suitable Cas9 nucleases include Streptococcus pyogenes Cas9 (SpCas9), Francisella novicida Cas9 (FnCas9), Staphylococcus aureus (SaCas9), Streptococcus thermophilus Cas9 (StCas9), Streptococcus pasteurianus (SpaCas9), Campylobacter) ej uni Cas9 (CjCas9), Neisseria meningitidis Cas9 (NmCas9), or Neisseria cinerea Cas9 (NcCas9). In other embodiments, the nickase can be derived from a type V CRISPR nuclease, such as a Cpfl nuclease. Suitable Cpfl nucleases include Francisella novicida Cpfl (FnCpfl), Acidaminococcus sp. Cpfl (AsCpfl), or Lachnospiraceae bacterium ND2006 Cpfl (LbCpfl). In yet another embodiment, the nickase can be derived from a type VI CRISPR nuclease, e g., Leptotrichia wadei Casl3a (LwaCasl3a) or Leptotrichia shahii Casl3a (LshCasl3a).

[0143] The cargo included in the vectors of the present disclosure can also be nucleic acids encoding chimeric antigen receptors. These include, without limitation, synnotch (Roybal et al., “Engineering T Cells with Customized Therapeutic Response Programs Using Synthetic Notch Receptors,” Cell 167(2):419-432 (2016); Morsut et al., “Engineering Customized Cell Sensing and Response Behaviors Using Synthetic Notch Receptors,” Cell 164(4):780-791 (2016)) and SNIPR CARs (Zhu et al., “Modular Design of Synthetic Receptors for Programmed Gene Regulation in Cell Therapies,” Cell 185(8): 1431-1443 (2022)). Generally, CARs and their sequences are well known to one skilled in the art.

[0144] Exemplary programmable nucleases are also known in the art and include, without limitation, programmable Type V or Type VI CRISPR / Cas enzyme. In some aspects, theprogrammable Type V CRISPR / Cas enzyme is a programmable Casl2 nuclease. In some aspects, the programmable Cast 2 nuclease is Cast 2a, Cast 2b, Cast 2c, Cast 2d, or Casl2e. In some aspects, the programmable Type V CRISPR / Cas enzyme is a programmable Casl4 nuclease. In some aspects, the programmable Casl4 nuclease is Casl4a, Casl4b, Casl4c, Casl4d, Casl4e, Casl4f, Casl4g, or Casl4h. In some aspects, the programmable nuclease is a programmable Type VI CRISPR / Cas enzyme. In some aspects, the programmable Type VI CRISPR / Cas enzyme is a programmable Casl3 nuclease. In some aspects, the programmable Casl3 nuclease is Casl3a, Casl3b, Casl3c, Casl3d, or Casl3e.

[0145] Programmable proteases for use as cargo in the vectors of the present disclosure include, without limitation, CRASPASE (Hu et al., “Craspase is a CRISPR RNA-guided, RNA- activated Protease,” Science 377(6612): 1278-1285 (2022) and protease regulated CAR-T cell receptors (Labanieh et al, Enhanced Safety and Efficacy of Protease-regulated CAR-T Cell Receptors,” Cell 185: 1745-1763 (2022).

[0146] The cargo included in the vectors of the present disclosure can also be nucleic acids encoding proteases such as Caspases or viral proteases. Viral proteases are well known in the art and include, without limitation, HIV protease. Caspases are well known in the art and include, without limitation, Caspase 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, and 14.

[0147] Examples of reporter genes which may be employed to identify transfected or transduced cell lines include alkaline phosphatase (AP), beta galactosidase (LacZ), beta glucoronidase (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), horseradish peroxidase (HRP), and luciferase (Luc). Possible antibiotic selectable markers include those that confer resistance to ampicillin, blasticidin, bleomycin, chloramphenicol, geneticin (G418), gentamycin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin, puromycin, and tetracyclin.

[0148] In some embodiments, the cargo of interest is located immediately downstream of the 5’ LTR.

[0149] In some embodiments, the cargo of interest is located such that there is a PRE 3’ of the cargo.

[0150] In some embodiments, the nucleic acid constructs of the present disclosure can include more than one cargo of interest. In some embodiments, the nucleic acid constructs disclosedherein can include at least one, at least two, at least three, at least four, at least five, or at least six cargos of interest.

[0151] In one embodiment, a second cargo comprises an sgRNA.

[0152] In some embodiments, each of the cargos of interest comprises a PRE sequence located 3’ to the cargo. In some embodiments, the sequence encoding the cargos of interest are operably linked to one another within a single open reading frame (e.g., in a polycistronic ORF).

[0153] In some embodiments, the sequence encoding the cargos of interest, can be linked to one another directly or indirectly (e.g., via one or more connector sequences). For example, in some embodiments, the sequence encoding the cargos of interest can be directly linked to one another, e.g., adjacently to one another. In some embodiments, at least two (e.g., 2, 3, 4, or 5) of the sequence encoding the cargos of interest are operably linked to one another by one or more connector sequences. In some embodiments, the length and amino acid composition of the connector sequences can be optimized to vary the orientation, flexibility, and / or proximity of the polypeptides relative to one another to achieve a desired activity or property of the encoded protein. In some embodiments, a connector sequence of the plurality of connector sequences includes one or more coding sequences for autoproteolytic peptide sequences. Generally, any proteolytic cleavage site known in the art can be incorporated into the nucleic acid molecules of the disclosure and can be, for example, proteolytic cleavage sequences that are cleaved postproduction by a protease. Further suitable proteolytic cleavage sites also include proteolytic cleavage sequences that can be cleaved following addition of an external protease. As used herein the term “autoproteolytic peptide” refers to a “self-cleaving” peptide that possesses autoproteolytic activity and is capable of cleaving itself from a larger polypeptide moiety. First identified in the foot-and-mouth disease virus (FMDV), a member of the picomavirus group, several autoproteolytic peptides have been subsequently identified such as, for example, “2A like” peptides from equine rhinitis A virus (E2A), porcine teschovirus-1 (P2A) and Thosea asigna virus (T2A), and their activities in proteolytic cleavage have been shown in various ex vitro, in vitro, ex vivo, and in vivo eukaryotic systems. As such, the concept of autoproteolytic peptides is available to one of skill in the art with many naturally-occurring autoprotease systems have been identified. Well studied autoprotease systems are e.g. viral proteases, developmental proteins (e.g. HetR, Hedgehog proteins), RumA autoprotease domain, UmuD, etc.). Non-limiting examples of autoproteolytic peptides suitable for the compositions and methods of the presentdisclosure include one or more autoproteolytic cleavage sequences from a calcium-dependent serine endoprotease (furin), a porcine teschovirus-1 2A (P2A), a foot-and-mouth disease virus (FMDV) 2A (F2A), an Equine Rhinitis A Virus (ERAV) 2A (E2A), a Thosea asigna virus 2A (T2A), a cytoplasmic polyhedrosis virus 2A (BmCPV2A), a Flacherie Virus 2A (BmIFV2A), or a combination thereof.

[0154] In some embodiments, the sequence encoding the cargos of interest are operably linked to one another by a coding sequence for one or more internal ribosomal entry sites (IRES). An IRES or “internal ribosome entry site” is a sequence located between polycistronic genes that permits the production of the expression product originating from the second gene by internal initiation of the translation of the dicistronic mRNA. It promotes direct internal ribosome entry to the initiation codon, such as ATG, of a cistron (a protein encoding region), thereby leading to the cap-independent translation of the gene. See, e g., Jackson et al., 1990. Trends Biochem Sci 15(12):477-83) and Jackson and Kaminski. 1995. RNA l(10):985-1000. In some embodiments, the IRES can be a viral IRES, a cellular IRES, or an artificial IRES. Examples of IRES generally employed by those of skill in the art include those described in U.S. Pat. No. 6,692,736. In some embodiments, the IRES is selected from a Kaposi’s sarcoma-associated herpesvirus (KSHV) IRES, a hepatitis virus IRES, a Pestivirus IRES, a Cripavirus IRES, a Rhopalosiphum padi virus IRES, a fibroblast growth factor IRES, a platelet-derived growth factor IRES, a vascular endothelial growth factor IRES, an insulin-like growth factor IRES, a picornavirus IRES, an encephalomyocarditis virus (EMCV) IRES, a Pim-1 IRES, a p53 IRES, an Apaf-1 IRES, a TDP2 IRES, an L-myc IRES, and a c-myc IRES., In some embodiments, the IRES is obtainable from EMCV.

[0155] One of skill in the art will appreciate that different configurations of sequence encoding the cargos of interest, the sequence encoding the autoproteolytic peptide, or an IRES can be employed as long as expression of sequence encoding the cargos of interest is adequately maintained. These sequences will typically be configured so that the polypeptide encoded by the gene of interest can be released from the protease and other sequences after cleavage by the autoprotease.

[0156] The term “operably linked”, as used herein, denotes a functional linkage between two or more sequences. For example, an operable linkage between a polynucleotide of interest and a regulatory sequence (for example, a promoter) is a functional link that allows for expression ofthe polynucleotide of interest, i.e., cargo of interest. In this sense, the term “operably linked” refers to the positioning of a regulatory region and a coding sequence to be transcribed so that the regulatory region is effective for regulating transcription or translation of the coding sequence of interest. In some embodiments disclosed herein, the term “operably linked” denotes a configuration in which a regulatory sequence is placed at an appropriate position relative to a sequence that encodes a polypeptide or functional RNA such that the control sequence directs or regulates the expression or cellular localization of the mRNA encoding the polypeptide, the polypeptide, and / or the functional RNA. Thus, a promoter is in operable linkage with a nucleic acid sequence if it can mediate transcription of the nucleic acid sequence. Operably linked elements may be contiguous or non-contiguous.

[0157] The basic techniques for operably linking two or more sequences of DNA together are familiar to one of ordinary skill in the art, and such methods have been described in many books for standard molecular biological manipulation (see, for example, Maniatis et al., “Molecular Cloning: A Laboratory Manual” 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; and Gibson et al., Nature Methods 6:343-45, 2009).Additional Components

[0158] The integration deficient retroviral vector described herein may also include transcriptional regulatory control sequences operably linked to the retroviral genome to direct transcription of the genome in a production cell / packaging cell. Some vector genomes require additional sequences for efficient virus production. For example, particularly in the case of HIV, RRE sequences may be included. However, the requirement for RRE (and dependence on rev which is provided in trans) may be reduced or eliminated by codon optimisation. Further details of this strategy can be found in WO 2001 / 79518.

[0159] Alternative sequences which perform the same function as the rev / RRE system are also known. For example, a functional analogue of the rev / RRE system is found in the Mason Pfizer monkey virus. This is known as the constitutive transport element (CTE) and comprises an RRE- type sequence in the genome which is believed to interact with a factor in the infected cell. The cellular factor can be thought of as a rev analogue. Thus, CTE may be used as an alternative to the rev / RRE system. Any other functional equivalents of the Rev protein which are known or become available may be relevant to the disclosure. For example, it is also known that the Rex protein of HTLV-I can functionally replace the Rev protein of HIV-1. Rev and RRE may beabsent or non-functional in the vector for use in the methods of the present disclosure; in the alternative rev and RRE, or functionally equivalent system, may be present

[0160] The retroviral vector disclosed herein can also include additional components such as, without limitation, splice donor sites (SD), splice acceptor sites (SA), and / or Rev responsive elements (RRE), Tat, and / or Rev.

[0161] A vector can also include other components as are known in the art, e.g., any of various selection markers and / or reporter genes. Examples of reporter genes which may be employed to identify transfected or transduced cell lines include alkaline phosphatase (AP), beta galactosidase (LacZ), beta glucoronidase (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), horseradish peroxidase (HRP), and luciferase (Luc). Possible antibiotic selectable markers include those that confer resistance to ampicillin, blasticidin, bleomycin, chloramphenicol, geneticin (G418), gentamycin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin, puromycin, and tetracyclin.Exemplary Constructs

[0162] In some embodiments, the recombinant integration deficient retroviral vector includes, from N-terminus to C-terminus, a 5’ LTR derived from MLV, a viral packaging signal, a cargo of interest, a WPRE sequence, and a 3 ’ LTR derived from MLV.

[0163] In some embodiments, the recombinant integration deficient retroviral vector comprises the nucleic acid sequence of SEQ ID NO: 34 as shown below. The MLV 5’ and 3’ LTRs are shown in bold. The MLV packaging signal is shown in italics. The GFP coding sequence is underlined. The WPRE sequence is in bold underline.GAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGT TAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAAT TAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGT TACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCA TAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTG GCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAG CAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCC GCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTT AATAGTTTGCGCAACGTTGTTGCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCG TTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTCTCATGTTTGACAGCTTATCATCGATTAGTCCAATTTGTTAAAGACAGGATATCAGTGGTCCAGGCTCTAGTTTTGACTCAACAATATCACCAGCTGAAGCCTATAGAGTACGAGCCATAGATAAAATAAAAGATTTTATTTAGTCTCCAGAAAAAGGGGGGAATGAAAGACCCCACCTGTAGGTTTGGCAAGCTAGCTTAAGTAACGCCATTTTGCAAGGCATGGAAAAATACATAACTGAGAATAGAGAAGTTCAGATCAAGGTCAGGAACAGATGGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGTCCCCAGATGCGGTCCAGCCCTCAGCAGTTTCTAGAGAACCATCAGATGTTTCCAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGTTCGCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCACAACCCCTCACTCGGCGCGCCAGTCCTCCGATTGACTGAGTCGCCCGGGTACCCGTGTATCCAATAAACCCTCTTGCAGTTGCATCCGACTTGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTACCCGTCAGCGGGGGTCTTTCATTTGGAGGTTCCACCGAGATCGGGAGACCCCTGCCCAGGGACCACCGACCCACCACCGGGAGGT / L4GC7GGCCAGCAACTTA TCIGIG CIGICCGA TIGK 'IAGIGK 'TA TGACTGA 1'11'1 A TGCGCCTGCGTCGGTACTAGTTAGCTAACTAGCTCTGTATCTGGCGGACCCGTGGTGGAACTGACGAGTTCGGAACACCCGGCCGCAACCCTGGGAGACGTCCCAGGGACTTCGGGGGCCGTTTTTGTGGCCCGACCTGAGTCCAAAAATCCCGATCGTTTTGGACTCTTTGGTGCACCCCCCTTAGAGGA GGGA TA TGTGGTTCTGGTA GGAGA CGA GAACCTAAAACAGTTCCCGCCTCCGTCTGAATTTTTGCTTTCGGTTTGGGACCGAAGCCGCGCCGCGCGTCTTGTCTGCTGCAGCK CGTCTGTGTTGTCTCTGTCTGACTGTGTTTCTGTATTTGTCTGAGAATATGCATGGATCCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCTTGACCTACGGCGTGCAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAAGGTCTATATCACCGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGACCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAAGCTTCAATTGGTCGACAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCGTCGACGCGGCCGCCCATGGGCATGCCTCGAGCATGGGGGGAATTGCCGCTGGAATAGGAACAGGGACTACTGCTCTAATGGCCACTCAGCAATTCCAGCAGCTCCAAGCCGCAGTACAGGATGATCTCAGGGAGGTTGAAAAATCAATCTCTAACCTAGAAAAGTCTCTCACTTCCCTGTCTGAAGTTGTCCTACAGAATCGAAGGGGCCTAGACTTGTTATTTCTAAAAGAAGGAGGGCTGTGTGCTGCTCTAAAAGAAGAATGTTGCTTCTATGCGGACCACACAGGACTAGTGAGAGACAGCATGGCCAAATTGAGAGAGAGGCTTAATCAGAGACAGAAACTGTTTGAGTCAACTCAAGGATGGTTTGAGGGACTGTTTAACAGATCCCCTTGGTTTACCACCTTGATATCTACCATTATGGGACCCCTCATTGTACTCCTAATGATTTTGCTCTTCGGACCCTGCATTCTTAATCGATTAGTCCAATTTGTTAAAGACAGGATATCAGTGGTCCAGGCTCTAGTTTTGACTCAACAATATCACCAGCTGAAGCCTATAGAGTACGAGCCATAGATAAAATAAAAGATTTTATTTAGTCTCCAGAAAAAGGGGGGAATGAAAGACCCCACCTGTAGGTTTGGCAAGTCGAGGCTTTATACTCCTCCACACACCATCACTCACTCTTTCTCAATCCAAGCTTAAGTAACGCCATTTTGCAAGGCATGGAAAAATACATAACTGAGAATAGAGAAGTTCAGATCAAGGTCAGGAACAGATGGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGTCCCCAGATGCGGTCCAGCCCTCAGCAGTTTCTAGAGAACCATCAGATGTTTCCAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGTTCGCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCACAACCCCTCACTCGGCGCGCCAGTCCTCCGATTGACTGAGTCGCCCGGGTACCCGTGTATCCAATAAACCCTCTTGCAGTTGCATCCGACTTGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTACCCGTCAGCGGGGGTCTTTCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGG TAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAA GCAGCAGATTACGCGCAGAAAAAAAGGATCTCAA

[0164] In some embodiments, the recombinant integration deficient retroviral vector includes, from N-terminus to C-terminus, a 5’ LTR derived from HIV-1, a viral packaging signal, a cargo of interest, Tat / Rev, a WPRE sequence, and a 3’ LTR derived from HIV-1.

