SLC17a5 gene inhibitor and use thereof

Abstract

The present invention relates to the field of molecular biology, and in particular to an SLC17A5 gene inhibitor and a use thereof. The present invention provides a use of the SLC17A5 gene inhibitor in preparation of a kidney cancer treatment product. According to the SLC17A5 gene inhibitor provided by the present invention, a proper RNAi target sequence and oligo DNA double-stranded sequence are designed for a target gene, and a lentiviral vector plasmid containing the oligo DNA double-stranded sequence and a finally formed lentivirus are constructed; the resistance gene carried in the lentivirus can effectively reduce the mRNA expression of the target gene SLC17A5, and the lentivirus has an very obvious knockdown effect, has high inhibitory efficiency on cell proliferation and cell migration of kidney cancer cells, and can be used in drugs for treating kidney cancer; moreover, the present invention can be operated with high throughput and has high repeatability.

Description

SLC17A5 gene inhibitors and uses thereof Technical Field

[0001] The present invention relates to the field of molecular biology, and in particular to an SLC17A5 gene inhibitor and uses thereof. Background Art

[0002] Kidney cancer is a malignant tumor with a high morbidity and mortality rate, posing a serious threat to patients' health. Over the past decade, the incidence of kidney cancer has increased annually. Although early diagnosis and treatment of kidney cancer have greatly improved, patients with advanced kidney cancer still face the risk of recurrence after recovery. Therefore, the treatment of kidney cancer has always been a research focus for medical professionals. Currently, the Solute Carrier Family 17 Member 5 (SLC17A5, NCBI Reference Sequence: NM-001382629.1) gene has been shown to be closely related to the development of kidney cancer cells. Identifying this specific gene for kidney cancer, clarifying its expression status, and developing drug formulations targeting this gene are of great significance in effectively improving the treatment efficiency of kidney cancer and reducing drug toxicity and side effects.

[0003] Summary of the Invention

[0004] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide a SLC17A5 gene inhibitor and its use, so as to solve the problem of the limited research and development of pharmaceutical preparations targeting the SLC17A5 gene in the prior art.

[0005] To achieve the above objectives and other related objectives, the present invention provides the use of SLC17A5 gene inhibitors in the preparation of tumor treatment products.

[0006] Preferably, the tumor is renal cancer.

[0007] The present invention also provides a nucleic acid molecule for reducing SLC17A5 gene expression in renal cancer cells, wherein the nucleic acid molecule is a double-stranded RNA comprising a nucleotide sequence as shown in any one of SEQ ID NOs: 4-6; or a DNA encoding the nucleotide sequence of the shRNA as shown in any one of SEQ ID NOs. 7-12.

[0008] The present invention also provides an SLC17A5 gene interference nucleic acid construct, which contains a gene fragment encoding the double-stranded RNA in the aforementioned nucleic acid molecule or a gene fragment encoding the DNA having a nucleotide sequence as shown in any one of SEQ ID NOs. 7-12.

[0009] The present invention also provides an SLC17A5 gene interference lentivirus, which is formed by viral packaging of the aforementioned SLC17A5 gene interference nucleic acid construct with the assistance of a lentiviral packaging plasmid and a cell line.

[0010] The present invention also provides a cell line, which is a cell line infected with the aforementioned gene interference lentivirus.

[0011] The present invention provides a composition for treating renal cancer, the effective substance of which contains: the aforementioned nucleic acid molecule; and / or the aforementioned SLC17A5 gene interfering nucleic acid construct; and / or the aforementioned SLC17A5 gene interfering lentivirus; and / or the aforementioned cell line; and / or a renal cancer chemotherapy drug and a pharmaceutically acceptable carrier or excipient.

[0012] As described above, the SLC17A5 gene inhibitor of the present invention and its use have the following beneficial effects:

[0013] The present invention provides an SLC17A5 gene inhibitor for renal cancer. Suitable RNAi target sequences and oligo DNA double-stranded sequences are designed for the target gene, and a lentiviral vector plasmid containing the aforementioned oligo DNA double-stranded sequence and the resulting lentivirus are constructed. The resistance gene carried in the lentivirus can effectively reduce the mRNA expression level of the target gene SLC17A5, resulting in a very significant knockdown effect and a high inhibitory efficiency on cell proliferation and cell migration of renal cancer cells. The lentivirus can be used in drugs for treating renal cancer. Moreover, the present invention can infect different renal cancer cell lines simultaneously or in the same batch, and can achieve good knockdown and therapeutic effects with high repeatability. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] FIG1 shows the background expression level of the SLC17A5 gene in different cells (786-O, ACHN, A498) detected by RT-PCR method in the present invention.

