A lipid drug delivery system for increased endosomal escape
The liposomal drug delivery system with a fusogenic and acid-cleavable lipid bilayer enhances endosomal escape, addressing low efficacy and cytotoxicity issues by efficiently delivering therapeutic agents into the cytosol, offering improved delivery and reduced side effects.
Patent Information
- Application Number
- PCT/EP2024/070941
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-07-23
- Filing Date
- 2024-07-23
- Publication Date
- 2025-11-06
AI Technical Summary
Existing drug delivery systems face challenges in efficiently crossing the endosomal membrane to deliver therapeutic agents, such as nucleic acids and proteins, into the cytosol of cells, leading to low efficacy and potential cytotoxicity from high dosages.
A liposomal drug delivery system comprising a lipid bilayer with an encapsulating agent, a fusogenic agent, and an acid-cleavable PEGylated lipid, which enhances endosomal escape and stability, encapsulating therapeutic agents like nucleic acids, peptides, or proteins.
The system significantly increases the delivery of therapeutic agents into the cytosol, improving efficacy and reducing cytotoxicity by leveraging a synergistic effect between the fusogenic and acid-cleavable components, surpassing the limitations of previous delivery methods.
Smart Images

Figure EP2024070941_06112025_PF_FP_ABST
Abstract
Description
[0001] ZSP Ref.: 1261-2 PCT A drug delivery system for increased endosomal escape Specification The present invention relates to a drug delivery liposome formulation to increase escape from endosomes within cells and to improve drug delivery to cells and tissues as well as enhance the subsequent release of the delivered drug within such cells and tissues. The lipid bilayer of the liposome comprises an encapsulating agent, a fusogenic agent, and an acid-cleavable PEGylated lipid. The liposome encapsulates a therapeutic agent, such as a nucleic acid (RNA; DNA), a peptide, a protein, a small molecule, or a non-lipinski molecule. The lipid bilayer may comprise further helper lipids for enhancing endosomal escape or increasing system stability, such as cholesterol, solasodine, ceramide, or diosgenin. Background of the invention The biggest challenge for the delivery of macromolecular therapeutics "cargos" in general, such as mRNA, is to target them to the correct cells and, once endocytosed, let them cross the endosomal membrane in a process called "endosomal escape". Indeed, only a small fraction of exogenous macromolecules can escape from endosomes into the cytosol where they can exert their activity. As a consequence, the efficiency of cargo delivery and importantly the desired cargo effect is usually quite low. In recent years, several types of RNA have emerged as potentially powerful therapeutics to inhibit gene expression, e.g. siRNA, to express proteins, e.g. mRNA, or for gene editing (e.g. CRISPR / Cas9 system). The plasma membrane of cells is a biological barrier that prevents access of macromolecules, especially RNAs, into the cell’s interior as cell defense mechanism. Consequently, numerous delivery systems have focused on facilitating the transport of molecular cargos across this membrane. In particular, eukaryotic cells internalize extracellularly administered cargos by endocytosis. This can be mediated by specific cell surface interactions, or simply involve non-specific engulfment of molecules present in the extracellular fluid. Upon internalization, cargos are sequestered within membrane-bound endosomes. Through fusion and fission events, endosomes exchange some of their luminal content, and cargos can subsequently distribute throughout a complex endosomal pathway that includes early endosomes, recycling endosomes, multivesicular bodies, late endosomes, and lysosomes. Cargos trapped in this pathway may either be recycled to the cell surface or undergo degradation by exposure to lysosomal enzymes. Notably, while conceptually in the cell, endosomally-trapped cargos do not have access to the cytosol, i.e. the space between cytoplasmic organelles such as the nucleus. Thus, delivery systems that simply promote endocytosis of cargos but not the crossing of the endosomal membranes are not sufficient to permit successful cytosolic penetration. Instead, cargos have to cross ZSP Ref.: 1261-2 PCT the membrane of endosomes. Therefore, delivery remains a membrane translocation challenge and some of the issues previously described in the context of crossing the plasma membrane apply. Yet, the endosomal pathway includes membrane systems that are different from the plasma membrane. Consequently, the mechanisms by which translocation is mediated, the efficiencies with which this is achieved, and the cellular responses that accompany delivery may all be distinct. The idea of promoting endosomal escape so as to increase cytosolic delivery has been pursued for several decades. The ability to cross the endosomal membrane for successful delivery into the cytosol of target cells is a major challenge also for RNA-based therapeutics. It has been shown that only 1 % or less of endocytosed RNA therapeutics escape the endosome. Therefore, it is very difficult to experimentally investigate where and how this small quantity of RNA escapes from endosomes. Previous research tried to solve the problem posed by low endosomal escape by administering therapeutic RNA at higher doses, in order to achieve the desired effect; however, this causes side effects such as cytotoxicity and innate immune system activation. A major step forward was the development of lipid nanoparticles (LNP) to deliver siRNA and mRNA. LNPs are not liposomes because they do not have a lipid bilayer only but have an amorphous lipid core matrix, and thus are not designed to fuse with cellular membranes as membrane vesicles and organelles can fuse. However, also this delivery vehicle suffers from the problem of low escape efficacy and cytotoxicity. Therefore, there is still a need for new and efficient delivery systems to specifically increase crossing of endosomal membranes by macromolecule drugs. It is the objective of the present invention to provide a liposomal drug delivery system for therapeutic agents inducing an increased endosomal escape, and thus an increased delivery of the therapeutic agent in the cell cytosol. The objective of the present invention is solved by the teaching of the independent claims. Further advantageous features, aspects and details of the invention are evident from the dependent claims, the description, the figures, and the examples of the present application. Summary of the invention The present invention relates to a drug delivery liposome formulation to increase escape from endosomes within cells and to improve drug delivery to cells and tissues as well as enhance the subsequent release of the delivered drug within such cells and tissues. The lipid bilayer of the liposome comprises an encapsulating agent, a fusogenic agent, and an acid-cleavable PEGylated lipid. The liposome encapsulates a therapeutic agent, such as a nucleic acid (RNA; DNA), a peptide, a protein, a small ZSP Ref.: 1261-2 PCT molecule, a non-lipinski molecule or another type of molecule. The lipid bilayer may further comprise helper lipids enhancing endosomal escape or increasing system stability, such as cholesterol, solasodine, ceramide, or diosgenin. The inventors have surprisingly found that, when transfecting Hela cells with siRNA against eGFP delivered by a liposome composition, the combination of a fusogenic agent such as LBPA with an acid- cleavable PEG-lipid in said composition shows an unexpected synergetic effect on eGFP downregulation (Figure 3c). Indeed, the eGFP downregulation reached by liposomes comprising both components amount to much more than the sum of the effects reached by the liposomes comprising only one of the two components. This effect is even more surprising as introduction of LBPA as fusogenic agent in MC3-based lipid nanoparticles (LNP) does not show a comparable improved effect on drug delivery and activity, such as siRNA mediated GFP downregulation. It is well known that lipid nanoparticles differ from liposomes for having an amorphous core structure made up of lipids, whereas liposomes in contrast have an aqueous core surrounded by one or multiple lipid bilayers. Moreover, this effect even more surprisingly when considering that prior art (Matsuo et al., 2004, Role of LBPA and Alix in multivesicular liposome formation and endosome organization. Science, New Series, 303, 5657, 531-534) shows that LBPA drives formation of membrane invaginations within acidic liposomes, thus stimulating MVL formation, and controls inward fission process by transient interaction between LBPA membranes and Alix. Remarkably, a similar effect to using LBPA as fusogenic agent can be obtained by using the compounds MGDG, PLPE (Figure 12 f-j), IsostA, GMO, POPE (eGFP- knock down efficiency by siRNA- liposomes, Figure 9b) , NPPE, MO, OIA, PalmA (Table 11), and with the isoforms Hemi-LBPA, 3,3'- R,R, 2,2'-S,S-C18:0, 2,2’-S,S-C12:0, 3,3'-S,S, and 3,3'-R,S (liposome-siRNA-mediated GFP downregulation Figure 7d). Therefore, the present invention in one embodiment provides a drug delivery system comprising a liposome having (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) between 1 and 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume, ZSP Ref.: 1261-2 PCT wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm as determined by dynamic light scattering. In an aspect the invention provides a composition comprising (a) a therapeutic agent or a pharmaceutically acceptable salt thereof; (b) a PEG-monoorthoester-lipid; (c) an amphiphilic lipid; (d) a cationic lipid and / or a beta-alanyl-prolyl-cysteine methyl ester; and optionally (e) a steroid and / or a ceramide and / or DOPE. In another aspect the invention provides a pharmaceutical composition comprising the composition of the invention. In another aspect the invention provides a method of producing the composition according to the invention, or the pharmaceutical composition according to the invention, comprising the steps of: (i) combining and mixing a composition comprising the components (b)-(d) and optionally (e) as defined herein; and (ii) mixing the composition obtained in step (i) with the therapeutic agent or with the pharmaceutically acceptable salt thereof (a). In another aspect the invention relates to the composition of the invention or the pharmaceutical composition of the invention for use in the treatment or prophylaxis of a disease. In another aspect the invention provides method of treatment or prophylaxis in a subject, comprising administering to the subject the composition according to the invention or the pharmaceutical composition according to the invention in a therapeutically effective amount. In another aspect the invention relates to the composition according to the invention or the pharmaceutical composition according to the invention for use in the manufacture of a medicament. In another aspect the invention provides a kit of parts comprising (i) the composition according to the invention or the pharmaceutical composition according to the invention; and (ii) an instruction manual. In another aspect the invention provides a composition comprising an artificial nucleic acid molecule, wherein the artificial nucleic acid molecule is an mRNA molecule having at least one open reading frame encoding an antigen derived from a pathogen, a therapeutic protein, or a CRISPR / CAS9 ribonucleoprotein, for use as a medicament, for use as a vaccine or for use in gene therapy, wherein the artificial nucleic acid molecule is associated with or complexed with components (b)-(d) and optionally (e) as defined herein, and wherein the composition is administered intramuscularly, intravenously, subcutaneously, intratumorally, orally, by inhalation or transdermally / topical. In another aspect the invention provides a method of delivering an siRNA, an mRNA and / or protein into a target cell, comprising the step of (i) contacting the target cell with a composition as defined herein, wherein component (a) is said siRNA, mRNA and / or protein. In another aspect the invention provides a method of transfecting a cell, wherein the cell is selected from the group consisting of epithelial cells (preferably epithelial cells from cervical cancer), macrophages, a hepatocytes and cardiomyocytes, the method comprising the step of contacting the cell with the composition of the invention. ZSP Ref.: 1261-2 PCT Another preferred embodiment of the invention is directed to the drug delivery system as disclosed above, wherein the encapsulating agent is a cationic lipid selected from 1,2-dialkanyloxy-3- trialkylammonium propane halide, 1,2-dialkenyloxy-3-trialkylammonium propane halide, 1,2- dialkanoyloxy-3-trialkylammonium propane halide, 1,2-dialkenoyloxy-3-trialkylammonium propane halide, tetraalkylammonium halide, 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine, and / or a lipidated polypeptide PD740. Another preferred embodiment of the invention is directed to the drug delivery system as disclosed above, wherein the encapsulating agent is a cationic lipid selected from 1,2-di-C12- C20 alkanyloxy-3-tri-C1-C6 alkylammonium propane halide, 1,2-di-C12-C20 alkenyloxy-3-tri-C1-C6 alkylammonium propane halide, 1,2-di-C12-C20 alkenoyloxy-3-tri-C1-C6 alkylammonium propane halide, di-C12-C20 alkyl di-C1-C6 alkyl ammonium halide, and / or a lipidated polypeptide PD740. Another more preferred embodiment of the invention is directed to the drug delivery system as disclosed above, wherein the encapsulating agent is a cationic lipid selected from the group consisting of 1,2-didodecyloxy-3-trimethylammonium propane chloride, 1,2-ditridecyloxy-3-trimethylammonium propane chloride, 1,2-ditetradecyloxy-3-trimethylammonium propane chloride, 1,2-dipentadecyloxy-3- trimethylammonium propane chloride, 1,2-dihexadecyloxy-3-trimethylammonium propane chloride, 1,2-diheptadecyloxy-3-trimethylammonium propane chloride, 1,2-dioctadecyloxy-3- trimethylammonium propane chloride, 1,2-dinonadecyloxy-3-trimethylammonium propane chloride, 1,2-diicosyloxy-3-trimethylammonium propane chloride, 1,2-didodecenyloxy-3-trimethylammonium propane chloride, 1,2-ditridecenyloxy-3-trimethylammonium propane chloride, 1,2-ditetradecenyloxy- 3-trimethylammonium propane chloride, 1,2-dipentadecenyloxy-3-trimethylammonium propane chloride, 1,2-dihexadecenyloxy-3-trimethylammonium propane chloride, 1,2-diheptadecenyloxy-3- trimethylammonium propane chloride, 1,2-dioctadecenyloxy-3-trimethylammonium propane chloride, 1,2-dinonadecenyloxy-3-trimethylammonium propane chloride, 1,2-diicosenyloxy-3- trimethylammonium propane chloride, 1,2-dilauroleoyloxy-3-trimethylammonium propane chloride, 1,2-dimyristoleoyloxy-3-trimethylammonium propane chloride, 1,2-dipalmitoleoyloxy-3- trimethylammonium propane chloride, 1,2-dipetroseloyloxy-3-trimethylammonium propane chloride, 1,2-dipetroselaidoyloxy-3-trimethylammonium propane chloride, 1,2-dioleoylloxy-3- trimethylammonium propane chloride, 1,2-dielaidoyloxy-3-trimethylammonium propane chloride, 1,2- divaccenoyloxy-3-trimethylammonium propane chloride, 1,2-digadoleoyloxy-3-trimethylammonium propane chloride, dimethyldidodecylammonium bromide, dimethylditridecylammonium bromide, dimethylditetradecylammonium bromide, dimethyldipentadecylammonium bromide, dimethyldihexadecylammonium bromide, dimethyldiheptadecylammonium bromide, dimethyldioctadecylammonium bromide, dimethyldinonadecylammonium bromide, dimethyldiicosylammonium bromide, and / or a lipidated polypeptide PD740. Another still more preferred embodiment of the invention is directed to the drug delivery system as disclosed above, wherein the encapsulating agent is a cationic lipid selected from the group consisting of 1,2-di- O-octadecenyl-3-trimethylammonium propane chloride, dimethyldioctadecylammonium bromide, 1,2- ZSP Ref.: 1261-2 PCT dioleoyl-3-trimethylammonium propane chloride, and / or a lipidated polypeptide PD740. A further more preferred embodiment of the invention is directed to the drug delivery system as disclosed above, wherein the encapsulating agent is a cationic lipid 1,2-dioleoyl-3-trimethylammonium propane chloride and / or a lipidated polypeptide PD740. A preferred embodiment of the invention is further directed to the drug delivery system as disclosed above, wherein the acid-cleavable polyethylene glycol conjugated lipid is an acid-cleavable polyethylene glycol conjugated with a C12-C20 alkyl, or with a C12-C20 acyl, or with a mono-C12-C20 acylglycerol, or with a di-C12-C20 acylglycerol. A further preferred embodiment of the invention is directed to the drug delivery system as disclosed above, wherein the acid-cleavable polyethylene glycol conjugated lipid comprises an acid-cleavable linkage selected from the group comprising an orthoester linkage, a hydrazone linkage, an acetal linkage, a vinyl ether linkage, and an imine linkage, and preferably a 2-methyl-2-alkoxy-1,3-dioxane or a 2-alkoxy-1,3-dioxolane, or an hydrazone. A further more preferred embodiment of the invention is directed to the drug delivery system as disclosed above, wherein the acid-cleavable polyethylene glycol conjugated lipid is selected from the group consisting of: N-(2-methyl-2-dodecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2- tridecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2-tetradecyloxy-[1,3]dioxan-5- yl)-amido-polyethyleneglycol, N-(2-methyl-2-pentadecyloxy-[1,3]dioxan-5-yl)-amido- polyethyleneglycol, N-(2-methyl-2-hexadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2- methyl-2-heptadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2-octadecyloxy- [1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2-nonadecyloxy-[1,3]dioxan-5-yl)-amido- polyethyleneglycol, and N-(2-methyl-2-icosyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol. A further still more preferred embodiment of the invention is directed to the drug delivery system as disclosed above, wherein the acid-cleavable polyethylene glycol conjugated lipid comprises polyethylene glycol having a number average molar mass Mn comprised between 400 and 5000 Da (Dalton). A further still more preferred embodiment of the invention is directed to the drug delivery system as disclosed above, wherein the acid-cleavable polyethylene glycol conjugated lipid is α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}-polyethylene glycol45. A preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is a glycolipid, a phosphatidylethanolamine, a phosphatidylglycerol, a fatty acid, or a fatty acid ester. A further preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is a galactolipid, preferably an unsaturated monogalactosyldiacylglycerol. A more preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is a 1,2-diacyl-sn-glycero-3- phosphoethanolamine or an N-acyl-1,2-diacyl-sn-glycero-3-phosphoethanolamine. A still more preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is a phosphatidylethanolamine selected from the group consisting of 1,2-dimyristoyl- sn-glycero-3-phosphoethanolamine, 1,2-dipentadecanoyl-sn-glycero-3-phosphoethanolamine, 1,2- ZSP Ref.: 1261-2 PCT dipalmitoyl-sn-glycero-3-phosphoethanolamine, 1,2-dimargaroyl-sn-glycero-3-phosphoethanolamine, 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dipalmitoleoyl-sn-glycero-3- phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3- phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl- sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2- dierucoyl-sn-glycero-3-phosphoethanolamine, 1-pentadecanoyl-2-oleoyl-sn-glycero-3- phosphoethanolamine, 1-palmitoyl-2-linoleoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2- oleoyl-sn-glycero-3-phosphoethanolamine, 1-stearoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine, 1- palmitoyl-2-arachidonoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2-docosahexaenoyl-sn- glycero-3-phosphoethanolamine, 1-stearoyl-2-linoleoyl-sn-glycero-3-phosphoethanolamine, 1- stearoyl-2-arachidonoyl-sn-glycero-3-phosphoethanolamine, 1-stearoyl-2-docosahexaenoyl-sn- glycero-3-phosphoethanolamine, and N-palmitoyl-1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine. A further more preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is a phosphatidylglycerol selected from the group consisting of bis(monoacylglycerol)phosphate, 3-acylglycero-1-phospho-3'-(1',2'-diacyl)-glycerol, 3-acylglycero-1- phospho-glycerol, and 1,2-diacylglycero-3-phospho-glycerol. A particular more preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is a bis(monoacylglycerol)phosphate selected from the group consisting of 2,2'-S,S- bis(monoacylglycerol)phosphate, 3,3'-S,S-bis(monoacylglycerol)phosphate, 3,3'-R,R- bis(monoacylglycerol)phosphate, and 3,3'-R,S-bis(monoacylglycerol)phosphate. A bis(monoacylglycerol)phosphate may also be selected from 2,2‘-R,R- bis(monoacylglycerol)phosphate and 2,2‘-R,S -bis(monoacylglycerol)phosphate. A particular still more preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is a bis(monoacylglycerol)phosphate selected from the group consisting of bis(monododecylglycerol)phosphate, bis(monotridecylglycerol)phosphate, bis(monotetradecylglycerol)phosphate, bis(monopentadecylglycerol)phosphate, bis(monohexadecylglycerol)phosphate, bis(monoheptadecylglycerol)phosphate, bis(monooctadecylglycerol)phosphate, bis(monononadecylglycerol)phosphate, bis(monoicosylglycerol)phosphate, bis(monolauroleoylglycerol)phosphate, bis(monomyristoleoylglycerol)phosphate, bis(monopalmitoleoylglycerol)phosphate, bis(monopetroseloylglycerol)phosphate, bis(monopetroselaidoylglycerol)phosphate, bis(monooleoylglycerol)phosphate, bis(monoelaidoylglycerol)phosphate, bis(monovaccenoylglycerol)phosphate, and bis(monogadoleoylglycerol)phosphate. A further embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is a 3-acylglycero-1-phospho-3'-(1',2'-diacyl)-glycerol selected from the group consisting of 3-dodecylglycero-1-phospho-3'-(1',2'-didodecyl)-glycerol, 3-tridecylglycero-1-phospho- 3'-(1',2'-ditridecyl)-glycerol, 3-tetradecylglycero-1-phospho-3'-(1',2'-ditetradecyl)-glycerol, 3- pentadecylglycero-1-phospho-3'-(1',2'-dipentadecyl)-glycerol, 3-hexadecylglycero-1-phospho-3'-(1',2'- ZSP Ref.: 1261-2 PCT dihexadecyl)-glycerol, 3-heptadecylglycero-1-phospho-3'-(1',2'-diheptadecyl)-glycerol, 3- octadecylglycero-1-phospho-3'-(1',2'-dioctadecyl)-glycerol, 3-nonadecylglycero-1-phospho-3'-(1',2'- dinonadecyl)-glycerol, 3-icosylglycero-1-phospho-3'-(1',2'-diicosyl)-glycerol, 3-lauroleoylglycero-1- phospho-3'-(1',2'-dilauroleoyl)-glycerol, 3-myristoleoylglycero-1-phospho-3'-(1',2'-dimyristoleoyl)- glycerol, 3-palmitoleoylglycero-1-phospho-3'-(1',2'-dpalmitoleoyl)-glycerol, 3-petroseloylglycero-1- phospho-3'-(1',2'-dipetroseloyl)-glycerol, 3-petroselaidoylglycero-1-phospho-3'-(1',2'- dipetroselaidoyl)-glycerol, 3-oleoylglycero-1-phospho-3'-(1',2'-dioleoyl)-glycerol, 3-elaidoylglycero-1- phospho-3'-(1',2'-dielaidoyl)-glycerol, 3-vaccenoylglycero-1-phospho-3'-(1',2'-divaccenoyl)-glycerol, and 3-gadoleoylglycero-1-phospho-3'-(1',2'-digadoleoyl)-glycerol. A further preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is a 3-acylglycero-1-phospho-glycerol selected from the group consisting of 3-dodecylglycero-1- phospho-glycerol, 3-tridecylglycero-1-phospho-glycerol, 3-tetradecylglycero-1-phospho-glycerol, 3-pentadecylglycero-1-phospho-glycerol, 3-hexadecylglycero-1-phospho-glycerol, 3-heptadecylglycero-1-phospho-glycerol, 3-octadecylglycero-1-phospho-glycerol, 3-nonadecylglycero-1-phospho-glycerol, 3-icosylglycero-1-phospho-glycerol, 3-lauroleoylglycero-1-phospho-glycerol, 3-myristoleoylglycero-1-phospho-glycerol, 3-palmitoleoylglycero-1-phospho-glycerol, 3-petroseloylglycero-1-phospho-glycerol, 3- petroselaidoylglycero-1-phospho-glycerol, 3-oleoylglycero-1-phospho-glycerol, 3-elaidoylglycero-1-phospho-glycerol, 3-vaccenoylglycero-1-phospho-glycerol, and 3- gadoleoylglycero-1-phospho-glycerol. A further more preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is a 1,2- diacylglycero-3-phospho-glycerol selected from the group consisting of 1,2-didodecylglycero-3- phospho-glycerol, 1,2-ditridecylglycero-3-phospho-glycerol, 1,2-ditetradecylglycero-3-phospho- glycerol, 1,2-dipentadecylglycero-3-phospho-glycerol, 1,2-dihexadecylglycero-3-phospho-glycerol, 1,2-diheptadecylglycero-3-phospho-glycerol, 1,2- dioctadecylglycero-3-phospho-glycerol, 1,2-dinonadecylglycero-3-phospho-glycerol, 1,2- diicosylglycero-3-phospho-glycerol, 1,2-dilauroleoylglycero-3-phospho-glycerol, 1,2- dimyristoleoylglycero-3-phospho-glycerol, 1,2-dipalmitoleoylglycero-3-phospho-glycerol, 1,2-dipetroseloylglycero-3-phospho-glycerol, 1,2- dipetroselaidoylglycero-3-phospho-glycerol, 1,2-dioleoylglycero-3-phospho-glycerol, 1,2- dielaidoylglycero-3-phospho-glycerol, 1,2-divaccenoylglycero-3-phospho-glycerol, and 1,2- digadoleoylglycero-3-phospho-glycerol. A further still more preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is a fatty acid selected from the group consisting of myristic acid, pentadecanoic acid, palmitic acid, margaric acid, stearic acid, isostearic acid, nonadecylic acid, arachidic acid, myristoleic acid, palmitoleic acid, sapienic acid, oleic acid, elaidic acid, vaccenic acid, and linoleic acid; or a methyl ester or a glyceryl ester of one of the aforementioned fatty acids. A further still more preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the fusogenic agent is selected from the ZSP Ref.: 1261-2 PCT group consisting of monogalactosyldilinolenoylglycerol, 1-palmitoyl-2-linoleoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine, N-palmitoyl-1,2-dipalmitoyl-sn-glycero-3- phosphoethanolamine, 2,2'-S,S-bis(monododecylglycerol)phosphate, 3,3'-S,S- bis(monododecylglycerol)phosphate, 3,3'-R,R-bis(monododecylglycerol)phosphate, 3,3'-R,S- bis(monododecylglycerol)phosphate, 2,2'-S,S-bis(monooctadecylglycerol)phosphate, 3,3'-S,S-bis(monooctadecylglycerol)phosphate, 3,3'- R,R-bis(monooctadecylglycerol)phosphate, 3,3'-R,S-bis(monooctadecylglycerol)phosphate, 2,2'-S,S- bis(monooleoylglycerol)phosphate, 3,3'-S,S-bis(monooleoylglycerol)phosphate, 3,3'-R,R-bis(monooleoylglycerol)phosphate, 3,3'-R,S-bis(monooleoylglycerol)phosphate, 3- dodecylglycero-1-phospho-3'-(1',2'-didodecyl)-glycerol, 3-octadecylglycero-1-phospho-3'-(1',2'- dioctadecyl)-glycerol, 3-oleoylglycero-1-phospho-3'-(1',2'-dioleoyl)-glycerol, glyceryl monoloeate, methyl oleate, isostearic acid, palmitoleic acid, and oleic acid. In another aspect, the present invention provides a drug delivery system as disclosed above, wherein the lipid bilayer comprises: iv) between 2.5 and 35 mol percent of at least one neutral lipid. In another preferred aspect, the present invention provides a drug delivery system as disclosed above, wherein the lipid bilayer comprises: iv) between 2.5 and 35 mol percent of at least one neutral lipid selected from the group consisting of cholesterol, diosgenin, solasodine, and ceramide. It is also herein provided a drug delivery system as disclosed above, wherein the therapeutic agent is a peptide, protein, an antibody, a nanobody, a nucleic acid, a ribonucleoprotein, a small molecule, a non- lipinski molecule, a biomimetic, or a natural compound. It is further herein provided a drug delivery system as disclosed above, wherein the therapeutic agent is a CRISPR / Cas9 ribonucleoprotein, a CRISPR guide RNA, or a Cas protein. A particular embodiment of the invention provides a drug delivery system as disclosed above, wherein the therapeutic agent is a nucleic acid selected from the group comprising ssDNA, dsDNA, ssRNA, dsRNA, aiRNA, miRNA, siRNA, piRNA, sdRNA, snRNA, snoRNA, PAR, tsRNA, endo-siRNA, MSY-RNA, tel-sRNA, crasiRNA, moRNA, xiRNA, lncRNA, ncRNA, circRNA, mRNA, sgRNA, crRNA, tracr RNA, guide RNA mix, self-amplifying RNA, ribozymes, and antisense oligonucleotides. In a preferred embodiment, the composition disclosed herein comprises as component (b) α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45; as component (c) 2,2'-S,S-bis(monooleoylglycerol)phosphate or 3,3'-S,S- bis(monooleoylglycerol)phosphate; ZSP Ref.: 1261-2 PCT as component (d) 1,2-dioleoyl-3-trimethylammonium propane chloride and / or PD740; and as component (e) cholesterol and / or solasodine. In a preferred embodiment, the composition disclosed herein comprises as component (b) α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45; as component (c) 2,2'-S,S-bis(monooleoylglycerol)phosphate or 3,3'-S,S- bis(monooleoylglycerol)phosphate; as component (d) 1,2-dioleoyl-3-trimethylammonium propane chloride; and as component (e) cholesterol. In a preferred embodiment, the composition disclosed herein comprises as component (b) α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45; as component (c) 2,2'-S,S-bis(monooleoylglycerol)phosphate or of 3,3'-S,S- bis(monooleoylglycerol)phosphate; and as component (d) 1,2-dioleoyl-3-trimethylammonium propane chloride. In a preferred embodiment, the composition disclosed herein comprises as component (b) between 1 and 20 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy- [1,3]dioxan-5-yl)-amido}-polyethylene glycol45, wherein said mol percent is calculated taking the total moles of all components except component (a) that are comprised in said composition as 100%. A preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride and / or PD740, ii) between 1 and 20 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45, iii) between 15 and 45 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate, and iv) between 13 and 35 mol percent of cholesterol. In one embodiment the composition of the invention comprises (b) between 1 and 20 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45; (c) between 15 and 45 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate or of 3,3'-S,S- bis(monooleoylglycerol)phosphate; (d) between 30 and 75 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride and / or PD740; and (e) between 13 and 35 mol percent of cholesterol; wherein said mol percent is calculated taking the total moles of all components except component (a) that are comprised in said composition as 100%. ZSP Ref.: 1261-2 PCT Another embodiment of the invention provides a drug delivery system as disclosed above, wherein the lipid bilayer comprises i) 50 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride, ii) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45, iii) 20 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate, and iv) 25 mol percent of cholesterol. In a preferred embodiment the composition of the invention comprises (b) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45; (c) 20 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate or of 3,3'-S,S- bis(monooleoylglycerol)phosphate; (d) 50 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride; and (e) 25 mol percent of cholesterol, wherein said mol percent is calculated taking the total moles of all components except component (a) that are comprised in said composition as 100%. In a preferred embodiment the composition of the invention comprises (b) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45; (c) 45 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate or of 3,3'-S,S- bis(monooleoylglycerol)phosphate; and (d) 50 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride, wherein said mol percent is calculated taking the total moles of all components except component (a) that are comprised in said composition as 100%. Another preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the lipid bilayer comprises i) 50 mol percent of PD740, ii) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45, iii) 20 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate, and iv) 25 mol percent of cholesterol. In one embodiment the composition of the invention comprises (b) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45; (c) 20 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate or of 3,3'-S,S- bis(monooleoylglycerol)phosphate; (d) 50 mol percent of PD740; and ZSP Ref.: 1261-2 PCT (e) 25 mol percent of cholesterol; wherein said mol percent is calculated taking the total moles of all components except component (a) that are comprised in said composition as 100%. A further preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the lipid bilayer comprises ia) 25 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride, ib) 25 mol percent of PD740, ii) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45, iii) 20 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate, and iv) 25 mol percent of cholesterol. In one embodiment the composition of the invention comprises (b) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45; (c) 20 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate or of 3,3'-S,S- bis(monooleoylglycerol)phosphate; (d1) 25 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride; (d2) 25 mol percent of PD740; and (e) 25 mol percent of cholesterol; wherein said mol percent is calculated taking the total moles of all components except component (a) that are comprised in said composition as 100%. A further more preferred embodiment of the invention provides a drug delivery system as disclosed above, wherein the lipid bilayer comprises i) 33 mol percent of PD740, ii) 7 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45, iii) 27 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate, and iv) 33 mol percent of cholesterol. In one embodiment the composition of the invention comprises (b) 7 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45; (c) 27 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate or of 3,3'-S,S- bis(monooleoylglycerol)phosphate; (d) 33 mol percent of PD740; and (e) 33 mol percent of cholesterol; ZSP Ref.: 1261-2 PCT wherein said mol percent is calculated taking the total moles of all components except component (a) that are comprised in said composition as 100%. An alternative embodiment of the invention provides a drug delivery system as disclosed above, wherein the lipid bilayer comprises i) 42 to 50 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride, ii) 4 to 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45, iii) 4 to 15 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate, iva) 13 to 15 mol percent of cholesterol, and ivb) 15 to 36 mol percent of solasodine. In one embodiment the composition of the invention comprises (b) between 4 and 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)- amido}-polyethylene glycol45; (c) between 4 and 15 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate or of 3,3'-S,S- bis(monooleoylglycerol)phosphate; (d) between 42 and 50 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride; (e1) between 13 and 15 mol percent of cholesterol; and (e2) between 15 and 36 mol percent of solasodine; wherein said mol percent is calculated taking the total moles of all components except component (a) that are comprised in said composition as 100%. In one embodiment the composition of the invention comprises (b) α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}-polyethylene glycol45; (c) monogalactosyldiacylglycerol or 1-palmitoyl-2-linoleoyl-sn-glycero-3-phosphoethanolamine; (d) 1,2-dioleoyl-3-trimethylammonium propane chloride and PD740; and (e) cholesterol. A further alternative embodiment of the invention provides a drug delivery system as disclosed above, wherein the lipid bilayer comprises ia) 25 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride, ib) 25 mol percent of PD740, ii) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45, iii) 20 mol percent of monogalactosyldiacylglycerol or 1-palmitoyl-2-linoleoyl-sn-glycero-3- phosphoethanolamine, and iv) 25 mol percent of cholesterol. In one embodiment the composition of the invention comprises ZSP Ref.: 1261-2 PCT (b) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45; (c) 20 mol percent of monogalactosyldiacylglycerol or 1-palmitoyl-2-linoleoyl-sn-glycero-3- phosphoethanolamine; (d1) 25 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride; (d2) 25 mol percent of PD740; and (e) 25 mol percent of cholesterol, wherein said mol percent is calculated taking the total moles of all components except component (a) that are comprised in said composition as 100%. A particular embodiment of the present invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 1:1 to about 50:1. Another embodiment of the present invention relates to the composition as disclosed herein, wherein the N:P ratio is from about 1:1 to about 50:1. Finally, another particular embodiment of the present invention provides a drug delivery system as disclosed above, wherein the liposome is a unilamellar and / or univesicular liposome. Description of the figures: Figure 1 Shows (a) schematic representation of endosomal escape induced by the drug delivery system disclosed herein; (b) Structure of labile, acid-cleavable PEG-lipid; (c) Structure of fusogenic lipid 2,2’-LBPA and isomerization to 3,3’ isoform. Figure 2 Shows in vitro characterization of the delivery system. (a) Liposomes of composition LP1 visualized by cryo transmission electron microscopy (scale bar 100 nm). The image shows unilamellar, univesicular individual spherical vesicles composed ofa single membrane surrounding an aqueous core with a diameter of 100 nm and less. Gold nanoparticles (10 nm) used for image alignment can be seen as electron-dense dots attached to some of the vesicles. (b) Extruded liposomes embedded in methyl cellulose and stained with sodium tungstate and uranyl acetate visualized by transmission electron microscopy (scale bar 100 nm). The image shows vesicles that are folded over or with a donut shape, as the spherical vesicles collapse during the embedding due to their aqueous core. Most of the vesicles are individual, while some are in contact with each other. Their size is between 50 and 300 nm along their longest axis. (c) Size distribution of extruded liposomes by dynamic light scattering (n = 6, mean ± SEM). (d) siRNA encapsulation in extruded liposomes, analyzed by Ribogreen assay (n = 12, mean ± SEM). (e) siRNA content before and after extrusion, analyzed by Ribogreen assay (n = 8 (without extrusion), 12 (with extrusion), mean ± SEM). (f,g) Agarose gel images and quantification of RNase A treatment kinetics of non-encapsulated (naked) siRNA (dark grey in (g)) and siRNA encapsulated in liposomes (light grey in (g)) (n = 3, mean ± SD). The image shows siRNA bands on the agarose gel for each timepoint. For siRNA in ZSP Ref.: 1261-2 PCT liposomes the siRNA band is present for each timepoint, while for non-encapsulated siRNA the band gets fainter over time and is becoming not visible after 8 min. This shows that siRNA in liposomes is protected from RNase degradation. (h) Comparison of size distribution of extruded liposomes analyzed by dynamic light scattering directly after preparation and after 9 months, 1.6 years and 2.4 years storage at 4°C (n = 16 (fresh), n = 12 (9 months), n = 15 (1.6 years), n = 14 (2.4 years), mean ± SEM). (i) Comparison of siRNA encapsulation analyzed by Ribogreen assay directly after preparation and after 9 months, 1.6 and 2.4 years of storage at 4°C (n = 12 (fresh), n =10 (9 months), n =10 (1.6 years), n = 14 (2.4 years), mean ± SEM). (j) Comparison of siRNA amount after 2.4 years of storage at 4°C, expressed as percentage of the siRNA amount measured directly after liposome formation (n = 8, mean ± SEM). (k) Comparison of siRNA encapsulation analyzed by Ribogreen assay between liposomes made with siRNA at N / P ratio 20:1 and 5:1 (n=1, mean± SD). This example shows that the delivery system of the composition of this invention can be formulated as liposomal, unilamellar, nanoscale sized, encapsulates RNA to a high degree and protects the RNA from RNAse degradation and the example shows that the in vitro parameters of the formulation are stable over time. Figure 3 Shows anti eGFP siRNA uptake and eGFP downregulation in HeLa eGFP cells. (a) HeLa cells control (left column) and after 4 h uptake of liposomes with 10 nM Alexa 647- labeled siRNA (right) (scale bar 25 µm). A vesicular pattern of Alexa 647 labeled siRNA can be detected in the treated cells, but not in the untreated ones (bottom row). The vesicular pattern shows that liposomal siRNA is taken up by endocytosis. Position of cells is visualized by Hoechst / Cell Mask Blue staining (top row). (b) Downregulation of eGFP and toxicity (nuclei number) induced by siRNA encapsulated in liposomes compared to naked, non-encapsulated siRNA, both at 10 nM, in HeLa cells. Mean eGFP expression intensity and number of nuclei are expressed as percentage of untreated control (n = 