[0165] In some embodiments, the recombinant integration deficient retroviral vector comprises the nucleic acid sequence of SEQ ID NO: 35 shown below (the SV40 and CMV promoters below are used to boost viral titer in the producer cell and these promoters are not incorporated in functional form into the packaged virus). The HIV 5’ and 3’ LTRs are shown in bold. The HIV packaging signal is shown in italics. The GFP coding sequence is underlined. The HIV Tat / Rev sequence is shown in bold underline. The WPRE sequence is shown in italic underline. The HIV Env (containing a frameshift mutation) is shown in bold italics.GAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGT TAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAAT TAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGT TACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCA TAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTG GCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAG CAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCC GCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTT AATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCG TTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCC CCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGT AAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACT GTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCT GAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAAT ACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGG CGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGT GCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCGACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCCAGATATACGCGCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTCGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGCGCGTTTTGCCTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACTTGAAAGCGKKKGGGKKKCCKGKGGKGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCKGTKHKKGCGGGGXGKTGG1GTCKKAAGGAGAAGAACTGTTCACCGGAGTGGTCCCAATCCTGGTGGAGCTGGACGGAGAT GTCAATGGCCACAAGTTCAGCGTGAGCGGAGAGGGAGAAGGAGACGCTACATACGGCAAGCTGACTCTGAAATTCATTTGCACCACAGGGAAGCTGCCCGTGCCTTGGCCAA CCCTGGTCACTACCCTGACATACGGCGTCCAGTGTTTTAGCAGATATCCAGACCACA TGAAGCAGCATGATTTCTTTAAATCCGCCATGCCCGAGGGCTACGTGCAGGAACGGACAATCTTCTTTAAGGACGATGGAAACTATAAAACTAGAGCTGAGGTGAAGTTCGA AGGAGACACCCTGGTCAACAGGATCGAGCTGAAGGGCATTGACTTTAAAGAAGATGGGAATATTCTGGGACACAAGCTGGAGTACAACTACAACTCTCATAACGTGTATATCA TGGCAGATAAGCAGAAAAACGGCATTAAGGTCAATTTCAAAATCCGCCACAATATTGAAGACGGGAGCGTGCAGCTGGCCGATCATTACCAGCAGAACACACCTATCGGCGA CGGACCCGTGCTGCTGCCTGATAATCACTATCTGTCTACTCAGAGTGCCCTGTCAAAGGACCCAAACGAGAAACGAGATCATATGGTGCTGCTGGAGTTTGTCACCGCTGCTG GAATCACACTGGGCATGGATGAGCTGTACAAGTAACGGCCGGCCGTATACACAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAG GGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGATCCAGTTTGGTTAATTAAGCAAGAAATGGAGCCAGTAGATCCTAGACTAGAGCCCTGGAA GCATCCAGGAAGTCAGCCTAAAACTGCTTGTACCAATTGCTATTGTAAAAAGTG TTGCTTTCATTGCCAAGTTTGTTTCATGACAAAAGCCTTAGGCATCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACAGTCAGACTCATCAAGCTTCTCTATCAAAGCAGTAAGTAGTACATGTAATGCAACCTATAATAGTAGCA ATAGTAGCATTAGTAGTAGCAATAATAATAGCAATAGTTGTGTGGTCCATAGTAATC ATAGAATATAGGAAAATATTAAGACAAAGAAAAATAGACAGGTTAATTGATAGACT A AG AG GCAG AGACAG GGCAATGAGAGTGAAGGAGAAGTATCAGCACTTGTGGA GA TGGGGGTGGAAA TGGGGCA CCA TGCTCCTTGGGA TA TTGA TGA TCTGTA GT GCTACAGAAAAATTGTGGGTCACCGTCTATTATGGGGTACCTGTGTGGAAGGAAGCAA CCACCACTCTATTTTGTGCATCAGATGCTAAAGCATATATGATACAGAGGTACATAATG TTTGGGCCACACATGCCTGTGTACCCACAGACCCCAACCCACAAGAAGTAGTATTGGT AAA TGTGA CA GAAAA TTTTAA CA TGTGGAAAAA TGA CA TGGTA GAA CA GA TGCA TGA G GATATAATCAGTTTATGGGATCAAAGCCTAAAGCCATGTGTAAAATTAACCCCACTCTGTGTTAGTTTAAAGTGCACTGATTTGAAGAATGATACTAATACCAATAGTAGTAGCGGGA GAA TGA TAA TGGA GAAA GGA GA GA TAAAAAA CTGCTCTTTCAA TA TCA GCA CAA GC ATAAGAGATAAGGTGCAGAAAGAATATGCATTCTTTTATAAACTTGATATAGTACCAAT AGATAATACCAGCTATAGGTTGATAAGTTGTAACACCTCAGTCATTACACAGGCCTGT CCAAA GGTA TCCTTTGA GCCAA TTCCCA TA CA TTA TTGTGCCCCGGCTGGTTTTGCGA T TCTAAAATGTAATAATAAGACGTTCAATGGAACAGGACCATGTACAAATGTCAGCACA GTACAATGTACACATGGAATCAGGCCAGTAGTATCAACTCAACTGCTGTTAAATGGCA GTCTAGCAGAAGAAGATGTAGTAATTAGATCTGCCAATTTCACAGACAATGCTAAAAC CATAATAGTACAGCTGAACACATCTGTAGAAATTAATTGTACAAGACCCAACAACAAT ACAAGAAAAAGTATCCGTATCCAGAGGGGACCAGGGAGAGCATTTGTTACAATAGGA AAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATGCCA CTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATC TTTAAGCAATCCTCAGGAGGGGACCCAGAAATTGTAACGCACAGTTTTAATTGTGGAG GGGAA TTTTTCTA CTGTAA TTCAA CA CAA CTGTTTAA TA GTA CTTGGTTTAA TA GTA CT TGGAGTACTGAAGGGTCAAATAACACTGAAGGAAGTGACACAATCACACTCCCATGCA GAA TA AAA CAA TTTA TAAA CA TGTGGCA GGA A GTA GGAAAA GCA A TGTA TGCCCCTCC CA TCA GTGGA CAAA TTA GA TGTTCA TCAAA TA TTA CTGGGCTGCTA TTAA CAA GA GA T GGTGGTAA TAA CAA CAA TGGGTCCGA GA TCTTCA GA CCTGGA GGAGGCGA TA TGA GG GA CAA TTGGA GAA GTGAA TTA TA TAAA TA TAAA GTA GTA AAA A TTGAA CCA TTA GGAG TAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAA TA GGA GCTTTGTTCCTTGGGTTCTTGGGA GCA GCA GGAA GCA CT A TGGGCGCA GCGTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGATATAGTGCAGCAGCAGAA CAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGC ATCAAACAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGC TCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAA TGCTA GTTGGA GTAA TAAA TCTCTGGAA CA GA TTTGGAA TAA CA TGA CCTGGA TGGA G TGGGA CA GA GAAA TTAA CAA TTA CA CAA GCTTAA TA CA CTCCTTAA TTGAA GAA TCGC AA AA CCA GCAA GAA AA GAA TGAA C l l GAA TTA TTGGAA TTA GA TAAA TGGGCAA GTTT GTGGAA TTGGTTTAA CA TAA CAAA TTGGCTGTGGTA TA TAAAA TTA TTCA TAA TGA TA G TA GGA GGCTTGGTA GGTTTAA GAA TA GTTTTTGCTGTA CTTTCTA TA GTGAA TA GA GTT AGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAATCCCGAGGGGACCCG ACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGA TTA GTGAA CGGA TCCTTA GCA CTTA TCTGGGA CGA TCTGCGGA GCCTGTGCCTCTT CA GCTA CCA CCGCTTGA GA GA CTTA CTCTTGA TTGTAA CGA GGA TTGTGGAA CTTCTG GGACGCAGGGGGTGGGAAGCCCTCAAATATTGGTGGAATCTCCTACAATATTGGAGT CAGGAGCTAAAGAATAGTGCTGTTAGCTTGCTCAATGCCACAGCCATAGCAGTAGCTG AGGGGACAGATAGGGTTATAGAAGTAGTACAAGGAGCTTGTAGAGCTATTCGCCACAT ACCTAGAAGAATAAGACAGGGCTTGGAAAGGATTTTGCTATAAGATGGGTGGCGCGG CCGCCATGGGGGCTGGGGCTACTGGGAGGGCTATGGACGGACCAAGGCTGCTGCTG CTGCTGCTGCTGGGAGTCTCACTGGGGGGGGCCAAGGAAGCCTGTCCTACTGGGCTG TACACCCACAGCGGAGAATGCTGTAAGGCTTGTAACCTGGGAGAGGGAGTGGCTCA GCCTTGCGGAGCAAATCAGACCGTCTGCGAGCCATGTCTGGACTCCGTGACATTCTC TGATGTGGTCAGTGCCACTGAACCTTGCAAACCATGTACCGAGTGCGTGGGGCTGCA GTCTATGAGTGCTCCCTGTGTCGAGGCTGACGATGCAGTGTGCCGCTGTGCATACGG ATACTATCAGGATGAGACCACAGGCCGATGTGAAGCCTGCCGGGTCTGTGAGGCTG GATCAGGCCTGGTGTTTAGCTGCCAGGATAAGCAGAACACAGTGTGCGAGGAATGT CCAGACGGCACTTATTCCGATGAGGCCAATCATGTCGACCCCTGCCTGCCTTGTACC GTGTGCGAGGATACAGAACGGCAGCTGAGAGAATGTACCCGATGGGCAGACGCCGA GTGCGAGGAAATCCCCGGGAGGTGGATTACCCGCTCCACACCCCCTGAAGGATCAG ACAGCACAGCACCATCTACTCAGGAGCCAGAAGCACCACCAGAGCAGGATCTGATC GCAAGTACTGTCGCCGGCGTGGTCACTACCGTGATGGGGAGCTCCCAGCCCGTGGTC ACAAGAGGCACAACTGATAACCTGATCCCTGTGTACTGCTCTATTCTGGCAGCTGTG GTCGTGGGACTGGTGGCATATATTGCTTTCAAAAGGTGACTCGAGAAZCAACCTCZGG ATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTG GA TACGCTGCTTTAA TGCCTTTGTA TCA TGCTA TTGCTTCCCGTA TGGCTTTCA TTTTCTCCT CCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACG TGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCAC CTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATC GCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGT GGTGTTGTCGGGGAAGCTGACGTCm^ TCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTC CCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGA GTCGGATCTCCCTTTGGGCCGCCTCCCCGCCTCGAGACCTAGAAAAACATGGAGCAATCACAAGTAGCAATACAGCAGCTAACAATGCTGCTTGTGCCTGGCTAGAAGCACAA GAGGAGGAAGAGGTGGGTTTTCCAGTCACACCTCAGGTACCTTTAAGACCAATGAC TTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAG GGCTAATTCACTCCCAAAGAAGACAAGATATCCTTGATCTGTGGATCTACCACACACAAGGCTACTTCCCTGATTGGCAGAACTACACACCAGGGCCAGGGGTCAGA TATCCACTGACCTTTGGATGGTGCTACAAGCTAGTACCAGTTGAGCCAGATAAG GTAGAAGAGGCCAATAAAGGAGAGAACACCAGCTTGTTACACCCTGTGAGCCT GCATGGAATGGATGACCCTGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAGCATTTCATCACGTGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTG ACATCGAGCTTGCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGGCCT GGGCGGGACTGGGGAGTGGCGAGCCCTCAGATGCTGCATATAAGCAGCTGCTTTTT GCCTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAA CTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTG TGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAG TGTGGAAAATCTCTAGCAGGCGTTTCATGTGAGCAAAAGGCCAGCAAAAGGCCAGG AACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAG CATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAG ATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCG CTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCT CACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGC ACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGT CCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATT AGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTA CGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTT CGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTG GTTTTTTTGTTTGGAAGGAOGAGATTAGGGGGAGAAAAAAAGGATGTLAA

[0166] In some embodiments, the recombinant integration deficient retroviral vector comprises the nucleic acid sequence of SEQ ID NO: 36 shown below. The MLV 5’ and 3’ LTRs are shown in bold. The MLV packaging signal is shown in italics. The GFP coding sequence is underlined. The WPRE gamma component sequence is shown in italic underline.GAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTCTCATGTTTGACAGCTTATCATCGATTAGTCCAATTTGTTAAAGACAGGATATCAGTGGTCCAGGCTCTAGTTTTGACTCAACAATATCACCAGCTGAAGCCTATAGAGTACGAGCCATAGATAAAATAAAAGATTTTATTTAGTCTCCAGAAAAAGGGGGGAATGAAAGACCCCACCTGTAGGTTTGGCAAGCTAGCTTAAGTAACGCCATTTTGCAAGGCATGGAAAAATACATAACTGAGAATAGAGAAGTTCAGATCAAGGTCAGGAACAGATGGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGTCCCCAGATGCGGTCCAGCCCTCAGCAGTTTCTAGAGAACCATCAGATGTTTCCAGGGTGCCCCAAGGACTCAGCAATTCCAGCAGCTCCAAGCCGCAGTACAGGATGATCTCAGGGAGGTTGAAAAATCAATCTCTAACCTAGAAAAGTCTCTCACTTCCCTGTCTGAAGTTGTCCTACAGAATCGAAGGGGCCTAGACTTGTTATTTCTAAAAGAAGGAGGGCTGTGTGCTGCTCTAAAAGAAGAATGTTGCTTCTATGCGGACCACACAGGACTAGTGAGAGACAGCATGGCCAAATTGAGAGAGAGGCTTAATCAGAGACAGAAACTGTTTGAGTCAACTCAAGGATGGTTTGAGGGACTGTTTAACAGATCCCCTTGGTTTACCACCTTGATATCTACCATTATGGGACCCCTCATTGTACTCCTAATGATTTTGCTCTTCGGACCCTGCATTCTTAATCGATTAGTCCAATTTGTTAAAGACAGGATATCAGTGGTCCAGGCTCTAGTTTTGACTCAACAATATCACCAGCTGAAGCCTATAGAGTACGAGCCATAGATAAAATAAAAGATTTTATTTAGTCTCCAGAAAAAGGGGGGAATGAAAGACCCCACCTGTAGGTTTGGCAAGTCGAGGCTTTATACTCCTCCACACACCATCACTCACTCTTTCTCAATCCAAGCTTAAGTAACGCCATTTTGCAAGGCATGGAAAAATACATAACTGAGAATAGAGAAGTTCAGATCAAGGTCAGGAACAGATGGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGAACAGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGTCCCCAGATGCGGTCCAGCCCTCAGCAGTTTCTAGAGAACCATCAGATGTTTCCAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCAGTTCGCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCACAACCCCTCACTCGGCGCGCCAGTCCTCCGATTGACTGAGTCGCCCGGGTACCCGTGTATCCAATAAACCCTCTTGCAGTTGCATCCGACTTGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGACTACCCGTCAGCGGGGGTCTTTCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAA CAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGC CTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAG TTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTA GCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAHost Cells

[0167] In another aspect, the disclosure provides a host cell which contains the recombinant integration deficient retroviral vector of the present disclosure. The host cell can be for the production of viral vectors according to the first aspect of the disclosure.