[0015] FIG2 shows the expression level of the gene SLC17A5 detected by RT-PCR in 786-O cells infected with the lentivirus of Example 1.

[0016] FIG3 shows the fold change in the number of cells growing from day 1 to day 5 after the cells 786-O were infected with the lentivirus of Example 1, as measured by the cell counting method of the present invention.

[0017] FIG4 shows the number of migrated cells in cells 786-O infected with the lentivirus of Example 1 after culturing for 16 hours, as measured by the cell Transwell assay of the present invention. DETAILED DESCRIPTION

[0018] The present invention provides use of an SLC17A5 gene inhibitor in preparing a tumor treatment product.

[0019] In some embodiments, the tumor is renal cancer.

[0020] In the present invention, a gene inhibitor refers to a molecule that has an inhibitory effect on a gene. Gene inhibitory effects include, but are not limited to, inhibiting gene expression or activity. Taking the SLC17A5 gene as an example, an SLC17A5 gene inhibitor refers to a molecule that has an inhibitory effect on SLC17A5, i.e., the target gene of the SLC17A5 gene inhibitor is SLC17A5. SLC17A5 inhibitory effects include, but are not limited to, inhibiting the expression or activity of SLC17A5.

[0021] Inhibiting gene activity means reducing gene activity and thus reducing the biological function of the gene. Preferably, the gene activity is reduced by at least 10%, such as at least 30%, 50%, 70% or 90%, compared to before inhibition.

[0022] Inhibiting gene expression may be inhibiting gene transcription or translation. Specifically, it may mean preventing gene transcription or reducing gene transcription activity, preventing gene translation or reducing gene translation level.

[0023] Those skilled in the art can use conventional methods to regulate gene expression, such as gene knockout, homologous recombination, interfering RNA, etc.

[0024] The inhibition of gene expression can be verified by detecting the expression level through PCR and Western Blot.

[0025] Preferably, gene expression is reduced by at least 10%, more preferably by at least 30%, even more preferably by at least 50%, even more preferably by at least 70%, even more preferably by at least 90%, and most preferably, the gene is not expressed at all compared to the wild type.

[0026] The tumor treatment product must include a gene inhibitor and use the gene inhibitor as the active ingredient for the aforementioned efficacy.

[0027] In the above-mentioned product, the active ingredient that exerts the aforementioned function may be only a gene inhibitor, or may contain other molecules that can exert the aforementioned function.

[0028] That is, the gene inhibitor is the only active ingredient or one of the active ingredients of the product.

[0029] The product can be a single-component substance or a multi-component substance.

[0030] The product is mainly targeted at mammals. The mammals are preferably rodents, artiodactyls, perissodactyls, lagomorphs, primates, etc. The primates are preferably monkeys, apes or humans.

[0031] The tumor treatment product is a tumor treatment drug or an enhancer for a tumor chemotherapy drug. The product is a pharmaceutical. The dosage form of the pharmaceutical is not specifically limited, and may include, for example, an oral preparation or an injection. The pharmaceutical may be a sustained-release preparation.

[0032] The gene inhibitor can be a nucleic acid molecule, a polypeptide, a protein, a small molecule substance, or a virus.

[0033] In one embodiment, the gene inhibitor can be a nucleic acid molecule that reduces gene expression in renal cancer cells.

[0034] The nucleic acid molecule is selected from any one or more of antisense oligonucleotides, RNA aptamers, ribozymes targeting genes or their receptor polypeptides, nucleic acid constructs, double-stranded RNA (dsRNA) or short hairpin RNA (shRNA).

[0035] The double-stranded RNA contains a nucleotide sequence capable of hybridizing with a gene.

[0036] The shRNA contains a nucleotide sequence capable of hybridizing with a gene.

[0037] Furthermore, the double-stranded RNA comprises a first strand and a second strand, the first strand and the second strand complement each other to form an RNA dimer, and the sequence of the first strand is substantially identical to the target sequence in the target gene (eg, the SLC17A5 gene).