6, mean ± SEM). (c) Comparison of eGFP downregulation by siRNA liposomes containing the two active components, LBPA and labile PEG lipid, to that by liposomes containing one active component and one non-active replacing component (n = 6, mean ± SEM, siRNA conc. = 10 nM). (d) eGFP downregulation in HeLa eGFP cells treated with different concentrations of siRNA in extruded liposomes for 5 h in the presence of serum (72 h after transfection, scale bar 100 µm). Decreased amount of GFP fluorescent signal can be detected with increasing amount of siRNA concentration (left column). The untreated cells are uniformly positive for GFP, while only a few positive cells can be detected in cells treated with 2.5 nM and most of the cells show no GFP signal when treated with 10 nM. This dose dependent reduction of protein levels corresponds to downregulation of GFP. The position of cells is indicated by DAPI staining (right column). Scalebar 100 µm. (e) Single cell distribution of eGFP intensity ZSP Ref.: 1261-2 PCT normalized to median of untreated control after treatment with different concentrations of siRNA in extruded liposomes (n = 1, mean ± SD). (f) Comparison of eGFP downregulation mediated by siRNA-liposomes containing different LBPA isomers (n = 36-53 (2,2’-LBPA), 11-17 (3,3’-LBPA), mean ± SEM). (g) Comparison of toxicity by siRNA-liposomes containing different LBPA isomers (n = 36-53 (2,2’-LBPA), 11-17 (3,3’-LBPA), mean ± SEM). (h) Dose response curve of eGFP downregulation and toxicity (n = 4, line: fit with four-parameter log-logistic model, shading: 95% confidence interval). (i) Reproducibility of eGFP downregulation liposomes comprising 2,2’-LBPA (n = 36-53). (j) Reproducibility of toxicity by siRNA-liposomes comprising 2,2’-LBPA (n = 36-53). (k) Comparison of eGFP downregulation by siRNA-liposomes directly after their preparation and after 9 months, 1.6 years and 2.4 years of storage at 4°C (n = 10 (fresh), 11 (9 months), 14 (1.6 years), and 14 (2.4 years), mean ± SD); (l) Dose-response curve for eGFP downregulation and toxicity (nuclei number) in Hela cells by siRNA- liposomes used fresh directly after preparation or after 5 h of serum pre-incubation (n = 3, mean ± SD). This example shows that this exemplary composition of the invention is effective for siRNA delivery at nanomolar concentrations in presence of serum with low toxicity. The knockdown efficiency is reproducible and stable over time. Figure 4 Shows uptake and eGFP downregulation in primary bone marrow-derived macrophages and hepatocytes from LifeAct-GFP mice. (a) Primary bone marrow-derived mouse macrophages after 6 h uptake of Alexa 647-labeled siRNA-liposomes (left column) and untreated control (right column) (scale bar 25 µm, c = 5 nM). A vesicular pattern of Alexa 647 labeled siRNA can be detected in the treated cells, but not in the untreated ones (bottom row), indicating uptake by endocytosis. Presence of cells is indicated by DAPI staining (top row). (b) eGFP downregulation in primary macrophages treated with different concentrations of anti eGFP siRNA-liposomes for 5 h in the presence of serum (72 h after transfection, scale bar 100 µm). Decrease of GFP signal can be seen with increased concentrations of siRNA (left column). Untreated cells are uniformly positive for GFP, while less cells are positive for GFP when treated with increasing siRNA concentration and most cells are negative when treated with 20 nM. This demonstrates dose dependent eGFP downregulation. The position of cells is indicated by DAPI staining (right column). (c) Quantification of eGFP downregulation and toxicity in primary macrophages (n = 9, mean ± SEM). (d) Dose response curve of eGFP downregulation and toxicity in primary macrophages (n = 4, line: fit with four- parameter log-logistic model, shading: 95% confidence interval). (e) Reproducibility of eGFP downregulation in primary macrophages (n = 37-49). (f) Reproducibility of toxicity in primary macrophages (n = 37-49). (g) eGFP downregulation in primary hepatocytes treated with different concentrations of anti eGFP siRNA-liposomes for 5 h in the presence of serum (72 h after transfection, scale bar 100 µm). Decrease of eGFP ZSP Ref.: 1261-2 PCT signal can be detected with increased concentrations of siRNA (left column). Cells are uniformly positive for eGFP in the untreated condition, while with increasing siRNA concentration less cells are positive. At 5 nM and above most treated cells are negative for eGFP. This corresponds to dose dependent eGFP downregulation. The position of cells is indicated by DAPI staining (right column). (h) Quantification of eGFP downregulation and toxicity in primary hepatocytes (n = 2, mean ± SEM) treated with different concentrations of siRNA-liposomes. This example shows that the aforementioned exemplary composition of the invention is effective for the delivery of siRNA into primary cells at nanomolar concentrations. Figure 5 Shows in vitro characterization of liposomes with mRNA and delivery of mRNA in HeLa cells, primary macrophages and hepatocytes. (a) Encapsulation efficiency of mRNA in liposomes at charge ratio 6:1, analyzed by Ribogreen assay (n = 9, mean ± SEM). (b) Conventional transmission electron microscopy of liposomes with mRNA (scale bar 100 nm). The image shows spherical vesicles with a diameter of 100 nm and below. (c) Size distribution of liposomes analyzed by dynamic light scattering before and after addition of mRNA at charge ratio 6:1 (n = 2, mean ± SD). (d) HeLa cells treated with different concentrations of eGFP mRNA-liposomes at charge ratio 6:1 in the presence of serum for 24 h (scale bar 100 µm). Number of cells expressing GFP and GFP fluorescence intensity increases with increasing mRNA dose treatment. Untreated cells show no GFP fluorescence, few cells are positive when treated with a 0.16 µg / ml dose with low GFP intensity, more cells are positive and the fluorescence intensity is increased when treated with 0.31 µg / ml and most cells are positive for GFP with high signal intensity for a treatment with 0.63 µg / ml, showing dose dependent GFP expression. GFP fluorescence (left column) and cellular location by DAPI staining (right column). (e) Quantification of eGFP expression and toxicity in the HeLa cells treated with eGFP mRNA-liposomes at charge ratio 6:1, shown in (d) (n = 3, mean ± SEM). (f) Quantification of eGFP expression and toxicity in HeLa cells at charge ratio 3:1 (n = 2, mean ± SEM). (g) Quantification of eGFP expression by intensity in HeLa cells after treatment with liposomes of composition LP1 and mRNA mixed at different N / P ratios (n = 1, mean ± SD). (h) Quantification of percentage of HeLa cells positive for eGFP expression after treatment with liposomes of composition LP1 and mRNA mixed at different N / P ratios (n = 1, mean ± SD). (i) Quantification of toxicity by analyzing total cell number normalized to untreated control in HeLa cells after treatment with liposomes of composition LP1 and mRNA mixed at different N / P ratios (n = 1, mean ± SD). (j) Primary bone marrow-derived mouse macrophages treated with different concentrations of eGFP mRNA-liposomes at charge ratio 6:1 in the presence of serum for 24 h (scale bar 100 µm). Both number of cells expressing eGFP and eGFP fluorescence intensity increases with increasing mRNA concentration (left column). ZSP Ref.: 1261-2 PCT Untreated cells show no eGFP signal, treatment with 0.31 µg / ml results in few eGFP positive cells, a treatment with 0.63 µg / ml results in many cells positive with a higher signal intensity and for a treatment with 1.25 µg / ml most cells are positive with high signal intensity, showing dose dependent eGFP expression. Cellular location is visualized by DAPI staining (right column). (k) Quantification of eGFP expression and toxicity in primary mouse macrophages treated with eGFP mRNA-liposomes at charge ratio 6:1, shown in (j) (n = 3, mean ± SEM). (l) Quantification of eGFP expression and toxicity in primary mouse macrophages at charge ratio 3:1 (n = 3, mean ± SEM). (m) Primary hepatocytes treated with different concentrations of eGFP mRNA-liposomes at charge ratio 3:1 in the presence of serum for 24 h (scale bar 50 µm). Both number of cells expressing eGFP and eGFP fluorescence intensity increase with increasing mRNA dose treatment (left column). Untreated cells are negative for eGFP, when treated with 0.63 µg / ml a few cells show eGFP fluorescence, when treated with 1.25 µg / ml about half of the cells are positive for eGFP with intermediate and high intensity and for a treatment with 2.50 µg / ml about ¾ of the cells are positive for eGFP, mostly with high intensity. Cellular location is visualized by nuclear staining with DAPI (right column). (n) Quantification of eGFP expression in primary hepatocytes shown in (m) (n = 1, mean ± SEM). This example shows that the tested exemplary composition of the invention is effective for the delivery of mRNA into various cell types, including primary cells, inducing high protein expression in the majority of cells present. Different charge ratios N / P can be used. The example further shows that liposomes with mRNA are in a nanoscale size range and encapsulate RNA to a high degree. Figure 6 Shows delivery of CRISPR Cas9 ribonucleoprotein complex (Cas9 RNP) and guide RNA in HeLa eGFP cells. (a) Downregulation of eGFP and toxicity of Cas9 RNP- liposomes in HeLa eGFP cells (n = 3, mean ± SEM). b) Comparison of downregulation efficiency of eGFP with Cas9 RNP in liposomes at charge ratio 9.10:1 (as in panel a) and 5.46:1 in HeLa eGFP cells (n = 3, mean ± SEM). (c) Comparison of toxicity by analyzing the number of nuclei compared to untreated control in HeLa eGFP cells treated with Cas9 RNP in liposomes at charge ratio 9.10:1 (as in panel a) and 5.46:1 (n = 3, mean ± SEM). (d) Comparison of different liposome compositions for the transfection of guide RNA mix against eGFP into HeLa cells previously transfected with BacMam Cas9; GFP intensity is normalized to untreated control. (n=5 (3,3’- and 2,2,’-LBPA), 3 (LP4), 1 (EPC), mean ± SEM). (e) Toxicity data for treatment of panel (b). (n=5 (3,3’- and 2,2,’-LBPA), 3 (LP4), 1 (EPC), mean ± SEM). (f) Comparison of downregulation efficiency of eGFP with guide RNA mix in liposomes at charge ratio 8,45:1 (as in panel c,d) and 5,07:1 in HeLa cells transfected with BacMan Cas9 (n = 3, mean ± SEM). (c) Comparison of toxicity by analyzing the number of nuclei compared to untreated control in HeLa cells expressing Cas9 after BacMam transfection treated ZSP Ref.: 1261-2 PCT with guide RNA in liposomes at charge ratio 8.45:1 (as in panel c,d) and 5.07:1 (n = 3, mean ± SEM). This example shows that the tested composition of the invention is effective for delivery of ribonucleoprotein complexes, specifically CRISPR / Cas9 ribonucleoprotein complexes with guideRNA as well as for the delivery of guideRNA for CRISPR / Cas9 mediated knockout. Different charge ratios N / P and compositions of the invention can be used. Figure 7 Shows exploration of suitable variations from the identified liposomal composition LP1. (a) Overview of different variations screened to optimize liposome formulation with anti eGFP siRNA as cargo in HeLa eGFP cells. (b) Identification of effective percentage ranges of the indicated components of the initial composition LP1 (black) with 10 nM siRNA in HeLa eGFP cells (n=3, mean ± SD). (c) Helper lipid variation in the basis formulation LP1 (n=12 (Solasodine), 1 (Ceramide), 2 (Diosgenin), 10 (LP1), mean ± SD). (d) Several isoforms of LBPA show a similar activity when replacing LBPA in LP1 formulation (n=3, mean ± SD). (e) Encapsulating agent variation in LP1 formulation. PD740 (LP2) shows increased activity compared to DOTAP (LP1) (n=6 (LP1), 3 (others), mean ± SD). (f) Test of formulations LP2, LP3, and LP4 containing PD740 to find optimal composition for eGFP knock down efficiency (n= 17 (LP1), 8 (LP2), 2 (LP3), 5 (LP4), mean ± SD). (g) Toxicity profiles of formulations from (f). (h, i) Dose response curves for eGFP intensity and nuclei number obtained using LP1-LP4 liposome formulations at 10 concentrations to extract EC50 and TC50 (n = 6 (LP1), 2 (LP2), 7 (LP3), 2 (LP4), mean ± SD). (j) Difference in eGFP intensity normalized to untreated control for HeLa eGFP cells treated with anti eGFP siRNA in liposomes at different N / P ratios compared to N / P ratio 20:1 (n= 2 (for N / P = 40:1, 20:1, 10:1), 1 (for N / P = 5:1), mean ± SD). (k) Difference in number of nuclei normalized to untreated control for HeLa eGFP cells treated with anti eGFP siRNA in liposomes at different N / P ratios compared to N / P ratio 20:1 (n= 2 (for N / P = 40:1, 20:1, 10:1), 1 (for N / P = 5:1), mean ± SD). This example shows different tested compositions and variations of compositions of the invention that are effective for siRNA delivery. Different compounds can be used as components (c), (d) and (e) of the composition, showing a comparable or increased effect for siRNA delivery in target cells. Different charge ratios N / P are effective for siRNA delivery using the compositions of the invention. Figure 8 Shows screening of potential fusogenic agents. (a) Similar eGFP knock down in HeLa eGFP cells reached by replacing LBPA in formulation LP3 with MGDG or PLPE (n= 7 (LP3), 2 (PLPE), 3 (MGDG), mean ± SD, fit: 4 parameter logistic). (b) Formulation containing MGDG shows a lower toxicity profile than LP3 (n= 7 (LP3), 2 (PLPE), 3 (MGDG), mean ± SD, fit: 4 parameter logistic). (c) Effect of substituting LBPA with GMO, POPE or IsostA in LP3 composition on eGFP downregulation efficiency by anti eGFP siRNA-liposomes, comparison with formulation LP1 (n= 6 (LP1), 2 (GMO, ZSP Ref.: 1261-2 PCT POPE), 3 (IsostA), mean ± SD, fit: 4 parameter logistic); (d) Toxicity profile for compositions from (c) (n= 6 (LP1), 2 (GMO, POPE), 3 (IsostA), mean ± SD, fit: 4 parameter logistic); (e, f) Compositions combining LBPA and fusogenic agents reach a similar knockdown efficiency and toxicity profile (n= 7 (LP3), 1 (all others), mean ± SD, fit: 4 parameter logistic). This example demonstrates that various compounds can serve as fusogenic agents or components (c) of the formulation of the invention, yielding similar or enhanced siRNA-mediated downregulation in cells compared to composition LP1. It also highlights that different compounds acting as cationic agents or components (d) are effective for siRNA-mediated downregulation when combined with various components (c). Figure 9 Shows changed downregulation profiles in primary mouse macrophages in response to different liposome compositions. (a) Comparison of eGFP knock down efficiency of LP1 (classic) with compositions containing varying amount of PD740 (n= 5 (LP3), 4 (LP1), 1 (LP2, LP4), mean ± SD, fit: 4 parameter logistic). (b) Comparison of eGFP knock down efficiency of anti eGFP siRNA-liposomes with LP3 composition and compositions where LBPA has been replaced with other fusogenic agents (n= 5 (LP3), 2 (MGDG, IsostA), 1 (GMO, POPE), mean ± SD, fit: 4 parameter logistic). (c) Comparison of eGFP knockdown efficiency of siRNA-liposomes with LP3 compositions containing both LBPA and another fusogenic agent (n= 5 (LP3), 1 (others), mean ± SD, fit: 4 parameter logistic). This example shows that different compositions of the invention containing different compounds as fusogenic agents or component (c) and / or different compounds as cationic agents or component (d) of the composition of the invention are effective for siRNA mediated downregulation in primary mouse macrophages with the same or increased effect compared to composition LP1. Figure 10 Shows (a) phenotypic comparison of siRNA-liposome treatment with treatment with the endosomal disruptive agent L-leucine methyl ester (LLOMe). HeLa cells were transfected with GFP-tagged galectin-8 by BacMam virus. Endosomal disruption is characterized by appearance of aggregated galectin-8 foci as seen for LLOME treatment, which are not visible upon liposome treatment (scale bar 20 µm). Untreated cells show a low background level of GFP fluorescence, cells treated with liposomes LP1 show the same background level as the untreated cells with a few cells exhibiting diffuse GFP fluorescence in cytosol and nuclei above background level (top row). Cell location is visualized by staining with DAPI and CMB (bottom row). (b) Phenotypic comparison of siRNA-liposome treatment with treatment with siRNA lipoplexes. HeLa cells were treated with A647-labeled siRNA complexed with lipofectamine 2000, resulting in endosomal bursting events (cells with release events are marked with arrows) (top row). Cells treated with A647-labeled siRNA in liposomes show a ZSP Ref.: 1261-2 PCT vesicular pattern on the same timescale (bottom row), indicating that endosomes are not ruptured by this more gentle treatment. Background GFP fluorescence was used to visualize cellular position (scale bar 10 µm), shown in the left panel of both rows. A647- siRNA was imaged at 6.4 s intervals for 5 min in the same position, images at 13, 45 and 77 s timepoint are shown in middle and right panels. This example shows that treatment of cells with the compositions of the invention does not disrupt endosomes and is milder than treatment with lipofectamine-based siRNA lipoplexes. Figure 11 (a) Screening in HeLa eGFP cells of structural analogues of E18 to identify potential endosomal escape enhancers. Cells were treated with both chol-siRNA (200 nM) and the indicated compounds (6 µM (treatments 1-24) and 7 µM (treatments 25-32)). Downregulation of eGFP and nuclei number were quantified as percentage of untreated control. (n=2 (treatments 1-24), 1 (treatments 25-32), mean ± SEM). (b) Dose response curves of hits from screening showed in (a). HeLa cells were treated with varying concentrations of the indicated compounds in the presence of chol-siRNA (150 nM). (n=3, mean ± SEM). This example shows the identification of enhancers of siRNA delivery. Figure 12 Shows comparison of different liposomal compositions for mRNA transfection in HeLa cells. HeLa cells were treated for 24 h with liposomes of varying composition containing eGFP mRNA in the presence of serum: (a,b) Quantification of eGFP expression (percentage of positive cells (a) and fluorescence intensity (b)) for treatment with mRNA-liposomes containing endosomal escape enhancer solasodine at two different concentrations. (n = 3, mean ± SEM). (c,d) Quantification of eGFP expression (percentage of positive cells (c) and fluorescence intensity (d)) for treatment with mRNA-liposomes with formulations LP3 and LP4 containing PD740 compared to LP1. (n = 2, mean ± SEM). (e) Quantification of toxicity of mRNA-liposome formulations shown in (c) and (d). (n = 2, mean ± SEM). (f, g, i, j) Quantification of eGFP expression (percentage of positive cells (f, i) and fluorescence intensity (g, j)) for the treatment with mRNA-liposomes LP-MGDG or LP-PLPE that comprise both PD740 as additional encapsulating agent and the alternative fusogenic agents MGDG or PLPE, respectively (n = 2 (f, g), mean ± SEM, n = 1 (i, j), mean ± SD), in comparison to LP1 and LP3. (h) Quantification of toxicity of mRNA-liposome formulations showed in (f, g). (n = 2, mean ± SEM). This example shows that different compositions of the invention containing different compounds as fusogenic agents or compounds (c) of the composition of the invention are effective for mRNA delivery with the same or increased effect compared to composition LP1. Figure 13 Shows semi-automated production of liposomes with NanoAssemblr microfluidic system. (a) Liposomes of composition LP1 produced by NanoAssemblr showed same transfection efficiency for mRNA in HeLa cells in terms of percentage of cells ZSP Ref.: 1261-2 PCT expressing eGFP as liposomes produced by extrusion (n = 1, mean ± SD). (b) Liposomes of composition LP1 produced by NanoAssemblr showed similar level of eGFP expression with mRNA in HeLa cells in terms of GFP intensity as liposomes produced by extrusion. (n = 1, mean ± SD). (c) Size distribution by DLS of liposomes of composition LP1 produced by NanoAssemblr compared to liposomes produced by extrusion. (n = 1, mean). This example shows that liposomes of the composition of the invention can be produced with microfluidic processes, which makes it possible to reach smaller average size without impacting mRNA delivery efficiency. Figure 14 Shows interchangeability of HeLa eGFP and HeLa dsGFP cell line for siRNA downregulation experiments and stability of liposomes towards freezing at -80°C. (a) Comparison of eGFP downregulation with extruded liposomes of composition LP1 in HeLa eGFP and HeLa dsGFP cells (n = 7 (HeLa dsGFP), 4 (HeLa eGFP), mean ± SD). (b) Comparison of toxicity of treatment with extruded liposomes of composition LP1 in HeLa eGFP and HeLa dsGFP cells (n = 7 (HeLa dsGFP), 4 (HeLa eGFP), mean ± SD). (c) Size distribution measured by DLS for liposomes stored in different buffers at -80 °C and 4 °C. (n=1, mean). (d) Comparison of siRNA mediated knock down efficiency in HeLa dsGFP cells in terms of GFP intensity normalized to untreated control using liposomes stored at -80 °C and 4 °C. (n=1, mean ± SD). (e) Comparison of toxicity of siRNA containing liposomes stored at -80 °C and 4 °C for treatment of HeLa dsGFP cells. (n=1, mean ± SD). This example shows that liposomes of the composition of the invention containing siRNA can be stored at -80 °C without impacting their size or downregulation efficiency. Figure 15 Shows mRNA delivery in THP1 cells. (a) Transfection of THP1 cells with eGFP encoding mRNA using liposomes of composition LP1. THP1 cells were treated with different concentrations of liposomes containing eGFP mRNA at charge ratio 6:1 for 24 h. Number of cells expressing eGFP and fluorescence intensity of eGFP increase with dosage. Scalebar 50 µm. Untreated cells show no GFP fluorescence, when treated with0.625 µg / ml a few positive cells with low GFP intensity can be seen, when treated with 1.25 µg / ml many cells are positive with intermediate GFP signal intensity and when treated with 2.5 µg / ml most cells are positive for GFP with high GFP signal intensity. (b) Quantification of eGFP expression by fluorescence intensity and percentage of eGFP positive cells and quantification of toxicity by total cell number in response to treatment. This example shows that the composition of the invention is effective for delivery of mRNA into THP-1 macrophages, a human primary macrophage model. Figure 16 Shows GFP protein delivery in HeLa cells. (a) HeLa cells were treated for 24 h with 125 nM GFP protein alone or mixed with in liposomes. Both a standard, wild-type GFP ((-7)GFP) and a negatively supercharged GFP ((-30)GFP) were used. Both proteins ZSP Ref.: 1261-2 PCT contain a nuclear location sequence (NLS). Top row shows DAPI stained nuclei and bottom row shows GFP stained with an Alexa647-labeled GFP antibody. No GFP signal can be detected in untreated cells and in cells that were treated with protein only, not mixed with liposomes. Cells treated with GFP protein-containing liposomes show GFP fluorescence. Cells treated with liposomes containing (-30)GFP protein show a nuclear stain and a vesicular pattern, while cells treated with liposomes containing (-7)GFP protein show nuclear and cytosolic signal. Scalebar 20 µm. These results demonstrate that the liposomal delivery system can be used for (pure) protein delivery without the need of any nucleic acid and that it does not depend on the protein being highly negatively charged. (b) Quantification of Alexa647-labeled antiGFP antibody fluorescence intensity (n = 1, mean ± SD). (c) Quantification of toxicity via count of total cell number normalized to untreated control (n = 1, mean ± SD ) (d) Quantification of percentage of nuclei that are GFP positive (n = 1, mean ± SD). This example shows that the composition of the invention is effective for delivery of proteins without the presence of nucleic acid or a high negative charge on the protein to be required. Figure 17 Shows comparison with prior art delivery compositions for siRNA delivery. (a, b) Comparison of eGFP downregulation in HeLa dsGFP cells treated with liposomes of composition LP1 and DOTAP / Chol liposomes containing anti eGFP siRNA. (a) Quantification of toxicity by total nuclei number and (b) quantification of downregulation by GFP intensity normalized to untreated control in response to siRNA concentration (n = 2, depicted error is the standard deviation). (c) Comparison of eGFP downregulation in HeLa dsGFP cells with liposomes of composition LP1 and lipid nanoparticles “MC3” of composition MC3:DSPC:Chol:PEG-DMG=50:38.5:10:1.5 both containing siRNA. Quantification of downregulation efficacy by measuring eGFP intensity normalized to untreated control in response to siRNA concentration (n=1, depicted error is the standard deviation). This example shows that the composition of the invention is more effective for siRNA delivery compared to prior art liposome compositions and similarly effective to prior art lipid nanoparticle compositions. Figure 18 Shows comparison with prior art delivery compositions for mRNA delivery. (a-c) Comparison of mRNA delivery in HeLa cells with liposomes of composition LP1 and DOTAP / Chol liposomes. Quantification of (b) eGFP expression, (c) percentage of eGFP positive cells and (a) total nuclei number in response to treatment (n = 1, depicted error is the standard deviation). This example shows that the composition of the invention is more effective for mRNA delivery compared with prior art compositions. Figure 19 Shows mRNA delivery in cardiomyocytes. (a) Cardiomyocytes were treated with different concentrations of eGFP mRNA in liposomes of composition LP1 at N / P ratio 6:1. Number of cells expressing eGFP and fluorescence intensity of eGFP increase with dosage. Scalebar 100 µm. Untreated cells show no eGFP fluorescence. When treated ZSP Ref.: 1261-2 PCT with 0.08 µg / ml a few positive cells with low eGFP intensity can be seen. Psoitive cell number and intensity increase with increased dosage, wherein at 0.625 µg / ml many cells are positive with intermediate eGFP signal intensity and wherein for cells treated with 2.5 µg / ml most cells are positive for eGFP with high eGFP signal intensity. (b) Quantification of eGFP expression by fluorescence intensity and percentage of eGFP positive cells and quantification of toxicity by total cell number in response to treatment (n = 1, mean ± SD). This example shows that the composition of this invention is effective for mRNA delivery into muscle cells, specifically cardiomyocytes. Figure 20 Shows comparison of different labile PEG lipid PEG chain lengths and impact on siRNA delivery in HeLa dsGFP cells. (a-c) Comparison of anti eGFP siRNA treatment of HeLa dsGFP cells with variations of composition LP1 with varying PEG lipid length. (a) eGFP knockdown efficiency in response to concentrations tested (x-axis), based on average eGFP intensity per nucleus, normalized to untreated condition (n= 1, mean ± SD). (b) Number of nuclei in response to dose tested as a percentage of number of nuclei present in the untreated condition (n= 1, mean ± SD). (c) Number of nuclei positive for eGFP, normalized to total nuclei number of the untreated condition in response to concentrations tested (n= 1, mean ± SD). (d-f) Comparison of anti eGFP siRNA treatment of HeLa dsGFP cells with variations of composition DOTAP:LBPA:labile PEG lipid = 50:45:5 with varying PEG lipid length. (d) GFP knockdown efficiency based on average eGFP intensity per nucleus, normalized to untreated condition in response to concentrations tested (n= 1, mean ± SD). (e) Number of nuclei in response to concentrations tested as a percentage of number of nuclei present in the untreated condition (n= 1, mean ± SD). (f) Number of nuclei positive for eGFP, normalized to total nuclei number of the untreated condition in response to dose tested (n= 1, mean ± SD). (g-i) Comparison of anti eGFP siRNA treatment of HeLa dsGFP cells with variations of composition DOTAP:DOPE:labile PEG lipid = 45:45:10 with varying PEG lipid length. (g) GFP knockdown efficiency based on average eGFP intensity per nucleus, normalized to untreated condition in response to concentrations tested (n= 1, mean ± SD). (h) Number of nuclei in response to concentrations tested as a percentage of number of nuclei present in the untreated condition (n= 1, mean ± SD). (i) Number of nuclei positive for eGFP, normalized to total nuclei number of the untreated condition in response to concentrations tested (n= 1, mean ± SD). This example shows that compositions of the invention are effective for siRNA delivery irrespective of PEG chain length. Figure 21 Shows comparison of different labile PEG lipid PEG chain lengths on mRNA delivery in HeLa cells. (a-c) Comparison of eGFP mRNA treatment of HeLa cells with variations of composition LP1 with varying PEG lipid length. (a) Mean eGFP intensity per nucleus in response to concentrations tested (x-axis) (n= 1, mean ± SD). (b) Number ZSP Ref.: 1261-2 PCT of nuclei in response to dose tested as a percentage of number of nuclei present in the untreated condition (n= 1, mean ± SD). (c) Number of nuclei positive for eGFP, normalized to total nuclei number of the untreated condition in response to concentrations tested (n= 1, mean ± SD). (d-f) Comparison of eGFP mRNA treatment of HeLa cells with variations of composition DOTAP:LBPA:labile PEG lipid = 50:45:5 with varying PEG lipid length. (d) Mean eGFP intensity per nucleus in response to concentrations tested (n= 1, mean ± SD). (e) Number of nuclei in response to concentrations tested as a percentage of number of nuclei present in the untreated condition (n= 1, mean ± SD). (f) Number of nuclei positive for eGFP, normalized to total nuclei number of the untreated condition in response to dose tested (n= 1, mean ± SD). (g-i) Comparison of eGFP mRNA treatment of HeLa cells with variations of composition DOTAP:DOPE:labile PEG lipid = 45:45:10 with varying PEG lipid length. (g) Mean eGFP intensity per nucleus in response to concentrations tested (n= 1, mean ± SD). (h) Number of nuclei as a percentage of number of nuclei present in the untreated condition in response to concentrations tested (n= 1, mean ± SD). (i) Number of nuclei positive for eGFP, normalized to total nuclei number of the untreated condition in response to concentrations tested (n= 1, mean ± SD). This example shows that compositions of the invention can be used to deliver mRNA irrespective of the PEG chain length. The eGFP mRNA mediated expression tested was highest for PEG lipid PEG5000-orthoester-C18 in composition LP1 and for PEG2000-orthoester-C18 in the composition of this invention without cholesterol. The composition containing DOPE (DOTAP:DOPE:labile PEG lipid = 45:45:10) is not very effective for mRNA delivery at any PEG chain length. Thus, it is preferred that a composition of the invention that comprises mRNA preferably does not contain the combination DOTAP (as component d) and DOPE (as component e) but does contain cholesterol as component e. Detailed description of the invention The present invention relates to a drug delivery liposome formulation to increase escape from endosomes within cells and to improve drug delivery to cells and tissues as well as enhance the subsequent release of the delivered drug within such cells and tissues. The lipid bilayer of the liposome comprises an encapsulating agent, a fusogenic lipid agent for endosomal escape, and an acid-labile PEG lipid for specific activation inside the endosomal system. The liposome-based drug delivery system disclosed herein is structurally and compositionally different from current LNP-based systems. The liposome according to the present invention allows a combination of functions using a modular and bioinspired approach, and can fuse with endosomal membranes. ZSP Ref.: 1261-2 PCT The encapsulating lipid or agent has the function of interacting with the negatively charged endosomal membrane as well as binding negatively charged macromolecules such as oligonucleotides. The liposome-based delivery system disclosed herein allows specific activation by acidification: the PEG coat / PEG-lipid conjugate around liposomes is in a non-active state at pH 7. Under these conditions, the PEG coat also acts as a shield prior to acidification. The PEG is attached to a lipid anchor by an acid-labile linker that breaks between pH 5 and 6. The acid-cleavable PEGylated lipid increases the hydrophilicity of the liposome and provides a steric barrier against opsonisation (shield effect), whereas the adverse steric hindrance of PEG in regard to cellular uptake and subsequent endosomal escape is circumvented by cleavage of the PEG under acidic conditions within the endosomes. Thus, the present invention provides in one embodiment a drug delivery system comprising a liposome having (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) between 1 and 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume, wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm as determined by dynamic light scattering. As used herein the term “about” in the context of a numerical value refers to said value + / - 5 % of said value, most preferably it refers to exactly said value. As used herein, the term “liposome” is meant to refer to lipid molecules assembled in a spherical configuration encapsulating an interior aqueous volume that is segregated from an aqueous exterior. Liposomes are vesicles that possess at least one lipid bilayer. Liposomes are typically used as carriers for drug / therapeutic delivery in the context of pharmaceutical development. The liposomes described in the invention are designed using a bio-inspired approach, i.e. work by fusing the lipid bilayer with a cellular membrane and repositioning its lipid structure to deliver a therapeutic agent, drug or active pharmaceutical ingredient. As such, the liposomes are structurally different from the LNPs that contain an amorphous lipid-containing core and lack lipids compatible with functionally interacting with the cellular (endosomal) membranes. ZSP Ref.: 1261-2 PCT An "aqueous volume" is used herein interchangeably with "aqueous core" or with "aqueous phase" or with "aqueous compartment" or with "aqueous lumen" or with "aqueous pocket". As used herein, the term “lipid” is meant to refer to a group of organic compounds characterized by being insoluble in water, but soluble in many organic solvents. Lipid molecules are amphiphilic meaning that they have a hydrophilic or polar end and a hydrophobic or nonpolar end. The shape and amphipathic nature of the lipid molecules cause them to organize spontaneously into structures such as bilayers, and micelles in aqueous environments. Lipid molecules are usually divided into at least three classes: (1) “simple lipids,” which include fats and oils as well as waxes; (2) “compound lipids,” which include phospholipids and glycolipids; and (3) “derived lipids” such as steroids. In an aspect, the invention provides a composition comprising (a) a therapeutic agent or a pharmaceutically acceptable salt thereof; (b) a PEG-monoorthoester-lipid; (c) an amphiphilic lipid; (d) a cationic lipid and / or a beta-alanyl-prolyl-cysteine methyl ester; and optionally (e) a steroid and / or a ceramide and / or DOPE. In one embodiment the therapeutic agent or pharmaceutically acceptable salt thereof is encapsulated by the composition. In one embodiment the invention provides a composition as described herein comprising (a) a therapeutic agent or a pharmaceutically acceptable salt thereof; (b) a PEG-monoorthoester-lipid; (c) an amphiphilic lipid; (d) a cationic lipid or a beta-alanyl-prolyl-cysteine methyl ester; and (e) a steroid, and preferably cholesterol. In one embodiment the invention provides a composition as described herein comprising (a) a therapeutic agent or a pharmaceutically acceptable salt thereof; (b) a PEG-monoorthoester-lipid; (c) an amphiphilic lipid; (d) a cationic lipid and a beta-alanyl-prolyl-cysteine methyl ester; and (e) a steroid, and preferably cholesterol. In one embodiment the invention provides a composition as described herein comprising (a) a therapeutic agent or a pharmaceutically acceptable salt thereof; (b) a PEG-monoorthoester-lipid; (c) an amphiphilic lipid; (d) a cationic lipid and / or beta-alanyl-prolyl-cysteine methyl ester; and (e) a steroid and a ceramide. In one embodiment the invention provides a composition as described herein comprising (a) a therapeutic agent or a pharmaceutically acceptable salt thereof, wherein the therapeutic agent is mRNA; (b) a PEG-monoorthoester-lipid; (c) an amphiphilic lipid; (d) a cationic lipid and / or a beta-alanyl-prolyl- cysteine methyl ester; and (e) cholesterol. ZSP Ref.: 1261-2 PCT In one embodiment the invention provides a composition composition comprising (a) a therapeutic agent or a pharmaceutically acceptable salt thereof; (b) a PEG-monoorthoester-lipid, wherein said PEG- monoorthoester lipid has the following structure: wherein n is an integer between 35 and 55 and wherein m is an integer between 10 and 27; and preferably wherein n is an integer between 40 and 50 and m is an integer of between 15 and 23; (c) an amphiphilic lipid; (d) a cationic lipid and / or a beta-alanyl-prolyl-cysteine methyl ester; and optionally (e) a steroid and / or a ceramide; wherein components (a)-(d) and optionally (e) are formulated as a liposome. In one embodiment, a composition as described herein does not comprise a steroid. In one embodiment, a composition as described herein does not comprise cholesterol. "Liposome component ratios" "Liposome component ratio" also abbreviated as "compound ratio" or "liposome agent ratio" or "agent ratio" or "component ratio" is defined as the molar ratio of that "Liposome component" or "compound" and is calculated as: [n(agent) / n(total)] * 100 wherein "n" is the molar amount or the number of moles used to prepare the liposomes. The molar ratios of each liposome component of the optimized liposome compositions disclosed herein are listed in Table 1. The molar ratios of each liposome component of the tested liposome compositions in the Examples disclosed herein are listed in Tables 2 - 12. The compound ratio of an encapsulating agent in the drug delivery system disclosed herein is not specifically restricted, but it is preferable that the liposome of the drug delivery system disclosed herein has 12.5, 15, 25, 30, 33, 35, 37.5, 40, 45, 47.5, 50, 52.5, 54, 55, 60 or 70 mol percent of at least one encapsulating agent. Preferably the liposome of the drug delivery system disclosed herein has between 10 and 90 mol percent, preferably between 12 and 90 mol percent, preferably between 15 and 90 mol percent, preferably between 20 and 90 mol percent, preferably between 25 and 90 mol percent, preferably between 30 and 90 mol percent, preferably between 40 and 90 mol percent, preferably between 10 and 80 mol percent, preferably between 12 and 80 mol percent, preferably between 15 and 80 mol percent, preferably between 20 and 80 mol percent, preferably between 25 and 80 mol percent, preferably between 30 and 80 mol percent, preferably between 40 and 80 mol percent, preferably between 10 and 75 mol percent, preferably between 12 and 75 mol percent, preferably between 15 and 75 mol percent, preferably between 20 and 75 mol percent, preferably between 25 and 75 mol percent, preferably between 30 and 75 mol percent, preferably between 40 ZSP Ref.: 1261-2 PCT and 75 mol percent, preferably between 10 and 70 mol percent, preferably between 12 and 70 mol percent, preferably between 15 and 70 mol percent, preferably between 20 and 70 mol percent, preferably between 25 and 70 mol percent, preferably between 30 and 70 mol percent, preferably between 40 and 70 mol percent, preferably between 10 and 60 mol percent, preferably between 12 and 60 mol percent, preferably between 15 and 60 mol percent, preferably between 20 and 60 mol percent, preferably between 25 and 60 mol percent, preferably between 30 and 60 mol percent, preferably between 40 and 60 mol percent, preferably between 10 and 55 mol percent, preferably between 12 and 55 mol percent, preferably between 15 and 5 mol percent, preferably between 20 and 55 mol percent, preferably between 25 and 5 mol percent, preferably between 30 and 5 mol percent, preferably between 40 and 55 mol percent, more preferred between 30 and 75 mol percent of at least one encapsulating agent. The compound ratio of an acid-cleavable polyethylene glycol conjugated lipid in the drug delivery system disclosed herein is not specifically restricted, but it is preferable that the liposome of the drug delivery system disclosed herein has 1, 2, 2.5, 3, 