[0168] Suitable host cells are those cells which are capable of producing viral vectors or viral vector particles when cultured under appropriate conditions. They are generally mammalian or human cells, for example HEK293T, HEK293, CAP, CAP-T or CHO cells, but can be, for example, insect cells such as SF9 cells.

[0169] The host cell may be a packaging cell line. A packaging cell for a retroviral vector may comprise gag, pol, env, and rev genes. The host cell may be a producer cell and comprise gag, pol, env and optionally rev genes and a retroviral vector genome.

[0170] In a typical recombinant retroviral vector for use in gene therapy, at least part of one or more of the gag-pol and env protein coding regions may be removed from the virus and provided by the packaging cell. This makes the viral vector replication-defective as the virus is capable of integrating its genome into a host genome but the modified viral genome is unable to propagate itself due to a lack of structural proteins.

[0171] Packaging cells are used to propagate and isolate quantities of viral vectors i.e., to prepare suitable titers of the retroviral vector for transduction of a target cell.

[0172] In some instances, propagation and isolation may entail isolation of the retroviral gag, pol and env genes and their separate introduction into a host cell to produce a packaging cell line. The packaging cell line produces the proteins required for packaging retroviral DNA but it cannot bring about encapsidation due to the lack of a packaging signal (e.g., a psi region).However, when a recombinant vector carrying a packaging signal (e.g., a psi region) is introduced into the packaging cell line, the helper proteins can package the psi-positive recombinant vector to produce the recombinant virus stock.

[0173] A summary of the available packaging lines is presented in “Retroviruses” (1997 Cold Spring Harbour Laboratory Press Eds: J M Coffin, S M Hughes, H E Varmus pp 449).

[0174] Packaging cells have also been developed in which the gag, pol and env (and, in some cases, rev) viral coding regions are carried on separate expression plasmids that are independently transfected into a packaging cell line, so that three recombinant events are required for wild type viral production.

[0175] Methods for introducing nucleic acids into production cells are well known in the art and have been described previously.

[0176] Stable cells may be packaging or producer cells. To generate producer cells from packaging cells the vector genome DNA construct may be introduced stably or transiently. Packaging / producer cells can be generated by transducing a suitable cell line with a retroviral vector which expresses one of the components of the packaging / producer cell, i.e., a genome, the gag-pol components and an envelope as described in WO 2004 / 022761.

[0177] Alternatively, the nucleic acid can be transfected into cells and then integration into the production cell genome occurs infrequently and randomly. The transfection methods may be performed using methods well known in the art. For example, the transfection process may be performed using calcium phosphate or commercially available formulations such as Lipofectamine™ 2000CD (Invitrogen, Calif), FuGENE® HD or polyethylenimine (PEI). Alternatively, modular constructs of the disclosure may be introduced into the production cell via electroporation. The skilled person will be aware of methods to encourage integration of the nucleic acids into production cells. For example, linearising a nucleic acid construct can help if it is naturally circular. Less random integration methodologies may involve the nucleic acid construct comprising of areas of shared homology with the endogenous chromosomes of the mammalian host cell to guide integration to a selected site within the endogenous genome. Furthermore, if recombination sites are present on the construct, then these can be used for targeted recombination. For example, the nucleic acid construct may contain a loxP site which allows for targeted integration when combined with Cre recombinase (i.e., using the Cre / lox system derived from Pl bacteriophage). Alternatively, or additionally, the recombination site is an att site (e.g., from X phage), wherein the att site permits site-directed integration in the presence of a lambda integrase. This would allow the retroviral genes to be targeted to a locus within the host cellular genome which allows for high and / or stable expression.

[0178] Other methods of targeted integration are well known in the art. For example, methods of inducing targeted cleavage of genomic DNA can be used to encourage targeted recombination at a selected chromosomal locus. These methods often involve the use of methods or systems to induce a double strand break (DSB) e.g., a nick in the endogenous genome to induce repair of the break by physiological mechanisms such as non-homologous end joining (NHEJ). Cleavage can occur through the use of specific nucleases such as engineered zinc finger nucleases (ZFN), transcription-activator like effector nucleases (TALENs), using CRISPR / Cas9 systems with an engineered crRNA / tracr RNA (‘single guide RNA’) to guide specific cleavage, and / or using nucleases based on the Argonaute system (e.g., from T. thermophilus).

[0179] Packaging / producer cell lines can be generated by integration of nucleic acids using methods of just retroviral transduction or just nucleic acid transfection, or a combination of both can be used.

[0180] Methods for generating retroviral vectors from production cells and in particular the processing of retroviral vectors are described in WO 2009 / 153563.

[0181] Production of retroviral vector from production cells can be via transfection methods, from production from stable cell lines which can include induction steps (e g., doxycycline induction) or via a combination of both. The transfection methods may be performed using methods well known in the art, and examples have been described previously.

[0182] Production cells, either packaging or producer cell lines or those transiently transfected with the retroviral vector encoding components are cultured to increase cell and virus numbers and / or virus titres. Culturing a cell is performed to enable it to metabolize, and / or grow and / or divide and / or produce viral vectors of interest according to the disclosure. This can be accomplished by methods well known to persons skilled in the art, and includes but is not limited to providing nutrients for the cell, for instance in the appropriate culture media. The methods may comprise growth adhering to surfaces, growth in suspension, or combinations thereof. Culturing can be done for instance in tissue culture flasks, tissue culture multiwell plates, dishes, roller bottles, wave bags or in bioreactors, using batch, fed-batch, continuous systems and the like. In order to achieve large scale production of viral vector through cell culture it is preferred in the art to have cells capable of growing in suspension. Suitable conditions for culturing cells are known (see e.g., Tissue Culture, Academic Press, Kruse and Paterson, editors (1973), and R.I. Freshney, Culture of animal cells: A manual of basic technique, fourth edition (Wiley-Liss Inc., 2000, ISBN 0-471-34889-9).

[0183] In one embodiment, cells are initially ‘bulked up’ in tissue culture flasks or bioreactors and subsequently grown in multi-layered culture vessels or large bioreactors (greater than 50 L) to generate the vector producing cells of the present disclosure.

[0184] In one embodiment, cells are grown in an adherent mode to generate the vector producing cells of the present disclosure.

[0185] In one embodiment, cells are grown in a suspension mode to generate the vector producing cells of the present disclosure.Viral Particles

[0186] The present disclosure also provides recombinant integration deficient retroviral particles comprising the retroviral vector constructs as described herein. In some embodiments, provided herein is one viral particle having the nucleic acid construct of the present disclosure and another viral particle having a different nucleic acid construct (e.g., to express an sgRNA). Thus, for example, a system or composition is provided that comprises two or more different viral particles, one comprising an IDRV as described herein wherein the cargo of interest is a Cas enzyme (whether wild-type, mutant, or fusion) and one comprising at least a pol III promoter controlling expression of a guide RNA molecule that can associate with the Cas enzyme.

[0187] A vector particle includes the following components: a vector genome, which may contain one or more cargos of interest, a nucleocapsid encapsi dating the nucleic acid, and a membrane surrounding the nucleocapsid.

[0188] By using producer / packaging cell lines, it is possible to propagate and isolate quantities of recombinant integration deficient retroviral particles (e.g., to prepare suitable titres of the viral vector particles) for subsequent transduction of, for example, a site of interest. Producer cell lines are usually better for large scale production or vector particles.

[0189] Producer cells / packaging cells can be of any suitable cell type. Producer cells are generally mammalian cells but can be, for example, insect cells.

[0190] Cells transfected with the retroviral vector encoding components are cultured to increase cell and virus numbers and / or virus titres. Culturing a cell is done to enable it to metabolize, and / or grow and / or divide and / or produce virus of interest according to thedisclosure. This can be accomplished by methods well known to persons skilled in the art, and includes but is not limited to providing nutrients for the cell, for instance in the appropriate culture media. The methods may comprise growth adhering to surfaces, growth in suspension, or combinations thereof. Culturing can be done for instance in tissue culture flasks, dishes, roller bottles or in bioreactors, using batch, fed-batch, continuous systems, hollow fiber, and the like, hi order to achieve large scale (continuous) production of virus through cell culture it is preferred in the art to have cells capable of growing in suspension. Suitable conditions for culturing cells are known (see e.g. Tissue Culture, Academic Press, Kruse and Paterson, editors (1973), and R.I. Freshney, Culture of animal cells: A manual of basic technique, fourth edition (Wiley- Liss Inc., 2000, ISBN 0-471-34889-9).

[0191] Cells can be initially 'bulked up' in tissue culture flasks and subsequently grown in multilayered culture vessels to generate the vector producing cells of the present disclosure.

[0192] In some embodiments, cells are grown in an adherent mode to generate the vector producing cells of the present disclosure.

[0193] In some embodiments, cells are grown in a batch mode to generate the vector producing cells of the present disclosure.

[0194] In some embodiments, the supernatant harvested from the cell culture is clarified. Clarification may be done by a filtration step, removing cell debris and other impurities. Suitable filters may utilize cellulose filters, regenerated cellulose fibers, cellulose fibers combined with inorganic filter aids (e g. diatomaceous earth, perlite, fumed silica), cellulose filters combined with inorganic filter aids and organic resins, or any combination thereof, and polymeric filters (examples include but are not limited to nylon, polypropylene, polyethersulfone) to achieve effective removal and acceptable recoveries. In general, a multiple stage process is preferable but not required. An exemplary two or three-stage process would consist of a coarse filter(s) to remove large precipitate and cell debris followed by polishing second stage filter(s) with nominal pore sizes greater than 0.2 micron but less than 1 micron. The optimal combination may be a function of the precipitate size distribution as well as other variables. In addition, single stage operations employing a relatively small pore size filter or centrifugation may also be used for clarification. More generally, any clarification approach including but not limited to dead-end filtration, microfiltration, centrifugation, or body feed of filter aids (e.g. diatomaceous earth) in combination with dead- end or depth filtration, which provides a filtrate of suitable clarity to notfoul the membrane and / or resins in the subsequent steps, will be acceptable to use in the clarification step of the present disclosure.

[0195] In some embodiments, depth filtration and membrane filtration is used. Commercially available products useful in this regard are for instance mentioned in WO 03 / 097797, p. 20- 21. Membranes that can be used may be composed of different materials, may differ in pore size, and may be used in combinations. They can be commercially obtained from several vendors.

[0196] In some embodiments, a nuclease is employed to degrade contaminating DNA / RNA, i.e. mostly host cell nucleic acids. Exemplary nucleases suitable for use in the present disclosure include Benzonase® Nuclease (EP 0229866) which attacks and degrades all forms of DNA and RNA (single stranded, double stranded linear or circular) or any other DNase and / or RNase commonly used within the art for the purpose of eliminating unwanted or contaminating DNA and / or RNA from a preparation.

[0197] In some embodiments, the vector suspension is subjected to ultrafiltration, Chromatography, Ion-Exchange Chromatography, Size-Exclusion Chromatography, Reversed- Phase Chromatography (RPC), Affinity Chromatography, Immobilised Metal Ion Affinity Chromatography (IMAC), Centrifugation, Filter-Sterilisation. Such methods are known in the art and described in WO 20091535.Pharmaceutical Compositions

[0198] In one aspect, the present disclosure also provides a pharmaceutical composition, which comprises a vector and a pharmaceutically acceptable carrier, diluent or excipient (including combinations thereof).

[0199] The pharmaceutical compositions may be for human or animal usage in human and veterinary medicine and will typically comprise any one or more of a pharmaceutically acceptable diluent, carrier, or excipient. Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro edit. 1985). The choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions may comprise as — or in addition to — the carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s).

[0200] Preservatives, stabilizers, dyes and even flavouring agents may be provided in the pharmaceutical composition. Examples of preservatives include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid. Antioxidants and suspending agents may be also used.

[0201] There may be different composition / formulation requirements dependent on the different delivery systems. By way of example, the pharmaceutical composition of the present dislocsure may be formulated to be delivered using a mini-pump or by a mucosal route, for example, as a nasal spray or aerosol for inhalation or ingestable solution, or parenterally in which the composition is formulated by an injectable form, for delivery, by, for example, an intravenous, intramuscular or subcutaneous route. Alternatively, the formulation may be designed to be delivered by both routes.

[0202] Where the pharmaceutical composition is to be delivered mucosally through the gastrointestinal mucosa, it should be able to remain stable during transit though the gastrointestinal tract; for example, it should be resistant to proteolytic degradation, stable at acid pH and resistant to the detergent effects of bile.

[0203] Where appropriate, the pharmaceutical compositions can be administered by inhalation, in the form of a suppository or pessary, topically in the form of a lotion, solution, cream, ointment or dusting powder, by use of a skin patch, orally in the form of tablets containing excipients such as starch or lactose or chalk, or in capsules or ovules either alone or in admixture with excipients, or in the form of elixirs, solutions or suspensions containing flavouring or colouring agents, or they can be injected parenterally, for example intravenously, intramuscularly or subcutaneously. For parenteral administration, the compositions may be best used in the form of a sterile aqueous solution which may contain other substances, for example enough salts or monosaccharides to make the solution isotonic with blood. For buccal or sublingual administration, the compositions may be administered in the form of tablets or lozenges which can be formulated in a conventional manner.