[0038] The target sequence in the target gene is the segment in the target gene corresponding to the mRNA segment recognized and silenced by the nucleic acid molecule.

[0039] Furthermore, the double-stranded RNA is small interfering RNA (siRNA).

[0040] Furthermore, the target sequence of the double-stranded RNA as an SLC17A5 gene inhibitor is as shown in any one of SEQ ID NOs: 1-3, specifically: SEQ ID NO. 1: AGGTTCAATGTTCAAGAGAAT, SEQ ID NO. 2: TTCGCCAAAGGTGAAGTACAA, SEQ ID NO. 3: GTGAATCTGAGTGTTGCGTTA. Further, the double-stranded RNA comprises an RNA with a nucleotide sequence as shown in any one of SEQ ID NOs: 4-6, specifically SEQ ID NO. 4: AGGUUCAAUGUUCAAGAGAAU, SEQ ID NO. 5: UUCGCCAAAGGUGAAGUACAA, SEQ ID NO. 6: GUGAAUCUGAGUGUUGCGUUA. Further, the nucleotide sequence encoding the shRNA is shown in any one of SEQ ID NOs. 7-12.

[0041] The shRNA includes a sense chain segment and an antisense chain segment, and a stem-loop structure connecting the sense chain segment and the antisense chain segment, the sequences of the sense chain segment and the antisense chain segment are complementary, and the sequence of the sense chain segment is substantially identical to the target sequence in the target gene (e.g., the SLC17A5 gene).

[0042] Furthermore, the target sequences of shRNAs acting as SLC17A5 inhibitors are shown in SEQ ID NOs: 1-3.

[0043] The shRNA can be processed into siRNA after enzyme cleavage, thereby playing a role in specifically silencing the expression of endogenous target genes in renal cancer cells.

[0044] Furthermore, the sequence of the stem-loop structure of the shRNA can be selected from any one of the following: UUCAAGAGA, UUCG, CCACC, CTCGAG, AAGCUU or CCACACC.

[0045] Furthermore, the SLC17A5 gene is derived from humans.

[0046] In some embodiments, the protein can be an anti-SLC17A5 antibody.

[0047] In some embodiments, the virus is selected from a lentivirus, an adenovirus, or an adeno-associated virus.

[0048] The lentivirus is composed of each gene interference nucleic acid construct, packaged with the help of a lentiviral packaging plasmid and a cell line. The lentivirus can infect renal cancer cells and produce small interfering RNA targeting the corresponding gene (e.g., SLC17A5), thereby inhibiting the proliferation of renal cancer cells.

[0049] The cancer treatment product of the present invention treats cancer by inhibiting the proliferation rate of renal cancer cells and / or inhibiting the migration of renal cancer cells.

[0050] The present invention has been verified through cell experiments that the gene inhibitor can significantly slow down the proliferation rate of renal cancer cells within 24 hours, and this trend becomes gradually more significant as time goes by.

[0051] The present invention also provides a nucleic acid molecule for reducing target gene expression in tumor cells, wherein the nucleic acid molecule is a double-stranded RNA having a nucleotide sequence as shown in any one of SEQ ID NOs: 4-6; or, the nucleic acid molecule is a shRNA encoding a nucleotide sequence as shown in any one of SEQ ID NOs: 7-12. The target gene is selected from the SLC17A5 gene.

[0052] In some embodiments, the tumor cells are renal cancer cells.

[0053] The present invention also provides an SLC17A5 gene interference nucleic acid construct, which contains a gene fragment encoding the double-stranded RNA, shRNA or DNA encoding shRNA in the aforementioned nucleic acid molecule and can express the double-stranded RNA, shRNA or DNA encoding shRNA.

[0054] The SLC17A5 gene interfering nucleic acid construct can be obtained by cloning a gene fragment encoding the aforementioned human target gene double-stranded RNA, shRNA, or shRNA-encoding DNA into a known vector. Taking the SLC17A5 gene interfering nucleic acid construct as an example, the SLC17A5 gene interfering nucleic acid construct can be obtained by cloning a gene fragment encoding the aforementioned human SLC17A5 gene double-stranded RNA, shRNA, or shRNA-encoding DNA into a known vector.