4, 5, 6, 7, 7.5, 8, 9, 10, 11, or 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid. Preferably the liposome of the drug delivery system disclosed herein has between 1 and 20 mol percent, preferably between 1 and 11 mol percent, preferably between 1 and 10 mol percent, preferably between 1 and 8 mol percent, preferably between 1 and 7 mol percent, preferably between 1 and 6 mol percent, preferably between 1 and 5 mol percent, preferably between 2 and 20 mol percent, preferably between 2 and 11 mol percent, preferably between 2 and 10 mol percent, preferably between 2 and 8 mol percent, preferably between 2 and 7 mol percent, preferably between 2 and 6 mol percent, preferably between 2 and 5 mol percent, preferably between 3 and 20 mol percent, preferably between 3 and 11 mol percent, preferably between 3 and 10 mol percent, preferably between 3 and 8 mol percent, preferably between 3 and 7 mol percent, preferably between 3 and 6 mol percent, preferably between 3 and 5 mol percent, preferably between 4 and 20 mol percent, preferably between 4 and 11 mol percent, preferably between 4 and 10 mol percent, preferably between 4 and 8 mol percent, preferably between 4 and 7 mol percent, preferably between 4 and 6 mol percent of an acid-cleavable polyethylene glycol conjugated lipid. The compound ratio of a fusogenic agent in the drug delivery system disclosed herein is not specifically restricted, but it is preferable that the liposome of the drug delivery system disclosed herein has 10, 15, 20, 25, 27, 30, 35, 40, 45, 50, 55, 60 mol percent of at least one fusogenic agent. Preferably the liposome of the drug delivery system disclosed herein has between 10 and 60 mol percent, preferably between 15 and 60 mol percent, preferably between 20 and 60 mol percent, preferably between 25 and 60 mol percent, preferably between 27 and 60 mol percent, preferably ZSP Ref.: 1261-2 PCT between 30 and 60 mol percent, preferably between 35 and 60 mol percent, preferably between 40 and 60 mol percent, between 10 and 55 mol percent, preferably between 15 and 55 mol percent, preferably between 20 and 55 mol percent, preferably between 25 and 55 mol percent, preferably between 27 and 55 mol percent, preferably between 30 and 55 mol percent, preferably between 35 and 55 mol percent, preferably between 40 and 55 mol percent, between 10 and 50 mol percent, preferably between 15 and 50 mol percent, preferably between 20 and 50 mol percent, preferably between 25 and 50 mol percent, preferably between 27 and 50 mol percent, preferably between 30 and 50 mol percent, preferably between 35 and 50 mol percent, between 10 and 45 mol percent, preferably between 20 and 45 mol percent, preferably between 25 and 45 mol percent, preferably between 27 and 45 mol percent, preferably between 30 and 45 mol percent, preferably between 35 and 45 mol percent, between 10 and 35 mol percent, preferably between 20 and 35 mol percent, preferably between 25 and 35 mol percent, more preferred between 15 and 45 mol percent of at least one fusogenic agent The compound ratio of a neutral lipid n the drug delivery system disclosed herein is not specifically restricted, but it is preferable that the liposome of the drug delivery system disclosed herein has 1, 2.5, 5, 10, 13, 20, 22.5, 25, 33, 36, 37.5, 40 mol percent of at least one neutral lipid, or is free of neutral lipid. Preferably the liposome of the drug delivery system disclosed herein has preferably between 1 and 40 mol percent, preferably between 2.5 and 40 mol percent, preferably between 5 and 40 mol percent, preferably between 10 and 40 mol percent, preferably between 13 and 40 mol percent, preferably between 20 and 40 mol percent, preferably between 22.5 and 40 mol percent, preferably between 25 and 40 mol percent, between 1 and 37.5 mol percent, preferably between 2.5 and 37.5 mol percent, preferably between 5 and 37.5 mol percent, preferably between 10 and 37.5 mol percent, preferably between 13 and 37.5 mol percent, preferably between 20 and 37.5 mol percent, preferably between 22.5 and 37.5 mol percent, preferably between 25 and 37.5 mol percent, preferably between 2.5 and 36 mol percent, preferably between 5 and 36 mol percent, preferably between 10 and 36 mol percent, preferably between 13 and 36 mol percent, preferably between 20 and 36 mol percent, preferably between 22.5 and 36 mol percent, preferably between 25 and 36 mol percent, preferably between 2.5 and 33 mol percent, preferably between 5 and 33 mol percent, preferably between 10 and 33 mol percent, preferably between 13 and 33 mol percent, preferably between 20 and 33 mol percent, preferably between 22.5 and 33 mol percent, preferably between 25 and 33 mol percent, preferably between 2.5 and 25 mol percent, preferably between 5 and 25 mol percent, preferably between 10 and 25 mol percent, preferably between 13 and 25 mol, preferably between 2.5 and 20 mol percent, preferably between 5 and 20 mol percent, preferably between 10 and 20 mol percent, more preferred between 13 and 36 mol percent of at least one neutral lipid. "Liposome size" ZSP Ref.: 1261-2 PCT As used herein, "size" or "mean size" in the context of liposome compositions refers to the mean diameter measured as Z-average by DLS of a liposome. The Z-average particle diameter of a liposome is a value measured by a dynamic light scattering method. "Z average" is defined as the intensity weighted mean hydrodynamic size of the ensemble collection of particles measured by dynamic light scattering (DLS). As defined by Malvern Panalytical Ltd., the Z average is derived from a Cumulants analysis of the measured correlation curve, wherein a single particle size is assumed and a single exponential fit is applied to the autocorrelation function. The sizes of the liposomes in the liposome delivery system of the present invention are not specifically restricted, but it is preferable that the Z-Average diameter size range is comprised between 20 nm and 200 nm as determined by dynamic light scattering. In some embodiments, the Z- Average diameter size range is comprised between 30 nm and 200 nm as determined by dynamic light scattering. In some embodiments, the Z-Average diameter size range is comprised between 45 nm and 200 nm as determined by dynamic light scattering. In some embodiments, the Z-Average diameter size range is comprised between 60 nm and 200 nm as determined by dynamic light scattering. In some embodiments, the Z-Average diameter size range is comprised between 70 nm and 200 nm as determined by dynamic light scattering. In some embodiments, the Z-Average diameter size range is comprised between 80 nm and 200 nm as determined by dynamic light scattering. In other embodiments, the Z-Average diameter size range is comprised between 20 nm and 180 nm as determined by dynamic light scattering. In other embodiments, the Z-Average diameter size range is comprised between 30 nm and 180 nm as determined by dynamic light scattering. In other embodiments, the Z-Average diameter size range is comprised between 45 nm and 180 nm as determined by dynamic light scattering. In other embodiments, the Z-Average diameter size range is comprised between 60 nm and 180 nm as determined by dynamic light scattering. In other embodiments, the Z-Average diameter size range is comprised between 70 nm and 180 nm as determined by dynamic light scattering. In other embodiments, the Z-Average diameter size range is comprised between 80 nm and 180 nm as determined by dynamic light scattering. In further embodiments, the Z-Average diameter size range is comprised between 20 nm and 160 nm, or between 30 and 160 nm, or between 45 nm and 160 nm as determined by dynamic light scattering. In further embodiments, the Z-Average diameter size range is comprised between 60 nm and 160 nm as determined by dynamic light scattering. In further embodiments, the Z- Average diameter size range is comprised between 70 nm and 160 nm as determined by dynamic light scattering. In further embodiments, the Z-Average diameter size range is comprised between 80 nm and 160 nm as determined by dynamic light scattering. In alternative embodiments, the Z- Average diameter size range is comprised between 20 nm and 150 nm, or between 30 nm and 150 nm, between 45 nm and 150 nm as determined by dynamic light scattering. In alternative embodiments, the Z-Average diameter size range is comprised between 60 nm and 150 nm as ZSP Ref.: 1261-2 PCT determined by dynamic light scattering. In alternative embodiments, the Z-Average diameter size range is comprised between 70 nm and 150 nm as determined by dynamic light scattering. In alternative embodiments, the Z-Average diameter size range is comprised between 80 nm and 150 nm as determined by dynamic light scattering. In other alternative embodiments, the Z-Average diameter size range is comprised between 20 nm and 140 nm, or between 30 nm and 140 nm, or between 45 nm and 140 nm as determined by dynamic light scattering. In other alternative embodiments, the Z-Average diameter size range is comprised between 60 nm and 140 nm as determined by dynamic light scattering. In other alternative embodiments, the Z-Average diameter size range is comprised between 70 nm and 140 nm as determined by dynamic light scattering. In other alternative embodiments, the Z-Average diameter size range is comprised between 80 nm and 140 nm as determined by dynamic light scattering. In further alternative embodiments, the Z- Average diameter size range is comprised between 20 nm and 130 nm, or between 30 nm and 130 nm, or between 45 nm and 130 nm as determined by dynamic light scattering. In further alternative embodiments, the Z-Average diameter size range is comprised between 60 nm and 130 nm as determined by dynamic light scattering. In further alternative embodiments, the Z-Average diameter size range is comprised between 70 nm and 130 nm as determined by dynamic light scattering. In further alternative embodiments, the Z-Average diameter size range is comprised between 80 nm and 130 nm as determined by dynamic light scattering. In preferred embodiments, the Z-Average diameter size is greater than 20 nm, 25 nm, 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, or 100 nm. In preferred embodiments, the Z-Average diameter size is also lower than 220 nm, 215 nm, 210 nm, 205 nm, 200 nm, 195 nm, 190 nm, 185 nm, 180 nm, 175 nm, 170 nm, 165 nm, 160 nm, 155 nm, 150 nm, 145 nm, 140 nm, 135 nm, 130 nm, 125 nm, 120 nm, 115 nm, or 100 nm. As used herein, the "polydispersity index" is a ratio that describes the homogeneity of the particle size distribution of a system, which is derived from the dynamic light scattering correlation data. It can assume values between 0 and 1. A small value, e.g., less than 0.3, indicates a narrow particle size distribution. As used herein, the "zeta potential" is the electrokinetic potential of a lipid, e.g., in a liposome composition. As used herein, a "lipid component" is that component of a "liposome composition" that includes one or more lipids. For example, the lipid component may include one or more cationic / ionizable, PEGylated, structural, or other lipids, such as phospholipids. The lipid components of the inventive liposome delivery system compositions developed and tested in the present invention are listed in Tables 1 - 12. The lipid components of the inventive liposome delivery system are a fusogenic agent, an encapsulating agent or therapeutic encapsulating agent, a labile PEG lipid, optionally, a helper or enhancer lipid. ZSP Ref.: 1261-2 PCT "Encapsulating agent" The wording "encapsulating agent" refers to a compound able to interact and bind a therapeutic agent of interest, so that when the encapsulating agent is present in the lipid bilayer enclosing an aqueous volume of a liposome composition, the therapeutic agent is encapsulated within the aqueous volume of said liposome. However, the therapeutic agent need not necessarily be encapsulated in the compositon of the invention, such as in a liposome composition of the invention, but the therapeutic agent may also be associated with the composition of the invention and / or its components in another way. This includes the therapeutic agent being complexed or associated with or bound or attached or adsorped to or integrated into the composition of the invention. An encapsulating agent also refers to a molecule acting as trapping agent forming a complex with the drug (ie therapeutic agent) PD740 (C45H82N4O6S2) is a lipidated tripeptide analogue. PD740 is able to bind the therapeutic agent, such as RNA, probably by an electrostatic interaction due to the pKa of PD740. The inventive liposome composition may also include one or more cationic and / or ionizable lipids (e.g., lipids that may have a positive or partial positive charge at physiological pH) as "encapsulating agent" in addition to the other liposome components listed elsewhere. As used herein, the term “cationic lipid” or "cationic agent" is meant to refer to a lipid, having a positively charged head group and one or two hydrocarbon chains. Liposome compositions with the encapsulating agents PD740, DOTAP, DOTMA, DOMA showed highest siRNA mediated downregulation efficiency in HeLa cells. Liposome compositions with the cationic lipid EPC 18:1 as encapsulating agent showed intermediate siRNA mediated downregulation efficiency in HeLa cells. Liposome compositions with the encapsulating agents TTAB, CTAB, 16-BAC, SA, PD739, Gl67, MVL5, TAP 18:0 showed no siRNA mediated downregulation in Hela cells. As used herein, the term “ionizable lipid” is meant to refer to a lipid, e.g., cationic lipid, having at least one protonatable or deprotonatable group, such that the lipid is positively charged at a pH at or below physiological pH (e.g., pH 7.4), and neutral at a second pH, preferably at or above physiological pH. It will be understood by one of ordinary skill in the art that the addition or removal of protons as a function of pH is an equilibrium process, and that the reference to a charged or a neutral lipid refers to the nature of the predominant species and does not require that all of the lipid be present in the charged or neutral form. Generally, ionizable lipids have a pKa of the protonatable group in the range of about 4 to about 7. Preferred ionizable lipids are 3ß-[N-(N',N'- dimethylaminoethane)-carbamoyl]cholesterol hydrochloride, N-(4-carboxybenzyl)-N,N-dimethyl- ZSP Ref.: 1261-2 PCT 2,3-bis(oleoyloxy)propan-1-aminium, 1,2-distearoyl-3-dimethylammonium-propane, 1,2- dipalmitoyl-3-dimethylammonium-propane, 1,2-dimyristoyl-3-dimethylammonium-propane, 1,2- dioleoyl-3-dimethylammonium-propane (DODAP), 1,2-dioleyloxy-3-dimethylaminopropane (DODMA), 6-((2-hexyldecanoyl)oxy)-N-(6-((2-hexyldecanoyl)oxy)hexyl)-N-(4- hydroxybutyl)hexan-1-aminium, YSK05, Dlin-DMA, DLin-KC2-DMA, DLin-MC3-DMA (MC3), C12-200, SM-102, ALC-0315, Lipid 5. Further ionizable lipids can be found at ionizable cationic lipid https: / / broadpharm.com / product-categories / lipid / ionizable-lipid. In some embodiments, a ionizable lipid may include “cleavable lipid” or “SS- cleavable lipid”. In one embodiment an encapsulating agent for the drug delivery system disclosed herein is a cationic lipid selected from 1,2-dialkanyloxy-3-trialkylammonium propane halide, 1,2-dialkenyloxy-3- trialkylammonium propane halide, 1,2-dialkanoyloxy-3-trialkylammonium propane halide, 1,2- dialkenoyloxy-3-trialkylammonium propane halide, tetraalkylammonium halide, and / or a lipidated polypeptide PD740. Preferentially, an encapsulating agent for the drug delivery system disclosed herein is a cationic lipid selected from 1,2-di-C12-C20 alkanyloxy-3-tri-C1-C6 alkylammonium propane halide, 1,2-di-C12-C20 alkenyloxy-3-tri-C1-C6 alkylammonium propane halide, 1,2-di-C12-C20 alkenoyloxy-3-tri-C1-C6 alkylammonium propane halide, di-C12-C20 alkyl di-C1-C6 alkyl ammonium halide, and / or a lipidated polypeptide PD740. More preferentially, an encapsulating agent for the drug delivery system disclosed herein is a cationic lipid selected from the group consisting of 1,2-didodecyloxy-3-trimethylammonium propane chloride, 1,2-ditridecyloxy-3-trimethylammonium propane chloride, 1,2-ditetradecyloxy-3-trimethylammonium propane chloride, 1,2-dipentadecyloxy-3- trimethylammonium propane chloride, 1,2-dihexadecyloxy-3-trimethylammonium propane chloride, 1,2-diheptadecyloxy-3-trimethylammonium propane chloride, 1,2-dioctadecyloxy-3- trimethylammonium propane chloride, 1,2-dinonadecyloxy-3-trimethylammonium propane chloride, 1,2-diicosyloxy-3-trimethylammonium propane chloride, 1,2-didodecenyloxy-3-trimethylammonium propane chloride, 1,2-ditridecenyloxy-3-trimethylammonium propane chloride, 1,2-ditetradecenyloxy- 3-trimethylammonium propane chloride, 1,2-dipentadecenyloxy-3-trimethylammonium propane chloride, 1,2-dihexadecenyloxy-3-trimethylammonium propane chloride, 1,2-diheptadecenyloxy-3- trimethylammonium propane chloride, 1,2-dioctadecenyloxy-3-trimethylammonium propane chloride, 1,2-dinonadecenyloxy-3-trimethylammonium propane chloride, 1,2-diicosenyloxy-3- trimethylammonium propane chloride, 1,2-dilauroleoyloxy-3-trimethylammonium propane chloride, 1,2-dimyristoleoyloxy-3-trimethylammonium propane chloride, 1,2-dipalmitoleoyloxy-3- trimethylammonium propane chloride, 1,2-dipetroseloyloxy-3-trimethylammonium propane chloride, 1,2-dipetroselaidoyloxy-3-trimethylammonium propane chloride, 1,2-dioleoylloxy-3- trimethylammonium propane chloride, 1,2-dielaidoyloxy-3-trimethylammonium propane chloride, 1,2- divaccenoyloxy-3-trimethylammonium propane chloride, 1,2-digadoleoyloxy-3-trimethylammonium propane chloride, dimethyldidodecylammonium bromide, dimethylditridecylammonium bromide, dimethylditetradecylammonium bromide, dimethyldipentadecylammonium bromide, ZSP Ref.: 1261-2 PCT dimethyldihexadecylammonium bromide, dimethyldiheptadecylammonium bromide, dimethyldioctadecylammonium bromide, dimethyldinonadecylammonium bromide, and dimethyldiicosylammonium bromide, and / or a lipidated polypeptide PD740. Still more preferentially, an encapsulating agent for the drug delivery system disclosed herein is a cationic lipid selected from the group consisting of 1,2-di-O-octadecenyl-3-trimethylammonium propane chloride, dimethyldioctadecylammonium bromide, and 1,2-dioleoyl-3-trimethylammonium propane chloride, and / or a lipidated polypeptide PD740. Particularly preferred, an encapsulating agent for the drug delivery system disclosed herein is a cationic lipid 1,2-dioleoyl-3-trimethylammonium propane chloride and / or a lipidated polypeptide PD740. In one embodiment, the invention provides a composition as described herein, comprising (a) a therapeutic agent or a pharmaceutically acceptable salt thereof; (b) a PEG-monoorthoester-lipid; (c) an amphiphilic lipid; (d) a cationic lipid and / or a beta-alanyl-prolyl-cysteine methyl ester; and optionally (e) a steroid and / or a ceramide, wherein the cationic lipid in (d) is selected from the group consisting of 1,2-dialkanyloxy-3-trialkylammonium propane halide, 1,2-dialkenyloxy-3-trialkylammonium propane halide, 1,2-dialkanoyloxy-3-trialkylammonium propane halide, 1,2-dialkenoyloxy-3-trialkylammonium propane halide, tetraalkylammonium halide, 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine. In one embodiment the cationic lipid in (d) is selected from the group consisting of 1,2-di-C12-C20 alkanyloxy-3-tri-C1-C6 alkylammonium propane halide, 1,2-di-C12-C20 alkenyloxy-3-tri-C1-C6 alkylammonium propane halide, 1,2-di-C12-C20 alkenoyloxy-3-tri-C1-C6 alkylammonium propane halide, di-C12-C20 alkyl di-C1-C6 alkyl ammonium halide. In one embodiment the cationic lipid in (d) is selected from the group consisting of 1,2-didodecyloxy- 3-trimethylammonium propane chloride, 1,2-ditridecyloxy-3-trimethylammonium propane chloride, 1,2-ditetradecyloxy-3-trimethylammonium propane chloride, 1,2-dipentadecyloxy-3- trimethylammonium propane chloride, 1,2-dihexadecyloxy-3-trimethylammonium propane chloride, 1,2-diheptadecyloxy-3-trimethylammonium propane chloride, 1,2-dioctadecyloxy-3- trimethylammonium propane chloride, 1,2-dinonadecyloxy-3-trimethylammonium propane chloride, 1,2-diicosyloxy-3-trimethylammonium propane chloride, 1,2-didodecenyloxy-3-trimethylammonium propane chloride, 1,2-ditridecenyloxy-3-trimethylammonium propane chloride, 1,2-ditetradecenyloxy- 3-trimethylammonium propane chloride, 1,2-dipentadecenyloxy-3-trimethylammonium propane chloride, 1,2-dihexadecenyloxy-3-trimethylammonium propane chloride, 1,2-diheptadecenyloxy-3- trimethylammonium propane chloride, 1,2-dioctadecenyloxy-3-trimethylammonium propane chloride, 1,2-dinonadecenyloxy-3-trimethylammonium propane chloride, 1,2-diicosenyloxy-3- trimethylammonium propane chloride, 1,2-dilauroleoyloxy-3-trimethylammonium propane chloride, 1,2-dimyristoleoyloxy-3-trimethylammonium propane chloride, 1,2-dipalmitoleoyloxy-3- trimethylammonium propane chloride, 1,2-dipetroseloyloxy-3-trimethylammonium propane chloride, 1,2-dipetroselaidoyloxy-3-trimethylammonium propane chloride, 1,2-dioleoylloxy-3- ZSP Ref.: 1261-2 PCT trimethylammonium propane chloride, 1,2-dielaidoyloxy-3-trimethylammonium propane chloride, 1,2- divaccenoyloxy-3-trimethylammonium propane chloride, 1,2-digadoleoyloxy-3-trimethylammonium propane chloride, dimethyldidodecylammonium bromide, dimethylditridecylammonium bromide, dimethylditetradecylammonium bromide, dimethyldipentadecylammonium bromide, dimethyldihexadecylammonium bromide, dimethyldiheptadecylammonium bromide, dimethyldioctadecylammonium bromide, dimethyldinonadecylammonium bromide, and dimethyldiicosylammonium bromide. In one embodiment the cationic lipid selected from the group consisting of 1,2-di-O-octadecenyl-3- trimethylammonium propane chloride, dimethyldioctadecylammonium bromide, and 1,2-dioleoyl-3-trimethylammonium propane chloride and preferably wherein the cationic lipid is 1,2- dioleoyl-3-trimethylammonium propane chloride. In one embodiment the beta-alanyl-prolyl-cysteine methyl ester is a lipidated polypeptide. In a preferred embodiment the beta-alanyl-prolyl-cysteine methyl ester is or comprises N-[3-(Hexadecan-1- sulfonylamino)propionyl]-4-(R)-(aminoethyl)-L-prolyl-S-farnesyl-L-cysteine methyl ester (PD740). In one embodiment the compound in (d) is selected from the group consisting of N-[3-(Hexadecan-1- sulfonylamino)propionyl]-4-(R)-(aminoethyl)-L-prolyl-S-farnesyl-L-cysteine methyl ester (PD740), 2,3-bis[[(Z)-octadec-9-enoyl]oxy]propyl-trimethylazanium (DOTAP), dioctadecyldimethylammonium bromide (DOMA), 1,2-di-O-octadecenyl-3-trimethylammonium propane (chloride salt) (DOTMA), 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (EPC 18:1), and mixtures thereof. In one embodiment the compound in (d) is 2,3-bis[[(Z)-octadec-9-enoyl]oxy]propyl-trimethylazanium (DOTAP) and / or beta-alanyl-prolyl-cysteine methyl ester N-[3-(Hexadecan-1- sulfonylamino)propionyl]-4-(R)-(aminoethyl)-L-prolyl-S-farnesyl-L-cysteine methyl ester (PD740). "Labile PEG-lipids" The lipid component of a liposome composition as disclosed herein may include one or more labile PEG or labile PEG-modified lipids. A "pH-labile PEG-lipid" or "acid-labile PEG-lipid" refers to an "acid-cleavable PEG-lipid", i.e. a lipid attached to a PEG by a pH-sensitive acid-labile linkage, such as an orthoester or an hydrazone, (Fang Y et al., Cleavable PEGylation: a strategy for overcoming the "PEG dilemma" in efficient drug delivery. Drug Deliv. 2017;24(sup1):22-3), that breaks at pH between 5 and 6. A "labile linkage" refers to a covalent bond that is capable of being selectively broken. Consequently, the labile bond may be broken in the presence of other covalent bonds in the liposome without the breakage of other covalent bonds eventually present. "pH-labile linkage " or "pH- sensitive linkage" refers to a linkage or bond the can be selective broken under acidic conditions (pH < 7). This means that a pH-labile bond may be broken under acidic conditions in the presence of other covalent bonds without their breakage. ZSP Ref.: 1261-2 PCT A labile PEG-lipid forms a PEG coat around the liposomes acting as a shield at neutral pH, i.e. pH around 7. As used herein, a "PEG lipid" or "PEGylated lipid" refers to a lipid comprising a polyethylene glycol component. In other words, the acid-cleavable PEGylated lipid increases the hydrophilicity of the liposome and provides a steric barrier against opsonisation (shield effect), whereas the endosomal escape after cellular uptake is allowed by the activating cleavage of the PEG in the acidic conditions within endosomes. Particularly suitable acid-labile linkages have been described in the prior art and include orthoester linkages, hydrazone linkages, acetal linkages, vinyl ether linkages, and imine linkages (Fang Y et al., 2017). pH-sensitive PEG lipids containing orthoester linkers have been described by Masson C. et al., 2004, pH-sensitive PEG lipids containing orthoester linkers: new potential tools for nonviral gene delivery, J. Controlled Release, (99)3, 423-434. PEG lipids containing orthoester linkers provide a useful mechanism for pH dependent PEG modification, e.g. shedding of PEG. Thus, the composition of the invention suitably comprises a PEG-monoorthoester-lipid. In one embodiment an ester bond of the PEG-monoorthoester-lipid hydrolyses at a pH of 6 or less, preferably wherein said orthoester bond breaks at a pH of from pH 5 to pH 6. An embodiment of the present invention discloses a drug delivery system as described herein, wherein the acid-cleavable polyethylene glycol conjugated lipid is an acid-cleavable polyethylene glycol conjugated with a C12-C20 alkyl, or with a C12-C20 acyl, or with a mono-C12-C20 acylglycerol, or with a di-C12-C20 acylglycerol, preferably an acid-cleavable polyethylene glycol conjugated with a mono-C12-C20 alkyl or a mono-C12-C20 acyl. In one embodiment, the PEG-monoorthoester-lipid of the composition described herein comprises a polyethylene glycol conjugated with a C12-C20 alkyl, or with a C12-C20 acyl, or with a mono-C12-C20 acylglycerol, or with a di-C12-C20 acylglycerol, or wherein said PEG-monoorthoester lipid has the following structure: wherein n is an integer between 35 and 120 and wherein m is an integer between 10 and 27; and preferably wherein n is an integer between 40 and 110 and m is an integer of between 15 and 23. In one embodiment, the PEG-monoorthoester-lipid of the composition described herein comprises a polyethylene glycol conjugated with a C12-C20 alkyl, or with a C12-C20 acyl, or with a mono-C12-C20 acylglycerol, or with a di-C12-C20 acylglycerol, or wherein said PEG-monoorthoester lipid has the following structure: ZSP Ref.: 1261-2 PCT wherein n is an integer between 20 and 200 and wherein m is an integer between 10 and 27; and preferably wherein n is an integer between 40 and 140. The following integers for n are particularly preferred: n = 22, n= 45, n=110. It was surprisingly found that compositions with a PEG-monoorthoester-lipid having the formula of the above structure, wherein n is an integer of from 40 to 120 and preferably wherein n is an integer of from 100 to 120 and more preferably of 110, provided a particularly effective transfection of mRNA molecules into target cells. A similar effect was also confirmed for other therapeutic agents, such as for siRNA. A more preferred embodiment of the present invention discloses a drug delivery system as described herein, wherein the acid-cleavable polyethylene glycol conjugated lipid comprises an acid-cleavable linkage selected from the group comprising an orthoester linkage, a hydrazone linkage, an acetal linkage, a vinyl ether linkage, and an imine linkage, preferably a 2-methyl-2-alkoxy-1,3-dioxane or a 2-alkoxy-1,3-dioxolane. A still more preferred embodiment of the present invention discloses a drug delivery system as described herein, wherein the acid-cleavable polyethylene glycol conjugated lipid is selected from the group consisting of: N-(2-methyl-2-dodecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2-tridecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2-tetradecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2-pentadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2-hexadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2-heptadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2-nonadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, and N-(2-methyl-2-icosyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol. In one embodiment, the PEG-monoorthoester-lipid of the composition described herein is selected from the group consisting of: N-(2-methyl-2-dodecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2- tridecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2-tetradecyloxy- [1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2-pentadecyloxy-[1,3]dioxan-5-yl)- amido-polyethyleneglycol, N-(2-methyl-2-hexadecyloxy-[1,3]dioxan-5-yl)-amido- polyethyleneglycol, N-(2-methyl-2-heptadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N- (2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol (PEGOEC18), N-(2- ZSP Ref.: 1261-2 PCT methyl-2-nonadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, and N-(2-methyl-2- icosyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol. A further more preferred embodiment of the present invention discloses a drug delivery system as described herein, wherein the acid-cleavable polyethylene glycol conjugated lipid is α-methoxy-ω- {N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}-polyethylene glycol45 (PEG2000- orthoester-C18, PEGOEC18). A further still more preferred embodiment of the present invention discloses a drug delivery system as described herein, wherein the acid-cleavable polyethylene glycol conjugated lipid comprises polyethylene glycol having a number average molar mass Mn comprised between 400 and 5000 Da. In one embodiment, the PEG-monoorthoester-lipid of the composition described herein comprises polyethylene glycol having a number average molar mass Mn comprised between 400 and 5000 Da. In one embodiment, the PEG-monoorthoester-lipid of the composition described herein is N-(2- methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol (PEGOEC18). In a preferred embodiment the PEG-monoorthoester-lipid of the composition described herein is α-methoxy-ω-{N- (2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}-polyethylene glycol45. In a further still more preferred embodiment of the present invention, the acid-cleavable polyethylene glycol conjugated lipid or the PEG-monoorthoester-lipid comprises polyethylene glycol having a number average molar mass Mn comprised between 500 and 5000 Da, or between 600 and 5000 Da, or between 700 and 5000 Da, or between 800 and 5000 Da, or between 900 and 5000 Da, or between 1000 and 5000 Da, or between 2000 and 5000 Da, or between 500 and 4000 Da, or between 600 and 4000 Da, or between 700 and 4000 Da, or between 800 and 4000 Da, or between 900 and 4000 Da, or between 1000 and 4000 Da, or between 2000 and 4000 Da, or between 500 and 3000 Da, or between 600 and 3000 Da, or between 700 and 3000 Da, or between 800 and 3000 Da, or between 900 and 3000 Da, or between 1000 and 3000 Da, or between 2000 and 3000 Da, or between 500 and 2000 Da, or between 600 and 2000 Da, or between 700 and 2000 Da, or between 800 and 2000 Da, or between 900 and 2000 Da, or between 1000 and 2000 Da. "Fusogenic agent" A "fusogenic agent" or "fusogenic lipid" are used herein interchangeably to indicate a lipid that is recognized by the cellular machinery, either by cellular proteins or endosomal lipids and sugar moieties, and facilitates the fusion of the lipid bilayer of the delivery system with the limiting membrane of the endosome. However, fusogenic lipids can also be lipids that prefer non-lamellar phase behavior. Preferably, a "fusogenic agent" or "fusogenic lipid" is selected from the group comprising a glycolipid, a phosphatidylethanolamine, a phosphatidylglycerol, a fatty acid, or a fatty acid ester. A particularly preferred fusogenic agent according to this invention is acylated diglycerolphosphate Liposome compositions with MGDG, PLPE; S,S-3,3’- or S,S-2,2'-LBPA; as fusogenic agent showed highest activity for siRNA mediated downregulation in HeLa cells. Liposome compositions with ZSP Ref.: 1261-2 PCT POPE, GMO, NPPE, MO or IsostA as fusogenic agent showed intermediate activity for siRNA mediated downregulation in HeLa cells. Liposome compositions with OIA or PalmA as fusogenic agent showed low activity for siRNA mediated downregulation in HeLa cells. Liposome compositions with NAPE as fusogenic agent showed no activity for siRNA mediated downregulation in HeLa cells. Liposome compositions containing POPE, S,S-3,3’- or S,S-2,2'-LBPA, OlA, GMO or PalmA showed high siRNA mediated downregulation in mouse macrophages. Liposome compositions with MO, IsostA and NAPE showed internmediate activity for siRNA downregulation in mouse macrophages, while NPPE showed low activity. Liposomes containing S,S-3,3'- or S,S- 2,2'-LBPA, PLPE or MGDG as fusogenic agents showed high expression of eGFP by mRNA delivery in HeLa cells. LBPA isomers S,S-2,2'-LBPA, R,R-3,3'-LBPA, S,S-3,3'-LBPA, R,S-3,3'-LBPA and isoforms S,R- Hemi, S,S-2,2'-C18:0-ether-LBPA and S,S-2,2'-C12:0-ether-LBPA showed a similar effect as LBPA in siRNA liposome compositions in terms of GFP downregulation in Hela cells. LBPA isoforms S,S-BDP, DOPG, lysoPG showed a lower effect as LBPA in siRNA liposome compositions in terms of GFP downregulation in Hela cells. LBPA isoforms R,S-C16:0-LBPA and R,S-C14:0-LBPA showed no activity in siRNA liposome compositions in terms of GFP downregulation in Hela cells. In some embodiments of the drug delivery system disclosed herein, the fusogenic agent is a glycolipid, a phosphatidylethanolamine, a phosphatidylglycerol, a fatty acid, or a fatty acid ester. In preferred embodiments of the drug delivery system disclosed herein, the fusogenic agent is a galactolipid, preferably an unsaturated monogalactosyldiacylglycerol. In further preferred embodiments of the drug delivery system disclosed herein, the fusogenic agent is a 1,2-diacyl-sn-glycero-3- phosphoethanolamine or an N-acyl-1,2-diacyl-sn-glycero-3-phosphoethanolamine. In further more preferred embodiments of the drug delivery system disclosed herein, the fusogenic agent is a phosphatidylethanolamine selected from the group consisting of 1,2-dimyristoyl-sn-glycero-3- phosphoethanolamine, 1,2-dipentadecanoyl-sn-glycero-3-phosphoethanolamine, 1,2-dipalmitoyl-sn- glycero-3-phosphoethanolamine, 1,2-dimargaroyl-sn-glycero-3-phosphoethanolamine, 1,2-distearoyl-sn-glycero-3- phosphoethanolamine, 1,2-dipalmitoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3- phosphoethanolamine, 1,2-dierucoyl-sn-glycero-3-phosphoethanolamine, 1-pentadecanoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2-linoleoyl-sn-glycero-3- phosphoethanolamine, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine, 1-stearoyl-2-oleoyl- sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2-docosahexaenoyl-sn- glycero-3-phosphoethanolamine, 1-stearoyl-2-linoleoyl-sn-glycero-3-phosphoethanolamine, 1- ZSP Ref.: 1261-2 PCT stearoyl-2-arachidonoyl-sn-glycero-3-phosphoethanolamine, 1-stearoyl-2-docosahexaenoyl-sn- glycero-3-phosphoethanolamine, and N-palmitoyl-1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine. In still more preferred embodiments of the drug delivery system disclosed herein, the fusogenic agent is a phosphatidylglycerol selected from the group consisting of bis(monoacylglycerol)phosphate, 3- acylglycero-1-phospho-3'-(1',2'-diacyl)-glycerol, 3-acylglycero-1-phospho-glycerol, and 1,2- diacylglycero-3-phospho-glycerol. An aspect of the present invention relates to the drug delivery system as disclosed herein, wherein the fusogenic agent is a bis(monoacylglycerol)phosphate selected from the group consisting of 2,2'-S,S- bis(monoacylglycerol)phosphate, 3,3'-S,S-bis(monoacylglycerol)phosphate, 3,3'-R,R- bis(monoacylglycerol)phosphate, and 3,3'-R,S-bis(monoacylglycerol)phosphate. A further aspect of the present invention relates to the drug delivery system as disclosed herein, wherein the fusogenic agent is a bis(monoacylglycerol)phosphate selected from the group consisting of bis(monododecylglycerol)phosphate, bis(monotridecylglycerol)phosphate, bis(monotetradecylglycerol)phosphate, bis(monopentadecylglycerol)phosphate, bis(monohexadecylglycerol)phosphate, bis(monoheptadecylglycerol)phosphate, bis(monooctadecylglycerol)phosphate, bis(monononadecylglycerol)phosphate, bis(monoicosylglycerol)phosphate, bis(monolauroleoylglycerol)phosphate, bis(monomyristoleoylglycerol)phosphate, bis(monopalmitoleoylglycerol)phosphate, bis(monopetroseloylglycerol)phosphate, bis(monopetroselaidoylglycerol)phosphate, bis(monooleoylglycerol)phosphate, bis(monoelaidoylglycerol)phosphate, bis(monovaccenoylglycerol)phosphate, and bis(monogadoleoylglycerol)phosphate. A further preferred aspect of the present invention relates to the drug delivery system as disclosed herein, wherein the fusogenic agent is a 3-acylglycero-1-phospho-3'-(1',2'-diacyl)-glycerol selected from the group consisting of 3-dodecylglycero-1-phospho-3'-(1',2'-didodecyl)-glycerol, 3-tridecylglycero-1- phospho-3'-(1',2'-ditridecyl)-glycerol, 3-tetradecylglycero-1-phospho-3'-(1',2'-ditetradecyl)-glycerol, 3- pentadecylglycero-1-phospho-3'-(1',2'-dipentadecyl)-glycerol, 3-hexadecylglycero-1-phospho-3'-(1',2'- dihexadecyl)-glycerol, 3-heptadecylglycero-1-phospho-3'-(1',2'-diheptadecyl)-glycerol, 3- octadecylglycero-1-phospho-3'-(1',2'-dioctadecyl)-glycerol, 3-nonadecylglycero-1-phospho-3'-(1',2'- dinonadecyl)-glycerol, 3-icosylglycero-1-phospho-3'-(1',2'-diicosyl)-glycerol, 3-lauroleoylglycero-1- phospho-3'-(1',2'-dilauroleoyl)-glycerol, 3-myristoleoylglycero-1-phospho-3'-(1',2'-dimyristoleoyl)- glycerol, 3-palmitoleoylglycero-1-phospho-3'-(1',2'-dpalmitoleoyl)-glycerol, 3-petroseloylglycero-1- phospho-3'-(1',2'-dipetroseloyl)-glycerol, 3-petroselaidoylglycero-1-phospho-3'-(1',2'- dipetroselaidoyl)-glycerol, 3-oleoylglycero-1-phospho-3'-(1',2'-dioleoyl)-glycerol, 3-elaidoylglycero-1- phospho-3'-(1',2'-dielaidoyl)-glycerol, 3-vaccenoylglycero-1-phospho-3'-(1',2'-divaccenoyl)-glycerol, and 3-gadoleoylglycero-1-phospho-3'-(1',2'-digadoleoyl)-glycerol. ZSP Ref.: 1261-2 PCT A further more preferred aspect of the present invention relates to the drug delivery system as disclosed herein, wherein the fusogenic agent is a 3-acylglycero-1-phospho-glycerol selected from the group consisting of 3-dodecylglycero-1-phospho-glycerol, 3-tridecylglycero-1-phospho-glycerol, 3- tetradecylglycero-1-phospho-glycerol, 3-pentadecylglycero-1-phospho-glycerol, 3-hexadecylglycero-1-phospho-glycerol, 3-heptadecylglycero-1-phospho-glycerol, 3-octadecylglycero-1-phospho-glycerol, 3-nonadecylglycero-1-phospho-glycerol, 3-icosylglycero-1-phospho-glycerol, 3-lauroleoylglycero-1-phospho-glycerol, 3-myristoleoylglycero-1-phospho-glycerol, 3-palmitoleoylglycero-1-phospho-glycerol, 3-petroseloylglycero-1-phospho-glycerol, 3- petroselaidoylglycero-1-phospho-glycerol, 3-oleoylglycero-1-phospho-glycerol, 3-elaidoylglycero-1-phospho-glycerol, 3-vaccenoylglycero-1-phospho-glycerol, and 3- gadoleoylglycero-1-phospho-glycerol. A still more preferred aspect of the present invention relates to the drug delivery system as disclosed herein, wherein the fusogenic agent is a 1,2-diacylglycero-3-phospho-glycerol selected from the group consisting of 1,2-didodecylglycero-3-phospho-glycerol, 1,2-ditridecylglycero-3-phospho-glycerol, 1,2- ditetradecylglycero-3-phospho-glycerol, 1,2-dipentadecylglycero-3-phospho-glycerol, 1,2- dihexadecylglycero-3-phospho-glycerol, 1,2-diheptadecylglycero-3-phospho-glycerol, 1,2- dioctadecylglycero-3-phospho-glycerol, 1,2-dinonadecylglycero-3-phospho-glycerol, 1,2- diicosylglycero-3-phospho-glycerol, 1,2-dilauroleoylglycero-3-phospho-glycerol, 1,2- dimyristoleoylglycero-3-phospho-glycerol, 1,2-dipalmitoleoylglycero-3-phospho-glycerol, 1,2-dipetroseloylglycero-3-phospho-glycerol, 1,2- dipetroselaidoylglycero-3-phospho-glycerol, 1,2-dioleoylglycero-3-phospho-glycerol, 1,2- dielaidoylglycero-3-phospho-glycerol, 1,2-divaccenoylglycero-3-phospho-glycerol, and 1,2- digadoleoylglycero-3-phospho-glycerol. A particularly preferred aspect of the present invention relates to the drug delivery system as disclosed herein, wherein the fusogenic agent is a fatty acid selected from the group consisting of myristic acid, pentadecanoic acid, palmitic acid, margaric acid, stearic acid, isostearic acid, nonadecylic acid, arachidic acid, myristoleic acid, palmitoleic acid, sapienic acid, oleic acid, elaidic acid, vaccenic acid, and linoleic acid; or a methyl ester or a glyceryl ester of one of the aforementioned