[0204] Typically, a physician will determine the actual dosage which will be most suitable for an individual subject and it will vary with the age, weight and response of the particular patient and severity of the condition. The dosages below are exemplary of the average case. There can, of course, be individual instances where higher or lower dosage ranges are merited.

[0205] The compositions (or component parts thereof) of the present disclosure may be administered orally. In addition, or in the alternative the compositions (or component partsthereof) of the present disclosure may be administered by direct injection. In addition, or in the alternative the compositions (or component parts thereof) of the present disclosure may be administered topically. In addition, or in the alternative the compositions (or component parts thereof) of the present disclosure may be administered by inhalation. In addition, or in the alternative the compositions (or component parts thereof) of the present disclosure may also be administered by one or more of: parenteral, mucosal, intramuscular, intravenous, subcutaneous, intraocular or transdermal administration means, and are formulated for such administration.

[0206] By way of further example, the pharmaceutical composition of the present disclosure may be administered in accordance with a regimen of 1 to 10 times per day, such as once or twice per day. The specific dose level and frequency of dosage for any particular patient may be varied and will depend upon a variety of factors including the activity of the specific compound employed, the metabolic stability and length of action of that compound, the age, body weight, general health, sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the particular condition, and the host undergoing therapy.

[0207] The term “administered” also includes but is not limited to delivery by a mucosal route, for example, as a nasal spray or aerosol for inhalation or as an ingestable solution; a parenteral route where delivery is by an injectable form, such as, for example, an intravenous, intramuscular or subcutaneous route.

[0208] Hence, the pharmaceutical composition of the present disclosure may be administered by one or more of the following routes: oral administration, injection (such as direct injection), topical, inhalation, parenteral administration, mucosal administration, intramuscular administration, intravenous administration, subcutaneous administration, intraocular administration or transdermal administration.METHODS OF THE DISCLOSUREMethod of Making Viral Vector Constructs and Particles

[0209] The present disclosure also provides methods of making the recombinant retroviral particles described herein.

[0210] The recombinant integration deficient retroviral vector is preferably “replication defective”, by which is meant that the genome does not comprise sufficient genetic informationalone to enable independent replication to produce infectious viral particles within the recipient cell. In some embodiments, the genome lacks a functional env, gag or pol gene.

[0211] As described above, the recombinant integration deficient retroviral vector construct includes one or more virus-derived long terminal repeats (LTR), a viral packaging signal, a nucleic acid sequence encoding a cargo of interest, and a post-transcriptional response element. The integration deficient retroviral vector does not comprise an exogenous promoter.

[0212] It is known that the separate expression of the components required to produce a retroviral vector particle on separate DNA sequences cointroduced into the same cell will yield retroviral particles carrying defective retroviral genomes that carry cargos of interest (e.g., Reviewed by Miller 1992). This cell is referred to as the producer cell and are described in more detail above.

[0213] A typical retroviral vector production system involves the separation of the viral genome from the essential viral packaging functions. These components are normally provided to the production cells on separate DNA expression cassettes (alternatively known as plasmids, expression plasmids, DNA constructs or expression constructs).

[0214] The vector genome carrying the cargo of interest is described herein.

[0215] The packaging functions include the gag / pol and env genes. These are required for the production of vector particles by the production cell. Providing these functions in trans to the genome facilitates the production of replication-defective viral vectors.

[0216] Production systems for retroviral vectors are typically 3-component systems requiring genome, gag / pol and env expression constructs. Production systems for some vectors may additionally require the accessory gene rev to be provided and for the vector genome to include the rev-responsive element (RRE). EIAV-based lentiviral vectors do not require rev to be provided in trans if an open-reading frame (ORF) is present within the genome (see WO 2003 / 064665).

[0217] Production of retroviral vectors involves either the transient co-transfection of the production cells with these DNA components or use of stable production cell lines wherein all the components are stably integrated within the production cell genome (e.g. Stewart H J, Fong- Wong L, Strickland I, Chipchase D, Kelleher M, Stevenson L, Thoree V, McCarthy J, Ralph G S, Mitrophanous K A and Radcliffe P A. (2011). Hum Gene Ther. March; 22 (3):357-69). An alternative approach is to use a stable packaging cell (into which the packaging components arestably integrated) and then transiently transfect in the vector genome plasmid as required (e.g., Stewart, H. J., M. A. Leroux-Carlucci, C. J. Sion, K. A. Mitrophanous and P. A. Radcliffe (2009). Gene Ther. June; 16 (6):805-14). It is also feasible that alternative, not complete, packaging cell lines could be generated (just one or two packaging components are stably integrated into the cell lines) and to generate vector the missing components are transiently transfected. The production cell may also express regulatory proteins such as a member of the tet repressor (TetR) protein group of transcription regulators (e.g., T-Rex, Tet-On, and Tet-Off), a member of the cumate inducible switch system group of transcription regulators (e.g., cumate repressor (CymR) protein), or an RNA-binding protein (e.g., TRAP -tryptophan-activated RNA- binding protein).

[0218] By using producer / packaging cell lines, it is possible to propagate and isolate quantities of retroviral vector particles (e.g., to prepare suitable titres of the retroviral vector particles) for subsequent transduction of, for example, a site of interest. Producer cell lines are usually better for large-scale production or vector particles.Method of Cargo Delivery and or Expression

[0219] In one aspect, provided herein is a method of delivering or introducing a nucleic acid to a cell. In some embodiments, the nucleic acid encodes one or more cargos of interest in the cell.

[0220] In one aspect, provided herein is a method of expressing one or more cargos of interest in a cell. In one aspect, provided herein is a method of expressing one or more cargos of interest in a subject in need thereof.

[0221] In one aspect, provided herein is a method of increasing expression of one or more cargos of interest in a cell or a subject in need thereof. In some embodiments, the expression of the one or more cargos from the retroviral vector or particle of the disclosure is higher compared with a corresponding retroviral vector or particle that comprises the exogenous promoter operably linked to the nucleic acid encoding the one or more cargos. In some embodiments, the expression of the one or more cargos is higher by at least about 2-fold, at least about 3 fold, at least about 4 fold, at least about 5 fold, at least about 8 fold, at least about 10 fold, at least about 15 fold, at least about 20 fold, at least about 25 fold, at least about 30 fold, at least about 40 fold, or at least about 50 fold. In some embodiments, the expression of the one or more cargos ishigher by at least about 2%, 3%, 4%, 5%, 8%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100% or more.

[0222] In one aspect, provided herein is a method of engineering a cell.

[0223] In one aspect, provided herein is a method of genetically modifying a cell.

[0224] Methods of the disclosure can comprise contacting or delivering the integration deficient retroviral vectors or particles of the disclosure to a cell, wherein the contacting does not result in integration of the vector or particle in the genome of the cell. In some embodiments, the contacting results in expression of the one or more cargos in the cell.

[0225] In some embodiments, the method is performed in vivo. In some embodiments, the method is performed in vitro or ex vivo. In some embodiments, the cell is derived from the subject in need thereof.Method of Editing a Gene in a Cell of Interest

[0226] The present disclosure also provides a method of editing a gene in a cell of interest. The method includes administering the recombinant integration deficient retroviral vector or particle as described herein to a cell of interest under conditions effective to edit a gene within the cell.

[0227] A cell can be an in vitro cell (e.g., established cultured cell line). A cell can be an ex vivo cell (cultured cell from an individual). A cell can be an in vivo cell (e.g., a cell in an individual). A cell can be an isolated cell. A cell can be a cell inside of an organism. A cell can be an organism. A cell can be a cell in a cell culture (e.g., in vitro cell culture). A cell can be one of a collection of cells. A cell can be a prokaryotic cell or derived from a prokaryotic cell. A cell can be a bacterial cell or can be derived from a bacterial cell. A cell can be an archaeal cell or derived from an archaeal cell. A cell can be a eukaryotic cell or derived from a eukaryotic cell. A cell can be a plant cell or derived from a plant cell. A cell can be an animal cell or derived from an animal cell. A cell can be an invertebrate cell or derived from an invertebrate cell. A cell can be a vertebrate cell or derived from a vertebrate cell. A cell can be a mammalian cell or derived from a mammalian cell. A cell can be a rodent cell or derived from a rodent cell. A cell can be a human cell or derived from a human cell. A cell can be a microbe cell or derived from a microbe cell. A cell can be a fungi cell or derived from a fungi cell. A cell can be an insect cell. A cell can be an arthropod cell. A cell can be a protozoan cell. A cell can be a helminth cell.

[0228] Suitable cells include a stem cell (e.g. an embryonic stem (ES) cell, an induced pluripotent stem (iPS) cell; a germ cell (e.g., an oocyte, a sperm, an oogonia, a spermatogonia, etc.); a somatic cell, e.g. a fibroblast, an oligodendrocyte, a glial cell, a hematopoietic cell, a neuron, a muscle cell, a bone cell, a hepatocyte, a pancreatic cell, etc.

[0229] Suitable cells include human embryonic stem cells, fetal cardiomyocytes, myofibroblasts, mesenchymal stem cells, cardiomyocytes, adipocytes, totipotent cells, pluripotent cells, blood stem cells, myoblasts, adult stem cells, bone marrow cells, mesenchymal cells, embryonic stem cells, parenchymal cells, epithelial cells, endothelial cells, mesothelial cells, fibroblasts, osteoblasts, chondrocytes, exogenous cells, endogenous cells, stem cells, hematopoietic stem cells, bone-marrow derived progenitor cells, myocardial cells, skeletal cells, fetal cells, undifferentiated cells, multi-potent progenitor cells, unipotent progenitor cells, monocytes, cardiac myoblasts, skeletal myoblasts, macrophages, capillary endothelial cells, xenogenic cells, allogenic cells, and post-natal stem cells.

[0230] In some cases, the cell is an immune cell, a neuron, an epithelial cell, an endothelial cell, or a stem cell. In some cases, the immune cell is a T cell, a B cell, a monocyte, a natural killer cell, a dendritic cell, or a macrophage. In some cases, the immune cell is a cytotoxic T cell. In some cases, the immune cell is a helper T cell. In some cases, the immune cell is a regulatory T cell (Treg).

[0231] In some cases, the cell is a stem cell. Stem cells include adult stem cells.

[0232] The recombinant integration deficient retroviral vector as described herein can be administered or delivered to a cell in vivo, in vitro, or ex vivo. In one embodiment, the recombinant integration deficient retroviral vector is administered or delivered in vivo. In one embodiment, the recombinant integration deficient retroviral vector is administered or delivered in vitro. In one embodiment, the recombinant integration deficient retroviral vector is administered or delivered ex vivo.SYSTEMS AND KITS

[0233] Also provided herein are various kits for the practice of a method described herein as well as written instructions for making and using the same. In particular, some embodiments of the disclosure provide kits for eliciting making an integration deficient retroviral vector as described herein. Some other embodiments relate to kits for methods of editing a gene of interestin a cell. For example, provided herein, in some embodiments, are kits that include one or more of the nucleic acid constructs, recombinant cells, viral particles, and / or pharmaceutical compositions as provided and described herein, as well as written instructions for making and using the same.

[0234] In some embodiments, the kits of the disclosure further include one or more means useful for the administration of any one of the provided nucleic acid constructs, recombinant cells, viral particles, and / or pharmaceutical compositions to a subject. For example, in some embodiments, the kits of the disclosure further include one or more syringes (including pre-filled syringes) and / or catheters (including pre-filled syringes) used to administer any one of the provided nucleic acid constructs, recombinant cells, viral particles, and / or pharmaceutical compositions to a subject. In some embodiments, a kit can have one or more additional therapeutic agents that can be administered simultaneously or sequentially with the other kit components for a desired purpose, e.g., for diagnosing, preventing, or treating a condition in a subject in need thereof.

[0235] Any of the above-described kits can further include one or more additional reagents, where such additional reagents can be selected from: dilution buffers; reconstitution solutions, wash buffers, control reagents, control expression vectors, negative controls, positive controls, reagents suitable for in vitro production of the provided nucleic acid constructs, recombinant cells, viral particles, and / or pharmaceutical compositions of the disclosure.

[0236] In some embodiment, a system is provided that includes a first recombinant integration deficient retroviral vector comprising one or more virus-derived long terminal repeats (LTR); a viral packaging signal; a nucleic acid sequence encoding a cargo of interest; and a post- transcriptional response element, wherein the integration deficient retroviral vector does not comprise an exogenous promoter; and at least one second vector comprising one or more nucleic acid sequences required for virus assembly.

[0237] In some embodiments, the components of a kit can be in separate containers. In some other embodiments, the components of a kit can be combined in a single container. Accordingly, in some embodiments of the disclosure, the kit includes one or more of the nucleic acid constructs, recombinant cells, recombinant polypeptides, and / or pharmaceutical compositions as provided and described herein in one container (e.g., in a sterile glass or plastic vial) and a further therapeutic agent in another container (e.g., in a sterile glass or plastic vial).

[0238] In another embodiment, the kit includes a combination of the compositions described herein, including one or more nucleic acid constructs, recombinant cells, and / or recombinant polypeptides of the disclosure in combination with one or more further therapeutic agents formulated together, optionally, in a pharmaceutical composition, in a single, common container.

[0239] If the kit includes a pharmaceutical composition for parenteral administration to a subject, the kit can include a device (e.g, an injection device or catheter) for performing such administration. For example, the kit can include one or more hypodermic needles or other injection devices as discussed above containing one or more nucleic acid constructs, recombinant cells, and / or recombinant polypeptides of the disclosure.

[0240] In some embodiments, a kit can further include instructions for using the components of the kit to practice the methods disclosed herein. For example, the kit can include a package insert including information concerning the pharmaceutical compositions and dosage forms in the kit. Generally, such information aids patients and physicians in using the enclosed pharmaceutical compositions and dosage forms effectively and safely. For example, the following information regarding a combination of the disclosure may be supplied in the insert: pharmacokinetics, pharmacodynamics, clinical studies, efficacy parameters, indications and usage, contraindications, warnings, precautions, adverse reactions, overdosage, proper dosage and administration, how supplied, proper storage conditions, references, manufacturer / distributor information and intellectual property information.

[0241] The instructions for practicing the methods are generally recorded on a suitable recording medium. For example, the instructions can be printed on a substrate, such as paper or plastic, etc. The instructions can be present in the kit as a package insert, in the labeling of the container of the kit or components thereof (e.g., associated with the packaging or subpackaging), etc. The instructions can be present as an electronic storage data file present on a suitable computer readable storage medium, e.g., CD-ROM, diskette, flash drive, etc. In some instances, the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source (e.g., via the internet), can be provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and / or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions can be recorded on a suitable substrate.

[0242] All publications and patent applications mentioned in this disclosure are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0243] No admission is made that any reference cited herein constitutes prior art. The discussion of the references states what their authors assert, and the Applicant reserves the right to challenge the accuracy and pertinence of the cited documents. It will be clearly understood that, although a number of information sources, including scientific journal articles, patent documents, and textbooks, are referred to herein; this reference does not constitute an admission that any of these documents forms part of the common general knowledge in the art.