[0055] Furthermore, the SLC17A5 gene interference nucleic acid construct is a SLC17A5 gene interference lentiviral vector.

[0056] Furthermore, the SLC17A5 gene interference lentiviral vector further contains a promoter sequence and / or a nucleotide sequence encoding a marker that can be detected in renal cancer cells; preferably, the detectable marker is such as green fluorescent protein (GFP).

[0057] Furthermore, the lentiviral vector can be selected from the group consisting of: BR-V108, pLKO.1-CMV-tGFP, pLKO.1-puro-CMV-tGFP, pLKO.1-CMV-Neo, pLKO.1-Neo, pLKO.1-Neo-CMV-tGFP, pLKO.1-puro-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-CMV-TagCFP, pLKO.1-puro-CMV-TagYFP, pLKO.1-puro-CMV-TagRFP, pLKO.1-puro-CMV-TagFP635, pLKO.1-CMV-TagFP635, pLKO.1-CMV-Tag KO.1-puro-UbC-TurboGFP, pLKO.1-puro-UbC-TagFP635, pLKO-puro-IPTG-1xLacO, pLKO-puro-IPTG-3xLacO, pLP1, pLP2, Any of pLP / VSV-G, pENTR / U6, pLenti6 / BLOCK-iT-DEST, pcDNA1.2 / V5-GW / lacZ, pLenti6.2 / N-Lumio / V5-DEST, and pGCSIL-GFP.

[0058] The siRNA of the present invention can be used alone or in combination with other drugs to inhibit the proliferation of renal cancer cells. Furthermore, it can be used as a drug or formulation for treating renal cancer. When used as a drug or formulation for treating renal cancer, a safe and effective amount of the nucleic acid molecule is administered to a mammal. The specific dosage will also take into account factors such as the route of administration and the patient's health status, all of which are within the skill of a skilled physician.

[0059] The present invention also provides a SLC17A5 gene interference lentivirus, which is produced by viral packaging of the aforementioned SLC17A5 gene interference nucleic acid construct with the assistance of a lentiviral packaging plasmid and a cell line. This lentivirus can infect renal cancer cells and produce small interfering RNA targeting the target gene, thereby inhibiting the proliferation of renal cancer cells.

[0060] The present invention also provides a cell line, which is a cell line infected with the SLC17A5 gene interference lentivirus.

[0061] In some embodiments, the cell line is selected from one or more of 293, 293T, 786-O, ACHN, and A498.

[0062] The present invention also provides a composition for treating tumors, wherein the effective substance comprises:

[0063] The aforementioned nucleic acid molecule; and / or, the aforementioned SLC17A5 gene interference nucleic acid construct; and / or, the aforementioned SLC17A5 gene interference lentivirus, and / or, the cell line, and / or tumor chemotherapy drugs and pharmaceutically acceptable carriers or excipients.

[0064] The composition for treating tumors is a composition for treating renal cancer.

[0065] The composition may be a pharmaceutical composition.

[0066] When the composition is used to prevent or treat renal cancer in a subject, an effective dose of the composition is administered to the subject. Using this method, the growth, proliferation, recurrence, and / or metastasis of the renal cancer is inhibited. Furthermore, at least 10% to 30%, 30% to 50%, 50% to 70%, 70% to 90%, or 90% to 100% of the growth, proliferation, recurrence, and / or metastasis of the renal cancer is inhibited.

[0067] The form of the composition is not particularly limited and can be in various forms such as solid, liquid, gel, semi-fluid, aerosol, etc.

[0068] The composition is mainly targeted at mammals. The mammals are preferably rodents, artiodactyls, perissodactyls, lagomorphs, primates, etc. The primates are preferably monkeys, apes or humans.

[0069] The present invention also provides a method for treating renal cancer, comprising administering an effective dose of the tumor treatment product to a subject.

[0070] In one embodiment, the tumor is renal cancer. The tumor treatment product is a renal cancer treatment product. Furthermore, when the drug is used to prevent or treat renal cancer in a subject, an effective dose of the drug needs to be administered to the subject. Using this method, the growth, proliferation, recurrence and / or metastasis of the renal cancer is inhibited. Furthermore, at least 10% to 30%, 30% to 50%, 50% to 70%, 70% to 90%, or 90% to 100% of the growth, proliferation, recurrence and / or metastasis of the renal cancer is inhibited.