fatty acids. A particularly preferred aspect of the present invention relates to the drug delivery system as disclosed herein, wherein the fusogenic agent is selected from the group consisting of monogalactosyl- dilinolenoylglycerol, 1-palmitoyl-2-linoleoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2- oleoyl-sn-glycero-3-phosphoethanolamine, N-palmitoyl-1,2-dipalmitoyl-sn-glycero-3- phosphoethanolamine, 2,2'-S,S-bis(monododecylglycerol)phosphate, 3,3'-S,S- bis(monododecylglycerol)phosphate, 3,3'-R,R-bis(monododecylglycerol)phosphate, 3,3'-R,S- bis(monododecylglycerol)phosphate, 2,2'-S,S-bis(monooctadecylglycerol)phosphate, 3,3'-S,S-bis(monooctadecylglycerol)phosphate, 3,3'- R,R-bis(monooctadecylglycerol)phosphate, 3,3'-R,S-bis(monooctadecylglycerol)phosphate, 2,2'-S,S- ZSP Ref.: 1261-2 PCT bis(monooleoylglycerol)phosphate, 3,3'-S,S-bis(monooleoylglycerol)phosphate, 3,3'-R,R- bis(monooleoylglycerol)phosphate, 3,3'-R,S-bis(monooleoylglycerol)phosphate, 3-dodecylglycero-1- phospho-3'-(1',2'-didodecyl)-glycerol, 3-octadecylglycero-1-phospho-3'-(1',2'-dioctadecyl)-glycerol, 3- oleoylglycero-1-phospho-3'-(1',2'-dioleoyl)-glycerol, glyceryl monoloeate, methyl oleate, isotearic acid, palmitoleic acid, and oleic acid. As used herein, the term “non-cationic lipid” is meant to refer to any amphipathic lipid as well as any other neutral lipid or anionic lipid. In some embodiments an amphiphilic lipid may have the fusogenic effect described herein. Thus, in one embodiment the present invention provides a drug delivery system comprising a composition comprising (c) an amphiphilic lipid as described herein, wherein the amphiphilic lipid is selected from the group consisting of glycolipids, phosphatidylethanolamines, phosphatidylglycerols, fatty acids, and fatty acid esters. In one embodiment the amphiphilic lipid is a galactolipid, preferably an unsaturated monogalactosyldiacylglycerol. In one embodiment the amphiphilic lipid is a 1,2-diacyl-sn-glycero-3-phosphoethanolamine or an N- acyl-1,2-diacyl-sn-glycero-3-phosphoethanolamine. In one embodiment the amphiphilic lipid is a phosphatidylethanolamine selected from the group consisting of 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine, 1,2-dipentadecanoyl-sn-glycero- 3-phosphoethanolamine, 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine, 1,2-dimargaroyl-sn- glycero-3-phosphoethanolamine, 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2- dipalmitoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3- phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn- glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2- diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-dierucoyl-sn-glycero-3- phosphoethanolamine, 1-pentadecanoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl- 2-linoleoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2-oleoyl-sn-glycero-3- phosphoethanolamine, 1-stearoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2-docosahexaenoyl- sn-glycero-3-phosphoethanolamine, 1-stearoyl-2-linoleoyl-sn-glycero-3-phosphoethanolamine, 1- stearoyl-2-arachidonoyl-sn-glycero-3-phosphoethanolamine, 1-stearoyl-2-docosahexaenoyl-sn- glycero-3-phosphoethanolamine, and N-palmitoyl-1,2-dipalmitoyl-sn-glycero-3- phosphoethanolamine. In one embodiment the amphiphilic lipid is a phosphatidylglycerol selected from the group consisting of bis(monoacylglycerol)phosphate, 3-acylglycero-1-phospho-3'-(1',2'-diacyl)-glycerol, 3- acylglycero-1-phospho-glycerol, and 1,2-diacylglycero-3-phospho-glycerol. ZSP Ref.: 1261-2 PCT In one embodiment the amphiphilic lipid is a bis(monoacylglycerol)phosphate selected from the group consisting of 2,2'-S,S-bis(monoacylglycerol)phosphate, 3,3'-S,S-bis(monoacylglycerol)phosphate, 3,3'- R,R-bis(monoacylglycerol)phosphate, and 3,3'-R,S-bis(monoacylglycerol)phosphate, S,R-Hemi, S,S- 2,2'-C18:0-ether-LBPA and S,S-2,2'-C12:0-ether-LBPA. A bis(monoacylglycerol)phosphate may also be selected from 2,2‘-R,R-bis(monoacylglycerol)phosphate and 2,2‘-R,S- bis(monoacylglycerol)phosphate. In a particularly preferred embodiment, the amphiphilic lipid is bis(monoacylglycerol)phosphates selected from 2,2'-S,S-bis(monoacylglycerol)phosphate and 3,3'-S,S-bis(monoacylglycerol)phosphate. Even more preferably the amphiphilic lipid is 3,3'-S,S-bis(monoacylglycerol)phosphate. In one embodiment the amphiphilic lipid is a bis(monoacylglycerol)phosphate selected from the group consisting of bis(monododecylglycerol)phosphate, bis(monotridecylglycerol)phosphate, bis(monotetradecylglycerol)phosphate, bis(monopentadecylglycerol)phosphate, bis(monohexadecylglycerol)phosphate, bis(monoheptadecylglycerol)phosphate, bis(monooctadecylglycerol)phosphate, bis(monononadecylglycerol)phosphate, bis(monoicosylglycerol)phosphate, bis(monolauroleoylglycerol)phosphate, bis(monomyristoleoylglycerol)phosphate, bis(monopalmitoleoylglycerol)phosphate, bis(monopetroseloylglycerol)phosphate, bis(monopetroselaidoylglycerol)phosphate, bis(monooleoylglycerol)phosphate, bis(monoelaidoylglycerol)phosphate, bis(monovaccenoylglycerol)phosphate, and bis(monogadoleoylglycerol)phosphate. In one embodiment the amphiphilic lipid is a 3-acylglycero-1-phospho-3'-(1',2'-diacyl)-glycerol selected from the group consisting of 3-dodecylglycero-1-phospho-3'-(1',2'-didodecyl)-glycerol, 3- tridecylglycero-1-phospho-3'-(1',2'-ditridecyl)-glycerol, 3-tetradecylglycero-1-phospho-3'-(1',2'- ditetradecyl)-glycerol, 3-pentadecylglycero-1-phospho-3'-(1',2'-dipentadecyl)-glycerol, 3- hexadecylglycero-1-phospho-3'-(1',2'-dihexadecyl)-glycerol, 3-heptadecylglycero-1-phospho-3'- (1',2'-diheptadecyl)-glycerol, 3-octadecylglycero-1-phospho-3'-(1',2'-dioctadecyl)-glycerol, 3- nonadecylglycero-1-phospho-3'-(1',2'-dinonadecyl)-glycerol, 3-icosylglycero-1-phospho-3'-(1',2'- diicosyl)-glycerol, 3-lauroleoylglycero-1-phospho-3'-(1',2'-dilauroleoyl)-glycerol, 3- myristoleoylglycero-1-phospho-3'-(1',2'-dimyristoleoyl)-glycerol, 3-palmitoleoylglycero-1- phospho-3'-(1',2'-dpalmitoleoyl)-glycerol, 3-petroseloylglycero-1-phospho-3'-(1',2'-dipetroseloyl)- glycerol, 3-petroselaidoylglycero-1-phospho-3'-(1',2'-dipetroselaidoyl)-glycerol, 3-oleoylglycero-1- phospho-3'-(1',2'-dioleoyl)-glycerol, 3-elaidoylglycero-1-phospho-3'-(1',2'-dielaidoyl)-glycerol, 3- vaccenoylglycero-1-phospho-3'-(1',2'-divaccenoyl)-glycerol, and 3-gadoleoylglycero-1-phospho-3'- (1',2'-digadoleoyl)-glycerol. In one embodiment the amphiphilic lipid is a 3-acylglycero-1-phospho-glycerol selected from the group consisting of 3-dodecylglycero-1-phospho-glycerol, 3-tridecylglycero-1-phospho-glycerol, 3-tetradecylglycero-1-phospho-glycerol, 3-pentadecylglycero-1-phospho-glycerol, 3- hexadecylglycero-1-phospho-glycerol, 3-heptadecylglycero-1-phospho-glycerol, 3- octadecylglycero-1-phospho-glycerol, 3-nonadecylglycero-1-phospho-glycerol, 3-icosylglycero-1- ZSP Ref.: 1261-2 PCT phospho-glycerol, 3-lauroleoylglycero-1-phospho-glycerol, 3-myristoleoylglycero-1-phospho- glycerol, 3-palmitoleoylglycero-1-phospho-glycerol, 3-petroseloylglycero-1-phospho-glycerol, 3- petroselaidoylglycero-1-phospho-glycerol, 3-oleoylglycero-1-phospho-glycerol, 3-elaidoylglycero- 1-phospho-glycerol, 3-vaccenoylglycero-1-phospho-glycerol, and 3-gadoleoylglycero-1-phospho- glycerol. In one embodiment the amphiphilic lipid is a 1,2-diacylglycero-3-phospho-glycerol selected from the group consisting of 1,2-didodecylglycero-3-phospho-glycerol, 1,2-ditridecylglycero-3-phospho- glycerol, 1,2-ditetradecylglycero-3-phospho-glycerol, 1,2-dipentadecylglycero-3-phospho-glycerol, 1,2-dihexadecylglycero-3-phospho-glycerol, 1,2-diheptadecylglycero-3-phospho-glycerol, 1,2- dioctadecylglycero-3-phospho-glycerol, 1,2-dinonadecylglycero-3-phospho-glycerol, 1,2- diicosylglycero-3-phospho-glycerol, 1,2-dilauroleoylglycero-3-phospho-glycerol, 1,2- dimyristoleoylglycero-3-phospho-glycerol, 1,2-dipalmitoleoylglycero-3-phospho-glycerol, 1,2-dipetroseloylglycero-3-phospho-glycerol, 1,2- dipetroselaidoylglycero-3-phospho-glycerol, 1,2-dioleoylglycero-3-phospho-glycerol, 1,2- dielaidoylglycero-3-phospho-glycerol, 1,2-divaccenoylglycero-3-phospho-glycerol, and 1,2- digadoleoylglycero-3-phospho-glycerol. In one embodiment the amphiphilic lipid is a fatty acid selected from the group consisting of myristic acid, pentadecanoic acid, palmitic acid, margaric acid, stearic acid, isostearic acid, nonadecylic acid, arachidic acid, myristoleic acid, palmitoleic acid, sapienic acid, oleic acid, elaidic acid, vaccenic acid, and linoleic acid; or a methyl ester or a glyceryl ester of one of the aforementioned fatty acids. In one embodiment the amphiphilic lipid is selected from the group consisting of monogalactosyl- dilinolenoylglycerol, 1-palmitoyl-2-linoleoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2- oleoyl-sn-glycero-3-phosphoethanolamine, N-palmitoyl-1,2-dipalmitoyl-sn-glycero-3- phosphoethanolamine, 2,2'-S,S-bis(monododecylglycerol)phosphate, 3,3'-S,S- bis(monododecylglycerol)phosphate, 3,3'-R,R-bis(monododecylglycerol)phosphate, 3,3'-R,S- bis(monododecylglycerol)phosphate, 2,2'-S,S-bis(monooctadecylglycerol)phosphate, 3,3'-S,S- bis(monooctadecylglycerol)phosphate, 3,3'-R,R-bis(monooctadecylglycerol)phosphate, 3,3'-R,S- bis(monooctadecylglycerol)phosphate, 2,2'-S,S-bis(monooleoylglycerol)phosphate, 3,3'-S,S- bis(monooleoylglycerol)phosphate, 3,3'-R,R-bis(monooleoylglycerol)phosphate, 3,3'-R,S- bis(monooleoylglycerol)phosphate, 3-dodecylglycero-1-phospho-3'-(1',2'-didodecyl)-glycerol, 3- octadecylglycero-1-phospho-3'-(1',2'-dioctadecyl)-glycerol, 3-oleoylglycero-1-phospho-3'-(1',2'- dioleoyl)-glycerol, glyceryl monoloeate, methyl oleate, isotearic acid, palmitoleic acid, and oleic acid. In one embodiment the amphiphilic lipid is selected from the group consisting of (S,S) Bisoleoyl- lysobisphosphatidic acid (LBPA), monogalactosyldiacylglycerol (MGDG), 1-palmitoyl-2-linoleoyl- sn-glycero-3-phosphoethanolamine (PLPE), isostearic acid (IsostA), glycerol mono oleate (GMO), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE), N-Palmitoyl phosphatidylethanolamine 16:0 (NPPE), N-acylphosphatidylethanolamine 12:0 (NAPE), methyl ZSP Ref.: 1261-2 PCT oleate (MO), palmitoleic acid (PalmA), oleic acid (OIA), or mixtures thereof, and even more preferably wherein the amphiphilic lipid is or comprises LBPA. In a preferred embodiment LBPA is selected from the group consisting of 3,3'-R,S-LBPA, 3,3'-R,R-LBPA, S,S-2,2'-C18:0-ether-LBPA, S,R-Hemi-LBPA, S,S-2,2'-C12:0-ether-LBPA, sn-[2,3-dioleoyl]-glycerol-1-phospho-sn-1’-[2’,3’- dioleoyl]-glycerol (S,S-BDP), 18:1 (Δ9-Cis)PG 1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DOPG) and 1-oleoyl-2-hydroxy-sn-glycero-3-phospho-(1'-rac-glycerol) (lysoPG). In another embodiment the amphiphilic lipid is selected from the group consisting of one of the following mixtures: (S,S) Bisoleoyl-lysobisphosphatidic acid (LBPA) and monogalactosyldiacylglycerol (MGDG), (S,S) Bisoleoyl-lysobisphosphatidic acid (LBPA) and isostearic acid (IsostA), (S,S) Bisoleoyl-lysobisphosphatidic acid (LBPA) and glycerol mono oleate (GMO), or (S,S) Bisoleoyl-lysobisphosphatidic acid (LBPA) and 1-palmitoyl-2-linoleoyl-sn- glycero-3-phosphoethanolamine (PLPE). "Helper Lipids" A liposome composition disclosed herein may include one or more components in addition to those described in the preceding sections. For example, a liposome composition may include one or more "enhancer lipids" or "helper lipids" that enhance endosomal escape, and, consequently, delivery of the cargo by the liposome composition. Preferred enhancers are neutral lipids selected from the group consisting of sterol-based compound E18, compounds 6-10,12-21, 23, 24, 27-32 of Figure 11a being analogs of E18, solasodine, solasodine acetate, diosgenin, ceramide, cholesterol. Further preferred enhancers are neutral lipids selected from the group consisting of cholesterol, diosgenin, solasodine, and ceramide. Thus, in one embodiment the composition of the invention comprises (e) a steroid and / or a ceramide selected from the group consisting of cholesterol, solasodine, ceramide, diosgenin, DOPE, sphingomyelin, and mixtures thereof. In a preferred embodiment, said steroid and / or a ceramide is selected from the group consisting of cholesterol, diosgenin, solasodine, ceramide, and mixtures thereof. In a more preferred embodiment, the lipid is selected from the group consisting of cholesterol, solasodine and a mixture thereof. In one embodiment the composition of the invention comprises (e) a steroid, wherein the steroid is cholesterol. In one embodiment said composition, comprising (e) cholesterol, is used to deliver a therapeutic agent to a cell selected from epithelial cells (preferably epithelial cells from cervical cancer), macrophages, hepatocytes and cardiomyocytes. In a preferred embodiment in this context, the therapeutic agent is an RNA, preferably siRNA or mRNA. In a more preferred embodiment the therapeutic agent is an RNA, preferably mRNA, and the cell to which the therapeutic agent is delivered is a hepatocyte. ZSP Ref.: 1261-2 PCT In one embodiment the composition described herein comprises (e) between 2.5 and 35 mol percent of at least one neutral lipid, wherein said mol percent is calculated taking the total moles of all components except component (a) that are comprised in said composition as 100%. In one embodiment the composition described herein comprises (e) between 2.5 and 35 mol percent of at least one neutral lipid selected from the group consisting of cholesterol, diosgenin, solasodine, and ceramide, wherein said mol percent is calculated taking the total moles of all components except component (a) that are comprised in said composition as 100%. One embodiment of the present invention provides a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, iv) between 2.5 and 35 mol percent of at least one neutral lipid, and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. One embodiment of the present invention provides a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) between 1 and 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, iv) between 2.5 and 35 mol percent of at least one neutral lipid selected from the group consisting of cholesterol, diosgenin, solasodine, and ceramide, and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume, wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. ZSP Ref.: 1261-2 PCT Endosomal escape is the process of cytosolic entry of macromolecules such as small interfering RNAs (siRNAs) from a vesicular compartment, following initial endocytosis of the macromolecule and delivery vehicle into the target cell. A "helper lipid" is usually a lipid that contributes either to 1) the formation of the lipid bilayer, or 2) the recognition of the delivery system by the limiting membrane of the endosome and 3) the membrane fusion of the delivery system with the limiting membrane of the endosome. Therefore, a "helper lipid" can be used to improve efficiency or physical characteristics such as stability, but is not essential for the function of the liposomal delivery system. The preferred lipids Cholesterol, Diosgenin, Solasodine, and ceramide showed high "helper" activity for siRNA transfection in HeLa cells. The lipid DOPE showed intermediate "helper" activity for siRNA delivery in HeLa cells, whereas DOPC and sphingomyelin showed no "helper" activity for siRNA transfection in HeLa cells. In other words, a particular aspect of the present invention provides a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) between 1 and 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, iv) between 13 and 35 mol percent of at least one helper lipid, and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume, wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. A more particular aspect of the present invention provides a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) between 1 and 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, iva) between 13 and 15 mol percent of cholesterol, and ZSP Ref.: 1261-2 PCT ivb) between 15 and 36 mol percent of solasodine, and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume, wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. A still more particular aspect of the present invention provides a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, iva) 13 mol percent of cholesterol, and ivb) 36 mol percent of solasodine; and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume, wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. A further more particular aspect of the present invention provides a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, iva) 15 mol percent of cholesterol, and ivb) 15 mol percent of solasodine; and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume, wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. As used herein, the term “neutral lipid” is meant to refer to any of a number of lipid species that exist either in an uncharged or neutral zwitterionic form at a selected pH. At physiological pH, such ZSP Ref.: 1261-2 PCT lipids include, for example, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, cephalin, cholesterol, cerebrosides, and diacylglycerols. Therapeutic agents The liposome compositions disclosed herein may include one or more therapeutic agents and / or prophylactic agents (or abbreviated as just therapeutic / s or prophylactic / s). The term "therapeutic agent" or "prophylactic agent" as used herein refers to any agent that, when administered to a subject, has a therapeutic, diagnostic, and / or prophylactic effect and / or elicits a desired biological and / or pharmacological effect. Therapeutic agents are also referred to as "actives" or "active agents". Moreover, the term "therapeutic agent" is meant to refer to a drug, a protein, a peptide, a gene, an oligonucleotide, a compound, an antibody, a nanobody, a nucleic acid, a ribonucleoprotein, a small molecule, a non-Lipinski molecule, a biomimetic, or a natural compound, or another pharmaceutically active ingredient. In one embodiment of the composition disclosed herein the therapeutic agent is selected from the group consisting of a drug, a protein, a peptide, a gene, an oligonucleotide, a compound, an antibody, a nanobody, a nucleic acid, a ribonucleoprotein, a small molecule, a non-lipinski molecule, a biomimetic, or a natural compound. In a preferred embodiment, a therapeutic agent such as a therapeutic siRNA is encapsulated in the lipid portion of the particle, thereby protecting it from enzymatic degradation. As used herein, the term "non-Lipinski molecule" refers to molecules that do not conform to Lipinski's rule of five, which is a rule to predict high probability of success or failure due to drug likeness for molecules complying with 2 or more of the following rules: 1) Molecular mass less than 500 Dalton; 2) High lipophilicity (expressed as LogP less than 5); 3) Less than 5 hydrogen bond donors; 4) Less than 10 hydrogen bond acceptors; 5) Molar refractivity should be between 40-130. The rule was formulated by Christopher A. Lipinski in 1997, based on the observation that most orally administered drugs are relatively small and moderately lipophilic molecules. The rule is indicative of molecular properties such as absorption, distribution, metabolism, and excretion ("ADME"), which are important for drug's pharmacokinetics in the human body. Capecchi et al., described that seven million entries of the PubChem database are non-Lipinski molecules (non- Lipinski PubChem (NLP)), 183,185 of which are also found in the ChEMBL database (non-Lipinski ChEMBL (NLC)) (Capecchi et al., PubChem and ChEMBL beyond Lipinski. Mol. Inf. 2019, 38, 1900016). ZSP Ref.: 1261-2 PCT The term "biomimetics" refers to a compound that mimics a biological compound in its structure or function. The term "natural products (NPs)" refers to small molecules produced by living organisms with potential applications in pharmacology and other industries as many of them are bioactive. Exemplary "natural products (NPs)" can be found in COlleCtion of Open Natural prodUcTs (COCONUT), https: / / coconut.naturalproducts.net. In some embodiments, a therapeutic agent is a polynucleotide or nucleic acid (e.g., ribonucleic acid or deoxyribonucleic acid). The term "polynucleotide," in its broadest sense, includes any compound and / or substance that is or can be incorporated into an oligonucleotide chain. Exemplary polynucleotides for use in accordance with the present disclosure include, but are not limited to, one or more of deoxyribonucleic acid (DNA), ribonucleic acid (RNA) including messenger mRNA (mRNA), hybrids thereof, RNAi-inducing agents, RNAi agents, siRNAs, shRNAs, miRNAs, antisense RNAs, ribozymes, catalytic DNA, RNAs that induce triple helix formation, aptamers, vectors, guide RNA, etc. In some embodiments, a therapeutic and / or prophylactic is an RNA as described above. As used herein, an "RNA" refers to a ribonucleic acid that may be naturally or non- naturally occurring. For example, an RNA may include modified and / or non-naturally occurring components such as one or more nucleobases, nucleosides, nucleotides, or linkers. An RNA may include a cap structure, a chain terminating nucleoside, a stem loop, a polyA sequence, and / or a polyadenylation signal. An RNA may have a nucleotide sequence encoding a polypeptide of interest. RNAs useful in the compositions and methods described herein can be selected from the group consisting of, but are not limited to, shortmers, antagomirs, antisense, ribozymes, small interfering RNA (siRNA), asymmetrical interfering RNA (aiRNA), microRNA (miRNA), piRNA, sdRNA, snRNA, snoRNA, PAR, tsRNA, endo-siRNA, MSY-RNA, tel-sRNA, crasiRNA, moRNA, xiRNA, lncRNA, circRNA, regulatory non-coding RNA (ncRNA), Dicer-substrate RNA (dsRNA), small hairpin RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA) (e.g Cas9 mRNA), single- guide RNA (sgRNA), guide RNA, CRISPR RNA (crRNA), tracr RNA, and mixtures thereof. In certain embodiments, the RNA is an mRNA. In other embodiments, a therapeutic and / or prophylactic is a siRNA. A siRNA may be capable of selectively knocking down or down regulating expression of a gene of interest. For example, a siRNA could be selected to silence or downregulating a gene associated with a particular disease, disorder, or condition upon administration to a subject in need thereof of a liposome composition including the siRNA. A siRNA may comprise a sequence that is complementary to a mRNA sequence that encodes a gene or protein of interest. In some embodiments, the siRNA may be an immunomodulatory siRNA. ZSP Ref.: 1261-2 PCT In some embodiments, a therapeutic agent is a shRNA or a vector or plasmid encoding the same. A shRNA may be produced inside a target cell upon delivery of an appropriate construct to the nucleus. Constructs and mechanisms relating to shRNA are well known in the relevant arts In certain embodiments, a therapeutic and / or prophylactic is a "CRISPR guide RNA" such as a sgRNA, a crispr guide RNA (also referred to as cr guide RNA), or a tracr RNA, a guide RNA mix. SgRNA, crispr guide RNA, tracr RNA and / or a guide RNA mix can be used as gene editing tools. For example, a guide RNA-Cas9 complex can affect mRNA translation of cellular genes. Thus, the term "CRISPR guide RNA" as used herein refer to a specific RNA sequence selected from the group comprising sgRNA, crRNA, tracr RNA, a guide RNA mix. A "guide RNA" (gRNA) or "guide RNA mix" refers to a specific RNA sequence that recognizes the target DNA region of interest and directs the Cas nuclease there for editing. The "guide RNA mix" is made up of two parts: crispr RNA ("crRNA"), a 17-20 nucleotide sequence complementary to the target DNA, and a "tracr RNA", which serves as a binding scaffold for the Cas nuclease. A “single guide RNA” or "sgRNA" refers to a single RNA molecule that contains both a target DNA specific "crRNA" fused to the scaffold "tracrRNA". Moreover, in some embodiments the therapeutic agent is a ribonucleoprotein. The term "ribonucleoprotein" refers to a protein present in the nucleus and cytoplasm that is complexed with, and influences the processing of different low molecular weight ribonucleic acids. An exemplary ribonucleoprotein is a ribonucleoprotein complex consisting of Cas9 protein and single guide RNA (sgRNA). In some embodiments, a therapeutic agent for the liposome delivery system disclosed herein is a regulatory long non coding RNA. The term "LncRNA" refers to RNA species longer than 200 nt, lacking protein-coding ability, and involved in regulation of genes expression and of diverse cellular functions. In some embodiments, a therapeutic agent for the liposome delivery system disclosed herein is a regulatory circular noncoding RNAs (circRNAs). In some embodiments, a therapeutic agent for the liposome delivery system disclosed herein is a regulatory small non coding RNA. The term "small non coding RNA" refers to RNA species 18– 200 nts long, lacking protein-coding ability, and having diverse roles. Small non coding RNA comprise microRNAs (miRNA), Small interfering RNAs (siRNA), PIWI-interacting RNAs (piRNAs), Sno-derived RNAs (sdRNAs), small nuclear RNA (snRNA), Small nucleolar RNAs (snoRNAs), Promoter-associated RNAs (PARs), tRNA-derived small RNAs (tsRNAs), endo- siRNA, MSY2-associated RNAs (MSY-RNAs), Telomere small RNAs (tel-sRNAs), Centrosome- ZSP Ref.: 1261-2 PCT associated RNAs (crasiRNAs), microRNA-offset RNAs (moRNAs), and X-inactivation RNAs (xiRNAs). Thus, a preferred therapeutic agent for the liposome delivery system disclosed herein is a peptide, a protein, an antibody, a nanobody, a nucleic acid, a ribonucleoprotein, a small molecule, a non-lipinski molecule, a biomimetic, or a natural compound. A further preferred therapeutic agent for the liposome delivery system disclosed herein is a CRISPR / Cas9 ribonucleoprotein, a CRISPR guide RNA, or a CRISPR associated Cas protein. A further more preferred therapeutic agent for the liposome delivery system disclosed herein is a nucleic acid selected from the group comprising ssDNA, dsDNA, ssRNA, dsRNA, aiRNA, miRNA, siRNA, piRNA, sdRNA, snRNA, snoRNA, PAR, tsRNA, endo-siRNA, MSY-RNA, tel-sRNA, crasiRNA, moRNA, xiRNA, lncRNA, ncRNA, circRNA, mRNA, sgRNA, crRNA, tracr RNA, guide RNA mix, self-amplifying RNA, ribozymes, and antisense oligonucleotides. The delivery system disclosed herein may not only be suitable for the delivery of cargo comprising nucleic acid molecules, but may also be used to deliver cargo not comprising nucleic acid molecules, such as proteins. It is preferred that such proteins are overall negatively charged. In one embodiment the therapeutic agent is a CRISPR / CAS9 ribonucleoprotein, a CRISPR guide RNA or a CRISPR associated Cas protein. In one embodiment the therapeutic agent is a nucleic acid selected from the group consisting of ssDNA, dsDNA, ssRNA, dsRNA, aiRNA, miRNA, siRNA, piRNA, sdRNA, snRNA, snoRNA, PAR, tsRNA, endo-siRNA, MSY-RNA, tel-sRNA, crasiRNA, moRNA, xiRNA, lncRNA, ncRNA, circRNA, mRNA, sgRNA, crRNA, tracr RNA, guide RNA mix, self-amplifying RNA, ribozymes, and antisense oligonucleotides. In one embodiment the therapeutic agent is selected from the group consisting of a CRISPR / CAS9 ribonucleoprotein, a siRNA, a mRNA, a guide RNA mix, and a protein. In a preferred embodiment the therapeutic agent is an anionic therapeutic agent. This can be particularly suitable, where the anionic therapeutic agent interacts with a cationic composition component of the composition of the invention, such as with a cationic lipid or a positively charged peptide component. Thus, the present invention also discloses a drug delivery system comprising a liposome having (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) between 1 and 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, and ZSP Ref.: 1261-2 PCT (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering, and wherein the therapeutic agent is a drug, a protein, a peptide, a gene, an oligonucleotide, a compound, an antibody, a nanobody, a nucleic acid, a ribonucleoprotein, a small molecule, a non-lipinski molecule, a biomimetic, or a natural compound. In particular, the present invention also discloses a drug delivery system comprising a liposome having (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) between 1 and 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering, and wherein the therapeutic agent is a CRISPR / Cas9 ribonucleoprotein, a CRISPR guide RNA, or a CRISPR associated Cas protein. More in particular, the present invention also discloses a drug delivery system comprising a liposome having (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) between 1 and 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering, and wherein the therapeutic agent is a nucleic acid selected from the group comprising ssDNA, dsDNA, ssRNA, dsRNA, aiRNA, miRNA, siRNA, piRNA, sdRNA, snRNA, snoRNA, PAR, tsRNA, endo- siRNA, MSY-RNA, tel-sRNA, crasiRNA, moRNA, xiRNA, lncRNA, ncRNA, circRNA, mRNA, ZSP Ref.: 1261-2 PCT sgRNA, crRNA, tracr RNA, guide RNA mix, self-amplifying RNA, ribozymes, and antisense oligonucleotides. Therapeutic proteins useful to be delivered with the liposome delivery system of this disclosure include vaccine proteins, antibodies against intracellular targets / intrabodies, a nanobodies, gene editing enzymes, cytotoxic proteins (for cancer therapeutics). More in particular useful therapeutic proteins can be insulin, erythropoietin (EPO), granulocyte-colony stimulating factor (G-CSF), granulocyte-macrophage colony stimulating factor (GM-CSF), luteinizing hormone-releasing hormone (LHRH) analogs, interferons, Hepatitis B surface antigen, a vaccine protein. In one embodiment the composition as described herein is a vaccine formulation. In one embodiment the composition as described herein is a drug delivery system. In one aspect the present invention provides a pharmaceutical composition comprising the composition disclosed herein. In another aspect the present invention relates to the composition disclosed herein or the pharmaceutical composition disclosed herein for use in the treatment or prophylaxis of a disease. In one embodiment, the treatment or prophylaxis of a disease is a vaccination against said disease. In one embodiment of the composition or the pharmaceutical composition for use described herein or of the method of treatment described elsewhere herein, the disease is selected from the group consisting of infectious diseases, cancer, and genetic defects and diseases. In one embodiment the composition or pharmaceutical composition described herein comprises a therapeutic agent or a pharmaceutically acceptable salt thereof, wherein the therapeutic agent is mRNA, and wherein the treatment or prophylaxis of a diseases is a vaccination against an infectious diseases or against cancer and / or against cancer progression. In one embodiment the composition or pharmaceutical composition described herein comprises a therapeutic agent or a pharmaceutically acceptable salt thereof, wherein the therapeutic agent is mRNA, and wherein the treatment of a diseases is in the form of introducing (partly or fully) missing protein activity. In a preferred embodiment the treatment of a diseases is in the form of introducing (partly or fully) missing protein activity into cells of a specific tissue and / or organ. Upon delivery of the mRNA the partly or fully missing protein can be produced from the encoding mRNA to compensate for the partly or fully missing protein activity. Alternatively or additionally to delivering encoding mRNA, proteins may also be delivered directly. This is particularly useful, where proteins are more difficult to express intracellularly from delivered mRNA, for instance due to folding limitations. An example may be certain forms of antibodies. Direct protein delivery may be used for instance to inhibit the activity of key regulatory proteins involved in ZSP Ref.: 1261-2 PCT disease progression, such as controlling cell cycle regulators in cancer. Direct protein delivery may be used for instance to inhibit intracellular protein aggregates and / or condensates that are associated with certain disease states. These include, but are not limited to, neurological diseases such as Alzheimer’s and Huntington's diseases, certain cancers where aberrant phase separation of proteins involved in transcriptional regulation contributes to oncogenesis, and a variety of myopathies and cardiomyopathies caused by abnormal accumulation of ribonucleoprotein (RNP) granule components (such as RBM20) or mutations in BAG3 or similar scaffold proteins. Direct protein delivery may further be used for instance to complement expression from delivered mRNA in situations where mRNAs can be intrinsically unstable. Direct protein delivery may further be used in situations where therapeutic applications, such as vaccines, need to be distributed to regions where cold chain logistics cannot be guaranteed. Proteins can be more stable therapeutic agent options under these conditions compared to more labile mRNA. In one embodiment the composition or pharmaceutical composition described herein comprises a therapeutic agent or a pharmaceutically acceptable salt thereof, wherein the therapeutic agent is a CRISPR / CAS9 ribonucleoprotein, and wherein the disease is a genetic disease. In a preferred embodiment, the treatment is in the form of gene editing. In one embodiment the composition or pharmaceutical composition described herein comprises a therapeutic agent or a pharmaceutically acceptable salt thereof, wherein the therapeutic agent is siRNA, and wherein the treatment of a diseases is in the form of post-transcriptional gene silencing of a diseases-related gene via RNA interference (RNAi). In another aspect the present invention relates to the composition as disclosed herein, or the pharmaceutical composition as disclosed herein for use in the manufacture of a medicament. As used herein, the term "polypeptide" or "polypeptide of interest" refers to a polymer of amino acid residues typically joined by peptide bonds that can be produced naturally (e.g., isolated or purified) or synthetically. As used herein, "modified" means non-natural. For example, an RNA may be a modified RNA that is an RNA including one or more nucleobases, nucleosides, nucleotides, or linkers that are non- naturally occurring. A "modified" species may also be referred to herein as an "altered" species. Species may be modified or altered chemically, structurally, or functionally. For example, a modified nucleobase species may include one or more substitutions that are not naturally occurring. As used herein, "naturally occurring" means existing in nature without artificial aid. As used herein, a "linker" is a moiety connecting two moieties, for example, the connection between two nucleosides of a cap species. A linker may include one or more groups including but not limited to phosphate groups (e.g., phosphates, boranophosphates, thiophosphates, selenophosphates, and phosphonates), alkyl groups, amidates, amides, esters, ethers, or glycerols. ZSP Ref.: 1261-2 PCT Polynucleotides and nucleic acids may be naturally or non-naturally occurring. Polynucleotides and nucleic acids may include one or more modified (e.g., altered or alternative) nucleobases, nucleosides, nucleotides, or combinations thereof. The nucleic acids and polynucleotides useful in the drug delivery system disclosed herein can include any useful modification or alteration, such as to the nucleobase, the sugar, or the internucleoside linkage (e.g., to a linking phosphate / to a phosphodiester linkage / to the phosphodiester backbone). In certain embodiments, alterations are present in each of the nucleobase, the sugar, and the internucleoside linkage. Modifications according to the present disclosure may be alterations of ribonucleic acids (RNAs) to deoxyribonucleic acids (DNAs), e.g., the substitution of the 2'-OH of the ribofuranosyl ring to 2'-H, threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs), unlocked nucleic acid (UNA), or hybrids thereof. Modifications can concern modified nucleobases such as hypoxanthine, 6-methyladenine, 5-methyl pyrimidines, particularly 5-methylcytosine, (5- Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC, gentobiosyl HMC, synthetic nucleobases, such as 2-aminoadenine, 2-(methylamino) adenine, 2-(imidazolylalkyl)adenine, 2- (aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2-thiothymine, 5- bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl)adenine and 2,6-diaminopurine. Preferred RNA modifications are 2'-O-Methylation (2'-OMe), 2'-O- methoxyethyl (2'-MOE), 2'-Fluoro (2'-F), 5-methoxy-uridine (5moU), N1-methylpseudouridine, pseudouridine, phosphorothioate (s).The phrase "pharmaceutically acceptable" is used herein to refer to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. As used herein, "pharmaceutically acceptable salts" refers to derivatives of the disclosed compounds wherein the parent compound is altered by converting an existing acid or base moiety to its salt form (e.g., by reacting a free base group with a suitable organic acid). Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. Representative acid addition salts include acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2- hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, ZSP Ref.: 1261-2 PCT magnesium, and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. The pharmaceutically acceptable salts of the present disclosure include the conventional non-toxic salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. The pharmaceutically acceptable salts of the present disclosure can be synthesized from the parent compound which contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. Lists of suitable salts are known in the art. Examples of particularly suitable pharmaceutically acceptable salts of the therapeutic agent as disclosed herein, wherein the therapeutic agent is a nucleic acid molecule, such as RNA, include sodium salts. The phrase "pharmaceutically acceptable excipient," as used herein, refers to any ingredient other than the compounds described herein (for example, a vehicle capable of suspending, complexing, or dissolving the active compound) and having the properties of being substantially nontoxic and non- inflammatory in a patient. Excipients may include, for example: anti-adherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, fragrances, glidants (flow enhancers), lubricants, preservatives, printing inks, sorbents, suspending or dispersing agents, sweeteners, and waters of hydration. Exemplary excipients include, but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, cross-linked polyvinyl pyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methyl paraben, microcrystalline cellulose, polyethylene glycol, polyvinyl pyrrolidone, povidone, pregelatinized starch, propyl paraben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E (alpha-tocopherol), vitamin C, xylitol, and other species disclosed herein. In one aspect the present invention provides a pharmaceutical composition comprising the drug delivery system disclosed herein and at least one pharmaceutically acceptable excipient. It has been shown that the compositions of the invention are effective in transporting nucleic acid molecules into a variety of cells (e.g. hepatocytes, macrophages, HeLa cells, cardiomyocytes). Therefore, in a further aspect the invention provides a composition comprising an artificial nucleic acid molecule, wherein the artificial nucleic acid molecule is an mRNA molecule having at least one open reading frame encoding an antigen derived from a pathogen, a therapeutic protein, or a CRISPR / CAS9 ZSP Ref.: 1261-2 PCT ribonucleoprotein, for use as a medicament, for use as a vaccine or for use in gene therapy, wherein the artificial nucleic acid molecule is associated with or complexed with components (b)-(d) and optionally (e) as defined herein, and wherein the composition is administered intramuscularly, intravenously, subcutaneously, intratumorally, orally, by inhalation or transdermally / topical. It is noted that intravenously administered drugs are typically transported to the liver. In view of the successful transfections of the cell types tested in the examples disclosed herein, an intravenous administration is a preferred mode of administration. In yet another aspect, the invention provides a method of transfecting a cell, wherein the cell is selected from the group consisting of epithelial cells (preferably epithelial cells from cervical cancer), macrophages, hepatocytes and cardiomyocytes, the method comprising the step of contacting the cell with the composition according to the invention. In a preferred embodiment, the method of transfecting a cell is an in vitro method. As used herein, the term "therapeutically effective amount" means an amount of an agent to be delivered (e.g., nucleic acid, drug, composition, therapeutic agent, diagnostic agent, prophylactic agent, etc.) that is sufficient, when administered to a subject suffering from or susceptible to an infection, disease, disorder, and / or condition, to treat, improve symptoms of, diagnose, prevent, and / or delay the onset of the infection, disease, disorder, and / or condition. In another aspect the present invention relates to a method of treatment or prophylaxis in a subject, comprising administering to the subject the composition of the invention or the pharmaceutical composition of the invention in a therapeutically effective amount. The efficacy concentration "EC50" of a therapeutic agent, such as an mRNA or a siRNA, is the concentration associated with efficacy in approximately 50% of the population. For example, the EC50 of a particular mRNA or siRNA delivered by the inventive liposome composition is the is the concentration associated with expression or downregulation of the mRNA target, in approximately 50% of the population. The method for EC50 calculation is described in Example 12. More in particular, the EC50 refers to a statistically or graphically estimated concentration that is expected to cause one or more specified effects in 50% of a group of organisms under specified conditions. Another important parameter is the toxic concentration TC50 that refers to a dose of a substance administered to test organisms (here Hela cells or primary cells) that produces toxic effects in 50 percent of test organisms. The method for TC50 calculation is described in Example 12. On the basis of the EC50 and TC50 can be calculated the "Therapeutic Index" ZSP Ref.: 1261-2 PCT of a particular agent. The therapeutic index is defined as the ratio between TC50 and EC50: Therapeutic index = TC50 / EC50 As used herein, "transfection" refers to the introduction of a species (e.g., an RNA) into a cell. Transfection may occur, for example, in vitro, ex vivo, or in vivo. In another aspect the present invention provides a method of producing the composition according to any one of claims 1 to 52, or the pharmaceutical composition as disclosed herein, comprising the steps of (i) combining and mixing a composition comprising the components (b)-(d) and optionally (e) as defined elsewhere herein; and (ii) mixing the composition obtained in step (i) with the therapeutic agent or with the pharmaceutically acceptable salt thereof (a). In another embodiment the invention provides a method of producing the composition according to the invention, or the pharmaceutical composition according to the invention, comprising the step of combining and mixing a composition comprising the components (a)-(d) and optionally (e) as defined herein. Thus, components (a)-(d) and optionally (e) as defined herein may also be combined and mixed in a single step. In another aspect the present invention provides a kit of parts comprising (i) a composition as disclosed herein or a pharmaceutical composition disclosed herein; and (ii) an instruction manual. In yet another aspect, the invention provides a method of delivering an siRNA, an mRNA and / or a protein into a target cell, comprising the step of (i) contacting the target cell with a composition as defined herein, wherein component (a) is said siRNA, mRNA and / or protein. "N / P ratio" As used herein, the "N / P ratio", also referred as "amine to phosphate" or "positive to negative" is the molar ratio of positively-chargeable amine (N = nitrogen) groups in a lipid to negatively-charged nucleic acid phosphate (P) groups in a nucleic acid molecule, such as an oligonucleotide, being encapsulated in the drug delivery system. Thus, the N / P ratio states the relative proportion of molar amount of positive to negative charges in the formulation As a consequence, the "N / P ratio" is a measure to ensure encapsulation, and is used to determine how much encapsulating agent is necessary for a given amount of cargo or viceversa. More in particular, the number of positive charges per molecule equals the number of amino groups present on each individual molecule (N) of encapsulating agent. For the cargo (in case of oligonucleotides) the number of negative charges per molecule is the number of phosphate groups present. ZSP Ref.: 1261-2 PCT n(positive charges) = n(encapsulating agent) * Namino groups per molecule n(negative charges) = n(oligonucleotide)*Nphosphate groups per oligonucleotide With n(encapsulating agent) and n(oligonucleotide) being the molar amount of respective entity, Namino groups per molecule the number of amino groups present on the encapsulating agent, Nphosphate groups per oligonucleotide the number of phosphate groups on the oligonucleotide. For the latter, in case it is a double stranded oligonucleotide (e.g. siRNA) or several single oligonucleotides (e.g. guide RNA mix) the sum of phosphates of both strands is considered. More details about the calculation are given in Example 31. Preferentially, in the drug delivery system of the invention the N / P ratio is from about 1:1 to about 50:1. Therefore, a preferred embodiment of the present invention provides a drug delivery system comprising a liposome having (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) between 1 and 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering, and wherein the N / P ratio is from about 1:1 to about 50:1. A more preferred embodiment of the present invention provides a drug delivery system comprising a liposome having (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of at least one encapsulating agent; ii) between 1 and 20 mol percent of an acid-cleavable polyethylene glycol conjugated lipid; iii) between 15 and 45 mol percent of at least one fusogenic agent, and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering, and ZSP Ref.: 1261-2 PCT wherein the therapeutic agent is a nucleic acid selected from the group comprising ssDNA, dsDNA, ssRNA, dsRNA, miRNA, siRNA, mRNA, sgRNA, crRNA, tracr RNA, guide RNA mix, self- amplifying RNA, ribozymes, and antisense oligonucleotides; wherein the N / P ratio is from about 1:1 to about 50:1. An embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 1:1 to about 6:1. A preferred embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 1:1 to about 10:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 1:1 to about 20:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 1:1 to about 30:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 1:1 to about 40:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 1:1 to about 50:1. An embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 2:1 to about 6:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 2:1 to about 10:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 2:1 to about 20:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 2:1 to about 30:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 2:1 to about 40:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 2:1 to about 50:1. An embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 3:1 to about 6:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 3:1 to about 10:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 3:1 to about 20:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 3:1 to about 30:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 3:1 to about 40:1. A embodiment of the invention relates to a drug delivery system as disclosed herein, wherein the N / P ratio is from about 3:1 to about 50:1. A more particular aspect of the invention relates to a drug delivery system as disclosed herein, comprising (b) a siRNA as therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; and wherein the N / P ratio is from about 1:1 to about 40:1, and preferably from 5:1 to 40:1. ZSP Ref.: 1261-2 PCT A further more particular aspect of the invention relates to a drug delivery system as disclosed herein, comprising (b) a mRNA as therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; and wherein the N / P ratio is from about 1:1 to about 20:1. A further more particular aspect of the invention relates to a drug delivery system as disclosed herein, comprising (b) a guide RNA mix as therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume, said guide RNA mix comprising a crRNA and a tracr RNA; and wherein the N / P ratio is from about 5:1 to about 10:1. A further more particular aspect of the invention relates to a drug delivery system as disclosed herein, comprising (b) a guide RNA mix as therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume, said guide RNA mix comprising a crRNA and a tracr RNA; and wherein the N / P ratio is 5.46:1, or 5.07:1, or 8.45:1, or 9.10:1 or any value comprised inbetween. "Liposome compositions" As used herein, a "liposome composition" refers to the composition of a liposome in term of lipids and therapeutic agents. More in particular, a "liposome composition" refers to the composition of a liposome as disclosed herein in terms of fusogenic agent, encapsulating agent, acid-cleavable PEG conjugated lipid, therapeutic agent, and optionally helper lipid. In other word, a preferred liposome composition of the inventive drug delivery system disclosed herein comprises the following liposome components (also referred to as "agents" or "compounds"): an "encapsulating agent", an "acid-cleavable agent or acid-cleavable PEG- lipid", a "fusogenic agent", a "therapeutic agent", and optionally an "helper lipid or agent" (also referred to as "enhancer" or "enhancer lipid" or "enhancer agent") The “cationic lipid and / or a beta-alanyl-prolyl-cysteine methyl ester” as recited as component (d) in the claims can preferably be any “encapsulating agent” as defined herein. The “amphiphilic lipid” recited as component (c) in the claims can preferably be any “fusogenic agent” as defined herein. ZSP Ref.: 1261-2 PCT The “PEG-monoorthoester-lipid” recited as component (b) in the claims can preferably be any PEG- monoorthoester-lipid as defined herein in the context of “acid-cleavable polyethylene glycol conjugated lipid”. The “steroid and / or a ceramide” recited as component (e) in the claims can be any steroid and / or a ceramide as defined herein in the context of a “helper lipid” or a “helper agent”. The wording liposome component is used within the meaning of the disclosed invention interchangeably with the terms "agent" and "compound". A "liposome composition variation" or "variation" refers to a liposome composition resulting from the replacement of a liposome component or from the variation of its ratio. An embodiment of the present invention refers to a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 30 and 75 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride and / or PD740, ii) between 1 and 11 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan- 5-yl)-amido}-polyethylene glycol45, iii) between 15 and 45 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate, and iv) between 13 and 35 mol percent of cholesterol; and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. A preferred embodiment of the present invention refers to a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) 50 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride, ii) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45, iii) 20 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate, and iv) 25 mol percent of cholesterol; and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and ZSP Ref.: 1261-2 PCT wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. A further preferred embodiment of the present invention refers to a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) 50 mol percent of PD740, ii) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45, iii) 20 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate, and iv) 25 mol percent of cholesterol; and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. A further more preferred embodiment of the present invention refers to a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises ia) 25 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride, ib) 25 mol percent of PD740, ii) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45, iii) 20 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate, and iv) 25 mol percent of cholesterol; and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between20 nm and 200 nm, as determined by dynamic light scattering. A still more preferred embodiment of the present invention refers to a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) 33 mol percent of PD740, ii) 7 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45, ZSP Ref.: 1261-2 PCT iii) 27 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate, and iv) 33 mol percent of cholesterol; and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. An alternative embodiment of the present invention refers to a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises i) between 42 and 50 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride, ii) between 4 and 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan- 5-yl)-amido}-polyethylene glycol45, iii) between 4 and 15 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate, iva) between 13 and 15 mol percent of cholesterol, and ivb) between 15 and 36 mol percent of solasodine. (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. A further alternative embodiment of the invention provides a drug delivery system comprising a liposome having: (a) a lipid bilayer enclosing an aqueous volume, wherein the lipid bilayer comprises ia) 25 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride, ib) 25 mol percent of PD740, ii) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45, iii) 20 mol percent of monogalactosyldiacylglycerol or 1-palmitoyl-2-linoleoyl-sn-glycero-3- phosphoethanolamine, and iv) 25 mol percent of cholesterol; and (b) a therapeutic agent or a pharmaceutically acceptable salt thereof, encapsulated within the aqueous volume; wherein the encapsulating agent is a cationic lipid and / or a lipidated polypeptide; and wherein the liposome has a Z-Average diameter size range comprised between 20 nm and 200 nm, as determined by dynamic light scattering. ZSP Ref.: 1261-2 PCT "Unilamellar liposomes" In a preferred embodiment, the composition is a liposome composition. In a more preferred embodiment the liposome is a unilamellar and / or univesicular liposome. Thus, a preferred embodiment of the present invention relates to a drug delivery system as disclosed herein, wherein the liposome is a unilamellar and / or univesicular liposome. Unilamellar liposomes are characterized for having one aqueous compartment, delimited by a single bilayer membrane. Unilamellar liposomes are usually spherical vesicles. In contrast, multilamellar liposomes are characterized by a liposome structure having plural concentric circular membranes similar to “coats layers of onion” and having shell-like concentric circular aqueous compartments present between said membranes. Moreover, the inventive drug delivery system comprises essentially only "univesicular liposomes". However, the inventive drug delivery system can also comprise some "multivesicular liposome". In the present invention, “univesicular liposome” (ULV, the same meaning as that of mononuclear liposome) indicates a liposome structure having a single inner aqueous phase, and such liposomes have a Z-average particle diameter size of nanometer order, usually about 20 to 500 nm. On the other hand, the “multivesicular liposome” (MVL) indicates a liposome structure comprising a lipid membrane surrounding plural non-concentric circular inner aqueous phases. Multivesicular liposomes and the multilamellar liposomes have a Z-average particle diameter of micrometer order, usually about 0.2 to 25 μm. As used herein, the term "delivering" means providing an entity to a destination. For example, delivering a therapeutic and / or prophylactic to a subject may involve administering a liposome composition including the therapeutic and / or prophylactic to the subject (e.g., by an intravenous, intramuscular, intradermal, or subcutaneous route). Administration of a liposome composition to a mammal or mammalian cell may involve contacting one or more cells with the liposome composition. As used herein, the term "enhanced delivery" means delivery of more (e.g., at least 1.5 fold more, at least 2-fold more, at least 3-fold more, at least 4-fold more, at least 5-fold more, at least 6-fold more, at least 7-fold more, at least 8-fold more, at least 9-fold more, at least 10-fold more) of a therapeutic and / or prophylactic by a liposome to a target tissue or cell of interest compared to the level of delivery of a therapeutic and / or prophylactic without that liposome or by a previously known delivery system (e.g. lipofectamine) to a target tissue or cell of interest. ZSP Ref.: 1261-2 PCT As used herein, the term "isomer" means any geometric isomer, tautomer, zwitterion, stereoisomer, enantiomer, or diastereomer of a compound. Compounds may include one or more chiral centers and / or double bonds and may thus exist as stereoisomers, such as double-bond isomers (i.e., geometric E / Z isomers) or diastereomers (e.g., enantiomers (i.e., (+) or (-)) or cis / trans isomers). The present disclosure encompasses any and all isomers of the compounds described herein, including stereomerically pure forms (e.g., geometrically pure, enantiomerically pure, or diastereomerically pure) and enantiomeric and stereoisomeric mixtures, e.g., racemates. Enantiomeric and stereomeric mixtures of compounds and means of resolving them into their component enantiomers or stereoisomers are well-known. As used herein, the term “isoform” refers to compounds that for example share the same backbone structure but include a different number of fatty acids attached, or include fatty acids of different chain length or with a different linkage. Certain embodiments of the invention In one aspect, the invention provides a method of introducing an mRNA into a target cell comprising the steps of (i) contacting said target cell with a composition comprising components a, b, c, d, e; wherein (a) is said mRNA; and wherein (b) is a PEG-monoorthoester with the structure: wherein n is an integer between 35 and 120 and wherein m is an integer between 10 and 27; and preferably wherein n is an integer between 40 and 110 and m is an integer of between 15 and 23; and wherein (c) is an amphiphilic lipid; and wherein (d) is a cationic lipid and / or a beta-alanyl-prolyl-cysteine methyl ester; and wherein (e) is cholesterol. Further provided is a composition comprising components a, b, c, d, e; wherein (a) is said mRNA; and wherein (b) is a PEG-monoorthoester with the structure: ZSP Ref.: 1261-2 PCT wherein n is an integer between 35 and 120 and wherein m is an integer between 10 and 27; and preferably wherein n is an integer between 40 and 110 and m is an integer of between 15 and 23; and wherein (c) is an amphiphilic lipid; and wherein (d) is a cationic lipid and / or a beta-alanyl-prolyl-cysteine methyl ester; and wherein (e) is cholesterol; for use in the treatment of a disease or for use in the vaccination of a human subject. Preferred embodiments in the above described method and composition for use are characterized by a combination of target cell, composition type and administration mode, as set out in the table below. The annotation as “any” indicates that any component falling under the definition disclosed herein of the categories above may be used in the respective combination. Table 16 Embod. Component (c) Component (d) Composition Component Administration type (a) mode A1 LBPA any any any any A2 LBPA any liposome any any A3 LBPA any LNP any any A4 LBPA any any mRNA any A5 LBPA any liposome mRNA any A6 LBPA any LNP mRNA any A7 LBPA any any siRNA any A8 LBPA any liposome siRNA any A9 LBPA any LNP siRNA any B1 LBPA DOTAP any any any B2 LBPA DOTAP liposome any any B3 LBPA DOTAP LNP any any B4 LBPA DOTAP any mRNA any B5 LBPA DOTAP liposome mRNA any B6 LBPA DOTAP LNP mRNA any B7 LBPA DOTAP any mRNA intravenously B8 LBPA DOTAP liposome mRNA intravenously B9 LBPA DOTAP LNP mRNA intravenously B10 LBPA DOTAP any mRNA intramuscularly B11 LBPA DOTAP liposome mRNA intramuscularly B12 LBPA DOTAP LNP mRNA intramuscularly B13 LBPA DOTAP any mRNA intratumorally B14 LBPA DOTAP liposome mRNA intratumorally B15 LBPA DOTAP LNP mRNA intratumorally B16 LBPA DOTAP any siRNA any B17 LBPA DOTAP liposome siRNA any B18 LBPA DOTAP LNP siRNA any B19 LBPA DOTAP any siRNA intravenously B20 LBPA DOTAP liposome siRNA intravenously B21 LBPA DOTAP LNP siRNA intravenously B22 LBPA DOTAP any siRNA intramuscularly B23 LBPA DOTAP liposome siRNA intramuscularly B24 LBPA DOTAP LNP siRNA intramuscularly C1 LBPA PD740 any any any C2 LBPA PD740 Liposome any any C3 LBPA PD740 LNP any any C4 LBPA PD740 any mRNA any C5 LBPA PD740 Liposome mRNA any C6 LBPA PD740 LNP mRNA any C7 LBPA PD740 any mRNA intravenously ZSP Ref.: 1261-2 PCT C8 LBPA PD740 Liposome mRNA intravenously C9 LBPA PD740 LNP mRNA intravenously C10 LBPA PD740 any mRNA intramuscularly C11 LBPA PD740 Liposome mRNA intramuscularly C12 LBPA PD740 LNP mRNA intramuscularly C13 LBPA PD740 any siRNA any C14 LBPA PD740 Liposome siRNA any C15 LBPA PD740 LNP siRNA any C16 LBPA PD740 any siRNA intravenously C17 LBPA PD740 Liposome siRNA intravenously C18 LBPA PD740 LNP siRNA intravenously C19 LBPA PD740 any siRNA intramuscularly C20 LBPA PD740 Liposome siRNA intramuscularly C21 LBPA PD740 LNP siRNA intramuscularly D1 LBPA DOMA any any any D2 LBPA DOMA Liposome any any D3 LBPA DOMA LNP any any D4 LBPA DOMA any mRNA any D5 LBPA DOMA Liposome mRNA any D6 LBPA DOMA LNP mRNA any D7 LBPA DOMA any siRNA any D8 LBPA DOMA Liposome siRNA any D9 LBPA DOMA LNP siRNA any E1 LBPA DOTMA any any any E2 LBPA DOTMA Liposome any any E3 LBPA DOTMA LNP any any E4 LBPA DOTMA any mRNA any E5 LBPA DOTMA Liposome mRNA any E6 LBPA DOTMA LNP mRNA any E7 LBPA DOTMA any siRNA any E8 LBPA DOTMA Liposome siRNA any E9 LBPA DOTMA LNP siRNA any F1 LBPA EPC 18:1 any any any F2 LBPA EPC 18:1 Liposome any any F3 LBPA EPC 18:1 LNP any any F4 LBPA EPC 18:1 LNP mRNA any F5 LBPA EPC 18:1 LNP mRNA any F6 LBPA EPC 18:1 LNP mRNA any F7 LBPA EPC 18:1 LNP siRNA any F8 LBPA EPC 18:1 LNP siRNA any F9 LBPA EPC 18:1 LNP siRNA any G1 any DOTAP any any any G2 any DOTAP Liposome any any G3 any DOTAP LNP any any G4 any DOTAP any mRNA any G5 any DOTAP Liposome mRNA any G6 any DOTAP LNP mRNA any G7 any DOTAP any siRNA any G8 any DOTAP Liposome siRNA any G9 any DOTAP LNP siRNA any H1 LBPA DOTAP any any any H2 LBPA DOTAP Liposome any any H3 LBPA DOTAP LNP any any H4 LBPA DOTAP any mRNA any H5 LBPA DOTAP Liposome mRNA any H6 LBPA DOTAP LNP mRNA any H7 LBPA DOTAP any siRNA any H8 LBPA DOTAP Liposome siRNA any H9 LBPA DOTAP LNP siRNA any I1 2,2’-S,S LBPA DOTAP any any any I2 2,2’-S,S LBPA DOTAP Liposome any any I3 2,2’-S,S LBPA DOTAP LNP any any I4 2,2’-S,S LBPA DOTAP any mRNA any I5 2,2’-S,S LBPA DOTAP Liposome mRNA any ZSP Ref.: 1261-2 PCT I6 2,2’-S,S LBPA DOTAP LNP mRNA any I7 2,2’-S,S LBPA DOTAP any siRNA any I8 2,2’-S,S LBPA DOTAP Liposome siRNA any I9 2,2’-S,S LBPA DOTAP LNP siRNA any J1 3,3’-S,S LBPA DOTAP any any any J2 3,3’-S,S LBPA DOTAP Liposome any any J3 3,3’-S,S LBPA DOTAP LNP any any J4 3,3’-S,S LBPA DOTAP any mRNA any J5 3,3’-S,S LBPA DOTAP Liposome mRNA any J6 3,3’-S,S LBPA DOTAP LNP mRNA any J7 3,3’-S,S LBPA DOTAP any siRNA any J8 3,3’-S,S LBPA DOTAP Liposome siRNA any J9 3,3’-S,S LBPA DOTAP LNP siRNA any K1 3,3’-R,S, LBPA DOTAP any any any K2 3,3’-R,S, LBPA DOTAP Liposome any any K3 3,3’-R,S, LBPA DOTAP LNP any any K4 3,3’-R,S, LBPA DOTAP any mRNA any K5 3,3’-R,S, LBPA DOTAP Liposome mRNA any K6 3,3’-R,S, LBPA DOTAP LNP mRNA any K7 3,3’-R,S, LBPA DOTAP any siRNA any K8 3,3’-R,S, LBPA DOTAP Liposome siRNA any K9 3,3’-R,S, LBPA DOTAP LNP siRNA any L1 3,3’-R,R, LBPA DOTAP any any any L2 3,3’-R,R, LBPA DOTAP Liposome any any L3 3,3’-R,R, LBPA DOTAP LNP any any L4 3,3’-R,R, LBPA DOTAP any mRNA any L5 3,3’-R,R, LBPA DOTAP Liposome mRNA any L6 3,3’-R,R, LBPA DOTAP LNP mRNA any L7 3,3’-R,R, LBPA DOTAP any siRNA any L8 3,3’-R,R, LBPA DOTAP Liposome siRNA any L9 3,3’-R,R, LBPA DOTAP LNP siRNA any M1 2,2’-S,S LBPA with 18:0 DOTAP any any any fatty acids M2 2,2’-S,S LBPA with 18:0 DOTAP Liposome any any fatty acids M3 2,2’-S,S LBPA with 18:0 DOTAP LNP any any fatty acids M4 2,2’-S,S LBPA with 18:0 DOTAP any mRNA any fatty acids M5 2,2’-S,S LBPA with 18:0 DOTAP Liposome mRNA any fatty acids M6 2,2’-S,S LBPA with 18:0 DOTAP LNP mRNA any fatty acids M7 2,2’-S,S LBPA with 18:0 DOTAP any siRNA any fatty acids M8 2,2’-S,S LBPA with 18:0 DOTAP Liposome siRNA any fatty acids M9 2,2’-S,S LBPA with 18:0 DOTAP LNP siRNA any fatty acids N1 2,2’-S,S LBPA with 12:0 DOTAP any any any fatty acids N2 2,2’-S,S LBPA with 12:0 DOTAP Liposome any any fatty acids N3 2,2’-S,S LBPA with 12:0 DOTAP LNP any any fatty acids N4 2,2’-S,S LBPA with 12:0 DOTAP any mRNA any fatty acids N5 2,2’-S,S LBPA with 12:0 DOTAP Liposome mRNA any fatty acids N6 2,2’-S,S LBPA with 12:0 DOTAP LNP mRNA any fatty acids N7 2,2’-S,S LBPA with 12:0 DOTAP any siRNA any fatty acids N8 2,2’-S,S LBPA with 12:0 DOTAP Liposome siRNA any fatty acids ZSP Ref.: 1261-2 PCT N9 2,2’-S,S LBPA with 12:0 DOTAP LNP siRNA any fatty acids O1 hemi-LBPA (3 fatty DOTAP any any any acids) O2 hemi-LBPA (3 fatty DOTAP Liposome any any acids) O3 hemi-LBPA (3 fatty DOTAP LNP any any acids) O4 hemi-LBPA (3 fatty DOTAP any mRNA any acids) O5 hemi-LBPA (3 fatty DOTAP Liposome mRNA any acids) O6 hemi-LBPA (3 fatty DOTAP LNP mRNA any acids) O7 hemi-LBPA (3 fatty DOTAP any siRNA any acids) O8 hemi-LBPA (3 fatty DOTAP Liposome siRNA any acids) O9 hemi-LBPA (3 fatty DOTAP LNP siRNA any acids) P1 any PD740, DOTAP any any any P2 any PD740, DOTAP Liposome any any P3 any PD740, DOTAP LNP any any P4 any PD740, DOTAP any mRNA any P5 any PD740, DOTAP Liposome mRNA any P6 any PD740, DOTAP LNP mRNA any P7 any PD740, DOTAP any siRNA any P8 any PD740, DOTAP Liposome siRNA any P9 any PD740, DOTAP LNP siRNA any Q1 LBPA PD740, DOTAP any any any Q2 LBPA PD740, DOTAP Liposome any any Q3 LBPA PD740, DOTAP LNP any any Q4 LBPA PD740, DOTAP any mRNA any Q5 LBPA PD740, DOTAP Liposome mRNA any Q6 LBPA PD740, DOTAP LNP mRNA any Q7 LBPA PD740, DOTAP any mRNA intravenously Q8 LBPA PD740, DOTAP Liposome mRNA intravenously Q9 LBPA PD740, DOTAP LNP mRNA intravenously Q10 LBPA PD740, DOTAP any mRNA intramuscularly Q11 LBPA PD740, DOTAP Liposome mRNA intramuscularly Q12 LBPA PD740, DOTAP LNP mRNA intramuscularly Q13 LBPA PD740, DOTAP any siRNA any Q14 LBPA PD740, DOTAP Liposome siRNA any Q15 LBPA PD740, DOTAP LNP siRNA any Q16 LBPA PD740, DOTAP any siRNA intravenously Q17 LBPA PD740, DOTAP Liposome siRNA intravenously Q18 LBPA PD740, DOTAP LNP siRNA intravenously Q19 LBPA PD740, DOTAP any siRNA intramuscularly Q20 LBPA PD740, DOTAP Liposome siRNA intramuscularly Q21 LBPA PD740, DOTAP LNP siRNA intramuscularly R1 MGDG PD740, DOTAP any any any R2 MGDG PD740, DOTAP Liposome any any R3 MGDG PD740, DOTAP LNP any any R4 MGDG PD740, DOTAP any mRNA any R5 MGDG PD740, DOTAP Liposome mRNA any R6 MGDG PD740, DOTAP LNP mRNA any R7 MGDG PD740, DOTAP any siRNA any R8 MGDG PD740, DOTAP Liposome siRNA any R9 MGDG PD740, DOTAP LNP siRNA any S1 PLPE PD740, DOTAP any any any S2 PLPE PD740, DOTAP Liposome any any S3 PLPE PD740, DOTAP LNP any any S4 PLPE PD740, DOTAP any mRNA any S5 PLPE PD740, DOTAP Liposome mRNA any ZSP Ref.: 1261-2 PCT S6 PLPE PD740, DOTAP LNP mRNA any S7 PLPE PD740, DOTAP any siRNA any S8 PLPE PD740, DOTAP Liposome siRNA any S9 PLPE PD740, DOTAP LNP siRNA any T1 NAPE PD740, DOTAP any any any T2 NAPE PD740, DOTAP liposome any any T3 NAPE PD740, DOTAP LNP any any T4 NAPE PD740, DOTAP any mRNA any T5 NAPE PD740, DOTAP liposome mRNA any T6 NAPE PD740, DOTAP LNP mRNA any T7 NAPE PD740, DOTAP any siRNA any T8 NAPE PD740, DOTAP liposome siRNA any T9 NAPE PD740, DOTAP LNP siRNA any U1 LBPA, MGDG PD740, DOTAP any any any U2 LBPA, MGDG PD740, DOTAP Liposome any any U3 LBPA, MGDG PD740, DOTAP LNP any any U4 LBPA, MGDG PD740, DOTAP any mRNA any U5 LBPA, MGDG PD740, DOTAP Liposome mRNA any U6 LBPA, MGDG PD740, DOTAP LNP mRNA any U7 LBPA, MGDG PD740, DOTAP any siRNA any U8 LBPA, MGDG PD740, DOTAP Liposome siRNA any U9 LBPA, MGDG PD740, DOTAP LNP siRNA any V1 LBPA, PLPE PD740, DOTAP any any any V2 LBPA, PLPE PD740, DOTAP Liposome any any V3 LBPA, PLPE PD740, DOTAP LNP any any V4 LBPA, PLPE PD740, DOTAP any mRNA any V5 LBPA, PLPE PD740, DOTAP Liposome mRNA any V6 LBPA, PLPE PD740, DOTAP LNP mRNA any V7 LBPA, PLPE PD740, DOTAP any siRNA any V8 LBPA, PLPE PD740, DOTAP Liposome siRNA any V9 LBPA, PLPE PD740, DOTAP LNP siRNA any In the context of any of the embodiments described herein above, wherein (b) is a PEG- monoorthoester lipid with the structure: it is most preferred that n is 22, 45 or 110. It is further most preferred that m is 17. Thus, it is preferred that the PEG-monoorthoester lipid is α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)- amido}-polyethylene glycol45(PEG2000-orthoester-C18 or PEGOEC18). Further provided herein is a composition comprising (a) a therapeutic agent or a pharmaceutically acceptable salt thereof; (b) a PEG-monoorthoester-lipid as disclosed herein; (c) an amphiphilic lipid; (d) a cationic lipid and / or a beta-alanyl-prolyl-cysteine methyl ester; and optionally (e) a steroid and / or a ceramide and / or DOPE; and wherein the combination of the compounds (a), (c) and (d) is a combination of compounds (a), (c) and (d) selected from the group consisting of the embodiments (A1) through (V9) that are listed in Table 16 above. ZSP Ref.: 1261-2 PCT Further provided herein is a composition comprising (a) a therapeutic agent or a pharmaceutically acceptable salt thereof; (b) a PEG-monoorthoester-lipid as disclosed herein; (c) an amphiphilic lipid; (d) a cationic lipid and / or a beta-alanyl-prolyl-cysteine methyl ester; and (e) cholesterol, wherein the combination of the compounds (a), (c) and (d) is a combination of compounds (a), (c) and (d) selected from the group consisting of the embodiments (A1) through (V9) that are listed in Table 16 above. Further provided herein is a composition comprising (a) a therapeutic agent or a pharmaceutically acceptable salt thereof; (b) a PEG-monoorthoester-lipid as disclosed herein; (c) an amphiphilic lipid; (d) a cationic lipid and / or a beta-alanyl-prolyl-cysteine methyl ester; and (e) cholesterol, wherein the combination of the compounds (a), (c) and (d) is a combination of compounds (a), (c) and (d) selected from the group consisting of the embodiments (A1) through (V9) that are listed in Table 16 above; and wherein the composition is of a type as set out in the same respective embodiment (A1) through (V9) that was selected from said table. In the embodiments described herein above, wherein the administration mode is in vivo, in certain embodiments, these embodiments preferably relate to said composition as defined above for use in the treatment of a human subject by administering said composition to said subject. Chemical structures Chemical structures of tested Cholesterol Diosgenin ZSP Ref.: 1261-2 PCT bromo-5-hydroxy-6- Solasodine acetate ZSP Ref.: 1261-2 PCT Sphingomyelin (porcine brain extract, mixture of different chain lengths) Chemical structures of tested LBPA isoforms ZSP Ref.: 1261-2 PCT Chemical structures of encapsulating agents DOTAP ZSP Ref.: 1261-2 PCT 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (EPC 18:1) TAP 18:0 ZSP Ref.: 1261-2 PCT MGDG (plant extract, the chemical structure represents the main species of a mixture of different chain length) ZSP Ref.: 1261-2 PCT ZSP Ref.: 1261-2 PCT NPPE PalmA Acid- cleavable PEG Lipid ZSP Ref.: 1261-2 PCT α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}-polyethylene glycol45 (PEG2000-orthoester-C18 or PEGOEC18) Cholesterol conjugated siRNA sense strand (Chol-siRNA (SEQ ID NO 7))
[0002] ZSP Ref.: 1261-2 PCT The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the scope of the invention. Further modifications and alternative embodiments of various aspects of the invention will be apparent to those skilled in the art in view of this description. Accordingly, this description is to be construed as illustrative only and is for the purpose of teaching those skilled in the art the general manner of carrying out the invention. It is to be understood that the forms of the invention shown and described herein are to be taken as examples of embodiments. Elements and materials may be substituted for those illustrated and described herein, parts and processes may be reversed, and certain features of the invention may be utilized independently, all as would be apparent to one skilled in the art after having the benefit of this description of the invention. Changes may be made in the elements described herein without departing from the scope of the invention as described in the following claims. Examples Abbreviations list: 2'-OMe – 2'-O-methyl 2'-MOE – 2'-O-methoxyethyl 5-Me-C – 5-methylcytosine 5moU – 5-methoxyuridine AcOH – acetic acid aiRNA – asymmetrical interfering RNA AllocCl – allyloxycarbonyl chloride BACMAM – Baculovirus gene transfer into Mammalian cells BHT – butylated hydroxytoluene ( BSA – bovine serum albumin CAS – Chemical Abstracts Service Cas – CRISPR associated protein Cas9 – CRISPR associated protein 9 Chol – cholesterol Chol-siRNA – cholesterol siRNA conjugate CMB – Cell Mask Blue conc. – concentration ZSP Ref.: 1261-2 PCT COVID – coronavirus disease 2019 cr guide RNA – CRISPR guide RNA crasiRNA – centrosome-associated RNA CRISPR – Clustered Regularly Interspaced Short Palindromic Repeats cryoEM – cryogenic electron microscopy DAPI – 4',6-Diamidino-2-phenylindol DCM – dichlormethane DDQ – 2,3-Dichloro-5,6-dicyano-1,4-benzoquinone DIPEA – diisopropylethyl amine DMAP – 4-(Dimethylamino)pyridin DMEM – Dulbecco's Modified Eagle Medium DMF – dimethylformamide DMSO – dimethylsulfoxid DMTP – dimethylterephthalate DNA – desoxyribonucleic acid dsRNA – double stranded RNA DLS – dynamic light scattering dsGFP – destabilized eGFP DSPE – 1,2-distearoyl-sn-glycero-3-phosphoethanolamine E18 – (5alpha,7alpha)-7-bromo-5-hydroxy-6-oxospirostan - 3-yl acetate EC50 – half maximal effective concentration EDTA – Ethylenediaminetetraacetic acid EDC – N-Ethyl-N′-carbodiimide hydrochloride eGFP / GFP – (enhanced) green fluorescent protein EGTA – ethylene glycol-bis(β-aminoethyl ether)-N,N,N′,N′-tetraacetic acid ELSD – evaporative light scattering detector EM – electron microscopy EPO – Erythropoietin EtOAc – ethyl acetate EtOH – ethanol eq. – equivalents ESI – electrospray ionization FACS – fluorescence-activated cell sorting FBS – fetal bovine serum FTMS – Fourier Transform Mass Spectrometry G418 – geneticin G-CSF – granulocyte-colony stimulating factor eGFP / GFP – (enhanced) green fluorescent protein HEPES ZSP Ref.: 1261-2 PCT GM-CSF – granulocyte-macrophage colony stimulating factor GNA – glycol nucleic acid guide RNA – mix of tracr RNA and cr guide RNA HBTU – 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate HEPES – 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid HMC – 5-hydroxymethylcytosine HOBt – hydroxybenzotriazole HPLC – high performance liquid chromatography KD – knock down LBPA – lysobisphophatidic acid LHRH – luteinizing hormone-releasing hormone LLOMe – L-leucine methyl ester LMV – large multilamellar vesicle LNA – locked nucleic acid LNP – lipid nanoparticle MCFS – macrophage colony-stimulating factor MeCN – acetonitrile MeOH – methanol MM – mouse macrophages MPI-CBG – Max Planck Institute of Molecular Cell Biology and Genetics mRNA – messenger RNA miRNA – micro RNA moRNA – microRNA-offset RNA MSY-RNA – MSY2-associated RNA MVL – multivesicular liposome ncRNA – regulatory non-coding RNA NLS – nuclear location sequence NMR – nuclear magnetic resonance spectroscopy ORF – open reading frame PAR – promoter-associated RNA PBS – phosphate buffered saline PDI – polydispersity index PEG – polyethylene glycol PEGOEC18 – PEG2000-orthoester-C18, α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan- 5-yl)-amido}-polyethylene glycol45 PEPC – protein expression, purification and characterization facility PEST amino acid sequence – proline-glutamate-serine-threonine-rich amino acid sequence (to target proteins for degradation) ZSP Ref.: 1261-2 PCT piRNA – PIWI-interacting RNA PNA – peptide nucleic acid PMA - phorbol 12-myristate 13-acetate PMBCl – para-methoxybenzyl chloride PTFE – Polytetrafluoroethylene pTosOH – p-toluene sulfonic acid rcf – relative centrifugal force Rf – retention factor RNA – ribonucleic acid RNP – ribonucleoprotein complex rt – room temperature SD – standard deviation sdRNA – sno-derived RNA SEM – standard error of the mean shRNA – small hairpin RNA siRNA – small interfering RNA sgRNA – single guide RNA snRNA – small nuclear RNA snoRNA – small nucleolar RNA ssRNA – single stranded RNA TBAF – tetrabutylammonium fluoride TBDMSCl – tert-butyldimethylsilyl chloride TBE – tris-borate-EDTA buffer tBuOOH – tert-Butyl hydroperoxide TC50 – half maximal toxic concentration TE – tris-EDTA buffer tel-sRNA – telomere small RNA TFA – trifluoroacetic acid THF – tetrahydrofuran TLC – thin layer chromatography TNA – threose nucleic acid tracr RNA – trans-activating crRNA tRNA – transfer RNA Tris – tris(hydroxymethyl)aminomethan tsRNA – tRNA-derived small RNA ULV – univesicular liposome UNA – unlocked nucleic acid UV – ultraviolet ZSP Ref.: 1261-2 PCT xiRNA – X-inactivation RNA General methods: RNase free handling All handling of liposome components to be used with RNA was done in an RNase free area using RNase free instruments. Area and instruments were cleaned with RNase zap (ThermoFisher Scientific, AM9780) repeatedly and regularly. RNase free plasticware was used (Eppendorf tubes, Falcon tubes, tips). All pipetting of compound solutions was done with RNase free filtered tips (ART tips, ThermoFisher Scientific) and Gilson Pipetman®pipettes. Glassware was made RNase free by heating to 220 °C for 2h. Lids for vials were made RNase free with RNase zap and subsequently washed with RNase free water and EtOH. RNA quantification RNA concentration was quantified by UV absorption at 260 nm using a NanoDrop instrument. Compound aliquoting and solvent selection Compounds were weighed into RNase-free glass vials (either 4 ml (Supelco 27138, screw top with solid green melamine cap with PTFE liner) or 1.5 ml (Certified CD™ Vial (Center Draining) Kit, 9 mm thread with cap / septa, Sigma Aldrich, 29307-U)) and dissolved in a suitable solvent as mentioned below. Compound Solvent 2,2’-LBPA Chloroform, dried over K2CO3 (see handling of 2,2’-LBPA) labile PEG lipid CD3CN 16:0 BMP, 14:0 BMP MeOH NAPE MeOH / CHCl3(2.5:1) all other compounds Chloroform Compound concentration was verified with quantitative NMR on a Bruker Avance III using ERETIC method (Akoka, Barantin and Trierweiler, 1999. Concentration Measurement by Proton NMR Using the ERETIC Method’, Analytical Chemistry, 71(13), pp.2554–2557) against a reference solution of DMTP (Standard for quantitative NMR, TraceCERT®, Merck, 07038). Handling labile PEG lipid PEG2000-orthoester-C18 PEG2000-orthoester-C18 is not stable in chloroform. Deuterated acetonitrile was used as the solvent of choice to allow monitoring of the stability of aliquots over a longer time and quantification of compound concentration by quantitative NMR on a Bruker Avance III using ERETIC method (Akoka, Barantin and Trierweiler, 1999) against a reference solution of DMTP (Standard for quantitative NMR, TraceCERT®, Merck, 07038). Glassware and commonly used lab equipment used ZSP Ref.: 1261-2 PCT for handling PEG2000-orthoester-C18 was thoroughly cleaned beforehand to avoid contamination with acids. The compound was handled at temperatures below 30 °C, including a lowered water bath temperature for solvent evaporation. Handling 2,2’-LBPA Isomerization of 2,2’- isomer to 3,3’ is increased under acidic conditions. Therefore, chloroform used for aliquotation of 2,2’-LBPA was pretreated with K2CO3 (0.1 g / ml) for 1 h to remove residual HCl. Verification of correct isomer was performed using a phospholipase digestion assay and detection by quantitative TLC (Kobayashi et al., 2002. Separation and characterization of late endosomal membrane domains, The Journal of Biological Chemistry, 277(35), 32157–32164). Solvents used during purification were precooled on ice to avoid isomerization during the purification process. Evaporation of solvents was done at 35°C maximum. Example 1 – Liposome formation with siRNA using extrusion