[0244] The discussion of the general methods given herein is intended for illustrative purposes only. Other alternative methods and alternatives will be apparent to those of skill in the art upon review of this disclosure, and are to be included within the spirit and purview of this application.

[0245] Additional embodiments are disclosed in further detail in the following examples, which are provided by way of illustration and are not in any way intended to limit the scope of this disclosure or the claims.EXAMPLES

[0246] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, cell biology, biochemistry, nucleic acid chemistry, and immunology, which are well known to those skilled in the art. Such techniques are explained fully in the literature, such as Sambrook, J., & Russell, D. W. (2012). Molecular Cloning: A Laboratory Manual (4th ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory and Sambrook, J., & Russel, D. W. (2001). Molecular Cloning: A Laboratory Manual (3rd ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory (jointly referred to herein as “Sambrook”); Ausubel, F. M. (1987). Current Protocols in Molecular Biology. New York, NY: Wiley (including supplements through 2014); Bollag, D. M. et al. (1996). Protein Methods. New York, NY: Wiley-Liss; Huang, L. et al. (2005). Nonviral Vectors for Gene Therapy. San Diego: Academic Press; Kaplitt, M. G. et al. (1995). Viral Vectors: Gene Therapy and Neuroscience Applications. San Diego, CA: Academic Press; Lefkovits, I. (1997). The Immunology Methods Manual: The Comprehensive Sourcebook of Techniques. San Diego, CA: Academic Press; Doyle, A. et al. (1998). Cell and Tissue Culture: Laboratory Procedures in Biotechnology. New York, NY: Wiley; Mullis, K. B., Ferre, F. & Gibbs, R. (1994). PCR: ThePolymerase Chain Reaction. Boston: Birkhauser Publisher; Greenfield, E. A. (2014). Antibodies: A Laboratory Manual (2nd ed.). New York, NY: Cold Spring Harbor Laboratory Press;Beaucage, S. L. et al. (2000). Current Protocols in Nucleic Acid Chemistry. New York, NY: Wiley, (including supplements through 2014); and Makrides, S. C. (2003). Gene Transfer and Expression in Mammalian Cells. Amsterdam, NL: Elsevier Sciences B.V., the disclosures of which are incorporated herein by reference.

[0247] Additional embodiments are disclosed in further detail in the following examples, which are provided by way of illustration and are not in any way intended to limit the scope of this disclosure or the claims.EXAMPLE 1Materials and Methods

[0248] Cell lines. Cell lines including human embryonic kidney (HEK)-293T (CRL-11268) and Jurkat (CRL-2899) cells were purchased from American Type Culture Collection. HEK- 293 T cells were cultured in Dulbecco’s modified Eagle’s Medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS), 2 mM glutamine, 1000 U / mL penicillin and 100 mg / mL streptomycin. Jurkat cells were cultured in RPMI medium supplemented with 10% heat- inactivated FBS, 2 mM glutamine, 1000 U / mL penicillin and 100 mg / mL streptomycin. All cells were maintained in a 37°C incubator with 5% CO2.

[0249] Retroviral plasmids. Plasmid pCMV-intron expresses wild-type Gag and Pol from NB-tropic Moloney murine leukemia virus, MLV (Soneoka, Y., et al., A transient three-plasmid expression system for the production of high titer retroviral vectors. Nucleic Acids Res, 1995. 23(4): p. 628-33). pCMV-intron D184A-IN is an integrase defective mutant of pCMV-intron created by site directed mutagenesis described previously (Wang, G.Z., Y. Wang, and S.P. Goff, Histones Are Rapidly Loaded onto Unintegrated Retroviral DNAs Soon after Nuclear Entry. Cell Host Microbe, 2016. 20(6): p. 798-809). pMD.G expresses the vesicular stomatitis virus (VSV) envelope glycoprotein. pNCA-GFP is a replication-defective single-round MLV transfer vector described previously (Ooi, S.K., et al., Dynamic instability of genomic methylation patterns in pluripotent stem cells. Epigenetics Chromatin, 2010. 3(1): p. 17). To generate pNCA-EFla-GFP, full length EFla promoter were PCR amplified using the following primers (Forward: GTCTGAGAATATGCATGGATCCGGGCAGAGCGCACATCGCCC (SEQ ID NO: 37),Reverse: CCTCGCCCTTGCTCACCATGGATCCTGAAATGGAAGAAAAAAACTTTGAACC (SEQ ID NO: 38)) and cloned into BamHI sites of pNCA-GFP via Sequence and Ligation Independent Cloning (SLIC) cloning as described (Li, M.Z. and S.J. Elledge, Harnessing homologous recombination in vitro to generate recombinant DNA via SLIC. Nat Methods, 2007. 4(3): p. 251- 6). To generate pNCA-GFP- WPRE, full length Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) were PCR amplified using the following primers (Forward: GCTTCAATTGGTCGACAATCAACCTCTGGATTACAAAATTTGTGA (SEQ ID NO: 39), Reverse: CCCATGGGCGGCCGCGTCGACGCGGGGAGGCGGCCCAAA (SEQ ID NO: 40)) and cloned into Sall sites of pNCA-GFP via SLIC cloning. To generate pNCA-EFla-GFP- WPRE, full length EFla promoter were PCR amplified using the following primers (Forward: GTCTGAGAATATGCATGGATCCGGGCAGAGCGCACATCGCCC (SEQ ID NO: 41), Reverse:CCTCGCCCTTGCTCACCATGGATCCTGAAATGGAAGAAAAAAACTTTGAACC (SEQ ID NO: 42)) and cloned into BamHI sites of pNCA-GFP-WPRE via SLIC cloning. All plasmids were verified by whole plasmid sequencing (Primordium Labs).

[0250] Lentiviral plasmids. Plasmid pCMVR8.2 expresses Human Immunodeficiency virus 1 (HIV-1) Gag / Pol, Tat and Rev and was a gift from Didier Trono (Addgene plasmid #12263). pCMVR8.2-D64A is an integrase defective mutant of pCMVR8.2 created by site directed mutagenesis using primers (Forward: TCTAAATGTGTACAAGCTAGCTGCCATATTC (SEQ ID NO: 43), Reverse: GAATATGGCAGCTAGCTTGTACACATTTAGA (SEQ ID NO: 44)). pHIV-1 LTR-GFP is a reporter vector that retains complete LTRs, tat, and rev, but has a frameshift mutation in env, an ngfr reporter gene in place of nef, and gfp in place of gag, pol, vif, and vpr as previously described (Yurkovetskiy, L., et al., Primate immunodeficiency virus proteins Vpx and Vpr counteract transcriptional repression of proviruses by the HUSH complex. Nat Microbiol, 2018. 3(12): p. 1354-1361). To generate pHIV-1 LTR-GFP-WPRE, full length WPRE were PCR amplified using the following primers (Forward: GCTTTCAAAAGGTGACTCGAGAATCAACCTCTGGATTACAAAATTTGTGA, (SEQ ID NO: 45) Reverse: CATGTTTTTCTAGGTCTCGAGGCGGGGAGGCGGCCCAAA (SEQ ID NO: 46)) and cloned into Xhol sites of pHIV-1 LTR-GFP via ligation. To generate pSIN-L TREE la-GFP -WPRE, full length EFla promoter were PCR amplified using the following primers(Forward: CAAAATTTTATCGATGGGCAGAGCGCACATCGCCC (SEQ ID NO: 47), Reverse: GCGACCGGTGGATCCTGAAATGGAAGAAAAAAACTTTGAACC (SEQ ID NO: 48)) and cloned into

[0251] pLV-eGFP, a gift from Pantelis Tsoulfas (Addgene plasmid #36083) that has been digested with BspDI and BamHI via ligation. To generate pSIN-LTR-EFla-GFP-deltaWPRE, pSIN-EFla-GFP-WPRE was digested with Sall and Kpnl to remove the WPRE sequence, followed by blunting of incompatible DNA ends using Quick Blunting Kit (NEB) and blunt-end ligation. All plasmids were verified by whole plasmid sequencing (Primordium Labs).

[0252] Virus production. Integration-deficient retroviral reporter viruses were produced by HEK-293T cell transfection with either 8 pg of respective GFP transfer vectors (pNCA-GFP, pNCA-EFla-GFP, pNCA-GFP- WPRE, or pNCA-EFla-GFP-WPRE), 4 pg of pCMV-intron D184A-IN, and 4 pg of pMD.G DNAs using Lipofectamine 3000 (ThermoFisher Scientific) according to the manufacturer’s instructions. Integration-deficient lentiviral reporter viruses were produced by HEK-293T cell transfection with either 8 pg of respective GFP transfer vectors (pHIV-LTR-GFP, pHIV-LTR-GFP-WPRE, pSIN-LTR-EFla-GFP-WPRE, or pSIN-LTR-EFla- GFP-deltaWPRE), 4 pg of pCMV delta R8.2 D64A-IN, and 4 pg of pMD.G DNAs using Lipofectamine 3000 (ThermoFisher Scientific) according to the manufacturer’s instructions. All reporter viruses were harvested 48 hr later, filtered (0.45 pm) and used directly for infection assays.

[0253] Retroviral Transduction Assay and Flow Cytometry Analysis. For transduction of Jurkat cells, 0.5 million cells were combined with 0.5 mL of unconcentrated virus in the presence of 8 pg / mL of Polybrene (EMD Millipore), cells were then transduced by spin infection at 1,800 rpm for 60 minutes at 37°C. At 48 hrs post infection, cells were diluted using flow cytometry buffer (PBS with 1% BSA), and subjected to flow cytometry using automated cell analyzer (Attune NxT Flow Cytometer, Thermo Fisher Scientific).EXAMPLE 2Modified Integration Deficient Retroviral Vectors Exhibit Increased Transgene Expression

[0254] Flow cytometry analysis of Jurkat cells infected with VSV-G pseudotyped integrase defective mutant (D184A) MLV-GFP reporter viruses (see FIG. 1) at 2 days post-infection was performed as shown in FIG. 2. Y-axis shows % of GFP positive cells. The presence of WPREdownstream of GFP, and in the absence of an ectopic EFla promoter (vector design 3) results in the highest GFP expression compared to vectors lacking both ectopic promoter and WPRE (vector design 1), vectors containing an ectopic EFla promoter alone (vector design 2) and vectors containing both ectopic EFla promoter and WPRE (vector design 4).EXAMPLE 3Modified Integration Deficient Lentiviral Vectors Exhibit Increased Transgene Expression

[0255] Flow cytometry analysis of Jurkat cells infected with VSV-G pseudotyped integrase defective mutant (D64A) lentiviral GFP reporter viruses (see FIG. 3) at 2 days post-infection was performed as shown in FIG. 4. Y-axis shows % of GFP positive cells. Vectors containing full length LTRs and WPRE downstream of GFP in the absence of an ectopic EFla promoter (vector design 3) results in the highest GFP expression compared to vectors containing full length LTR but lacking an ectopic EFla promoter or WPRE (vector design 1), vectors containing truncated self-inactivating LTR (SIN-LTR) and an ectopic EFla promoter but no WPRE (vector design 2), and vectors containing SIN-LTR, ectopic EFla promoter and WPRE (vector design 4).EXAMPLE 4Modified Integration Deficient Retroviral Vectors Containing Minimal PRE Sequence Exhibit Increased Transgene Expression

[0256] Flow cytometry analysis of HeLa cells infected with VSV-G pseudotyped integrase defective mutant (D184A) MLV-GFP reporter viruses (see FIG. 5) at 2 days post-infection was performed as shown in FIG. 6. Y-axis shows % of GFP positive cells. Compared to vectors lacking both ectopic promoter and WPRE (vector design 1), the presence of minimal WPRE sequence (gamma component alone) downstream of GFP, and in the absence of an ectopic EF la promoter (vector design 3) results in high GFP expression to the same extent as vectors containing the full WPRE sequence downstream of GFP (vector design 2).EMBODIMENTS

[0257] Embodiment 1. A recombinant integration deficient retroviral vector comprising a nucleic acid comprising:one or more virus-derived long terminal repeats (LTR); a viral packaging signal; a nucleic acid sequence encoding one or more cargos of interest; and a post-transcriptional response element, wherein the integration deficient retroviral vector does not comprise an exogenous promoter operably linked to the nucleic acid sequence encoding the one or more cargos of interest.

[0258] Embodiment 2. The recombinant integration deficient retroviral vector according to embodiment 2, wherein the one or more virus-derived LTRs are derived from a murine leukemia virus (MLV), Bovine leukemia virus (BLV), Human T-lymphotropic virus 1 (HTLV 1), Human T- lymphotropic virus 2 (HTLV 2), Gibbon ape leukemia virus (GALV), Feline leukemia virus (FeLV), Porcine endogenous retroviruses (PERV), Feline Foamy Virus (FeFV), Bovine foamy virus (BFV), Mouse mammary tumor virus (MMTV), Jaagsiekte sheep retrovirus (JSRV), Mason-Pfizer monkey virus (MPMV), Avian sarcoma leukosis virus (ALV), Rous sarcoma virus (RSV), Human Endogenous Retrovinis-W (HERV-W), or a Human endogenous retrovirus K (HERV-K).

[0259] Embodiment 3. Tire recombinant integration deficient retroviral vector according to any one of embodiments 1 or 2. wherein the vector is derived from a murine leukemia vims (MLV), Bovine leukemia vims (BLV), Human T-lymphotropic vims 1 (HTLV 1). Human T-lymphotropic vims 2 (HTLV 2). Gibbon ape leukemia vims (GALV). Feline leukemia vims (FeLV), Porcine endogenous retrovimses (PERV), Feline Foamy Vims (FeFV), Bovine foamy vims (BFV), Mouse mammary tumor vims (MMTV), Jaagsiekte sheep retrovims (JSRV), Mason-Pfizer monkey vims (MPMV), Avian sarcoma leukosis vims (ALV), Rous sarcoma vims (RSV), Human Endogenous Retrovims-W (HERV-W), or a Human endogenous retrovims K (HERV-K).

[0260] Embodiment 4. The recombinant integration deficient retroviral vector according to embodiment 1, wherein the vector is a simple retroviral vector.

[0261] Embodiment 5. The recombinant integration deficient retroviral vector according to embodiment 1, wherein the vector is a complex retroviral vector.

[0262] Embodiment 6. Tire recombinant integration deficient retroviral vector according to embodiment 4, wherein the one or more virus-derived LTRs are derived from a MLV. GALV, FeLV, PERV, BFV, MMTV, JSRV, MPMV. ALV, or RSV.

[0263] Embodiment 7. The recombinant integration deficient retroviral vector according to embodiment 5, wherein the one or more virus-derived LTRs are derived from a HIV-1, FIV, EIAV, HIV- 2, SIV, HERV-W, HERV-K, BLV, HTLV-1, or HTLV-2.

[0264] Embodiment 8. Tire recombinant integration deficient retroviral vector according to any- preceding embodiment, wherein the one or more virus-derived LTRs are self-inactivating (SIN) LTRs.

[0265] Embodiment 9. The recombinant integration deficient retroviral vector according to any one of embodiments 7 or 8, wherein the vector is derived from HIV.