[0071] The subject of the method can be a human.

[0072] The following describes the embodiments of the present invention through specific examples. Those skilled in the art will readily understand the other advantages and benefits of the present invention from the disclosure herein. The present invention may also be implemented or applied through various other specific embodiments, and the details in this specification may be modified or altered based on different viewpoints and applications without departing from the spirit of the present invention.

[0073] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing specific specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0074] When the embodiments provide numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the understanding of the prior art by those skilled in the art and the description of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention may also be used to implement the present invention.

[0075] Example 1 Lentivirus Preparation

[0076] This embodiment provides a lentivirus for renal cancer. The RNAi target sequence of the lentivirus has a fragment coding sequence of: SEQ ID NO.1: AGGTTCAATGTTCAAGAGAAT, SEQ ID NO.2: TTCGCCAAAGGTGAAGTACAA, and SEQ ID NO.3: GTGAATCTGAGTGTTGCGTTA.

[0077] Next, the target sequence is constructed into the corresponding lentiviral vector to construct a lentiviral vector plasmid. The preparation steps include:

[0078] Select tool vector to obtain target gene fragment;

[0079] BR-V108 was selected as the tool vector (purchased from Shanghai Yiberui Biopharmaceutical Technology Co., Ltd.), the nucleotide sequence of which is shown in SEQ ID NO.17, and the core sequence of the target gene fragment is shown in SEQ ID NO.1-3.

[0080] synthesize single-stranded primers and oligo DNA;

[0081] In step (2), the single-stranded primer comprises the following three groups of sequences:

[0082] 1) SEQ ID NO.7: 5'-ccggAGGTTCAATGTTCAAGAGAATctcgagATTCTCTTGAACATTGAACCTtttttg-3' and SEQ ID NO.8 5'-aattcaaaaaAGGTTCAATGTTCAAGAGAATctcgagATTCTCTTGAACATTGAACCT-3';

[0083] II) SEQ ID NO.9 5'-ccggTTCGCCAAAGGTGAAGTACAActcgagTTGTACTTCACCTTTGGCGAAtttttg-3' and SEQ ID NO.10 5'-AATTCAAAAATTCGCCAAAGGTGAAGTACAACTCGAGTTGTACTTCACCTTTGGCGAA;

[0084] III) SEQ ID NO.11 5'-ccggGTGAATCTGAGTGTTGCGTTActcgagTAACGCAACACTCAGATTCACtttttg-3' and SEQ ID NO.12 5'-aattcaaaaaGTGAATCTGAGTGTTGCGTTActcgagTAACGCAACACTCAGATTCAC-3'.

[0085] The above primers are annealed to form oligo DNA.

[0086] The annealing system is: 2.5 μL upstream chain (10 μmol / L) + 2.5 μL downstream chain (10 μmol / L) + 5 μL annealing buffer + 10 μL ultrapure water; the annealing temperature is: 95°C for 5 min in a PCR instrument; 95°C for 40 s; reduce by 0.7°C every 40 s, for 99 cycles; 25°C for 3 min; and store at 8°C.

[0087] The oligo DNA and the linearized tool vector were ligated and transformed;

[0088] First, the tool vector was enzymatically digested with EcoR I and Age I at the enzyme digestion sites. The enzymatic digestion system consisted of 16 μL ultrapure water + 30 μL 10× CutSmart Buffer (manufacturer: NEB component number: B6004SVIA) + 12 μL purified plasmid DNA (1 μg / μL) + 1 μL Age Ⅰ (10 U / μL) + 1 μL EcoR Ⅰ (10 U / μL). The reaction was carried out at 37°C for 3 h. After enzymatic digestion, agarose gel electrophoresis was performed to recover the target fragment.

[0089] The digested tool vector was reacted with oligo DNA in a reaction system at 22°C for 1 hour. The reaction system was:

[0090] 1. 50ng of tool vector after enzyme digestion

[0091] 2ul oligo DNA

[0092] 3. 0.5μL T4 DNA ligase (EL0011, ThermoFisher)

[0093] 4. 2μL 10×T4 DNA ligase Buffer (EL0011, ThermoFisher)

[0094] 5. Ultrapure water (up to 20 μL)

[0095] Thaw competent TOP10 competent cells (Zymecon GTC, GTC-BC-G001) on ice, add 10 μL of ligation product to 100 μL of competent cells, and place on ice for 1 min; heat shock in a 42°C water bath for 40 s, and place on ice for 2 min; add 200 μL of LB liquid medium without resistance, and shake and culture at 37°C at 200 rpm for 1 h; take 150 μL of bacterial liquid and evenly spread it on LB solid medium containing ampicillin (Amp) resistance, and culture in a 37°C incubator for 14 h.