or sonication Liposomes (lipid vesicles) are formed when thin lipid films or lipid cakes are hydrated and stacks of liquid crystalline bilayers become fluid and swell. The hydrated lipid sheets detach during agitation and self-close to form large, multilamellar vesicles (LMV) which prevents interaction of water with the hydrocarbon core of the bilayer at the edges. Once these particles have formed, they are subjected to downsizing, i.e. size reduction, by sonication, wherein the energy input is in the form of sonic energy, or by extrusion, wherein the energy input is in the form of mechanical energy. Individual lipid components were dissolved in suitable solvents as specified in Table 15. siRNA was dissolved in a suitable buffer and its concentration was determined by UV absorption at 260 nm using a NanoDrop instrument. The following protocol has actual amounts for preparation of 500 µl of liposome solution of composition LP1 (DOTAP:Chol:LBPA:labile PEG lipid= 50:25:20:5) at an siRNA concentration of 2 µM in 5% glucose solution (w / w) with anti eGFP siRNA (Sigma Aldrich, custom synthesis). Individual components such as buffer, concentrations, total volume as well as the drug binding agent, helper lipid, fusogenic agent, PEG lipid, siRNA and the stoichiometry of components can be varied. The preparation was prepared at a charge ratio N:P (amine to phosphate) of 20:1. The charge ratio N:P is calaculated as described in example 31. The siRNA in this example has 42 charges per molecule (number of phosphate groups), while the liposomes have one charge per DOTAP molecule included (number of amino groups). This charge ratio can be varied. Amounts need to be adjusted depending on compounds and siRNA used. Lipid film generation: Suitable volumes of DOTAP solution in CHCl3 (0.59 mg, 8.40*10^(-7) mol, 50 eq.) and cholesterol solution in CHCl3 (0.16 mg, 4.20*10^(-7) mol, 25 eq.) were added to an RNase-free glass vial (4 ml) (screw top vial with Thermoset cap with PTFE liner, Supelco 27138 (Merck)) and dried down under ZSP Ref.: 1261-2 PCT nitrogen stream. The dried film was kept for 15 min at room temperature to ensure full evaporation. Suitable volume of a solution of LBPA in CHCl3 (0.27 mg, 3.36*10^(-7) mol, 20 eq.) was added to the existing film and dried down under nitrogen stream. The dried film was kept for 15 min at room temperature to ensure full evaporation. Suitable volume of labile PEG lipid in deuterated acetonitrile (0.20 µg, 8.40*10^(-8) mol, 5 eq.) was added to the existing film and dried down under nitrogen stream. The dried film was kept for 15 min at room temperature or dried under vacuum for 2 h to ensure full evaporation. Lipid film hydration: A 2 µM solution of anti eGFP siRNA (1 nmol, charges: 42 nmol) in sterile 5% glucose solution (w / w) in RNase free water (500 µl) was added to the dried film in a sterile environment. The sample was vortexed for 5 min and left to mature at room temperature for 30 min. Total lipid concentration after hydration is 3.36 mM. Downsizing can be achieved by 2 methods: Downsizing by extrusion: In a sterile environment, the sample was extruded with a disposable NanoSizer MINI extruder (T&T Scientific) containing a 100 nm membrane with 22 passes and collected from the receiving syringe. Alternatively, an Avanti Mini Extruder and 100 nm polycarbonate membranes (Sigma Aldrich, 610005) can be used. The sample was incubated at room temperature for 30 min before storing it at 4 °C. This method was used for final compositions. Downsizing by sonication: The sample was sonicated in a water bath sonicator (Bandelin Sonorex Super RK 102 H) for 45 min. The sample was incubated at room temperature for 30 min before storing it at 4 °C. This method is high throughput and was used for compositional screening. Quality control: Dynamic light scattering was used to check the presence of particles and analyse their size distribution (Example 6 for experimental details). The RiboGreen assay was used to assess siRNA concentration and siRNA encapsulation (Example 7 for experimental details). Example 2 – Liposome formation without cargo using extrusion or sonication Individual lipid components were dissolved in suitable solvents as specified in Table 15. The following protocol has actual amounts for preparation of 500 µl of liposome solution of composition LP1 (DOTAP:Chol:LBPA:labile PEG lipid= 50:25:20:5) in 5% glucose solution (w / w) at a total lipid concentration of 3.36 mM. Individual components such as buffer, concentrations, total volume as ZSP Ref.: 1261-2 PCT well as encapsulating agent, helper lipid, fusogenic agent, PEG lipid and stoichiometry of components can be varied. Lipid film generation was performed as described in Example 1 using the same components, amounts, and experimental conditions. Lipid film hydration: A sterile 5% glucose solution (w / w) in RNase free water (500 µl) was added to the dried film in a sterile environment. The sample was vortexed for 5 min and left to mature at room temperature for 30 min. Downsizing was achieved by extrusion or sonication as described in Example 1 above. Quality control: Dynamic light scattering was used to check the presence of particles and analyse their size distribution (Example 6 for experimental details). The lipid concentration was quantified using a variation of Cholesterol / Cholesterol Ester-Glo™ Assay (Promega J3190) (Example 28 for experimental details). Example 3 - Liposome formation with mRNA Liposomes were prepared without cargo according to protocol from example 2. Prior to transfection they were mixed with mRNA at an N / P ratio of 6:1. This ratio can be varied; and similar transfection data were obtained with a N / P ratio of 3:1. The mRNA-containing liposomes were obtained mixing a liposome composition LP1 in 5% glucose solution (w / w) with CleanCap®EGFP mRNA (5moU) (Trilink, L-7201, 996 charges) at an N / P ratio of 6:1. To this aim, EGFP mRNA (10 µl, 100 µg / ml, PBS) was added to a solution of LP1 (10.92 µl, 3.36 mM total lipid) and mixed by pipetting up and down several times. The mixture was incubated for 15 min at room temperature and diluted to the concentration needed for transfection with 5% glucose solution, i.e. 12.5 µg / ml mRNA concentration. Quality control: Dynamic light scattering was used to analyse particle size distribution (Example 6 for experimental details). The RiboGreen assay was used to assess mRNA concentration and mRNA encapsulation (Example 7 for experimental details). Example 4 – Liposome formation with guide RNA Liposomes were prepared without cargo according to the protocol described in example 2. Prior to transfection they were mixed with guide RNA mix at an N / P ratio of 8.45:1. This ratio can be varied. ZSP Ref.: 1261-2 PCT A liposome solution of composition LP1 in 5% glucose (w / w) at a total lipid concentration of 3.36 mM was prepared as described in example 2 and mixed with GFP cr guide and tracr RNA at an N / P ratio of 8.45:1. The guide RNA mix was prepared by mixing GFP cr guide 1 (0.84 µl, 100 µM, 50 charges) and tracr RNA (0.84 µl, 100 µM, 50 charges) and diluting it to 30 µl total volume using 20 mM Hepes, pH 7.5, 150 mM KCl. This mix was incubated for 15 min at 37 °C. Afterwards, 3.55 µl of this mix were mixed with LP1 solution (5 µl) by pipetting up and down and then incubated at room temperature for 30 min. It was then diluted with 5% glucose solution to the concentration needed for transfection, i.e.100 nM GFP cr guide RNA prior to transfection. Example 5 – Liposome formation with Cas9 RNP Liposomes were prepared without cargo according to the protocol described in example 2. Prior to transfection they were mixed with Cas9 protein / guide RNA complex at an N / P ratio of 9.10:1. This ratio can be varied. A liposome solution of composition LP1 in 5% glucose (w / w) at a total lipid concentration of 3.36 mM was mixed with Cas9 protein guide RNA ribonucleoprotein complex at an N / P ratio of 9.10:1. Cas9 protein guide RNA ribonucleoprotein complex was prepared by mixing GFP cr guide (0.84 µl, 100 µM, 50 negative charges), tracer RNA (0.84 µl, 100 µM, 50 negative charges) and Cas9 protein (4.29 µl, 3 mg / ml, 22 positive charges) diluting it to 30 µl total volume using 20 mM Hepes, pH 7.5, 150 mM KCl. This mix was incubated for 15 min at 37 °C. Afterwards, 3.55 µl of this mix were mixed with LP1 solution (5 µl) by pipetting up and down and then incubated at room temperature for 30 min. It was then diluted to the concentration needed for transfection, i.e.100 nM GFP cr guide RNA prior to transfection. Example 6 – Liposome size analysis by dynamic light scattering Description of method: The liposome sample (3.36 mM, 1 µl) was diluted 1:150 in the initial "preparation" buffer (e.g.5% Glucose (w / w) in RNase free water) to a total lipid concentration around 20 µM and transferred to a micro UV cuvette (Brand®, BR759200). The sample was measured with the size program of a Malvern Zetasizer Nano ZS (laser 632.8 nm) at 25°C using 173° backscatter, automatic measurement settings and 120 s preequilibration time.3 repeat measurements were conducted for each sample. Data analysis: The size Z-average, (Z-Ave), which corresponds to the liposome diameter in nm, and polydispersity index (PDI) were calculated on the basis of the light scattering data by the Malvern Zetasizer software and averaged over 3 measurements. The size distribution based on intensity, volume and number was exported as an average of 3 measurements. Distributions based on number of particles are shown in Figures 2c, h, 5c, 12c and 13c. ZSP Ref.: 1261-2 PCT Results: Size distribution of extruded siRNA- liposomes Dynamic light scattering analysis of extruded liposomes containing siRNA (prepared according to example 1) showed a narrow size distribution around 100 nm (Fig.2c). The average diameter Z-Ave was 121.3 ± 2.8 nm and the average polydispersity index was 0.123 ± 0.007 (n=6, error: SEM). siRNA-liposome size stability over time After storage at 4 °C for 9 months, and 1.6 and 2.4 years the size distribution of extruded liposomes containing siRNA (prepared according to example 1) was unchanged (Fig.2h), demonstrating high stability of the liposomal system. Size distribution of mRNA-liposomes Dynamic light scattering several hours after mixing of empty extruded liposomes with mRNA (prepared according to example 3) showed a slight shift of the size distribution towards larger sizes for extruded liposomes with mRNA compared to the same liposomes without mRNA (Fig.5c). Example 7 – RNA quantification with RiboGreen assay Description of method: The concentration and encapsulation efficiency of RNA was determined using the Quant-it™ RiboGreen RNA Assay Kit from Invitrogen™ (ThermoFisher Scientific, R11490). The assay was performed in a Nunc™ F96 MicroWell™ Black Polystyrene Plate (ThermoFisher Scientific, 237105). Each sample was assayed in triplicate both in the absence and in the presence of 0.5% Triton X. The individual samples were compared to a four-point standard curve of the same RNA with and without 0.5% Triton X. The standard curve for siRNA was recorded in the range between 10 and 50 nM, while the standard curve for mRNA was recorded in the range between 0.05 and 0.5 µg / ml. Specific example for analysis of liposomes containing 2 µM siRNA (prepared according to example 1): 3 replicates of the sample (1.5 µl) were diluted to 50 µl using Tris-HCl buffer (10 mM, 1 mM EDTA, pH 7.5), another 3 replicates were diluted to 45 µl with Tris-HCl buffer, and addition of 5 µl of a 10% triton solution in RNase free water. The standard curve samples were prepared from an siRNA aliquot with fitting volumes with the same procedure. The Quant-it™ RiboGreen RNA Reagent was warmed to room temperature and diluted 200-fold in Tris-HCl buffer. 50 µl of this solution were added to each well. The fluorescence intensity was measured using a Perkin Elmer Envision plate reader using a 492 nm excitation and a 535 nm emission filter. The gain was adjusted for each measurement. Data analysis: ZSP Ref.: 1261-2 PCT The fluorescence intensity was plotted against the RNA concentration for the standard curves with and without triton and analyzed using the software R employing a weighted linear fit. The concentration (c(RNA)) and subsequently molar amount of RNA (n(RNA)) for each well was calculated based on the extracted slope and intercept of the relevant standard curve and averaged for each condition. RNA content compared to theoretical RNA content in was quantified as follows: RNA loss compared to theoretical content is calculated as follows: is the molar amount detected in the triton treated sample, which equals the total RNA content of the sample, and ntheoreticalis the theoretical molar amount of the triton treated sample, based on the input. Encapsulation is as follows: is the molar amount detected in the triton treated sample, which equals the total RNA content of the sample after liposome lysis, triton is the molar amount detected in the untreated sample, which equals the RNA content outside the liposomes. The molar concentration of the original sample (c(RNA)) was calculated by dividing the average molar amount per well of the triton treated the sample volume VSample (1.5 µl). This value was used as the concentration of the sample for subsequent transfections. Change in concentration between two measurements (e.g. at a later timepoint) in percentage is calculated as follows: "Measurement 1" is the original measurement, "measurement 2" is the one at a later timepoint. Results: siRNA encapsulation and content of extruded siRNA liposomes Ribogreen assay shows successful binding of siRNA and average encapsulation efficiency of 97.0 ± 0.83 % at charge ratio N / P 20:1 (positive / negative) for liposomes containing siRNA prepared by extrusion according to the protocol of example 1 (n=12, error: SEM) (Fig.2d). ZSP Ref.: 1261-2 PCT Average siRNA content loss due to extrusion for samples made according to the protocol in example 1 was 14.5 ± 2.21 % (n=12, error: SEM) (Fig.2e). siRNA encapsulation and content of extruded siRNA liposomes – stability over time siRNA encapsulation efficiency of extruded liposomes made according to example 1 was unchanged after 9 months, 1.6 and 2.4 years of storage at 4°C (Fig. 2i).Also, siRNA concentration of these samples was not reduced after prolonged storage, even after 2.4 years at 4°C. (Fig.2j). siRNA encapsulation of liposomes at different N / P ratios siRNA liposomes prepared at charge ratio N / P 5:1 showed an average encapsulation efficiency of 93%, which is close to full encapsulation that can be seen at N / P ratio 20:1 (Fig.2k). By extension any N / P ratio in between or above should also lead to high encapsulation. siRNA encapsulation and content of extruded mRNA liposomes For mRNA-liposomes made according to protocol in example 3 at charge ratio 6:1 (positive / negative) around 40% of total mRNA was encapsulated while the rest was detected on the outside of the liposomes (Fig.5a). Example 8 – Cryogenic electron microscopy (EM) Description of method: Grids preparation and plunge-freezing For cryo electron microscopy aquoeous samples are cooled to cryogenic temperatures to preserve the sample in the most native state in vitreous ice by plunge freezing. Samples are spread into a thin film across an EM grid before rapidly submerging it in a cryogen, e.g. liquid ethane. A Lacey Carbon Supported Copper Grid (200 mesh) was glow-discharged for 12 s before insertion in the chamber of a plunge freezer EM GP2EM (Leica). Anti eGFP siRNA containing liposomes of composition LP1 prepared according to the protocol detailed in example 1 were diluted to a total lipid concentration of 400 µM in 20 mM TRIS, 150 mM NaCl.3 μl of this sample and 1 μl of 10 nm of gold nanoparticles suspension (BBI Solutions, EM.GC10) were added to the grid just before blotting. The plunge- freezing parameters were set to 30 °C, 99% humidity. Blotting was done on the sample-side of the grid for 1.4 s, and immediately followed by plunging in liquid ethane at -180°C. Frozen grids were preserved in liquid nitrogen. Cryo-electron imaging Transmission Electron Microscopy was done on a Titan Halo 300 kV FEG-TEM (FEI, Hillsboro, Oregon, USA) equipped with a field emission gun and an energy filter BioQuantum Model 967 from Gatan (Gatan, Pleasanton, California, USA). The images were zero loss filtered with a slit width of 20 eV and taken on a Gatan K2 summit direct detector in the counted mode. The program ZSP Ref.: 1261-2 PCT DigitalMicrograph (Gatan) was used to control the energy filter and the K2 detector. Images were taken with the program SerialEM (Mastronarde, D.N., Automated electron microscope tomography using robust prediction of specimen movements. J. Struct. Biol. (2005) 152, 36–51) at a resolution of 3710 x 3838 pixels at a magnification resulting in a pixel size of 0.31 nm. The beam intensity was set between 6 and 10 electrons per pixel per second and the overall dose per image was adjusted to the range 50 - 100 electrons per Square-Ångstrom. Instead of a single image, twenty sub frames were taken with frame times between 0.1 s and 0.25 s and aligned using K2 align software, which is based on the MotionCorr algorithm, to compensate for any drift. The sample was in a Gatan 626 Cryoholder, cooled by liquid nitrogen without counter-heating so that the final sample temperature was constant and always below -165 °C. Results: CryoEM imaging shows that liposomal structure is unilamellar and univesicular (Fig. 2a). This means that the liposomes are composed of a single membrane layer around an aqueous core, making it possible for them to fuse with other membranes such as the endosomal membrane. They are in a diameter size range around 100 nm, in accordance with the data obtained by dynamic light scattering (Fig.2c). Their morphology in solution is spherical. Example 9 – conventional electron microscopy Description of method: For siRNA-liposomes, a sample (0.5 µl) of extruded liposomes of composition LP1 containing anti eGFP siRNA (prepared according to protocol detailed in example 1) was diluted 10x with water and 5 µl of the solution were incubated for 3 min on a non-carbon coated and not glow-discharged, copper, square 400-mesh grid (Plano G2400C), coated with formvar film. For mRNA liposomes, a sample of liposomes of composition LP1 (prepared according to protocol detailed in example 2) (1 µl) was mixed mRNA solution (100 µg / ml, 1,83 µl) at charge ratio 3:1 and incubated for 15 min at room temperature (according to protocol detailed in example 3). The solution was diluted to 10 µl with 5% Glucose and incubated for 5 min at room temperature. 5 µl of the solution were incubated for 5 min on a non-carbon coated and not glow-discharged, copper, square 400-mesh grid (Plano G2400C), coated with formvar film. The grid was washed on 3 drops of water for 5 s per drop. For the first staining step, the grid was incubated on a drop of 1% sodium tungstate (Electron Microscopy Sciences 21400) in water for 2 min, followed by washing on 3 drops of water, 1 s per drop. For the second staining step, the grid was incubated with 0.1% uranyl formate (Electron Microscopy Sciences 22450) in 1.8% methyl cellulose (pH 4.5, Sigma Aldrich M6385) on 3 consecutive drops, on ice, for a total of 2 min. The grid was lifted from the last drop using a nichrome wire loop, excess uranyl formate / methyl cellulose solution was removed using a filter paper, and the grid was air dried at room temperature. The protocol was adapted from Asadi et al., 2017 (Asadi, J. et al. Enhanced imaging of lipid rich ZSP Ref.: 1261-2 PCT nanoparticles embedded in methylcellulose films for transmission electron microscopy using mixtures of heavy metals. Micron 99, 40–48 (2017)). The grid was imaged at 13,000x magnification in a Tecnai T12 transmission electron microscope (FEI, now Thermo Fisher Scientific), operated at 100 kV and equipped with an axial 2k CCD camera (TVIPS) and EM-MENU software (TVIPS). Results: Size and morphology of siRNA containing liposomes Conventional electron microscopy (EM) imaging showed the size distribution and morphology of extruded liposomes containing siRNA in fixed state (Fig.2b). During the fixation in methyl cellulose liposomes collapse onto themselves which results in a folded or donut shape. This is in accordance with literature examples of particles containing an aqueous core. Their size distribution is in accordance with data in solution obtained by dynamic light scattering (Fig.2c). Size and morphology of mRNA containing liposomes Conventional EM imaging showed the size distribution and morphology of extruded liposomes containing mRNA at charge ratio 3:1 in fixed state (Fig.5b). EM grids were prepared directly after mixing mRNA and liposomes for 15 min (preparation of mRNA containing liposomes according to protocol described in example 3). Extruded liposomes with mRNA appear to be smaller than liposomes with siRNA when embedded in methyl cellulose (Comparison Figs. 2b and 5b, Figs. 2c and 5c). Example 10 – RNase degradation assay Description of method: A 4% (w / w) suspension of NuSieve GTG agarose (FMC Bioproducts (now Lonza), 50082) in Tris- borate-EDTA buffer (TBE, 89 mM TRIS base, 89 mM boric acid, 2 mM EDTA in RNAse free water (ThermoFisher Scientific, AM9938)) was prepared. After soaking for 15 min, it was heated in a microwave at 360 W for 1 min, then kept for 15 min in a 60 °C water bath. Ethidium bromide (1 µl) was added to 27 ml of this molten solution and it was cast into a gel cast with a comb. The gel was left to set at room temperature and covered with TBE buffer afterwards. Samples were prepared using anti eGFP siRNA (c= 1.85 µM, volume (V)= 7.5 µl) or siRNA- containing, extruded liposomes of composition LP1 made by the protocol detailed in example 1 (c (siRNA)= 1.73 uM, V= 7.5 µl). The siRNA or liposome solutions and RNase A (Sigma Aldrich, R6513) stock in TBE buffer (c=0.01 mg / ml) were incubated at 37 °C for 5 min. RNase A stock solution (V= 1 µl) was added to each sample to reach a final concentration 0.001 mg / ml and followed by addition of RNase inhibitor RNaseOUTTM(ThermoFisher Scientific, 10777019, 40 U / µl, V= 1.25 µl) after the indicated time of incubation (0-60 min, 9 time points) to stop the reaction. After treatment the samples were incubated for 2 min at 37 °C, then a 10% triton X solution (V= 1 µl) was added to each sample to lyse the liposomes. After 3 min incubation at room temperature, Orange G / bromophenol blue loading buffer (0.15% (w / v) Orange G, 0.03% (w / v) bromophenol blue in ZSP Ref.: 1261-2 PCT glycerol / TBE buffer (3:2), V= 2 µl) was added and 10 µl of this solution was loaded into the gel pockets. The gel was run with 80 V for 20 min using an Amersham Pharmacia Biotech Electrophoresis Power Supply EPS 301. Imaging and data analysis: The gels were imaged using a Vilber Bio-Vision Gel Doc system with transillumination at 312 nm and an exposure of 440 ms. The images were analyzed with Fiji by creating an intensity plot for each lane with the gels submenu and calculating the area under the curve for the RNA band. The amount of RNA present in each sample relative to the starting point of the kinetic experiment was calculated by normalizing the area under the curve obtained to the one obtained for t= 0 min. Results: siRNA formulated in liposomes resulted in being protected from degradation by RNase A over time, in stark contrast to naked siRNA which was degraded within minutes at the same RNase concentration (Fig.2f, g). Example 11 – uptake of liposomes containing labeled siRNA in HeLa cells Description of method: HeLa cells stably expressing eGFP were obtained as described by Bramsen, J.B. et al. 2009 (Bramsen, J.B. et al., A large-scale chemical modification screen identifies design rules to generate siRNAs with high activity, high stability and low toxicity. Nucleic Acids Res.37, 2867–2881 (2009)). Liposomes containing Alexa 647 labeled anti eGFP siRNA made by the protocol described in example 1 were transfected in HeLa eGFP cells to assess their uptake. HeLa eGFP cells were cultured in DMEM media complemented with 10% FBS at 37 °C and 5% CO2 and seeded the day before the transfection into a black 384 well cell culture microplate (Greiner 781092) in DMEM medium with 10% FBS and 50 µg / ml gentamicin. The transfection mixes were prepared in a 96 well master plate: the liposomes were diluted to 12x the final siRNA concentration (i.e. 120 nM) in 5% glucose. Untreated control samples were prepared using only buffer. Directly before transfection, equal volume of DMEM containing 20% FBS was added to each transfection mix to have a concentration of siRNA of 6x the final concentration of the transfection and 10% FBS. 10 µl of this transfection mix was added to each well of the 384 well plate containing 50 µl of medium, resulting in a final concentration of 10 nM. Each condition was tested in quadruplicate. The plate was incubated at 37 °C and 5% CO2. After 5 h the plate was fixed with 3.7% formaldehyde in PBS for 15 min. After additional washing with PBS each well was stained with 6 µg / ml Hoechst 33342 and 0.5 µg / ml HCS CellMask™ Blue Stain (Invitrogen, H32720) in PBS containing 0.04% sodium azide. Every treatment was performed in quadruplicate. Imaging and data analysis: ZSP Ref.: 1261-2 PCT The plate was imaged at 40x magnification on a Yokogawa CellVoyager CV7000 automated laser spinning disk microscope. 4 fields per well were imaged. Images were adjusted and exported with MotionTracking (http: / / motiontracking.mpi-cbg.de). Results: Alexa 647-labeled siRNA in liposomes is taken up by HeLa cells and shows a specific vesicular pattern as expected for uptake by endocytosis (Fig.3a). No Alexa 647 uptake can be seen in untreated cells. Example 12 – transfection of HeLa eGFP cells with siRNA containing liposomes Description of method: Liposomes made by the protocol described in example 1 containing anti eGFP siRNA or AF647 labeled anti eGFP siRNA were transfected in HeLa eGFP cells to assess downregulation efficiency. The following description is for a dose response experiment with concentration points taken at 10, 5, 2.5 and 1 nM. This can be adjusted to use different concentrations, more or less points if necessary. HeLa eGFP cells (obtained as described in Bramsen, J. B. et al. (2009)) were cultured in DMEM media (ThermoFisher Scientific, 31966) complemented with 10% FBS (Merck, S0615)at 37°C and 5% CO2 and seeded the day before the transfection into a black 384 well cell culture microplate (Greiner 781092) in DMEM medium with 10% FBS and 50 µg / ml gentamicin. The transfection mixes were prepared in a 96 well master plate: the liposomes were diluted to 10x the concentration of the highest concentration point (100 nM) in the "preparation" buffer (e.g. 5% glucose). Serial dilution was performed to obtain solutions at 10x concentration for the other concentration points. Untreated control samples were prepared using only buffer. Directly before transfection, equal volume of DMEM containing 20% FBS was added to each transfection mix to have a concentration of siRNA of 5x the final concentration of the transfection and 10% FBS. 10 µl of this transfection mix was added to each well of the 384 well plate containing 40 µl of medium. Each condition was tested in quadruplicate. The plate was incubated at 37°C and 5% CO2. After 5 h, the transfection mix was washed away by replacing the medium three times with fresh DMEM and aspirating to 25 µl with a Biotek EL406 washer. Afterwards, 25 µl of DMEM containing 20% FBS and 100 µg / ml gentamicin was added. The plate was further incubated for 72 h and then fixed with 3.7% formaldehyde in PBS for 15 min. After additional washing with PBS each well was stained with 1 µg / ml DAPI (Sigma Aldrich, D9542-5MG) and 0.25 µg / ml HCS CellMask™ Blue Stain (Invitrogen, H32720) in PBS containing 0.04% sodium azide. Every treatment was performed in quadruplicate. Imaging and data analysis: The plate was imaged at 10x magnification on a Perkin Elmer Operetta high throughput microplate imager or a Yokogawa CellVoyager CV7000 automated laser spinning disk microscope.9 fields per ZSP Ref.: 1261-2 PCT well were imaged. The nuclei and cells were segmented based on the DAPI / CMB staining and the mean GFP intensity for each nucleus was recorded. The nuclei number in percentage was calculated as follows: The number of nuclei per image was summed up per well and then averaged per condition. This value was normalized to the value calculated in the same way from the untreated control wells. The GFP intensity in percentage was calculated as follows: Median of the mean GFP intensity per nucleus or per cell was calculated per image, averaged per well and averaged per condition. This value was normalized to the value calculated in the same way from the untreated control wells. The analysis was conducted using Perkin Elmer Harmony software or CellProfiler for segmentation and parameter extraction and Knime Analytics platform for calculation, averaging and normalization. The calculation for the single cell distribution plot of percentage GFP intensity was performed as follows: The mean GFP intensity per nucleus was normalized to the median value of GFP intensity per nucleus of the untreated condition. The percentage was rounded up to the next integer number for each nucleus. For each condition (treatment, concentration) the occurrence of nuclei for each GFP intensity value was counted per well and then averaged over the quadruplicate repeats. The difference in normalized GFP intensity and nuclei number for different N / P ratios was calculated as follows: The GFP intensity or nuclei number in percentage for a specific N / P ratio at a specific concentration was calculated as above. Then the value of N / P ratio 20:1 at this concentration was subtracted the initial value. EC50 / TC50 calculation EC50 and TC50 values for 4 and 10 concentration datasets were calculated by fitting a 4-parameter logistic equation to the GFP intensity and nuclei number normalized to untreated control in response to siRNA concentration respectively. Calculations were done using Knime Analytics platform. The lower limit was constrained to 100%, while the lower limit was left unconstraint for GFP intensity and set to 0 for Nuclei number. Fits were scored as non-applicable if the lower limit was estimated to be above 40% or below -10%. The therapeutic index is defined as the ratio between TC50 and EC50, as previously described in section "Therapeutic agents". Scoring Calculated based on result at dose 10 nM, if not stated otherwise. ZSP Ref.: 1261-2 PCT Toxicity scoring: Score Nuclei number normalized to untreated - > 80% † 60-80% †† 40-60% ††† 20-40% †††† < 20% Effect scoring to distinguish between non-working preparations (following toxicity or no effect) and low-working preparations (knock down (KD) effect visible, but fitting not possible): Score (Normalized GFP intensity) / (Normalized Nuclei number) KD < 0.8 no KD > 0.8 Results: siRNA downregulation with liposomes The treatment of HeLa eGFP cells with 10 nM eGFP anti siRNA in LP1 liposomes caused 80% downregulation of eGFP intensity compared to untreated control, while treatment with the same concentration of naked siRNA showed no effect (Fig 3b). Dependence of siRNA downregulation efficiency of liposomes on both active agents To show that the functionality of the invention depends on the specific combination of the active agents as contained in the inventive liposome composition, i.e. on the combination of a fusogenic agent with an acid-cleavable PEG lipid, liposomes were prepared in which each of the active agents was replaced with a non-active form and compared with those comprising both active agents. The anti eGFP siRNA- liposomes were prepared according to the protocol in example 1. The non- fusogenic liposome sample was prepared by replacing the fusogenic agent LBPA in the composition LP1 with the non-fusogenic lipid DOPC. The non-acid cleavable sample was prepared by replacing the acid-cleavable PEG lipid in the composition LP1 with the non-acid cleavable PEG lipid DSPE- PEG2000. The downregulation of eGFP in HeLa eGFP cells transfected with formulations without active agents or comprising only one active agent was compared to the formulation containing both active agents (LP1). The downregulation effect was only successful if both active agents were present. Indeed compositions comprising only the non-fusogenic lipid or only the non-acid cleavable lipid as active agent did not show any eGFP downregulation (Fig.3c). These results show that both active agents in the liposomal system have a surprising synergistic effect on inducing endosomal escape and efficient siRNA delivery. Dose dependence of eGFP downregulation with siRNA-liposomes (four concentrations) ZSP Ref.: 1261-2 PCT Testing the effect of liposomes containing siRNA against eGFP made by the protocol detailed in example 1 at different siRNA concentrations (10, 5, 2.5 and 0.5 nM) showed that the downregulation effect was dose dependent (Fig.3d). A single cell analysis of distribution of mean GFP intensity per nucleus in the dose dependent experiment (Fig 3e) showed that the untreated control has a very wide distribution of mean eGFP intensities per nucleus. A clear, dose-dependent shift is visible with anti eGFP siRNA-liposome treatment, culminating in a narrow distribution around 20% of the median of the untreated condition at 10 nM dose. This indicates that GFP downregulation is achieved in the majority of treated cells. Dose dependence of siRNA downregulation with liposomes containing different LBPA isomers siRNA-LP1 liposomes containing one of the main isomer forms of LBPA, 2,2’-S,S and 3,3’-S,S, were prepared according to the protocol in Example 1. These liposome compositions showed same dose response in eGFP downregulation (Fig.3f) and same low toxicity response (Fig.3g). The EC50 for downregulation (determined from four point curve) was very similar: 2,2’-S,S-LBPA containing liposomes showed EC502.34 ± 0.18 nM, 3,3’-S,S-LBPA containing liposomes showed EC502.50 ± 0.35 nM. Effectiveness of delivery system does not depend on a specific LBPA isomer. Dose dependency of GFP downregulation with siRNA liposomes (10 concentrations) To explore the dose dependency of siRNA-mediated downregulation with liposomes of composition LP1 made by the protocol detailed in example 1 in greater detail, a dose response curve with 10 concentration points was explored. This allows for a more exact calculation of the effect (EC50) and toxic (TC50) concentration (Fig. 3h). By fitting a four-parameter log-logistics model, these values were calculated as being EC50: 0.93 nM, and TC50: 19.44 nM. Therefore, therapeutic index (TC50 / EC50): 21. Reproducibility of dose dependent siRNA mediated downregulation with liposomes siRNA mediated downregulation at four concentrations using liposomes of composition LP1 containing 2,2’-LBPA as fusogenic agent prepared according to the protocol detailed in example 1 was shown to be reproducible over a large number of repeated experiments (Fig. 3i). The toxicity profile was reproducible as well (Fig.3j). Effect of liposome storage on siRNA mediated downregulation. Extruded siRNA liposomes of composition LP1 prepared according to the protocol detailed in example 1 were tested for downregulation efficiency at four concentrations directly after formation as well as after 9 months, 1.6 and 2.4 years of storage at 4°C. The downregulation profile resulted in a similar curve showing that liposomes with siRNA are stable over years without losing efficiency of downregulation (Fig.3k). ZSP Ref.: 1261-2 PCT Stability of siRNA containing liposomes towards serum Transfection is often done in serum free conditions to increase success rates. In contrast, all the experiments herein were performed within serum presence to be closer to in vivo conditions. Therefore, to check the stability of siRNA liposomes towards serum exposure, LP1 liposomes prepared according to the protocol detailed in example 1 were pretreated with serum for 5 h at room temperature. Their dose-dependent siRNA downregulation and toxicity was compared with a sample of the same liposome batch that was not pretreated with serum (Fig. 3l). No difference in downregulation efficiency (eGFP intensity) or toxicity profile (number of nuclei) could be observed indicating that downregulation efficiency of siRNA in liposomes is stable towards prolonged serum exposition (Fig.3l). Example 13 – Variation of chemical composition of the identified siRNA delivery system Different compositional variations of anti eGFP siRNA-containing liposomes made by the protocol detailed in example 1 were prepared and tested for their downregulation efficiency and toxicity in HeLa eGFP cells at different siRNA concentrations according to experimental procedure described in example 12. In vitro parameters (size, stability, encapsulation and siRNA content) were analyzed for each liposome composition variation with the techniques detailed in examples 6 and 7. Results from the different compositions are detailed in the following paragraphs. 1. Stoichiometry variation The percentage of each compound in the composition LP1 was varied resulting in 20 different liposome composition variations. Each of these liposome compositions was tested at 4 siRNA concentrations (Table 2, Fig. 7b, only 10 nM siRNA dose shown). Effective compositions were identified by the GFP downregulation assay in HeLa eGFP cells as having the following percentage ranges for each component: DOTAP: 30-75% Cholesterol: 0-35% LBPA: 15-30% or 45% for cholesterol = 0% Labile PEG lipid: 1-10% 2. Variation of helper lipid The helper lipid cholesterol in formulation LP1 was replaced with similar compounds or delivery enhancers, which structures are shown in the section "Chemical Structures" (identified by the protocol detailed in example 25) generating 14 liposome composition variations. Each of these liposome variations was tested for knock down of eGFP in HeLa eGFP cells at 4 siRNA concentrations (table 3). The three compounds solasodine, ceramide, and diosgenin showed a similar effect as cholesterol in this composition (Fig.7c). ZSP Ref.: 1261-2 PCT 3. LBPA isomer and isoform variation 6 LBPA isoforms and four structurally similar molecules were explored in the formulation LP1 (table 4). The resulting liposome composition variations were tested in HeLa eGFP cells at 4 siRNA concentrations each. Several LBPA isomers show a similar activity: in addition to 2,2’-S,S and 3,3’- S,S isomers (Fig.3f,g) five more isomers or isoforms were showing a similar effect (3,3’-R,S, 3,3’- R,R, 2,2’-S,S with 18:0 or 12:0 fatty acids and hemi-LBPA (3 fatty acids)) (Fig.7d). 4. Encapsulating agent variation PD740 was tested as encapsulating agent. PD740 (N-[3-(Hexadecan-1-sulfonylamino)propionyl]-4- (R)-(aminoethyl)-L -prolyl-S-farnesyl-L -cysteine methyl ester) has been first synthetized by Biel et al. 2006 as a single isomer (Biel et al. Synthesis and Evaluation of Acyl Protein Thioesterase 1 (APT1) Inhibitors. Chem. Eur. J. 2006, 12, 4121 - 4143). It was tested by Gilleron et al. for siRNA transfection and identified as a delivery enhancer (Gilleron, J. et al. Identification of siRNA delivery enhancers by a chemical library screen. Nucleic Acids Res. 2015, 43, 7984–8001). PD740 was custom synthetized to prepare the inventive liposomes, obtaining PD740 as mixture of isomers of different ratios, which all had the same effect, so that the particular isomer ratio has not influence on the liposome drug delivery efficiency. DOTAP in formulation LP1 was replaced with 12 different cationic agents or ionizable lipids, and the resulting liposome compositions were tested in HeLa cells at 4 siRNA concentrations (Table 5). One drug binding agent, PD740 showed increased activity at lower concentration (composition LP2 (see Table 1)) (Fig. 7e). Two other cationic lipids, DOMA and DOTMA, showed a similar activity profile as DOTAP (Fig.7e). Another cationic lipid, EPC 18:1, shows downregulation activity, but at a lower EC50. Variation of PD740 percentage As liposomes with PD740 were identified as being more active than those with DOTAP as a encapsulating agent in the same composition, different variations of LP2 composition were explored using varying percentages of PD740 and mixtures of PD740 and DOTAP. 