[0266] Embodiment 10. The recombinant integration deficient retroviral vector according to any preceding embodiment, wherein the vector further comprises a nucleic acid sequence encoding a HIV Tat protein and / or a Rev protein.

[0267] Embodiment 11. The recombinant integration deficient retroviral vector according to any preceding embodiment, wherein the post-transcriptional response element is selected from the group consisting of a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) and a Hepatitis B Virus Posttranscriptional Regulatory Element (HPRE).

[0268] Embodiment 12. Tire recombinant integration deficient retroviral vector according to any preceding embodiment, wherein the nucleic acid sequence encoding one or more cargos of interest encodes two cargos of interest.

[0269] Embodiment 13. The recombinant integration deficient retroviral vector according to embodiment 12, wherein the nucleic acid sequence comprises coding sequences for two polypeptide cargos of interest and an IRES or P2A sequence between the coding sequences.

[0270] Embodiment 14. The recombinant integration deficient retroviral vector according to any preceding embodiment, wherein the one or more cargos of interest are selected from the group consisting of gene-editing nucleases, endonuclease deficient Cas, endonuclease deficient Cas effectors, endonuclease deficient Cas enzymes, engineered DNA binding proteins, base editors, prime editors, RNA interference (RNAi), RNA targeting systems, CRISPR DNA binding proteins, CRISPR nickases, recombinases, integrases, programmable integrases, transposons, retrotransposons, DNA polymerases, reverse transcriptases, transposases, chimeric antigen receptors (CAR), transcription factors, caspases, natural proteases, programmable proteases, reporter genes, and selection markers.

[0271] Embodiment 15. The recombinant integration deficient retroviral vector according to embodiment 14, wherein the gene-editing nuclease is selected from the group consisting of zinc finger nucleases (ZFNs), Transcription Activator-Like Effector Nucleases (TALENs), and nucleases of the CRISPR / Cas system.

[0272] Embodiment 16. The recombinant integration deficient retroviral vector according to embodiment 15. wherein the gene-editing nuclease is Cas9.

[0273] Embodiment 17. A cell comprising the recombinant integration deficient retroviral vector according to any preceding embodiment.

[0274] Embodiment 18. A composition comprising the recombinant integration deficient retroviral vector of embodiments 1-16 or the cell of embodiment 17.

[0275] Embodiment 19. A recombinant integration deficient retroviral particle comprising a nucleic acid comprising: one or more virus-derived long terminal repeats (LTR); a viral packaging signal; a nucleic acid sequence encoding one or more cargos of interest; and a post-transcriptional response element. wherein the nucleic acid does not comprise an exogenous promoter operably linked to the nucleic acid sequence encoding the one or more cargos of interest.

[0276] Embodiment 20. The recombinant integration deficient retroviral particle according to embodiment 19, wherein the one or more virus-derived LTRs are derived from a murine leukemia virus (MLV), Bovine leukemia virus (BLV), Human T-lymphotropic virus 1 (HTLV 1), Human T- lymphotropic virus 2 (HTLV 2). Gibbon ape leukemia virus (GALV). Feline leukemia virus (FeLV), Porcine endogenous retroviruses (PERV), Feline Foamy Virus (FeFV), Bovine foamy virus (BFV), Mouse mammary tumor virus (MMTV), Jaagsiekte sheep retrovirus (JSRV), Mason-Pfizer monkey virus (MPMV), Avian sarcoma leukosis virus (ALV), Rous sarcoma virus (RSV), Human Endogenous Retrovirus-W (HERV-W), or Human endogenous retrovirus K (HERV-K).

[0277] Embodiment 21. The recombinant integration deficient retroviral particle according to any one of embodiments 19 or 20, wherein the viral particle is derived from a murine leukemia virus (MLV), Bovine leukemia virus (BLV), Human T-lymphotropic virus 1 (HTLV 1), Human T-lymphotropic virus 2 (HTLV 2), Gibbon ape leukemia virus (GALV), Feline leukemia virus (FeLV), Porcine endogenous retroviruses (PERV), Feline Foamy Virus (FeFV), Bovine foamy virus (BFV), Mouse mammary tumor virus (MMTV), Jaagsiekte sheep retrovirus (JSRV), Mason-Pfizer monkey virus (MPMV), Avian sarcoma leukosis virus (ALV), Rous sarcoma virus (RSV), Human Endogenous Retrovirus-W (HERV- W), or Human endogenous retrovirus K (HERV-K).

[0278] Embodiment 22. The recombinant integration deficient retroviral particle according to embodiment 19, wherein the viral particle is derived from a simple retrovirus.

[0279] Embodiment 23. The recombinant integration deficient retroviral particle according to embodiment 19, wherein the viral particle is derived from a complex retrovirus.

[0280] Embodiment 24. The recombinant integration deficient retroviral particle according to embodiment 22. wherein the one or more virus-derived LTRs are derived from MLV. GALV. FeLV, PERV, BFV, MMTV, JSRV, MPMV, ALV, or RSV

[0281] Embodiment 25. The recombinant integration deficient retroviral particle according to embodiment 23, wherein the one or more virus-derived LTRs arc derived from HIV-1, FIV, EIAV, HIV- 2, SIV, HERV-W, HERV-K, BLV, HTLV-1, or HTLV-2.

[0282] Embodiment 26. The recombinant integration deficient retroviral particle according to embodiment 20-25, wherein the one or more virus-derived LTRs are self-inactivating (SIN) LTRs.

[0283] Embodiment 27. The recombinant integration deficient retroviral particle according to any one of embodiments 23 or 24, wherein the viral particle is derived from HIV.

[0284] Embodiment 28. The recombinant integration deficient retroviral particle according to embodiment 19-27, wherein the nucleic acid further comprises a nucleic acid sequence encoding a HIV Tat protein and / or a Rev protein.

[0285] Embodiment 29. The recombinant integration deficient retroviral particle according to embodiment 19-28, wherein the post -transcriptional response element is selected from the group consisting of Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) and Hepatitis B Virus Posttranscriptional Regulatory Element (HPRE).

[0286] Embodiment 30. The recombinant integration deficient retroviral vector according to any preceding embodiment, wherein the nucleic acid sequence encodes two cargos of interest.

[0287] Embodiment 31. The recombinant integration deficient retroviral vector according to embodiment 30, wherein the nucleic acid sequence comprises coding sequences for two polypeptide cargos of interest and an IRES or P2A sequence between the coding sequences.

[0288] Embodiment 32. The recombinant integration deficient retroviral particle according to embodiment 19-31, wherein the one or more cargos of interest are selected from tire group consisting of gene-editing nucleases, endonuclease deficient Cas, endonuclease deficient Cas effectors, endonuclease deficient Cas enzymes, engineered DNA binding proteins, base editors, prime editors, RNA interference (RNAi), RNA targeting systems, CRISPR DNA binding proteins, CRISPR nickases, recombinases, integrases, programmable integrases, transposons, retrotransposons, DNA polymerases, reverse transcriptases, transposases, chimeric antigen receptors (CAR), transcription factors, caspases, natural proteases, programmable proteases, reporter genes, and selection markers.

[0289] Embodiment 33. The recombinant integration deficient retroviral particle according to embodiment 32, wherein the gene-editing nuclease is selected from the group consisting of zinc finger nucleases (ZFNs), Transcription Activator-Like Effector Nucleases (TALENs), and nucleases of the CRISPR / Cas system.

[0290] Embodiment 34. The recombinant integration deficient retroviral particle according to embodiment 33. wherein the gene-editing nuclease is Cas9.

[0291] Embodiment 35. A system comprising: a first recombinant integration deficient retroviral vector nucleic acid comprising: one or more virus-derived long terminal repeats (LTR); a viral packaging signal;a nucleic acid sequence encoding one or more cargos of interest; and a post-transcriptional response element, wherein the integration deficient retroviral vector nucleic acid does not comprise an exogenous promoter operably linked to the nucleic acid sequence encoding the cargo of interest; and at least one second vector comprising one or more nucleic acid sequences required for virus assembly.

[0292] Embodiment 36. The system of embodiment 35, wherein the first recombinant integration deficient retroviral vector nucleic acid comprises the following in 5’ to 3’ order: a first LTR, the viral packaging signal, the nucleic acid sequence encoding the one or more cargos of interest, the post- transcriptional response element, and a second LTR.

[0293] Embodiment 37. The system of embodiment 35 or embodiment 36, wherein the nucleic acid sequence encodes two cargos of interest.

[0294] The system of embodiment 38, wherein the nucleic acid sequence comprises coding sequences for two polypeptide cargos of interest and an IRES or P2A sequence between the coding sequences.

[0295] Embodiment 39. A method of editing a gene in a cell of interest, the method comprising: administering the recombinant integration deficient retroviral vector of any one of embodiments 1-16 to a cell of interest under conditions effective to edit a gene within said cell.

[0296] Embodiment 40. A recombinant integration deficient retroviral vector comprising a nucleic acid comprising: one or more virus-derived long terminal repeats (LTR); a viral packaging signal; a nucleic acid sequence encoding one or more cargos of interest; a post-transcriptional response element, a pol Ill-based promoter, and a nucleic acid sequence encoding a guide RNA, wherein the pol Ill-based promoter is the only exogenous promoter in the nucleic acid.

[0297] Embodiment 41. The recombinant integration deficient retroviral vector of embodiment 40, wherein the nucleic acid comprises tire following in 5 ' to 3 ’ order: a first virus-derived long terminal repeat (LTR); a viral packaging signal; a nucleic acid sequence encoding one or more cargos of interest; a post-transcriptional response element, a pol Ill-based promoter, a nucleic acid sequence encoding a guide RNA, and a second virus-derived long terminal repeat (LTR), wherein the pol Ill-based promoter is the only exogenous promoter in the nucleic acid.

[0298] Embodiment 42. The recombinant integration deficient retroviral vector according to embodiment 40 or embodiment 41, wherein the one or more virus-derived LTRs are derived from murineleukemia virus (MLV), Bovine leukemia virus (BLV), Human T-lymphotropic virus 1 (HTLV-1 ). Human T-lymphotropic virus 2 (HTLV-2), Gibbon ape leukemia virus (GALV), Feline leukemia virus (FeLV), Porcine endogenous retroviruses (PERV), Feline Foamy Virus (FeFV), Bovine foamy virus (BFV), Mouse mammary tumor virus (MMTV). Jaagsiekte sheep retrovirus (JSRV), Mason-Pfizer monkey virus (MPMV), Avian sarcoma leukosis virus (ALV), Rous sarcoma virus (RSV). Human Endogenous Retrovirus-W (HERV-W), and Human endogenous retrovirus K (HERV-K).

[0299] Embodiment 43. The recombinant integration deficient retroviral vector according to any one of embodiments 40, 41, or 42, wherein the vector is derived from murine leukemia virus (MLV), Bovine leukemia virus (BLV), Human T-lymphotropic vims 1 (HTLV-1), Human T-lymphotropic vims 2 (HTLV-2), Gibbon ape leukemia vims (GALV), Feline leukemia vims (FeLV), Porcine endogenous retroviruses (PERV), Feline Foamy Vims (FeFV). Bovine foamy vims (BFV), Mouse mammary tumor vims (MMTV), Jaagsiekte sheep retrovims (JSRV). Mason-Pfizer monkey vims (MPMV), Avian sarcoma leukosis vims (ALV), Rous sarcoma vims (RSV), Human Endogenous Retrovims-W (HERV- W), and Human endogenous retrovims K (HERV-K).

[0300] Embodiment 44. The recombinant integration deficient retroviral vector according to embodiment 40, wherein the vector is a simple retroviral vector.

[0301] Embodiment 45. The recombinant integration deficient retroviral vector according to embodiment 40. wherein the vector is a complex retroviral vector.

[0302] Embodiment 46. The recombinant integration deficient retroviral vector according to embodiment 44, wherein the one or more virus-derived LTRs are derived from MLV, GALV, FeLV, PERV, BFV, MMTV, JSRV, MPMV, ALV, or RSV.

[0303] Embodiment 47. The recombinant integration deficient retroviral vector according to embodiment 45, wherein tire one or more virus-derived LTRs are derived from HIV-1, FIV. EIAV, HIV- 2, S1V, HERV-W. HERV-K, BLV, HTLV-1, or HTLV-2.

[0304] Embodiment 48. The recombinant integration deficient retroviral vector according to any one of embodiments 40-47, wherein the one or more virus-derived LTRs are self-inactivating (SIN) LTRs.

[0305] Embodiment 49. The recombinant integration deficient retroviral vector according to any one of embodiments 47 or 48, wherein the vector is derived from HIV.

[0306] Embodiment 50. The recombinant integration deficient retroviral vector according to any one of embodiments 40-49, wherein the vector further comprises a nucleic acid sequence encoding HIV Tat and / or Rev.

[0307] Embodiment 51. The recombinant integration deficient retroviral vector according to any one of embodiments 40-50, wherein the post -transcriptional response element is selected from the groupconsisting of Woodchuck Hepatitis Vims Posttranscriptional Regulatory Element (WPRE) and Hepatitis B Vims Posttranscriptional Regulatory Element (HPRE).

[0308] Embodiment 52. The recombinant integration deficient retroviral vector according to any one of embodiments 40-51, wherein the nucleic acid sequence encodes two cargos of interest.

[0309] Embodiment 53. The recombinant integration deficient retroviral vector according to embodiment 52. wherein the nucleic acid sequence comprises coding sequences for two polypeptide cargos of interest and an IRES or P2A sequence between the coding sequences.

[0310] Embodiment 54. The recombinant integration deficient retroviral vector according to any one of embodiments 40-53, wherein the one or more cargos of interest are selected from the group consisting of gene-editing nucleases, endonuclease deficient Cas, endonuclease deficient Cas effectors, endonuclease deficient Cas enzymes, engineered DNA binding proteins, base editors, prime editors. RNA interference (RNAi), RNA targeting systems, CRISPR DNA binding proteins, CRISPR nickases, recombinases, integrases, programmable integrases, transposons, retrotransposons, DNA polymerases, reverse transcriptases, transposases, chimeric antigen receptors (CAR), transcription factors, caspases, natural proteases, programmable proteases, reporter genes, and selection markers.

[0311] Embodiment 55. The recombinant integration deficient retroviral vector according to embodiment 54, wherein tire gene-editing nuclease is selected from the group consisting of zinc finger nucleases (ZFNs). Transcription Activator-Like Effector Nucleases (TALENs), and nucleases of the CRISPR / Cas system.

[0312] Embodiment 56. The recombinant integration deficient retroviral vector according to embodiment 55, wherein the gene-editing nuclease is Cas9.

[0313] Embodiment 57. A cell comprising the recombinant integration deficient retroviral vector according to any one of embodiments 40-56.

[0314] Embodiment 58. A composition comprising the recombinant integration deficient retroviral vector of embodiments 40-56 or the cell of embodiment 57.

[0315] Embodiment 59. The recombinant integration deficient retroviral vector or particle according to any one of the preceding embodiments, wherein: the one or more virus-derived long terminal repeats (LTR) comprises a nucleotide sequence having at least 50%. 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%. 99%. or 100% sequence identity to the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2: the viral packaging signal comprises a nucleotide sequence having at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 18 or SEQ ID NO: 19; or the post-transcriptional response element comprises a nucleotide sequence having at least50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the sequence set forth in any one of SEQ ID NOs: 29-33.