[0096] (4) Colony PCR identification, sequencing, and plasmid extraction;

[0097] In the colony PCR identification, the identification primer-F sequence is SEQ ID NO.13: CCTATTTCCCATGATTCCTTCATA, and the identification primer-R sequence is SEQ ID NO.14: GTAATACGGTTATCCACGCG; the PCR reaction system is: 10ul 2×Hieff HotStart PCR Master Mix (With Dye); Manufacturer: Yisheng Product No.: 10732ES03 + 0.4 μL identification primer-F + 0.4 μL identification primer-R + ultrapure water (to a system of 20 μL), PCR amplification conditions: 94°C 3min; 94°C 30s, 55°C 30s, 72°C 30s, 22 cycles; 72°C 5min; after the PCR is completed, 5 μL of product was taken and the bands were detected by 1% agarose gel electrophoresis (electrophoresis loading: the blank control used ultrapure water as a template; the negative control used an empty vector without the target gene inserted as a template).

[0098] The identified positive clone transformants were inoculated into LB liquid culture medium containing the corresponding resistance, cultured at 37°C for 14 h, and sent for sequencing after colony PCR identification.

[0099] Transfer the correctly sequenced bacterial suspension to 150 ml of LB liquid medium containing Amp resistance, culture overnight on a shaker at 37°C, collect the bacterial suspension, and use the Tiangen Endotoxin-Free Plasmid Extraction Kit to extract the plasmid:

[0100] 1. Bacterial enrichment: Take 10mL of bacterial liquid, centrifuge at 8000rpm for 4min, and collect the bacteria; 2. Bacterial liquid lysis: Add 1mL of GP1 Buffer to resuspend the bacteria and transfer to a 2.0mL centrifuge tube; 3. Lysis termination: Add 0.5mL of GP2 Buffer, gently invert and mix, let it stand for 1min, and centrifuge at 12000rpm for 1min; Take 0.7mL of the supernatant from the previous step and add it to the activated adsorption column GP, ​​centrifuge at 3000rpm for 1min; remove the waste liquid in the collection tube; 4. Wash: Add 0.5mL of GPW Buffer and centrifuge at 12000rpm for 1min; 5. Recovery: Replace the collection tube, add 0.2mL of GP3 Buffer to the adsorption column, let it stand for 1min, and centrifuge at 12000rpm for 1min; 6. Stabilization: Place the centrifuge tube containing the recovery liquid in a 37℃ constant temperature incubator for 15min.

[0101] The lentivirus is prepared by co-transfecting 293T cells with the above-mentioned lentiviral vector plasmid, the psPAX2 vector plasmid nucleotide sequence as shown in SEQ ID NO.18, and the pMD2.G vector nucleotide sequence as shown in SEQ ID NO.19.

[0102] The preparation steps of the lentivirus are as follows: (1) 12-18 h before transfection, 293T cells (ATCC ACS-4500) in the logarithmic growth phase were digested with trypsin, and the cell density was adjusted to about 5×10 6 / 15mL, re-inoculate into a 10cm cell culture dish, and culture in a 37℃, 5% CO2 incubator. When the cell density reaches 70% to 80%, it can be used for transfection;

[0103] (2) 2 h before transfection, the cell culture medium was replaced with serum-free medium;

[0104] (3) Add DNA solution (10 μg of lentiviral vector plasmid, 7.5 μg of pMD2.G vector plasmid, and 5 μg of pSPAX2 vector plasmid) to 500 μL of Opti-MEM R1 medium and let it stand at room temperature for 5 minutes; add the corresponding amount of transfection reagent Polybrene (manufacturer: Santa Cruz Biotechnology, catalog number: sc-134220A) to another 500 μL of Opti-MEM R1 medium and let it stand at room temperature for 5 minutes; gently mix the two and let it stand at room temperature for 20 minutes.