9 liposome composition variations were tested using HeLa eGFP knock down assay at 4 siRNA concentrations (Table 6, Fig. 7f, 7g). The composition LP3 containing equal amounts of PD740 and DOTAP showed an even higher effect than composition LP2 (Fig. 7f). The composition LP4 containing a lower amount of PD740 showed a similar efficiency profile as composition LP2, while exhibiting a decreased toxicity effect (Fig.7f,g). The most effective compositions LP1, LP2, LP3 and LP4 were further explored with a 10- concentration dose response experiment using lower siRNA concentrations to be able to extract both EC50 and TC50 values with higher accuracy (Table 7). Composition LP3 was confirmed as the most ZSP Ref.: 1261-2 PCT effective, while composition LP4 was slightly less effective, but showed lower toxicity (Fig. 7h,i) confirming the results of Fig.7f,g. Variation of N / P ratio All previous data were obtained with liposomes containing siRNA at an N / P ratio of 20:1. To explore the scope of possible N / P ratios for the delivery system, liposome formulations of composition LP1 containing siRNA against eGFP were also prepared at charge ratios 40:1, 10:1 and 5:1. The encapsulation of siRNA was 93% at N / P 5:1 (see example 7 and Fig.2k), leading to the conclusion that any higher charge ratio will lead to an encapsulation above this value, close to 100%. eGFP downregulation with these liposomes was tested at 4 concentrations in HeLa eGFP cells. The GFP intensity and nuclei number were calculated as difference to the same formulation at N / P ratio 20:1 by subtracting the value for the N / P = 20:1 control formulation from the one obtained at the same concentration for the specific formulation in the same experiment. This leads to negative values if the percentage was lower and positive values if it was higher. At concentration 10 nM all N / P ratios showed a similar downregulation result. At lower concentrations the 5:1 formulation was less effective, while the 40:1 is more effective. At the lowest concentration tested (1 nM) the downregulation result was again close to within error for all ratios tested (Fig.7j). The toxicity of all preparations is within error for all N / P ratios tested (Fig.7k). Screening of potential fusogenic agents To show that other fusogenic agents than LBPA can be used to reach the same effect, LBPA in siRNA containing liposomes of composition LP3 was replaced with different fusogenic agents. The 14 resulting liposome variations were tested each at 10 siRNA concentrations for their GFP downregulation efficiency and toxicity in HeLa eGFP cells (Table 8). The compounds used were identified from literature as either being fusogenic or being lipids that prefer hexagonal or cubic phase packing. Liposome variations with MGDG and PLPE showed the same efficiency in downregulation as those with LBPA (Fig.8a). Liposomes containing PLPE showed a similar toxicity profile as LP3 composition with LBPA, while liposomes containing MGDG were less toxic (Fig. 8b). Liposomes containing GMO, IsostA, and POPE showed an activity comparable to composition LP1 (Fig.8c), with higher or comparable toxicity (Fig.8d). These results show that other compounds can be used as fusogenic agents for the developed delivery system. Combination of different fusogenic agents with LBPA in the same composition Four liposome composition variations of LP3 containing both LBPA and an additional active fusogenic agent were tested at 10 siRNA concentrations in HeLa eGFP (Table 9). The downregulation efficiency of liposome compositions with MGDG and PLPE was comparable to LP3, while compositions with GMO and isostearic acid were lower in efficiency (Fig. 8e). All ZSP Ref.: 1261-2 PCT compositions tested show a similar toxicity profile (Fig.8f). These results suggest that the effect in HeLa cannot be boosted by a fusogenic agent combination, but is also not decreased. Example 14 – uptake of liposomes containing labeled siRNA in primary bone marrow derived mouse macrophages Description of method: Murine Macrophage Purification from Bone Marrow Homogeneous population of quiescent murine monocytes were derived from bone marrow protocol to seed them in 38 multi well plates (Greiner 781092). Briefly, femurs and tibia from C57Bl6 mouse strain were extracted from the mouse after euthanasia following cervical dislocation. The bones were mechanically cleaned from contaminating tissues and resuspended in cold PBS. Samples were transferred to a sterile laminar flow hood for extraction of bone marrow and purification of the relevant cell type. Always working on ice, the cleaned bones were cut at both ends using a surgical scalpel. Using a 10 cc syringe with a 25 Gauge needle filled with 3 ml of cold PBS, the bone marrow was flushed in an empty 50 ml tube (Corning, 430829) until the cavity of the bone resulted empty. The process was repeated with each available bone, and at the end the cell suspension was disaggregated by continuous pipetting using a 5 ml pipette (Sarstedt, 86.1253.001). The cell suspension was passed through a wet 40 micron sieve (Falcon, 352340) to filter out big tissue clumps, and the filter was washed with cold PBS. The tube was centrifuged at 300xg for 10 minutes on a tabletop centrifuge (Beckman Coultr, Allegra X-22R), and after the centrifugation the supernatant was removed and the cellular pellet was resuspended in PBS, 0.5%BSA, 2mM EDTA. The viable cell number of the complex mixture was determined using the Luna2 automated cell counter. A volume containing a total of 5x107cells was then transferred to an empty 15 ml tube and the cell suspension was centrifuged at 300xg for 10 minutes, after which the supernatant was completely aspirated, being careful not to disrupt the cell pellet, which was then resuspended in 350 microliters of PBS, 0.5% BSA, 2mM EDTA. A Mouse Monocyte isolation kit (Miltenyi, 130-091- 153) was used to purify the monocytes: 25 microliters of FCR Blocking reagent was added to the cell suspension, followed by addition of 50 microliters of Monocyte-Biotin antibody cocktail. The suspension was then incubated for 5 minutes on ice, after which 10 ml of cold PBS, 0.5%BSA, 2mM EDTA was added to the mix. Suspension was then centrifuged at 300xg for 10 minutes, supernatant was discarded and the pellet was again resuspended in 400 µl of PBS, 0.5% BSA, 2mM EDTA.100 µl of AntiBiotin Cocktail solution was added to the suspension and incubated for 10 minutes on ice. During this incubation, LS columns (Miltenyi Biotec, 130-042-401) were assembled on a MACS magnetic stand (Miltenyi Biotec, 130-042-303) and rinsed with 3 ml of cold PBS, 0.5% BSA, 2 mM EDTA to drip in an empty beaker. Upon the end of the drip, the beaker was substituted with an empty 15 ml falcon tube on ice. Cell suspension was applied to the column, and the column was washed 3 times with 3 ml of PBS, 0.5% BSA, 2 mM EDTA collecting the flow through. This cell suspension ZSP Ref.: 1261-2 PCT was again centrifuged at 300xg, supernatant discarded and pellet resuspended in 2 ml of PBS, 0.5% BSA, 2 mM EDTA. After evaluation of cell number using the LUNA2 automated cell counter, an appropriate number of cells were resuspended in DMEM / F12 (Gibco, 21331-020), 10% FBS (GE Healthcare, A15-102), 50 µg / ml of Gentamicin and 10 ng / ml of macrophage colony-stimulating factor MCSF (Peprotech, 315-02-100UG) to differentiate the monocytes into mouse macrophages (MM): typically MM cells were seeded and cultured at 37 °C and 5% CO2 in 384 well format , using 15,000 cells per well, in 50 microliters of medium. Assessment of uptake of liposomes LP1-liposomes containing Alexa 647 labeled siRNA made by the protocol described in example 1 were transfected in MM in 384 well format to assess their uptake. Prior to transfection, MM were cultured for at least 5 days in DMEM / F1210% FBS, 50 µg / ml of gentamicin, 10 ng / ml of MCSF into a black 384 well cell culture microplate (Greiner 781092). The transfection mixes were prepared in a 96 well master plate: the liposomes were diluted to 10x the siRNA concentration of the final concentration (5 nM) in 5% glucose. Untreated control samples were prepared using only buffer. Directly before transfection, equal volume of DMEM containing 20% FBS was added to each transfection mix to have a concentration of siRNA of 5x the final concentration for the transfection and 10% FBS.10 µl of this transfection mix was added to each well of the 384 well plate containing 40 µl of medium, resulting in a final concentration of 5 nM. Each condition was typically tested in quadruplicate. The plate was cultured at 37 °C and 5% CO2. After 5 h the plate was washed with PBS using the automated PowerWasher cell washer (TECAN) and fixed with 3.7% formaldehyde in PBS for 15 min. After additional washing with PBS each well was stained with 1 µg / ml DAPI (SIGMA, D9542-5MG) and 0.25 µg / ml HCS CellMask™ Blue Stain (Invitrogen, H32720) in PBS containing 0.02% sodium azide. Every treatment was performed in quadruplicate. Imaging and data analysis: The plate was imaged at 40x magnification on a Yokogawa CellVoyager CV7000 automated laser spinning disk microscope. 4 fields per well were imaged. Images were adjusted and exported with MotionTracking (http: / / motiontracking.mpi-cbg.de). Results: MM were incubated with Alexa 647-labeled siRNA formulated in LP1-liposomes. Internalization of labelled siRNA visualized by confocal microscopy yielded a specific vesicular pattern as expected for uptake by endocytosis (Fig.4a). No aspecific signal could be seen in the 647 channel in untreated cells. Example 15 – transfection of bone marrow derived macrophages from LifeAct eGFP mice with siRNA containing liposomes ZSP Ref.: 1261-2 PCT Description of method Isolation of primary cells Primary mouse macrophages (MM) cells were isolated from a mouse strain expressing the LifeAct reporter: the procedure for isolations and differentiation is as described in example14. The transfections were routinely made in 384 well formats, using 15,000 cells per well. Transfection Liposomes containing anti eGFP siRNA or A647 labeled anti eGFP siRNAmade by the protocol described in example 1 were transfected in MM from LifeAct reporter mouse to assess eGFP downregulation efficiency. The following description is for a dose response experiment with concentration points taken at 20, 10, 5, 1 and 0.1 nM. This can be adjusted to use different concentrations, more or less points if necessary. The transfection mixes were prepared in a 96 well master plate: the liposomes were diluted to 10x the concentration of the highest concentration point (100 nM) in the same buffer used for liposome preparation (e.g.5% glucose). A serial dilution was performed using automated multichannel pipettes (Eppendorf) to obtain solutions at 10x concentration for the other concentration points. Untreated control samples were prepared using only buffer. Directly before transfection, equal volume of DMEM / F12 containing 20% FBS and 20 ng / ml of MCSF was added to each transfection mix to have a concentration of siRNA of 5x the final concentration of the transfection and 10% FBS. 10 µl of this transfection mix was added to each well of the 384 well plate containing 40 µl of medium. Each condition was tested in quadruplicate. The plate was further cultured for 72 h and then fixed with 3.7% formaldehyde in PBS for 15 min. After additional washing with PBS each well was stained with 1 µg / ml DAPI and 0.25 µg / ml HCS CellMask™ Blue Stain in PBS containing 0.02% sodium azide. Every treatment was performed in quadruplicate. Imaging and data analysis was performed as described in Example 12, except that 9 fields per well were recorded with the Perkin Elmer Operetta high throughput microplate imager and 4 fields per well, sufficient to cover >90% of the well, were recorded with the Yokogawa Cell Voyager CV7000 automated laser spinning disk microscope. EC50 / TC50 calculation EC50 and TC50 values for 4 and 10 siRNA concentration datasets were calculated by fitting a 4- parameter logistic equation to the GFP intensity and nuclei number normalized to untreated control in response to siRNA concentration as described in example 12. For the 4 and 10 concentration datasets in macrophages only the GFP intensity data could be fitted, as mainly non-toxic concentrations were explored. ZSP Ref.: 1261-2 PCT Scoring Scoring of toxicity and effect was done as described in example 12. Results: siRNA downregulation with liposomes MM isolated from a LifeAct-eGFP reporter mouse were incubated with various anti eGFP siRNA concentrations (1-20 nM) formulated in LP1 liposomes made according to protocol in example 1 for 5 hours. Downregulation of eGFP was determined by confocal microscopy imaging and quantitative image analysis as described above. Downregulation of eGFP intensity compared to untreated control increase in response to siRNA concentration, reaching value of 70% eGFP downregulation at of 20 nM, while no evident effect on cell viability as determined by the number of nuclei was detected (Fig 4c). Dose dependency of siRNA downregulation with liposomes (10 concentrations) To explore the dose dependency of siRNA downregulation with liposomes of composition LP1 made by the protocol detailed in example 1 in greater detail, a dose response curve with 10 concentration points was conducted. This allowed for a more exact calculation of the effect and toxic concentration (Fig.4d). By fitting a four-parameter log-logistics model, the half maximal effective concentration (EC50) was calculated to be 6.37 nM. It was not possible to calculate the half maximal toxic concentration from this experiment as the fitting was not applicable. Toxicity would need to be explored at higher concentrations. Reproducibility of dose dependent GFP downregulation and toxicity profile mediated by siRNA in liposomes Downregulation by siRNA at four concentrations in liposomes of composition LP1 containing 3,3’- LBPA as the fusogenic agent and prepared according to the protocol detailed in example 1 was shown to be reproducible over a large number of repeated experiments (Fig. 4e). The toxicity profile was reproducible as well (Fig.4f). Example 16 – Variation of chemical composition of the identified siRNA delivery system in MM 20 liposome composition variations of initial compositions LP1 and LP3 previously tested on HeLa cells (datasets from tables 7-9, using PD740 and DOTAP as encapsulating agents, and other potential fusogenic compounds to replace LBPA or in combination with LBPA) were tested on bone-marrow derived macrophages from LifeAct eGFP mice at 10 concentrations to compare efficiency profiles (Tables 10, 11, 12). The different composition variations of anti eGFP siRNA-containing liposomes were made by the protocol detailed in example 1 and tested for their downregulation efficiency and toxicity in HeLa eGFP cells at different siRNA concentrations prior to testing on macrophages ZSP Ref.: 1261-2 PCT (example 13). In vitro parameters (size, stability, encapsulation and siRNA content) were analyzed for each liposome variation with the techniques detailed in examples 6 and 7. Results obtained with the different liposome compositions are detailed in the following paragraphs. Encapsulating agent variation Similar as in HeLa cells, composition LP3 showed a higher downregulation (KD) efficiency and statistically significant lower EC50 than formulation LP1. The difference between the values is not as pronounced as in HeLa cells. Formulation LP4 is significantly less active in macrophages than in HeLa (Fig.9a, Table 10). Generalization of fusogenic agent concept Replacement of LBPA in formulation LP3 with different fusogenic agents leads to a different downregulation efficiency in macrophages. Compositions with MGDG and PLPE that showed similar activity as LP3 with LBPA for HeLa transfection showed reduced activity compared to LP3 or no activity in mouse macrophages. Compositions with POPE, which in HeLa showed a reduced activity compared to LP3, showed a similar effect as LP3 in macrophages (Fig.9 b, Table 11). Combination of different fusogenic agents with LBPA in the same composition In contrast to the result in HeLa, combinations of LBPA with an additional fusogenic agent within LP3 formulation had increased downregulation activity compared to LP3 (containing only LBPA) as showed by a significantly lower EC50 (Fig.9c, Table 12). Conclusion: The efficiency of different compositions resulted to be cell type specific. Composition LP3 showed increased GFPdownregulation efficiency in response to siRNA compared to LP1 in macrophages, but different fusogenic agents showed a different effect in macrophages compared to HeLa cells. A combination of LBPA with an additional fusogenic agent can boost the efficiency of LP3 in macrophages, but not in HeLa cells. Example 17 – transfection of primary hepatocytes from LifeAct eGFP mice with siRNA containing liposomes Description of method Hepatocyte isolation Primary mouse hepatocytes were isolated from LifeAct eGFP mice via collagenase perfusion using a previously described protocol. Mice were anaesthetized using i.p. injection with Ketamin:Rompun (1.6:1) and fixed unto a sterile surface. The abdominal wall was opened to expose the organs and intestine and fat tissue are moved to expose the venae cavae and the hepatic portal vein. A needle (20G x 1 ½’’, 0.9x40 mm, not sharpt) attached to a peristaltic pump was inserted into the venae ZSP Ref.: 1261-2 PCT cavae, running with a flow rate of 10 ml / min, and the hepatic portal vein was cut to drain solutions. The liver was rinsed for 10 min with EGTA buffer (0.19 g / l EGTA, 0.04 M NaOH, 5.67 g / l glucose, 6.10 g / l NaCl, 0.18 g / l KCl, 0.16 g / l KH2PO4, 6.10 g / l HEPES, 0.07 g / l glutamine, 0.04 g / l L-alanine, 0.02 g / l L-aspartic acid, 0.06 g / l asparagine, 0.04 g / l citrulline, 0.02 g / l L-cysteine, 0.15 g / l L- histidine, 0.15 g / l L-glutamic acid, 0.15 g / l glycine, 0.06 g / l L-isoleucine, 0.12 g / l L-leucine, 0.20 g / l L-lysine, 0.08 g / l L-methionine, 0.10 g / l L-ornithine, 0.08 g / l L-phenylalanine, 0.08 g / l L-proline, 0.10 g / l L-serine, 0.20 g / l L-threonine, 0.10 g / l L-tryptophan, 0.08 g / l L-tyrosine, 0.12 g / l L-valine). The solution was switched to collagenase (0.35 g / l collagenase (1-2.5 U / ml) in collagenase buffer (5.46 g / l glucose, 5.87 g / l NaCl, 0.17 g / l KCl, 0.16 g / l KH2PO4, 5.87 g / l HEPES, 0.07 g / l glutamine, 0.74 g / l CaCl2, 0.04 g / l L-alanine, 0.02 g / l L-aspartic acid, 0.06 g / l asparagine, 0.04 g / l citrulline, 0.02 g / l L-cysteine, 0.15 g / l L-histidine, 0.15 g / l L-glutamic acid, 0.15 g / l glycine, 0.06 g / l L- isoleucine, 0.12 g / l L-leucine, 0.20 g / l L-lysine, 0.08 g / l L-methionine, 0.10 g / l L-ornithine, 0.08 g / l L-phenylalanine, 0.08 g / l L-proline, 0.10 g / l L-serine, 0.20 g / l L-threonine, 0.10 g / l L-tryptophan, 0.08 g / l L-tyrosine, 0.12 g / l L-valine)) and perfused for 8 min. After the perfusion the liver was removed from the animal and put into 15 ml suspension buffer (5.63 g / l glucose, 6.05 g / l NaCl, 0.18 g / l KCl, 0.16 g / l KH2PO4, 6.05 g / l HEPES, 0.07 g / l glutamine, 0.15 g / l CaCl2, 0.10 g / l MgSO4, 0.04 g / l L-alanine, 0.02 g / l L-aspartic acid, 0.06 g / l asparagine, 0.04 g / l citrulline, 0.02 g / l L-cysteine, 0.15 g / l L-histidine, 0.15 g / l L-glutamic acid, 0.15 g / l glycine, 0.06 g / l L-isoleucine, 0.12 g / l L- leucine, 0.20 g / l L-lysine, 0.08 g / l L-methionine, 0.10 g / l L-ornithine, 0.08 g / l L-phenylalanine, 0.08 g / l L-proline, 0.10 g / l L-serine, 0.20 g / l L-threonine, 0.10 g / l L-tryptophan, 0.08 g / l L-tyrosine, 0.12 g / l L-valine). Hepatocytes were extracted from the liver tissue using forceps. The cell suspension was filtered though a cell strainer (100µm pore size) and diluted to 50 ml with suspension buffer. The cells were pelleted by centrifugation at 4 °C with 50xg for 5 ml and the pellet was washed with 50 ml suspension buffer and recentrifuged before being resuspended in 10 ml suspension buffer by gentle inversion. Hepatocyte plating Cells were plated into 96 well plates (Greiner 655090) precoated with collagen using a previously published protocol. Rat tail collagen (10 mg, Roche 11179179001) was dissolved in sterile 0.2% acetic acid (10 ml) and incubated at 4 °C for at least 6 h, this solution was diluted to a concentration of 0.9 mg / ml in 10x DMEM and the pH was adjusted to 7.4. The collagen bottom layer was added to the wells by adding 25 µl of this solution and letting it polymerize at 37°C for 1h before adding 150 µl Williams E medium (Pan Biotech P04-29150), substituted with 10% FBS (Pan Biotech P40- 37500), 100 nM dexamethasone (Sigma D4902-500MG) and penicillin / streptomycin (Gibco 15140- 122). The medium was removed and replaced by cell solution containing 30,000 cells per well. Cells were incubated for 1,5 h at 37°C in an atmosphere with 5% CO2 atmosphere for attachment, washed two times with PBS and 90 µl Williams E medium was added. ZSP Ref.: 1261-2 PCT Hepatocyte transfection siRNA liposomes of composition LP1 containing anti eGFP siRNA prepared to protocol described in example 1 were diluted to 10x the desired concentration for transfection in a master plate and 10 µl of this solution was added to each well. The plate was incubated for 5 h, washed with PBS and a second collagen layer was added on top by adding 50 µl of 0.6 mg / ml collagen solution. The plate was incubated for 1 h at 37 °C before 150 µl of Williams E medium was added on top. The plate was incubated for 3 d at 37 °C and the medium was replaced with fresh medium each day. For fixation medium is removed and 100 µl of 3.7% formaldehyde solution is added and incubated at room temperature for 15 min. The plate is washed three times with PBS and stained with 1 µg / ml DAPI (SIGMA, D9542-5MG) and 0.5 µg / ml HCS CellMask™ Blue Stain (Invitrogen, H32720) in PBS containing 0.02% sodium azide. Imaging and data analysis: The plate was imaged with 10x magnification on a Yokogawa CellVoyager CV7000 automated laser spinning disk microscope (6 fields per well). The cell area was masked based on the DAPI / CMB staining and the total GFP intensity normalized by masked area for each image was analyzed. The GFP intensity in percentage was calculated as follows: The mean GFP intensity per well was averaged per condition. This value was normalized to the value calculated the same way from the untreated control wells. The analysis was conducted using MotionTracking software (http: / / motiontracking.mpi-cbg.de, Collinet, C. et al., Systems survey of endocytosis by multiparametric image analysis. Nature 464, 243–249 (2010)) for segmentation, parameter extraction, averaging and normalization. Results: Primary hepatocytes isolated from a LifeAct-eGFP reporter mouse were incubated with various concentrations (0.1-20 nM) of siRNA against eGFP formulated in liposomes of composition LP1 made according to protocol in example 1 for 5 hours. Downregulation of eGFP was determined by confocal microscopy imaging and quantitative image analysis as previously described (Fig. 4g). Increasing concentrations of liposome-siRNA caused up to 97% downregulation of eGFP intensity compared to untreated control, while it had limited effect on cell viability as determined by the number of nuclei (Fig 4h). Example 18 – transfection of HeLa cells with mRNA containing liposomes Description of method Liposomes were made by the protocol described in example 3 containing an mRNA coding for eGFP fluorescent reporter (TriLink Biotechnologies, L-7201) and were used to transfect HeLa cells, (Accession: CVCL_1922, https: / / www.cellosaurus.org / CVCL_1922) (2000 cells / well in a 384 well ZSP Ref.: 1261-2 PCT plate) to assess the ability to induce expression of the fluorescent reporter, as monitored by automated microscopy. The cells were plated and cultured as in example 12. The following description is for a dose response experiment with concentration points ranging from 1.25 µg / ml to 0.039 µg / ml This can be adjusted to use different concentrations, more or less points if necessary. Liposomes containing mRNA were prepared (e.g.5% glucose) at the highest concentration necessary for transfection as described in example 3 using a lipid to mRNA ratio of 6:1. Serial dilution was performed using automated multichannel pipettes (Eppendorf) to obtain solutions at 10x concentration for the other concentration points. Untreated control samples were prepared using only buffer. Directly before transfection, equal volume of DMEM containing 20% FBS was added to each transfection mix to have a concentration of mRNA of 5x the final concentration of the transfection and 10% FBS.10 µl of this transfection mix was added to each well of the 384 well plate containing 40 µl of medium. Each condition was tested in quadruplicate. The plate was further cultured for 24 hours and then fixed with 3.7% formaldehyde for 15 min. After additional washing with PBS each well was stained with 1 µg / ml DAPI and 0.25 µg / ml HCS CellMask™ Blue Stain in PBS containing 0.02% sodium azide. Every treatment was performed in quadruplicate. Imaging and data analysis: The plate was imaged with 10x magnification on a Yokogawa CellVoyager CV7000 automated laser spinning disk microscope.4 fields per well were imaged. The nuclei and cells were segmented based on the DAPI / CMB staining and the mean GFP intensity for each nucleus was recorded. The total cell number in percentage was calculated as follows: The number of nuclei per image was summed up per well and then averaged per condition. This value was normalized to the value calculated the same way from the untreated control wells and multiplied by 100. The GFP intensity was calculated as follows: Median of the mean GFP intensity per nucleus or per cell was calculated per image, averaged per well and averaged per condition. Additionally, the number of cells expressing GFP was calculated from single cell data, utilizing a threshold evaluated on the comparison of the distribution of the value of the mean intensity of eGFP in the untreated cells and cells transfected with the eGFP mRNA. The threshold was chosen in order to exclude false positives due to cell autofluorescence: cells having values of mean eGFP fluorescence above that threshold were considered as GFP positive, while cells below were considered GFP negative. For each well, the number of cells that were evaluated as positives was counted and the percentage of GFP expressing cells was evaluated calculating the ratio of these positive cells and the total number of cells per condition, and multiplying it by 100. ZSP Ref.: 1261-2 PCT The analysis was conducted using CellProfiler for segmentation and parameter extraction and Knime Analytics platform for calculation, averaging and normalization. Results: Liposomes of composition LP1 carrying eGFP mRNA can induce eGFP expression in HeLa cells at a low charge ratio of 6:1 (positive / negative) in a dose-dependent manner within 24 h. Over 90% of all cells were GFP positive by using liposomes with eGFP mRNA at a dose of 0.31 µg / ml without toxicity (Fig. 5d, e). A similar result can be obtained at a charge ratio of 3:1 (Fig.5f). Comparing a wider range of N / P ratios ranging between 1:1 and 20:1 showed that similar number of cells can be transfected at the same concentration with any ratio above 3:1 (Fig.5h), the highest eGFP expression at the same concentration can be reached with 3:1 ratio. Both the lower and higher ratios show lower expression (Fig. 5g). Toxicity for all N / P ratios above 3:1 was similar and is lower for the less effective N / P ratio 1:1 (Fig.5i). Exploration of chemical space of the identified delivery system for mRNA delivery Different liposomal compositions were tested for their transfection efficiency of mRNA in HeLa cells and compared with the initial composition LP1. Compositions containing varying amounts of solasodine showed a similar response in terms of total cell number expressing eGFP at a specific mRNA concentration (Fig. 12a). In terms of eGFP intensity, solasodine containing compositions show slightly increased expression levels in one out of three experiments (Fig. 12b). Compositions LP3 and LP4 (the most effective compositions for siRNA delivery in HeLa cells and primary macrophages (see figure 7h, 7i and 9a; Tables 7 and 10)) did not result to be the most effective for mRNA delivery. mRNA containing LP3 showed a similar effect as mRNA containing LP1, while mRNA containing LP4 was much less effective (Fig.12c,d). Both showed higher toxicity at concentrations 0.3125 and 0.625 µg / ml compared to LP1 (Fig.12e). Compositions with MGDG and PLPE (combining PD740, DOTAP and MGDG / PLPE as fusogenic agents) were among the most effective compositions for siRNA delivery and GFP downregulation in HeLa and primary macrophages (see Fig. 8e,f and 9b, Tables 8 and 11). For mRNA delivery in HeLa cells they showed a response at much lower concentration than the original composition LP1, reaching most cells already at the lowest concentration tested (Fig. 12f). GFP expression intensity was also increased at the lowest concentration (Fig 12g). Toxicity levels were within the error range of the treatment with LP1 and not as pronounced as for treatment with LP3 (same formulation except LBPA as fusogenic agent) (Fig. 12h). These compositions were also tested at lower concentrations to see full dose response curve. These experiments confirmed that by using LP-MGDG and LP-PLPE compositions for mRNA delivery more cells were reached and GFP expression was higher at lower concentrations of mRNA compared to composition LP1 (Fig.12i,j). ZSP Ref.: 1261-2 PCT Example 19 – transfection of primary bone marrow derived mouse macrophages with mRNA containing liposomes Description of method Isolation of primary cells Primary MM cells were isolated from wild type C57Bl6 mouse strain. The procedure for isolations and differentiation is as described in example 14. The transfections were routinely made in 384 well formats, using 15,000 cells per well and 4 replicates for each condition Transfection Liposomes complexed with an mRNA coding for fluorescent reporter eGFP (as described in example 3) were transfected in MM to assess the ability to induce expression of the fluorescent reporter, which was monitored by automated microscopy. Transfection of MM cells with mRNA containing liposomes was performed as described in Example 18 for Hela cells. Imaging and data analysis was performed as described in Example 18. Results: eGFP expression in primary bone marrow-derived mouse macrophages after delivery of eGFP mRNA in liposomes at a charge ratio of 6:1 is dose-dependent with the majority of cells expressing eGFP at a dose of 1.25 µg / ml after 24 h without toxic effects (Fig. 5j,k). ). Liposome mRNA complexes at a charge ratio of 3:1 also show downregulation, albeit with lower efficiency, reaching 60% of cells at a dose of 1.25 µg / ml and showing lower fluorescence intensity (Fig.5l). Example 20 – transfection of primary mouse hepatocytes with mRNA containing liposomes Description of method Hepatocyte isolation and plating Primary mouse hepatocytes were isolated from wild type C57Bl6 mice via collagenase perfusion and plated as described in example 17. Hepatocyte transfection Liposomes prepared as in example 2 were complexed with an mRNA coding for eGFP (as described in example 3) at ratio N / P 3:1 were transfected into hepatocytes to assess the ability to induce expression of the fluorescent reporter. The following description is for a dose response experiment with concentrations ranging from 2,5 to 0,3125 µg / ml. Liposome mRNA complexes were diluted to 10x the desired concentration for transfection in a master plate and 10 µl of this solution was added to each well of a 96-well plate containing 90 µl of cells in Williams E medium. The plate was incubated for 5 h, washed with PBS and a second collagen layer was added on top by adding 50 µl ZSP Ref.: 1261-2 PCT of 0.6 mg / ml collagen solution. The plate was incubated for 1 h at 37 °C before 150 µl of Williams E medium was added on top. The plate was incubated for 24 h at 37 °C before removing the medium and adding 100 µl of 3.7% formaldehyde solution for fixation. The plate was incubated at room temperature for 15 min. The plate was washed three times with PBS and stained with 1 µg / ml DAPI (SIGMA, D9542-5MG) and 0,5 µg / ml HCS CellMask™ Blue Stain (Invitrogen, H32720) in PBS containing 0.02% sodium azide. Imaging and data analysis: The plate was imaged with 40x magnification on a Yokogawa CellVoyager CV7000 automated laser spinning disk microscope (9 fields per well). The cell area was masked based on the DAPI / CMB staining and the total GFP intensity normalized by masked area for each image was analyzed. The GFP intensity in percentage was calculated as follows: The mean GFP intensity per well was averaged per condition. The value was substracted with the mean GFP intensity calculated the same way for untreated conditions (background). The analysis was conducted using MotionTracking software (http: / / motiontracking.mpi-cbg.de) for segmentation, parameter extraction, averaging and normalization. Results: eGFP expression in primary hepatocytes could be generated using eGFP mRNA liposomes at N / P ratio 3:1 and was dose dependent (Fig.5m,n). Example 21 – transfection of HeLa eGFP cells with CRISPR Cas9 RNP containing liposomes Description of method Liposomes were complexed with CRISPR Cas9 ribonucleoprotein complex as described in example 5 and transfected in HeLa eGFP cells to assess their ability to induce sequence specific editing of eGFP: the functional result of the sequence specific gene editing would be the lack of eGFP expression, which is evaluated by automated microscopy. Complex Cas9 / guide formation The first step in the process is the preparation of the complex between the guide / tracer and a recombinant CAS9 protein. The recombinant Cas9 protein (https: / / www.uniprot.org / uniprotkb / Q99ZW2 / entry) was obtained from the Protein Expression, Purification and Characterization (PEPC) facility of the MPI-CBG, where the protein is available in aliquots of 10µl, at the concentration of 5 mg / ml. A custom designed guide sequence against eGFP (target sequence: GGAGCGCACCATCTTCTTCA, SEQ ID NO 5) and tracr RNA were purchased from IDT (Table 14) and are available as a 100 µM stock. ZSP Ref.: 1261-2 PCT A typical complexing reaction was performed in a total volume of 35 µL, mixing 3 µL of Cas9 protein, 32 µL of protein buffer (20 mM Hepes, pH 7.5, 150 mM KCl), 0.98 µL of GFP cr guide RNA and 0.98 µL of tracr RNA for 15 minutes at 37°C. The resulting concentration of the GFP cr guide RNA in the complexing solution is 2.8 µM. Transfection of liposome-RNP complex The ribonucleic protein complex (RNP) was then incubated with liposomes as in example 5. The transfection mixes were prepared in a 96 well master plate: the complexes were diluted to 10x the concentration of the highest concentration point (100 nM) of GFP cr guide RNA in the preparation buffer (e.g.5% glucose). The following description is for a dose response experiment with GFP cr guide RNA concentrations of 10, 5, 2.5, 1 and 0.1 nM. HeLa eGFP cells were cultured in DMEM media complemented with 10% FBS at 37 °C and 5% CO2 and seeded the day before the transfection into a black 384 well cell culture microplate (Greiner 781092) in DMEM medium with 10% FBS and 50 µg / ml gentamicin. Serial dilution of liposome composition and cell transfection were performed as described in Example 12. Imaging was performed using a Yokogawa CellVoyager CV7000 automated laser spinning disk microscope as described in Example 12, but imaging only 4 fields per well. Data analysis was performed using CellProfiler for segmentation and parameter extraction and Knime analytics platform for calculation, averaging and normalization as described in Example 12. Results: Using liposomes of composition LP1 loaded with Cas9 ribonucleoprotein with guide RNA mix containing GFP cr guide RNA and tracr RNA at charge ratio 9.10:1 downregulation of eGFP intensity to 20% of expression compared to untreated control is possible at 2.5 nM RNA concentration with low toxicity. Increased toxicity is observed at higher concentrations (Fig. 6a). Lowering the charge ratio to 5,46:1 shows a similar result both for downregulation and toxicity response (Fig.6b,c). Example 22 – transfection of HeLa eGFP cells with guide RNA containing liposomes Description of method Liposomes made by the protocol described in example 4 were transfected in HeLa eGFP cells to assess their ability to induce sequence specific editing of eGFP: the functional result of the gene editing would be the lack of eGFP expression evaluated with automated microscopy. Differently from Example 21 the Cas9 protein is not delivered by the liposomes, but is independently delivered by infection of the Hela cells with a BACMAM virus containing an orf for it.The BACMAM virus was produced by the Protein Expression and Purification (PEPC) facility of the MPI-CBG. ZSP Ref.: 1261-2 PCT Guide complex formation The first step in the process is the preparation of the cr guide / tracr RNA complex as species of RNA to be transfected in cells infected with a BACMAM virus containing Cas9. A custom designed guide sequence against eGFP (GFP cr guide RNA, target sequence: GGAGCGCACCATCTTCTTCA) and tracr RNA were purchased from IDT and are available as a 100 µM stock. A typical complexing reaction was performed in a total volume of 30 µL, using 28.32 µL of 20 mM Hepes, pH 7.5, 150 mM KCl, 0.84 µL of GFP cr guide RNA and 0.84 µL of tracr RNA for 15 minutes at 37°C. The resulting concentration of the GFP cr guide RNA in the complexing solution is 2.8 µM. Transfection of guide RNA liposomes The guide RNA complex was then incubated with liposomes prepared by the protocol detailed in example 2 as described in example 4. The transfection mixes were prepared in a 96 well master plate: the complexes were diluted to 10x the concentration of the highest concentration point (100 nM) in the buffer that they were prepared in (e.g.5% glucose). For Cas9 expression HeLa eGFP cells were mixed with 0.71 µl of BACMAM virus solution per 1000 cells during seeding. Seeding, culture and transfection of Hela eGFP cells as well as imaging and data analysis were performed in Example 21. Results: After testing the delivery of the Cas9 protein and guide RNA mix together in form of the Cas9-guide RNA ribonucleoprotein complex (Example 21), this Example aims to determine the delivery of guide RNA mix alone into HeLa eGFP cells that were expressing the Cas9 protein. Cas9 protein was expressed in these cells prior to transfection using a BacMam system. Different liposome compositions were tested using a charge ratio of 8.45:1 which corresponds to the same amount of guide RNA mix as for the delivery of Cas9 RNP at charge ratio 9.10:1 (as used in Fig.6a). Both isoforms of LBPA in composition LP1 showed similar activity for knock out of eGFP in response to RNA concentration. A similar level could also be reached using composition LP4, while replacing the encapsulating agent for EPC 18:1 resulted in a slightly lower efficiency (Fig.6d). Toxicity was comparable for both LBPA isoforms and EPC 18:1, while it was increased for composition LP4 (Fig.6e). Toxicity is decreased compared to transfection of Cas9 RNP at the same concentration (see Fig.6 a). Using a lower charge ratio of 5.07:1 for transfection with guide RNA mix and liposomes of composition LP1 results in a similar dose response both for eGFP reduction as well as for toxicity (Fig.6f,g). Example 23 – Galectin recruitment Description of method ZSP Ref.: 1261-2 PCT Following method is to investigate the question if the liposomal delivery system causes endosomal damage by disrupting endosomal membranes during the escape process using galectin recruitment assay similar to a previous report. HeLa eGFP cells (Bramsen, J. B. et al., 2009) were cultured DMEM media complemented with 10% FBS at 37 °C and 5% CO2. The cells were seeded at the density of 600cells / 40ul / well into a black 384 well cell culture microplate (Greiner 781092) in DMEM medium with 10% FBS and 50 µg / ml gentamicin. GFP-Galectin 8 plasmid (Galectin 8 / LGALS8 cDNA ORF Clone, Human, C-GFPSpark® tag, SinoBiological HG10301-ACG) and lipofectamine 3000 were prepared in OptiMEM at 10x the final concentration and mixed in a 1:1 ratio via pipetting to reach 5x the final concentration. The transfection mix was incubated at room temperature for 15 min and 10 µl were added to each well of cells containing 40 µl total volume. The final concentrations were 10 ng / well for the Galectin plasmid and 0.1 µl / well for lipofectamine. The cells were incubated for 72h at 37 °C and 5% CO2 before being washed with BioTek EL406 washer using serum medium for 2 cycles. In each cycle, the medium was aspirated to 20 µl and 90 µl of medium was added. For final aspiration, the me...