[0316] Embodiment 60. The recombinant integration deficient retroviral vector according to embodiment 59, wherein the one or more LTR comprises a nucleotide sequence having at least 50%, 60%, 70%, 80%, 90%, 95%, 96%. 97%, 98%, 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 1, and wherein the viral packaging signal comprises a nucleotide sequence having at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 18.

[0317] Embodiment 61. The recombinant integration deficient retroviral vector according to embodiment 59, wherein the one or more LTR comprises a nucleotide sequence having at least 50%, 60%, 70%, 80%, 90%, 95%, 96%. 97%. 98%, 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 2, and wherein the viral packaging signal comprises a nucleotide sequence having at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 19.

[0318] Embodiment 62. The recombinant integration deficient retroviral vector according to any one of embodiments 59-61, wherein the post -transcriptional response element comprises a nucleotide sequence having at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 31.

[0319] Embodiment 63. The recombinant integration deficient retroviral vector according to embodiment 62, wherein the post-transcriptional response element does not comprise the nucleotide sequence set forth in SEQ ID NO: 29 and / or SEQ ID NO: 30.

[0320] Embodiment 64. The recombinant integration deficient retroviral vector according to any one of embodiments 59-62, wherein the post-transcriptional response element comprises a nucleotide sequence having at least 50%. 60%. 70%. 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 32.

[0321] Embodiment 65. The recombinant integration deficient retroviral vector according to any one of embodiments 59-62, wherein the post-transcriptional response element comprises a nucleotide sequence having at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 33.

[0322] Embodiment 66. A method for increasing expression of one or more cargos in a cell, the method comprising contacting the cell with a recombinant integration deficient retroviral vector comprising a nucleic acid comprising: one or more virus-derived long tcnninal repeats (LTR); a viral packaging signal;a nucleic acid sequence encoding one or more cargos of interest: and a post-transcriptional response element, wherein the integration deficient retroviral vector does not comprise an exogenous promoter operably linked to the nucleic acid sequence encoding the one or more cargos of interest, and wherein the contacting results in an increased expression of the one or more cargos in the cell than that upon contacting the cell with a corresponding recombinant integration deficient retroviral vector that comprises the exogenous promoter operably linked to the nucleic acid encoding the one or more cargos.

[0323] Embodiment 67. The method according to embodiment 66, wherein the contacting does not result in integration of the recombinant integration deficient retroviral vector in the genome of the cell.

[0324] Embodiment 68. Tire method according to any one of embodiments 66-67, wherein the expression is increased by at least about 2%, 3%, 4%, 5%. 8%, 10%, 15%, 20%, 25%, 30%. 40%. 50%, 60%, 70%, 80%, 90%, 95%, 100% or more compared with the corresponding recombinant integration deficient retroviral vector that comprises the exogenous promoter operably linked to the nucleic acid encoding the one or more cargos.

[0325] Embodiment 69. The method according to any one of embodiments 66-68, wherein the one or more virus-derived long terminal repeats (LTR) comprises a nucleotide sequence having at least 50%. 60%, 70%, 80%, 90%, 95%, 96%. 97%. 98%, 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2: the viral packaging signal comprises a nucleotide sequence having at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 18 or SEQ ID NO: 19; and the post-transcriptional response element comprises a nucleotide sequence having at least 50%, 60%, 70%, 80%, 90%, 95%, 96%. 97%. 98%, 99%, or 100% sequence identity to the sequence set forth in any one of SEQ ID NOs: 29-33.

[0326] Embodiment 70. The method according to any one of embodiments 66-69, wherein the recombinant integration deficient retroviral vector further comprises a nucleic acid encoding a RNA, optionally a RNA.

[0327] Embodiment 71. The method according to embodiment 70, wherein the nucleic acid encoding the RNA is operably linked to a pol III based promoter.

[0328] Embodiment 72. The method according to any one of embodiments 69-71, wherein the post- transcriptional response element comprises a nucleotide sequence having at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 31.

[0329] Embodiment 73. The method according to embodiment 72, wherein the post-transcriptional response element does not comprise the nucleotide sequence set forth in SEQ ID NO: 29 and / or SEQ ID NO: 30.

[0330] Embodiment 74. Tire method according to any one of embodiments 66-73, wherein the method is perfonned in vivo, in vitro or ex vivo.

[0331] Embodiment 75. A method for delivering a nucleic acid that encodes one or more cargos to a cell, the method comprising contacting the cell with a recombinant integration deficient retroviral vector comprising a nucleic acid comprising: one or more virus-derived long terminal repeats (LTR); a viral packaging signal; the nucleic acid sequence encoding the one or more cargos of interest; and a post-transcriptional response element, wherein the integration deficient retroviral vector does not comprise an exogenous promoter operably linked to the nucleic acid sequence encoding the one or more cargos of interest, thereby delivering the nucleic acid sequence encoding the one or more cargos of interest.

[0332] Embodiment 76. The method according to embodiment 77, wherein the contacting does not result in integration of the recombinant integration deficient retroviral vector in the genome of the cell.

[0333] Embodiment 77. The method according to any one of embodiments 75-76, wherein said delivering results in expression of the one or more cargos of interest in the cell.

[0334] Embodiment 78. The method according to embodiment 77, where the expression of the one or more cargos is higher than that upon contacting the cell with a corresponding recombinant integration deficient retroviral vector that comprises the exogenous promoter operably linked to the nucleic acid encoding the one or more cargos.

[0335] Embodiment 79. The method according to embodiment 78. wherein the expression is higher by at least about 2%, 3%, 4%, 5%, 8%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100% or more.

[0336] Embodiment 80. The method according to any one of embodiments 75-79, wherein the one or more virus-derived long terminal repeats (LTR) comprises a nucleotide sequence having at least 50%. 60%, 70%, 80%, 90%, 95%, 96%. 97%. 98%. 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2;

[0337] the viral packaging signal comprises a nucleotide sequence having at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 18 or SEQ ID NO: 19; and

[0338] the post-transcriptional response element comprises a nucleotide sequence having at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the sequence set forth in any one of SEQ ID NOs: 29-33,

[0339] Embodiment 81. Tire method according to any one of embodiments 75-80, wherein the recombinant integration deficient retroviral vector further comprises a nucleic acid encoding a RNA, optionally a RNA.

[0340] Embodiment 82. The method according to embodiment 81, wherein the nucleic acid encoding the RNA is operably linked to a pol III based promoter.

[0341] Embodiment 83. The method according to any one of embodiments 69-71, wherein the post- transcriptional response element comprises a nucleotide sequence having at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%. or 100% sequence identity to the sequence set forth in SEQ ID NO: 31.

[0342] Embodiment 84. The method according to embodiment 83, wherein the post-transcriptional response element does not comprise the nucleotide sequence set forth in SEQ ID NO: 29 and / or SEQ ID NO: 30.

[0343] Embodiment 85. The method according to any one of embodiments 75-84, wherein the method is perfonned in vivo, in vitro or ex vivo.

[0344] Embodiment 86. A method for engineering a cell, the method comprising contacting the cell with a recombinant integration deficient retroviral vector comprising a nucleic acid comprising: one or more virus-derived long terminal repeats (LTR); a viral packaging signal; the nucleic acid sequence encoding the one or more cargos of interest; and a post-transcriptional response element, wherein the integration deficient retroviral vector does not comprise an exogenous promoter operably linked to the nucleic acid sequence encoding the one or more cargos of interest, thereby engineering the cell.

[0345] Embodiment 87. A method for genetically modifying a cell, the method comprising contacting the cell with a recombinant integration deficient retroviral vector comprising a nucleic acid comprising: one or more virus-derived long terminal repeats (LTR); a viral packaging signal; the nucleic acid sequence encoding the one or more cargos of interest; and a post-transcriptional response element, wherein the integration deficient retroviral vector docs not comprise an exogenous promoter operably linked to the nucleic acid sequence encoding the one or more cargos of interest, thereby geneticallymodifying the cell, optionally wherein the one or more cargos comprise a gene editing nuclease, a zinc finger nuclease (ZFN), a Transcription Activator-Like Effector Nuclease (TALEN), nuclease of the CRISPR / Cas system, a Cas protein, an endonuclease, a meganuclease, a base editor, a prime editor, a nickase, a RNA guided endonuclease, RNA interference (RNAi), RNA targeting systems, CRISPR DNA binding protein, CRISPR nickase, recombinase, integrase, programmable integrase, transposon, retrotransposon. DNA polymerase, reverse transcriptase, transposase, chimeric antigen receptors (CAR), transcription factor, caspase, or a natural protease.

[0346] Embodiment 88. The method according to any one of embodiment 86-87, wherein the contacting does not result in integration of tire recombinant integration deficient retroviral vector in the genome of the cell.

[0347] Embodiment 89. The method according to any one of embodiments 86-88, wherein said contacting results in expression of the one or more cargos of interest in the cell.

[0348] Embodiment 90. The method according to embodiment 89, where the expression of the one or more cargos is higher than that upon contacting the cell with a corresponding recombinant integration deficient retroviral vector that comprises the exogenous promoter operably linked to the nucleic acid encoding tire one or more cargos.

[0349] Embodiment 91. The method according to embodiment 90, wherein the expression is higher by at least about 2%, 3%. 4%, 5%, 8%. 10%. 15%. 20%. 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100% or more.

[0350] Embodiment 92. The method according to any one of embodiments 86-91, wherein the one or more virus-derived long terminal repeats (LTR) comprises a nucleotide sequence having at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2;

[0351] the viral packaging signal comprises a nucleotide sequence having at least 50%, 60%. 70%.80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 18 or SEQ ID NO: 19; and

[0352] the post-transcriptional response element comprises a nucleotide sequence having at least 50%, 60%, 70%, 80%, 90%, 95%, 96%. 97%, 98%, 99%, or 100% sequence identity to the sequence set forth in any one of SEQ ID NOs: 29-33,

[0353] Embodiment 93. The method according to any one of embodiments 86-92, wherein the recombinant integration deficient retroviral vector further comprises a nucleic acid encoding a RNA, optionally a guide RNA.

[0354] Embodiment 94. The method according to embodiment 93, wherein the nucleic acid encoding the RNA is operably linked to a pol III based promoter.

[0355] Embodiment 95. The method according to any one of embodiments 92-94, wherein the post- transcriptional response element comprises a nucleotide sequence having at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to tire sequence set forth in SEQ ID NO: 31.

[0356] Embodiment 96. The method according to embodiment 95. wherein the post-transcriptional response element does not comprise the nucleotide sequence set forth in SEQ ID NO: 29 and / or SEQ ID NO: 30.

[0357] Embodiment 97. The method according to any one of embodiments 86-96, wherein the method is performed in vivo, in vitro or ex vivo.

[0358] Embodiment 108. A method for increasing expression of one or more cargos in a subject in need thereof, the method comprising administering to the subject a recombinant integration deficient retroviral vector comprising a nucleic acid comprising: one or more virus-derived long terminal repeats (LTR); a viral packaging signal; a nucleic acid sequence encoding one or more cargos of interest; and a post-transcriptional response element, wherein the integration deficient retroviral vector does not comprise an exogenous promoter operably linked to the nucleic acid sequence encoding the one or more cargos of interest, and wherein the administering results in an increased expression of the one or more cargos than that upon administering to the subject a corresponding recombinant integration deficient retroviral vector that comprises the exogenous promoter operably linked to the nucleic acid encoding the one or more cargos.

[0359] Embodiment 109. Tire method according to embodiment 108. wherein the administering does not result in integration of the recombinant integration deficient retroviral vector in the genome of the subject.

[0360] Embodiment 110. The method according to any one of embodiments 108-109, wherein the expression is increased by at least about 2%, 3%, 4%, 5%, 8%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100% or more.

[0361] Embodiment 111. The method according to any one of embodiments 108-110, wherein the one or more virus-derived long terminal repeats (LTR) comprises a nucleotide sequence having at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2; the viral packaging signal comprises a nucleotide sequence having at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%. 99%, or 100% sequence identity to the sequence set forth inSEQ ID NO: 18 or SEQ ID NO: 19; and the post-transcriptional response element comprises a nucleotide sequence having at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the sequence set forth in any one of SEQ ID NOs: 29-33,

[0362] Embodiment 112. Tire method according to any one of embodiments 108-111, wherein the recombinant integration deficient retroviral vector further comprises a nucleic acid encoding a RNA, optionally a guide RNA.

[0363] Embodiment 113. The method according to embodiment 112, wherein the nucleic acid encoding the RNA is operably linked to a pol III based promoter.

[0364] Embodiment 114. The method according to any one of embodiments 111-113, wherein the post-transcriptional response element comprises a nucleotide sequence having at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%. 99%. or 100% sequence identity to the sequence set forth in SEQ ID NO: 31.

[0365] Embodiment 115. The method according to embodiment 114, wherein the post-transcriptional response element does not comprise the nucleotide sequence set forth in SEQ ID NO: 29 and / or SEQ ID NO: 30.

[0366] Embodiment 116. Tire method according to any one of embodiments 108-115, wherein the subject is suffering from or susceptible to a disease.

[0367] Embodiment 117. The method according to any one of embodiments 108-116, wherein the subject is a human.

[0368] Embodiment 118. The method according to any one of embodiments 66-117, wherein the recombinant integration deficient retroviral vector nucleic acid comprises the following in 5’ to 3' order: a first LTR, the viral packaging signal, the nucleic acid sequence encoding the one or more cargos of interest, the post-transcriptional response element, and a second LTR.

[0369] Embodiment 1 19. The recombination integration deficient retroviral vector according to any one of embodiments, 59-65, wherein the recombinant integration deficient retroviral vector nucleic acid comprises the following in 5’ to 3’ order: a first LTR, the viral packaging signal, the nucleic acid sequence encoding the one or more cargos of interest, the post-transcriptional response element, and a second LTR.

Claims

CLAIMSWHAT IS CLAIMED IS:

1. A recombinant integration deficient retroviral vector comprising a nucleic acid comprising: one or more virus-derived long terminal repeats (LTR); a viral packaging signal; a nucleic acid sequence encoding one or more cargos of interest; and a post-transcriptional response element, wherein the integration deficient retroviral vector does not comprise an exogenous promoter operably linked to the nucleic acid sequence encoding the one or more cargos of interest.

2. The recombinant integration deficient retroviral vector according to claim 2, wherein the one or more virus-derived LTRs are derived from a murine leukemia virus (MLV), Bovine leukemia virus (BLV), Human T-lymphotropic virus 1 (HTLV 1), Human T- lymphotropic virus 2 (HTLV 2), Gibbon ape leukemia virus (GALV), Feline leukemia virus (FeLV), Porcine endogenous retroviruses (PERV), Feline Foamy Virus (FeFV), Bovine foamy virus (BFV), Mouse mammary tumor virus (MMTV), Jaagsiekte sheep retrovirus (JSRV), Mason-Pfizer monkey virus (MPMV), Avian sarcoma leukosis virus (ALV), Rous sarcoma virus (RSV), Human Endogenous Retrovirus-W (HERV-W), or a Human endogenous retrovirus K (HERV-K).