[0105] (4) The mixture was added dropwise to the 293T cell culture medium, mixed gently, and cultured in a 37°C, 5% CO2 cell culture incubator; after 6 hours, 10 mL of 10% FBS culture medium was replaced and the cells were cultured in a 37°C, 5% CO2 incubator for another 60 hours.

[0106] (5) Collect the cell supernatant 48h and 72h after transfection.

[0107] Example 2 Lentivirus reduces SLC17A5 expression

[0108] shCtrl: normal target cell group infected with negative control lentivirus (control group);

[0109] shSLC17A5-1, shSLC17A5-2, and shSLC17A5-3 correspond to the normal target cell groups (experimental groups) infected with the RNAi lentivirus in Examples 1-3, respectively.

[0110] 1. Real-time qPCR detection of target gene SLC17A5 expression levels: After total RNA extraction using the Sigma Trizol protocol, 4X gDNA wiper mix and 1.0 μg total RNA were added to PCR tubes. RNase-free HO was added to 8 μL, mixed thoroughly, centrifuged, and incubated at 42°C for 2 min. Reverse transcription was performed using 5X qPCR supermix and incubated at 55°C for 15 min and 85°C for 2 min. The resulting cDNA was stored at -80°C until further use. The real-time qPCR reaction system was as follows: 5.0 μL SYBR Green mastermix + 0.25 μL upstream primer (10 μmol / L, sequence SEQ ID NO.15: GTGATTATTCTTTGGCCGTTGC) + 0.25 μL downstream primer (10 μmol / L, sequence SEQ ID NO.16: TATTTGTGATGCCCAGGAGG) + 0.2 μL Dye2 (Qihengxing, FS-Q1001) + 2.3 μL RNase-Free H2O; －△△ The expression levels of mRNA were analyzed using the Ct method. The expression results of the SLC17A5 gene in different cells are shown in Figure 1. The SLC17A5 gene was highly expressed in cells 786-O, ACHN, and A498. The effect of the preparation in Example 1 on SLC17A5 expression in 786-O cells is shown in Figure 2.

[0111] As shown in Figure 2, in 786-O cells, after infection with the lentivirus, the SLC17A5 gene knockdown efficiency of the shSLC17A5-1 group, i.e., the virus prepared by the vector containing the nucleotide sequence of group I) in Example 1, reached 81.0% (p<0.05) relative to the shCtrl group; the SLC17A5 gene knockdown efficiency of the shSLC17A5-2 group, i.e., the virus prepared by the vector containing the nucleotide sequence of group II) in Example 1, reached 60.8% (p<0.05); the SLC17A5 gene knockdown efficiency of the shSLC17A5-3 group, i.e., the virus prepared by the vector containing the nucleotide sequence of group III) in Example 1, reached 69.0% (p<0.05).

[0112] Example 3 Lentivirus reduces the growth rate of renal cancer cells

[0113] Cell counting and growth detection: After subculturing 786-O cells, trypsinize the 786-O cells in the logarithmic growth phase to prepare a cell suspension; inoculate the cell suspension (cell number is about 1500-2500) in a 96-well plate and culture in a 37°C, 5% CO2 incubator until the cell confluence reaches about 20-30%; add an appropriate amount of virus according to the cell MOI value; observe the cell status after 12 hours and replace the culture medium; observe the expression of the reporter gene GFP on the lentivirus 2-3 days after infection, and the fluorescence rate reaches about 80%. The cells were cultured until the confluence was 70%-90%, and the cells were collected; the cells in each experimental group in the logarithmic growth phase were trypsinized and resuspended in complete medium into a cell suspension and counted; the cell density of the plate was determined according to the cell size (the number of cell plates was set to 2000 cells / well), and the cells were cultured in a 37°C, 5% CO2 incubator, with 3 replicates per group, and the culture system was 100 μL / well. The number of cells added to each well was ensured to be consistent during the plate laying; starting from the next day, the Celigo assay was read once a day for 5 consecutive days; by adjusting the input parameters of the analysis settings, the number of cells with green fluorescence in each scanned well plate was accurately calculated; the data was statistically plotted to draw a 5-day cell proliferation curve. After 5 days of lentiviral infection of the target cells, the curve results of the change in the number of cells in Example 1 and the control group over time are shown in Figure 3.