Claims
ZSP Ref.: 1261-2 PCT Claims 1. A composition comprising (a) a therapeutic agent or a pharmaceutically acceptable salt thereof; (b) a PEG-monoorthoester-lipid; (c) an amphiphilic lipid; (d) a cationic lipid and / or a beta-alanyl-prolyl-cysteine methyl ester; and optionally (e) a steroid and / or a ceramide and / or DOPE.
2. The composition according to claim 1, wherein the composition is a liposome composition, preferably wherein the liposome is a unilamellar and / or univesicular liposome.
3. The composition according to any one of claims 1 or 2, wherein the therapeutic agent or pharmaceutically acceptable salt thereof (a) is encapsulated by the mixture comprising of (b), (c), (d) and (e) if (e) is part of said composition.
4. The composition according to any one of claims 1 to 3, wherein the PEG-monoorthoester-lipid hydrolyses at a pH of 6 or less, preferably wherein said orthoester bond hydrolyses at a pH of between pH 5 and pH 6.
5. The composition according to any one of the preceding claims comprising (a) a therapeutic agent or a pharmaceutically acceptable salt thereof; (b) a PEG-monoorthoester-lipid; (c) an amphiphilic lipid; (d) a cationic lipid or a beta-alanyl-prolyl-cysteine methyl ester; and (e) a steroid, and preferably cholesterol.
6. The composition according to any one of the claims 1 to 4 comprising (a) a therapeutic agent or a pharmaceutically acceptable salt thereof; (b) a PEG-monoorthoester-lipid; (c) an amphiphilic lipid; (d) a cationic lipid and a beta-alanyl-prolyl-cysteine methyl ester; and (e) a steroid, and preferably cholesterol.
7. The composition according to any one of the claims 1 to 4 comprising (a) a therapeutic agent or a pharmaceutically acceptable salt thereof; (b) a PEG-monoorthoester-lipid; (c) an amphiphilic lipid; (d) a cationic lipid and / or beta-alanyl-prolyl-cysteine methyl ester; andZSP Ref.: 1261-2 PCT (e) a steroid and a ceramide.
8. The composition according to any one of the claims 1 to 4 comprising (a) a therapeutic agent or a pharmaceutically acceptable salt thereof, wherein the therapeutic agent is mRNA; (b) a PEG-monoorthoester-lipid; (c) an amphiphilic lipid; (d) a cationic lipid and / or a beta-alanyl-prolyl-cysteine methyl ester; and (e) cholesterol.
9. The composition according to any one of claims 1 to 4, wherein said composition does not comprise a steroid, and preferably does not comprise cholesterol.
10. The composition according to any of the preceding claims, wherein the compound (d) is selected from the group consisting of 1,2-dialkanyloxy-3-trialkylammonium propane halide, 1,2- dialkenyloxy-3-trialkylammonium propane halide, 1,2-dialkanoyloxy-3-trialkylammonium propane halide, 1,2-dialkenoyloxy-3-trialkylammonium propane halide, tetraalkylammonium halide, 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine, and / or is a lipidated polypeptide PD740.
11. The composition according to any of the preceding claims, wherein the compound (d) is selected from the group consisting of 1,2-di-C12-C20 alkanyloxy-3-tri-C1-C6 alkylammonium propane halide, 1,2-di-C12-C20 alkenyloxy-3-tri-C1-C6 alkylammonium propane halide, 1,2-di-C12-C20 alkenoyloxy-3-tri-C1-C6 alkylammonium propane halide, di-C12-C20 alkyl di-C1-C6 alkyl ammonium halide, and / or is a lipidated polypeptide PD740.
12. The composition according to any one of the preceding claims, wherein the compound (d) is selected from the group consisting of 1,2-didodecyloxy-3-trimethylammonium propane chloride, 1,2-ditridecyloxy-3-trimethylammonium propane chloride, 1,2-ditetradecyloxy-3- trimethylammonium propane chloride, 1,2-dipentadecyloxy-3-trimethylammonium propane chloride, 1,2-dihexadecyloxy-3-trimethylammonium propane chloride, 1,2-diheptadecyloxy-3- trimethylammonium propane chloride, 1,2-dioctadecyloxy-3-trimethylammonium propane chloride, 1,2-dinonadecyloxy-3-trimethylammonium propane chloride, 1,2-diicosyloxy-3- trimethylammonium propane chloride, 1,2-didodecenyloxy-3-trimethylammonium propane chloride, 1,2-ditridecenyloxy-3-trimethylammonium propane chloride, 1,2-ditetradecenyloxy- 3-trimethylammonium propane chloride, 1,2-dipentadecenyloxy-3-trimethylammonium propane chloride, 1,2-dihexadecenyloxy-3-trimethylammonium propane chloride, 1,2-ZSP Ref.: 1261-2 PCT diheptadecenyloxy-3-trimethylammonium propane chloride, 1,2-dioctadecenyloxy-3- trimethylammonium propane chloride, 1,2-dinonadecenyloxy-3-trimethylammonium propane chloride, 1,2-diicosenyloxy-3-trimethylammonium propane chloride, 1,2-dilauroleoyloxy-3- trimethylammonium propane chloride, 1,2-dimyristoleoyloxy-3-trimethylammonium propane chloride, 1,2-dipalmitoleoyloxy-3-trimethylammonium propane chloride, 1,2- dipetroseloyloxy-3-trimethylammonium propane chloride, 1,2-dipetroselaidoyloxy-3- trimethylammonium propane chloride, 1,2-dioleoylloxy-3-trimethylammonium propane chloride, 1,2-dielaidoyloxy-3-trimethylammonium propane chloride, 1,2-divaccenoyloxy-3- trimethylammonium propane chloride, 1,2-digadoleoyloxy-3-trimethylammonium propane chloride, dimethyldidodecylammonium bromide, dimethylditridecylammonium bromide, dimethylditetradecylammonium bromide, dimethyldipentadecylammonium bromide, dimethyldihexadecylammonium bromide, dimethyldiheptadecylammonium bromide, dimethyldioctadecylammonium bromide, dimethyldinonadecylammonium bromide, and dimethyldiicosylammonium bromide, and / or is a lipidated polypeptide PD740.
13. The composition according to any one of the preceding claims, wherein the compound (d) is selected from the group consisting of 1,2-di-O-octadecenyl-3-trimethylammonium propane chloride, dimethyldioctadecylammonium bromide, and 1,2-dioleoyl-3-trimethylammonium propane chloride, and / or is a lipidated polypeptide PD740. and preferably wherein the compound (d) is 1,2-dioleoyl-3-trimethylammonium propane chloride and / or a lipidated polypeptide PD740.
14. The composition according to any one of the preceding claims, wherein the beta-alanyl-prolyl- cysteine methyl ester is a lipidated polypeptide, and preferably wherein the beta-alanyl-prolyl-cysteine methyl ester is or comprises N-[3- (Hexadecan-1-sulfonylamino)propionyl]-4-(R)-(aminoethyl)-L-prolyl-S-farnesyl-L-cysteine methyl ester (PD740).
15. The composition according to any one of the preceding claims, wherein the compound in (d) is selected from the group consisting of N-[3-(Hexadecan-1-sulfonylamino)propionyl]-4-(R)- (aminoethyl)-L-prolyl-S-farnesyl-L-cysteine methyl ester (PD740), 2,3-bis[[(Z)-octadec-9- enoyl]oxy]propyl-trimethylazanium (DOTAP), dioctadecyldimethylammonium bromide (DOMA), 1,2-di-O-octadecenyl-3-trimethylammonium propane (chloride salt) (DOTMA), 1,2- dioleoyl-sn-glycero-3-ethylphosphocholine (EPC 18:1), and mixtures thereof.
16. The composition according to any one of the preceding claims, wherein the compound in (d) is 2,3-bis[[(Z)-octadec-9-enoyl]oxy]propyl-trimethylazanium (DOTAP) and / or beta-alanyl-ZSP Ref.: 1261-2 PCT prolyl-cysteine methyl ester N-[3-(Hexadecan-1-sulfonylamino)propionyl]-4-(R)- (aminoethyl)-L-prolyl-S-farnesyl-L-cysteine methyl ester (PD740).
17. The composition according to any one of the preceding claims, wherein the PEG- monoorthoester-lipid comprises a polyethylene glycol conjugated with a C12-C20 alkyl, or with a C12-C20 acyl, or with a mono-C12-C20 acylglycerol, or with a di-C12-C20 acylglycerol, or wherein said PEG-monoorthoester lipid has the following structure:wherein n is an integer between 35 and 120 and wherein m is an integer between 10 and 27; and preferably wherein n is an integer between 40 and 110 and m is an integer of between 15 and 23.
18. The composition according to any one of claims 1-16, wherein said PEG-monoorthoester lipid has the following structure:wherein n is an integer between 20 and 200 and wherein m is an integer between 10 and 27; and preferably wherein n is an integer between 100 and 120; and preferably wherein the composition comprises as component (e) cholesterol.
19. The composition according to any one of the preceding claims, wherein the PEG- monoorthoester-lipid is selected from the group consisting of: N-(2-methyl-2-dodecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2- tridecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2-tetradecyloxy- [1,3]dioxan-5-yl)-amido-polyethyleneglycol, N-(2-methyl-2-pentadecyloxy-[1,3]dioxan-5-yl)- amido-polyethyleneglycol, N-(2-methyl-2-hexadecyloxy-[1,3]dioxan-5-yl)-amido- polyethyleneglycol, N-(2-methyl-2-heptadecyloxy-[1,3]dioxan-5-yl)-amido- polyethyleneglycol, N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol (PEGOEC18), N-(2-methyl-2-nonadecyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol, and N-(2-methyl-2-icosyloxy-[1,3]dioxan-5-yl)-amido-polyethyleneglycol.
20. The composition according to any one of the preceding claims, wherein the PEG- monoorthoester-lipid comprises polyethylene glycol having a number average molar mass Mn comprised between 400 and 5000 Da.ZSP Ref.: 1261-2 PCT 21. The composition according to any one of the preceding claims, wherein the PEG- monoorthoester-lipid is N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido- polyethyleneglycol (PEGOEC18), and preferably α-methoxy-ω-{N-(2-methyl-2-octadecyloxy- [1,3]dioxan-5-yl)-amido}-polyethylene glycol45.
22. The composition according to any one of the preceding claims, wherein the amphiphilic lipid is selected from the group consisting of a glycolipid, a phosphatidylethanolamine, a phosphatidylglycerol, a fatty acid, and a fatty acid ester.
23. The composition according to claim 22, wherein the amphiphilic lipid is a galactolipid, preferably an unsaturated monogalactosyldiacylglycerol.
24. The composition according to claim 22, wherein the amphiphilic lipid is a 1,2-diacyl-sn- glycero-3-phosphoethanolamine or an N-acyl-1,2-diacyl-sn-glycero-3-phosphoethanolamine.
25. The composition according to claim 22, wherein the amphiphilic lipid is a phosphatidylethanolamine selected from the group consisting of 1,2-dimyristoyl-sn-glycero-3- phosphoethanolamine, 1,2-dipentadecanoyl-sn-glycero-3-phosphoethanolamine, 1,2- dipalmitoyl-sn-glycero-3-phosphoethanolamine, 1,2-dimargaroyl-sn-glycero-3- phosphoethanolamine, 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dipalmitoleoyl- sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine, 1,2- dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3- phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2- diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-dierucoyl-sn-glycero-3- phosphoethanolamine, 1-pentadecanoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2-linoleoyl-sn- glycero-3-phosphoethanolamine, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine, 1- stearoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2- docosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1-stearoyl-2-linoleoyl-sn-glycero-3- phosphoethanolamine, 1-stearoyl-2-arachidonoyl-sn-glycero-3-phosphoethanolamine, 1- stearoyl-2-docosahexaenoyl-sn-glycero-3-phosphoethanolamine, and N-palmitoyl-1,2- dipalmitoyl-sn-glycero-3-phosphoethanolamine.
26. The composition according to claim 22, wherein the amphiphilic lipid is a phosphatidylglycerol selected from the group consisting of bis(monoacylglycerol)phosphate, 3-acylglycero-1-ZSP Ref.: 1261-2 PCT phospho-3'-(1',2'-diacyl)-glycerol, 3-acylglycero-1-phospho-glycerol, and 1,2-diacylglycero-3- phospho-glycerol.
27. The composition according to claim 26, wherein the amphiphilic lipid is a bis(monoacylglycerol)phosphate selected from the group consisting of 2,2'-S,S- bis(monoacylglycerol)phosphate, 3,3'-S,S-bis(monoacylglycerol)phosphate, 3,3'-R,R- bis(monoacylglycerol)phosphate, 3,3'-R,S-bis(monoacylglycerol)phosphate, S,R-Hemi, S,S- 2,2'-C18:0-ether-LBPA and S,S-2,2'-C12:0-ether-LBPA.
28. The composition according to claim 26, wherein the amphiphilic lipid is a bis(monoacylglycerol)phosphate selected from the group consisting of bis(monododecylglycerol)phosphate, bis(monotridecylglycerol)phosphate, bis(monotetradecylglycerol)phosphate, bis(monopentadecylglycerol)phosphate, bis(monohexadecylglycerol)phosphate, bis(monoheptadecylglycerol)phosphate, bis(monooctadecylglycerol)phosphate, bis(monononadecylglycerol)phosphate, bis(monoicosylglycerol)phosphate, bis(monolauroleoylglycerol)phosphate, bis(monomyristoleoylglycerol)phosphate, bis(monopalmitoleoylglycerol)phosphate, bis(monopetroseloylglycerol)phosphate, bis(monopetroselaidoylglycerol)phosphate, bis(monooleoylglycerol)phosphate, bis(monoelaidoylglycerol)phosphate, bis(monovaccenoylglycerol)phosphate, and bis(monogadoleoylglycerol)phosphate.
29. The composition according to claim 26, wherein the amphiphilic lipid is a 3-acylglycero-1- phospho-3'-(1',2'-diacyl)-glycerol selected from the group consisting of 3-dodecylglycero-1- phospho-3'-(1',2'-didodecyl)-glycerol, 3-tridecylglycero-1-phospho-3'-(1',2'-ditridecyl)- glycerol, 3-tetradecylglycero-1-phospho-3'-(1',2'-ditetradecyl)-glycerol, 3-pentadecylglycero- 1-phospho-3'-(1',2'-dipentadecyl)-glycerol, 3-hexadecylglycero-1-phospho-3'-(1',2'- dihexadecyl)-glycerol, 3-heptadecylglycero-1-phospho-3'-(1',2'-diheptadecyl)-glycerol, 3- octadecylglycero-1-phospho-3'-(1',2'-dioctadecyl)-glycerol, 3-nonadecylglycero-1-phospho-3'- (1',2'-dinonadecyl)-glycerol, 3-icosylglycero-1-phospho-3'-(1',2'-diicosyl)-glycerol, 3- lauroleoylglycero-1-phospho-3'-(1',2'-dilauroleoyl)-glycerol, 3-myristoleoylglycero-1- phospho-3'-(1',2'-dimyristoleoyl)-glycerol, 3-palmitoleoylglycero-1-phospho-3'-(1',2'- dpalmitoleoyl)-glycerol, 3-petroseloylglycero-1-phospho-3'-(1',2'-dipetroseloyl)-glycerol, 3- petroselaidoylglycero-1-phospho-3'-(1',2'-dipetroselaidoyl)-glycerol, 3-oleoylglycero-1- phospho-3'-(1',2'-dioleoyl)-glycerol, 3-elaidoylglycero-1-phospho-3'-(1',2'-dielaidoyl)- glycerol, 3-vaccenoylglycero-1-phospho-3'-(1',2'-divaccenoyl)-glycerol, and 3- gadoleoylglycero-1-phospho-3'-(1',2'-digadoleoyl)-glycerol.ZSP Ref.: 1261-2 PCT 30. The composition according to claim 26, wherein the amphiphilic lipid is a 3-acylglycero-1- phospho-glycerol selected from the group consisting of 3-dodecylglycero-1-phospho-glycerol, 3-tridecylglycero-1-phospho-glycerol, 3-tetradecylglycero-1-phospho-glycerol, 3-pentadecylglycero-1-phospho-glycerol, 3- hexadecylglycero-1-phospho-glycerol, 3-heptadecylglycero-1-phospho-glycerol, 3- octadecylglycero-1-phospho-glycerol, 3-nonadecylglycero-1-phospho-glycerol, 3- icosylglycero-1-phospho-glycerol, 3-lauroleoylglycero-1-phospho-glycerol, 3- myristoleoylglycero-1-phospho-glycerol, 3-palmitoleoylglycero-1-phospho-glycerol, 3- petroseloylglycero-1-phospho-glycerol, 3-petroselaidoylglycero-1-phospho-glycerol, 3- oleoylglycero-1-phospho-glycerol, 3-elaidoylglycero-1-phospho-glycerol, 3-vaccenoylglycero-1-phospho-glycerol, and 3-gadoleoylglycero-1-phospho-glycerol.
31. The composition according to claim 26, wherein the amphiphilic lipid is a 1,2-diacylglycero-3- phospho-glycerol selected from the group consisting of 1,2-didodecylglycero-3-phospho- glycerol, 1,2-ditridecylglycero-3-phospho-glycerol, 1,2-ditetradecylglycero-3-phospho- glycerol, 1,2-dipentadecylglycero-3-phospho-glycerol, 1,2-dihexadecylglycero-3-phospho- glycerol, 1,2-diheptadecylglycero-3-phospho-glycerol, 1,2-dioctadecylglycero-3-phospho- glycerol, 1,2-dinonadecylglycero-3-phospho-glycerol, 1,2-diicosylglycero-3-phospho-glycerol, 1,2-dilauroleoylglycero-3-phospho-glycerol, 1,2-dimyristoleoylglycero-3-phospho-glycerol, 1,2-dipalmitoleoylglycero-3-phospho-glycerol, 1,2-dipetroseloylglycero-3-phospho-glycerol, 1,2-dipetroselaidoylglycero-3-phospho-glycerol, 1,2-dioleoylglycero-3-phospho-glycerol, 1,2- dielaidoylglycero-3-phospho-glycerol, 1,2-divaccenoylglycero-3-phospho-glycerol, and 1,2- digadoleoylglycero-3-phospho-glycerol.
32. The composition according to claim 22, wherein the amphiphilic lipid is a fatty acid selected from the group consisting of myristic acid, pentadecanoic acid, palmitic acid, margaric acid, stearic acid, isostearic acid, nonadecylic acid, arachidic acid, myristoleic acid, palmitoleic acid, sapienic acid, oleic acid, elaidic acid, vaccenic acid, and linoleic acid; or a methyl ester or a glyceryl ester of one of the aforementioned fatty acids.
33. The composition according to any one of the claims 1 to 32, wherein the amphiphilic lipid is selected from the group consisting of monogalactosyldilinolenoylglycerol, 1-palmitoyl-2- linoleoyl-sn-glycero-3-phosphoethanolamine, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine, N-palmitoyl-1,2-dipalmitoyl-sn- glycero-3-phosphoethanolamine, 2,2'-S,S-bis(monododecylglycerol)phosphate, 3,3'-S,S- bis(monododecylglycerol)phosphate, 3,3'-R,R-bis(monododecylglycerol)phosphate, 3,3'-R,S- bis(monododecylglycerol)phosphate, 2,2'-S,S-bis(monooctadecylglycerol)phosphate, 3,3'-S,S- bis(monooctadecylglycerol)phosphate, 3,3'-R,R-bis(monooctadecylglycerol)phosphate, 3,3'-ZSP Ref.: 1261-2 PCT R,S-bis(monooctadecylglycerol)phosphate, 2,2'-S,S-bis(monooleoylglycerol)phosphate, 3,3'- S,S-bis(monooleoylglycerol)phosphate, 3,3'-R,R-bis(monooleoylglycerol)phosphate, 3,3'-R,S- bis(monooleoylglycerol)phosphate, 3-dodecylglycero-1-phospho-3'-(1',2'-didodecyl)-glycerol, 3-octadecylglycero-1-phospho-3'-(1',2'-dioctadecyl)-glycerol, 3-oleoylglycero-1-phospho-3'- (1',2'-dioleoyl)-glycerol, glyceryl monoloeate, methyl oleate, isotearic acid, palmitoleic acid, and oleic acid.
34. The composition according to claim 22, wherein the amphiphilic lipid is selected from the group consisting of (S,S) Bisoleoyl-lysobisphosphatidic acid (LBPA), monogalactosyldiacylglycerol (MGDG), 1-palmitoyl-2-linoleoyl-sn-glycero-3-phosphoethanolamine (PLPE), isostearic acid (IsostA), glycerol mono oleate (GMO), 1-palmitoyl-2-oleoyl-sn-glycero-3- phosphoethanolamine (POPE), N-Palmitoyl phosphatidylethanolamine 16:0 (NPPE), N- acylphosphatidylethanolamine 12:0 (NAPE), methyl oleate (MO), palmitoleic acid (PalmA), oleic acid (OIA), or mixtures thereof, and even more preferably wherein the amphiphilic lipid is or comprises LBPA.
35. The composition according to claim 34, wherein LBPA is selected from the group consisting of 3,3'-R,S-LBPA, 3,3'-R,R-LBPA, S,S-2,2'-C18:0-ether-LBPA, S,R-Hemi-LBPA, S,S-2,2'- C12:0-ether-LBPA, 3,3'-C16:0-LBPA, sn-[2,3-dioleoyl]-glycerol-1-phospho-sn-1’-[2’,3’- dioleoyl]-glycerol (S,S-BDP), 18:1 (Δ9-Cis)PG 1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac- glycerol) (DOPG), 1-oleoyl-2-hydroxy-sn-glycero-3-phospho-(1'-rac-glycerol) (lysoPG) and 3,3'-C14:0-LBPA.
36. The composition according to any of the preceding claims, wherein the composition comprises (e) a steroid and / or a ceramide selected from the group consisting of cholesterol, solasodine, ceramide, diosgenin, DOPE, sphingomyelin, and mixtures thereof, preferably selected from the group consisting of cholesterol, diosgenin, solasodine, ceramide, and mixtures thereof, more preferably selected from the group consisting of cholesterol, solasodine and a mixture thereof.
37. The composition according to any one of the preceding claims, wherein the composition comprises: iv) between 2.5 and 35 mol percent of at least one neutral lipid, wherein said mol percent is calculated taking the total moles of all components except component (a) that are comprised in said composition as 100%.ZSP Ref.: 1261-2 PCT 38. The composition according to any one of the preceding claims, wherein the composition comprises: iv) between 2.5 and 35 mol percent of at least one neutral lipid selected from the group consisting of cholesterol, diosgenin, solasodine, and ceramide, wherein said mol percent is calculated taking the total moles of all components except component (a) that are comprised in said composition as 100%.
39. The composition according to any one of the preceding claims, wherein the therapeutic agent is selected from the group consisting of a drug, a protein, a peptide, a gene, an oligonucleotide, a compound, an antibody, a nanobody, a nucleic acid, a ribonucleoprotein, a small molecule, a non- lipinski molecule, a biomimetic, or a natural compound.
40. The composition according to any one of the preceding claims, wherein the therapeutic agent is a CRISPR / CAS9 ribonucleoprotein, a CRISPR guide RNA or a CRISPR associated Cas protein.
41. The drug delivery system according to any one of the claims 1 to 39, wherein the therapeutic agent is a nucleic acid selected from the group consisting of ssDNA, dsDNA, ssRNA, dsRNA, aiRNA, miRNA, siRNA, piRNA, sdRNA, snRNA, snoRNA, PAR, tsRNA, endo-siRNA, MSY- RNA, tel-sRNA, crasiRNA, moRNA, xiRNA, lncRNA, ncRNA, circRNA, mRNA, sgRNA, crRNA, tracr RNA, guide RNA mix, self-amplifying RNA, ribozymes, and antisense oligonucleotides.
42. The composition according to any one of the claims 1 to 39, wherein the therapeutic agent is selected from the group consisting of a CRISPR / CAS9 ribonucleoprotein, a siRNA, a mRNA, a guide RNA mix or a protein.
43. The composition according to any one of the preceding claims, wherein the therapeutic agent is an anionic therapeutic agent.
44. The composition according to any one of the claims 1 to 43 comprising as component (b) α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45; as component (c) 2,2'-S,S-bis(monooleoylglycerol)phosphate or 3,3'-S,S- bis(monooleoylglycerol)phosphate; as component (d) 1,2-dioleoyl-3-trimethylammonium propane chloride and / or PD740; and as component (e) cholesterol and / or solasodine.
45. The composition according to any one of the claims 1 to 43 comprisingZSP Ref.: 1261-2 PCT as component (b) α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45; as component (c) 2,2'-S,S-bis(monooleoylglycerol)phosphate or of 3,3'-S,S- bis(monooleoylglycerol)phosphate; as component (d) 1,2-dioleoyl-3-trimethylammonium propane chloride; and as component (e) cholesterol.
46. The composition according to any one of the claims 1-4, 9-35, 37 or 39-43 comprising as component (b) α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45; as component (c) 2,2'-S,S-bis(monooleoylglycerol)phosphate or of 3,3'-S,S- bis(monooleoylglycerol)phosphate; and as component (d) 1,2-dioleoyl-3-trimethylammonium propane chloride.
47. The composition according to any one of the claims 1 to 44 comprising as component (b) between 1 and 20 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy- [1,3]dioxan-5-yl)-amido}-polyethylene glycol45, wherein said mol percent is calculated taking the total moles of all components except component as component (a) that are comprised in said composition as 100%.
48. The composition according to any one of the claims 1 to 47 comprising as component (b) between 1 and 20 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy- [1,3]dioxan-5-yl)-amido}-polyethylene glycol45; as component (c) between 15 and 45 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate or of 3,3'-S,S-bis(monooleoylglycerol)phosphate; as component (d) between 30 and 75 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride and / or PD740; and as component (e) between 13 and 35 mol percent of cholesterol; wherein said mol percent is calculated taking the total moles of all components except component (a) that are comprised in said composition as 100%.
49. The composition according to any one of the claims 1 to 43 comprising as component (b) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45; as component (c) 20 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate or of 3,3'-S,S- bis(monooleoylglycerol)phosphate; as component (d) 50 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride; and as component (e) 25 mol percent of cholesterol,ZSP Ref.: 1261-2 PCT wherein said mol percent is calculated taking the total moles of all components except component (a) that are comprised in said composition as 100%.
50. The composition according to any one of the claims 1-4, 9-35, 37 or 39-43 comprising as component (b) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45; as component (c) 45 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate or of 3,3'-S,S- bis(monooleoylglycerol)phosphate; and as component (d) 50 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride, wherein said mol percent is calculated taking the total moles of all components except component (a) that are comprised in said composition as 100%.
51. The composition according to any one of the claims 1 to 43 comprising as component (b) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45; as component (c) 20 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate or of 3,3'-S,S- bis(monooleoylglycerol)phosphate; as component (d) 50 mol percent of PD740; and as component (e) 25 mol percent of cholesterol; wherein said mol percent is calculated taking the total moles of all components except component (a) that are comprised in said composition as 100%.
52. The composition according to any one of the claims 1 to 43 comprising as component (b) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45; as component (c) 20 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate or of 3,3'-S,S- bis(monooleoylglycerol)phosphate; as component (d1) 25 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride; as component (d2) 25 mol percent of PD740; and as component (e) 25 mol percent of cholesterol; wherein said mol percent is calculated taking the total moles of all components except component (a) that are comprised in said composition as 100%.
53. The composition according to any one of the claims 1 to 43 comprising as component (b) 7 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45;ZSP Ref.: 1261-2 PCT as component (c) 27 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate or of 3,3'-S,S- bis(monooleoylglycerol)phosphate; as component (d) 33 mol percent of PD740; and as component (e) 33 mol percent of cholesterol; wherein said mol percent is calculated taking the total moles of all components except component (a) that are comprised in said composition as 100%.
54. The composition according to any one of the claims 1 to 43 comprising as component (b) between 4 and 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy- [1,3]dioxan-5-yl)-amido}-polyethylene glycol45; as component (c) between 4 and 15 mol percent of 2,2'-S,S-bis(monooleoylglycerol)phosphate or of 3,3'-S,S-bis(monooleoylglycerol)phosphate; as component (d) between 42 and 50 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride; as component e: component (e1) between 13 and 15 mol percent of cholesterol; and component (e2) between 15 and 36 mol percent of solasodine; wherein said mol percent is calculated taking the total moles of all components except component (a) that are comprised in said composition as 100%.
55. The composition according to any one of the claims 1 to 43 comprising as component (b) α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5-yl)-amido}- polyethylene glycol45; as component (c) monogalactosyldiacylglycerol or 1-palmitoyl-2-linoleoyl-sn-glycero-3- phosphoethanolamine; as component (d) 1,2-dioleoyl-3-trimethylammonium propane chloride and PD740; and as component (e) cholesterol.
56. The composition according to any one of the claims 1 to 43 comprising as component (b) 5 mol percent of α-methoxy-ω-{N-(2-methyl-2-octadecyloxy-[1,3]dioxan-5- yl)-amido}-polyethylene glycol45; as component (c) 20 mol percent of monogalactosyldiacylglycerol or 1-palmitoyl-2-linoleoyl-sn- glycero-3-phosphoethanolamine; as component (d): component (d1) 25 mol percent of 1,2-dioleoyl-3-trimethylammonium propane chloride; and component (d2) 25 mol percent of PD740; and as component (e) 25 mol percent of cholesterol, wherein said mol percent is calculated taking the total moles of all components except component as component (a) that are comprised in said composition as 100%.ZSP Ref.: 1261-2 PCT 57. The composition according to any one of the preceding claims, wherein the N:P ratio is from about 1:1 to about 50:
1.
58. The composition according to any one of claims 1 to 57, wherein the composition is a vaccine formulation.
59. The composition according to any one of claims 1 to 57, wherein the compositon is a drug delivery system.
60. A pharmaceutical composition comprising the composition according to any one of claims 1 to 41.
61. A method of producing the composition according to any one of claims 1 to 59, or the pharmaceutical composition according to claim 60, comprising the steps of: (i) combining and mixing a composition comprising the components (b)-(d) and optionally (e) as defined in any one of claims 1 to 36 or 42 to 59; and (ii) mixing the composition obtained in step (i) with the therapeutic agent or with the pharmaceutically acceptable salt thereof (a).
62. The composition according to any one of claims 1 to 59 or the pharmaceutical composition according to claim 60 for use in the treatment or prophylaxis of a disease.
63. A method of treatment or prophylaxis in a subject, comprising administering to the subject the composition according to any one of claims 1 to 59 or the pharmaceutical composition according to claim 60 in a therapeutically effective amount.
64. The composition or the pharmaceutical composition for use according to claim 62 or the method of treatment according to claim 63, wherein the treatment or prophylaxis of a disease is a vaccination against said disease.
65. The composition or the pharmaceutical composition for use according to claim 62 or the method of treatment according to claim 63, wherein the disease is selected from the group consisting of infectious diseases, cancer, and genetic defects and diseases.
66. The composition according to any one of claims 1 to 59, or the pharmaceutical composition according to claim 60 for use in the manufacture of a medicament.
67. A kit of parts comprisingZSP Ref.: 1261-2 PCT (i) the composition according to any one of claims 1 to 59 or the pharmaceutical composition according to claim 60; and (ii) an instruction manual.
65. A composition comprising an artificial nucleic acid molecule, wherein the artificial nucleic acid molecule is an mRNA molecule having at least one open reading frame encoding an antigen derived from a pathogen, a therapeutic protein, or a CRISPR / CAS9 ribonucleoprotein, for use as a medicament, for use as a vaccine or for use in gene therapy, wherein the artificial nucleic acid molecule is associated with or complexed with components (b)-(d) and optionally (e) as defined in any one of claims 1 to 38 or 44 to 59, and wherein the composition is administered intramuscularly, intravenously, subcutaneously, intratumorally, orally, by inhalation or transdermally / topical.
68. A method of delivering an siRNA, an mRNA and / or protein into a target cell, comprising the step of (i) contacting the target cell with a composition as defined in any one of claims 1 to59, wherein component (a) is said siRNA, mRNA and / or protein.
69. A method of transfecting a cell, wherein the cell is selected from the group consisting of epithelial cells, macrophages, hepatocytes and cardiomyocytes, the method comprising the step of contacting the cell with the composition according to any one of claims 1 to 59.