3. The recombinant integration deficient retroviral vector according to any one of claims 1 or 2, wherein the vector is derived from a murine leukemia virus (MLV), Bovine leukemia virus (BLV), Human T-lymphotropic virus 1 (HTLV 1), Human T-lymphotropic virus 2 (HTLV 2), Gibbon ape leukemia virus (GALV), Feline leukemia virus (FeLV), Porcine endogenous retroviruses (PERV), Feline Foamy Virus (FeFV), Bovine foamy virus (BFV), Mouse mammary tumor virus (MMTV), Jaagsiekte sheep retrovirus (JSRV), Mason-Pfizer monkey virus (MPMV), Avian sarcoma leukosis virus (ALV), Rous sarcoma virus (RSV),Human Endogenous Retrovirus-W (HERV-W), or a Human endogenous retrovirus K (HERV- K).

4. The recombinant integration deficient retroviral vector according to claim 1, wherein the vector is a simple retroviral vector.

5. The recombinant integration deficient retroviral vector according to claim 1, wherein the vector is a complex retroviral vector.

6. The recombinant integration deficient retroviral vector according to claim 4, wherein the one or more virus-derived LTRs are derived from a MLV, GALV, FeLV, PERV, BFV, MMTV, JSRV, MPMV, ALV, or RSV.

7. The recombinant integration deficient retroviral vector according to claim 5, wherein the one or more virus-derived LTRs are derived from a HIV-1, FIV, EIAV, HIV-2, SIV, HERV-W, HERV-K, BLV, HTLV-1, or HTLV-2.

8. The recombinant integration deficient retroviral vector according to any preceding claim, wherein the one or more virus-derived LTRs are self-inactivating (SIN) LTRs.

9. The recombinant integration deficient retroviral vector according to any one of claims 7 or 8, wherein the vector is derived from HIV.

10. The recombinant integration deficient retroviral vector according to any preceding claim, wherein the vector further comprises a nucleic acid sequence encoding a HIV Tat protein and / or a Rev protein.

11. The recombinant integration deficient retroviral vector according to any preceding claim, wherein the post-transcriptional response element is selected from the group consisting of a Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) and a Hepatitis B Virus Posttranscriptional Regulatory Element (HPRE).

12. The recombinant integration deficient retroviral vector according to any preceding claim, wherein the nucleic acid sequence encoding one or more cargos of interest encodes two cargos of interest.

13. The recombinant integration deficient retroviral vector according to claim 12, wherein the nucleic acid sequence comprises coding sequences for two polypeptide cargos of interest and an IRES or P2A sequence between the coding sequences.

14. The recombinant integration deficient retroviral vector according to any preceding claim, wherein the one or more cargos of interest are selected from the group consisting of gene-editing nucleases, endonuclease deficient Cas, endonuclease deficient Cas effectors, endonuclease deficient Cas enzymes, engineered DNA binding proteins, base editors, prime editors, RNA interference (RNAi), RNA targeting systems, CRISPR DNA binding proteins, CRISPR nickases, recombinases, integrases, programmable integrases, transposons, retrotransposons, DNA polymerases, reverse transcriptases, transposases, chimeric antigen receptors (CAR), transcription factors, caspases, natural proteases, programmable proteases, reporter genes, and selection markers.

15. The recombinant integration deficient retroviral vector according to claim 14, wherein the gene-editing nuclease is selected from the group consisting of zinc finger nucleases (ZFNs), Transcription Activator-Like Effector Nucleases (TALENs), and nucleases of the CRISPR / Cas system.

16. The recombinant integration deficient retroviral vector according to claim 1 , wherein the gene-editing nuclease is Cas9.

17. A cell comprising the recombinant integration deficient retroviral vector according to any preceding claim.

18. A composition comprising the recombinant integration deficient retroviral vector of claims 1-16 or the cell of claim 17.

19. A recombinant integration deficient retroviral particle comprising a nucleic acid comprising: one or more virus-derived long terminal repeats (LTR); a viral packaging signal; a nucleic acid sequence encoding one or more cargos of interest; and a post-transcriptional response element, wherein the nucleic acid does not comprise an exogenous promoter operably linked to the nucleic acid sequence encoding the one or more cargos of interest.

20. The recombinant integration deficient retroviral particle according to claim 19, wherein the one or more virus-derived LTRs are derived from a murine leukemia virus (MLV), Bovine leukemia virus (BLV), Human T-lymphotropic virus 1 (HTLV 1), Human T- lymphotropic virus 2 (HTLV 2), Gibbon ape leukemia virus (GALV), Feline leukemia virus (FeLV), Porcine endogenous retroviruses (PERV), Feline Foamy Virus (FeFV), Bovine foamy virus (BFV), Mouse mammary tumor virus (MMTV), Jaagsiekte sheep retrovirus (JSRV), Mason-Pfizer monkey virus (MPMV), Avian sarcoma leukosis virus (ALV), Rous sarcoma virus (RSV), Human Endogenous Retrovirus-W (HERV-W), or Human endogenous retrovirus K (HERV-K).

21. The recombinant integration deficient retroviral particle according to any one of claims 19 or 20, wherein the viral particle is derived from a murine leukemia virus (MLV), Bovine leukemia virus (BLV), Human T-lymphotropic virus 1 (HTLV 1), Human T- lymphotropic virus 2 (HTLV 2), Gibbon ape leukemia virus (GALV), Feline leukemia virus (FeLV), Porcine endogenous retroviruses (PERV), Feline Foamy Virus (FeFV), Bovine foamy virus (BFV), Mouse mammary tumor virus (MMTV), Jaagsiekte sheep retrovirus (JSRV), Mason-Pfizer monkey virus (MPMV), Avian sarcoma leukosis virus (ALV), Rous sarcoma virus (RSV), Human Endogenous Retrovirus-W (HERV-W), or Human endogenous retrovirus K (HERV-K).

22. The recombinant integration deficient retroviral particle according to claim 19, wherein the viral particle is derived from a simple retrovirus.

23. The recombinant integration deficient retroviral particle according to claim 19, wherein the viral particle is derived from a complex retrovirus.

24. The recombinant integration deficient retroviral particle according to claim 22, wherein the one or more virus-derived LTRs are derived from MLV, GALV, FeLV, PERV, BFV, MMTV, JSRV, MPMV, ALV, or RSV.

25. The recombinant integration deficient retroviral particle according to claim 23, wherein the one or more virus-derived LTRs are derived from HIV-1, FIV, EIAV, HIV-2, SIV, HERV-W, HERV-K, BLV, HTLV-1, or HTLV-2.

26. The recombinant integration deficient retroviral particle according to claim 20-25, wherein the one or more virus-derived LTRs are self-inactivating (SIN) LTRs.

27. The recombinant integration deficient retroviral particle according to any one of claims 23 or 24, wherein the viral particle is derived from HIV.

28. The recombinant integration deficient retroviral particle according to claim 19-27, wherein the nucleic acid further comprises a nucleic acid sequence encoding a HIV Tat protein and / or a Rev protein.

29. The recombinant integration deficient retroviral particle according to claim 19-28, wherein the post-transcriptional response element is selected from the group consisting of Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) and Hepatitis B Virus Posttranscriptional Regulatory Element (HPRE).

30. The recombinant integration deficient retroviral vector according to any preceding claim, wherein the nucleic acid sequence encodes two cargos of interest.

31. The recombinant integration deficient retroviral vector according to claim 30, wherein the nucleic acid sequence comprises coding sequences for two polypeptide cargos of interest and an IRES or P2A sequence between the coding sequences.

32. The recombinant integration deficient retroviral particle according to claim 19-31, wherein the one or more cargos of interest are selected from the group consisting of geneediting nucleases, endonuclease deficient Cas, endonuclease deficient Cas effectors, endonuclease deficient Cas enzymes, engineered DNA binding proteins, base editors, prime editors, RNA interference (RNAi), RNA targeting systems, CRISPR DNA binding proteins, CRISPR nickases, recombinases, integrases, programmable integrases, transposons, retrotransposons, DNA polymerases, reverse transcriptases, transposases, chimeric antigen receptors (CAR), transcription factors, caspases, natural proteases, programmable proteases, reporter genes, and selection markers.

33. The recombinant integration deficient retroviral particle according to claim 32, wherein the gene-editing nuclease is selected from the group consisting of zinc finger nucleases (ZFNs), Transcription Activator-Like Effector Nucleases (TALENs), and nucleases of the CRISPR / Cas system.

34. The recombinant integration deficient retroviral particle according to claim 33, wherein the gene-editing nuclease is Cas9.

35. A system comprising: a first recombinant integration deficient retroviral vector nucleic acid comprising: one or more virus-derived long terminal repeats (LTR); a viral packaging signal; a nucleic acid sequence encoding one or more cargos of interest; and a post-transcriptional response element, wherein the integration deficient retroviral vector nucleic acid does not comprise an exogenous promoter operably linked to the nucleic acid sequence encoding the cargo of interest; and at least one second vector comprising one or more nucleic acid sequences required for virus assembly.

36. The system of claim 35, wherein the first recombinant integration deficient retroviral vector nucleic acid comprises the following in 5’ to 3’ order: a first LTR, the viral packaging signal, the nucleic acid sequence encoding the one or more cargos of interest, the post-transcriptional response element, and a second LTR.

37. The system of claim 35 or claim 36, wherein the nucleic acid sequence encodes two cargos of interest.

38. The system of claim 37, wherein the nucleic acid sequence comprises coding sequences for two polypeptide cargos of interest and an IRES or P2A sequence between the coding sequences.

39. A method of editing a gene in a cell of interest, the method comprising: administering the recombinant integration deficient retroviral vector of any one of claims 1-16 to a cell of interest under conditions effective to edit a gene within said cell.

40. A recombinant integration deficient retroviral vector comprising a nucleic acid comprising: one or more virus-derived long terminal repeats (LTR); a viral packaging signal; a nucleic acid sequence encoding one or more cargos of interest; a post-transcriptional response element, a pol Ill-based promoter, and a nucleic acid sequence encoding a guide RNA, wherein the pol Ill-based promoter is the only exogenous promoter in the nucleic acid.

41. The recombinant integration deficient retroviral vector of claim 40, wherein the nucleic acid comprises the following in 5’ to 3’ order: a first virus-derived long terminal repeat (LTR); a viral packaging signal; a nucleic acid sequence encoding one or more cargos of interest; a post-transcriptional response element, a pol Ill-based promoter, a nucleic acid sequenceencoding a guide RNA, and a second virus-derived long terminal repeat (LTR), wherein the pol Ill-based promoter is the only exogenous promoter in the nucleic acid.

42. The recombinant integration deficient retroviral vector according to claim 40 or claim 41, wherein the one or more virus-derived LTRs are derived from murine leukemia virus (MLV), Bovine leukemia virus (BLV), Human T-lymphotropic virus 1 (HTLV-1), Human T- lymphotropic virus 2 (HTLV-2), Gibbon ape leukemia virus (GALV), Feline leukemia virus (FeLV), Porcine endogenous retroviruses (PERV), Feline Foamy Virus (FeFV), Bovine foamy virus (BFV), Mouse mammary tumor virus (MMTV), Jaagsiekte sheep retrovirus (JSRV), Mason-Pfizer monkey virus (MPMV), Avian sarcoma leukosis virus (ALV), Rous sarcoma virus (RSV), Human Endogenous Retrovirus-W (HERV-W), and Human endogenous retrovirus K (HERV-K).

43. The recombinant integration deficient retroviral vector according to any one of claims 40, 41, or 42, wherein the vector is derived from murine leukemia virus (MLV), Bovine leukemia virus (BLV), Human T-lymphotropic virus 1 (HTLV-1), Human T-lymphotropic virus 2 (HTLV-2), Gibbon ape leukemia virus (GALV), Feline leukemia virus (FeLV), Porcine endogenous retroviruses (PERV), Feline Foamy Virus (FeFV), Bovine foamy virus (BFV), Mouse mammary tumor virus (MMTV), Jaagsiekte sheep retrovirus (JSRV), Mason-Pfizer monkey virus (MPMV), Avian sarcoma leukosis virus (ALV), Rous sarcoma virus (RSV), Human Endogenous Retrovirus-W (HERV-W), and Human endogenous retrovirus K (HERV- K).

44. The recombinant integration deficient retroviral vector according to claim 40, wherein the vector is a simple retroviral vector.

45. The recombinant integration deficient retroviral vector according to claim 40, wherein the vector is a complex retroviral vector.

46. The recombinant integration deficient retroviral vector according to claim 44, wherein the one or more virus-derived LTRs are derived from MLV, GALV, FeLV, PERV, BFV, MMTV, JSRV, MPMV, ALV, or RSV.

47. The recombinant integration deficient retroviral vector according to claim 45, wherein the one or more virus-derived LTRs are derived from HIV-1, FIV, EIAV, HIV-2, SIV, HERV-W, HERV-K, BLV, HTLV-1, or HTLV-2.

48. The recombinant integration deficient retroviral vector according to any one of claims 40-47, wherein the one or more virus-derived LTRs are self-inactivating (SIN) LTRs.

49. The recombinant integration deficient retroviral vector according to any one of claims 47 or 48, wherein the vector is derived from HIV.

50. The recombinant integration deficient retroviral vector according to any one of claims 40-49, wherein the vector further comprises a nucleic acid sequence encoding HIV Tat and / or Rev.

51. The recombinant integration deficient retroviral vector according to any one of claims 40-50, wherein the post-transcriptional response element is selected from the group consisting of Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE) and Hepatitis B Virus Posttranscriptional Regulatory Element (HPRE).

52. The recombinant integration deficient retroviral vector according to any one of claims 40-51, wherein the nucleic acid sequence encodes two cargos of interest.

53. The recombinant integration deficient retroviral vector according to claim 52, wherein the nucleic acid sequence comprises coding sequences for two polypeptide cargos of interest and an IRES or P2A sequence between the coding sequences.

54. The recombinant integration deficient retroviral vector according to any one of claims 40-53, wherein the one or more cargos of interest are selected from the group consisting of gene-editing nucleases, endonuclease deficient Cas, endonuclease deficient Cas effectors, endonuclease deficient Cas enzymes, engineered DNA binding proteins, base editors, prime editors, RNA interference (RNAi), RNA targeting systems, CRISPR DNA binding proteins, CRISPR nickases, recombinases, integrases, programmable integrases, transposons,retrotransposons, DNA polymerases, reverse transcriptases, transposases, chimeric antigen receptors (CAR), transcription factors, caspases, natural proteases, programmable proteases, reporter genes, and selection markers.

55. The recombinant integration deficient retroviral vector according to claim 54, wherein the gene-editing nuclease is selected from the group consisting of zinc finger nucleases (ZFNs), Transcription Activator-Like Effector Nucleases (TALENs), and nucleases of the CRISPR / Cas system.

56. The recombinant integration deficient retroviral vector according to claim 55, wherein the gene-editing nuclease is Cas9.

57. A cell comprising the recombinant integration deficient retroviral vector according to any one of claims 40-56.

58. A composition comprising the recombinant integration deficient retroviral vector of claims 40-56 or the cell of claim 57.

Images