[0114] As shown in FIG3 , after lentiviral infection, cell proliferation in the shSLC17A5-1 group in Example 1 was significantly inhibited compared with the shCtrl group, with a fold change value of -2.0 (p<0.05).

[0115] Example 4 Renal cancer cell invasion assay

[0116] Transwell in vitro cell invasion assay: (1) Place the required number of chambers in an empty 24-well plate, add 100 μL of serum-free culture medium to the chamber, and place in an incubator for 1 to 2 hours; (2) Prepare cell suspension: Digest the 786-O cells of each group in the logarithmic growth phase with trypsin, resuspend them in low-serum culture medium, and make a cell suspension; count the cells in the cell suspension using a hemocytometer; (3) After step (1), carefully remove the culture medium from the chamber, add 600 μL of 30% FBS culture medium to the lower chamber, and dilute them with serum-free culture medium at a certain ratio. Cells were added, 100 μL of the cell suspension (containing 100,000 to 200,000 cells) was added to each chamber; the chamber was transferred to the lower chamber containing 30% FBS medium using tweezers and cultured in a tissue culture incubator for 20 hours. The chamber was then inverted on absorbent paper to remove the medium. Non-migrated cells were gently removed with a cotton swab. 400 μL of staining solution was added to an empty well of a 24-well plate and the chamber was immersed in the staining solution for 5 minutes. The migrating cells were stained on the lower surface of the membrane. The chamber was immersed in a large cup of water, rinsed several times, air-dried, and the membrane was photographed under a microscope. The results of the comparison of the number of migrating cells in the experimental group and the control group of Example 1 after 16 hours of incubation in the Transwell chamber are shown in Figure 4.

[0117] As shown in FIG4 , after lentiviral infection, the Transwell transfer rate of the shSLC17A5-1 group in Example 1 was reduced by 17% compared with the shCtrl group (p<0.05).

[0118] The above examples are intended to illustrate the embodiments disclosed herein and are not to be construed as limiting the present invention. In addition, the various modifications listed herein and variations of the methods in the invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications apparent to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.

Claims

1. Use of SLC17A5 gene inhibitors in the preparation of renal cancer treatment products; The renal cancer treatment product is a tumor treatment drug, or an enhancer of tumor chemotherapy drugs; the SLC17A5 gene inhibitor is a nucleic acid molecule or a virus packaged by a nucleic acid construct containing the aforementioned nucleic acid molecule; The nucleic acid molecule is selected from any one or more of siRNA or shRNA; The target sequence of the siRNA is shown in any one of SEQ ID NOs: 1-3; The siRNA has a nucleotide sequence as shown in any one of SEQ ID NOs: 4-6; The nucleotide sequence encoding the shRNA is shown in any one of SEQ ID NOs. 7-12; The virus is a lentivirus, an adenovirus or an adeno-associated virus.

2. A nucleic acid molecule for reducing the expression of the SLC17A5 gene in renal cancer cells, characterized in that: The nucleic acid molecule is an siRNA whose nucleotide sequence is shown in any one of SEQ ID NOs: 4-6; or, the nucleic acid molecule is an shRNA, and the nucleotide sequence encoding the shRNA is shown in any one of SEQ ID NOs. 7-12.

3. A SLC17A5 gene interference nucleic acid construct, characterized in that: The SLC17A5 gene interference nucleic acid construct contains a sequence encoding the siRNA described in claim 2 or a sequence encoding the shRNA described in claim 2.

4. A SLC17A5 gene interference lentivirus, characterized in that: The SLC17A5 gene interference nucleic acid construct according to claim 3 is packaged by viruses with the assistance of lentiviral packaging plasmids and cell lines.

5. A cell line, characterized in that The cell line is a cell line infected with the SLC17A5 gene interference lentivirus according to claim 4.

6. The cell line according to claim 5, characterized in that The cell line is selected from one or more of 293, 293T, 786-O, ACHN, and A498.

7. A composition for treating renal cancer, characterized in that: The effective substance contains: the nucleic acid molecule according to claim 2; and / or the SLC17A5 gene interference nucleic acid construct according to claim 3; and / or the SLC17A5 gene interference lentivirus according to claim 4; and / or the cell line according to claim 5 or 6; and / or a renal cancer chemotherapy drug and a pharmaceutically acceptable carrier or excipient.

Images