Application of PABPC3 as marker for evaluating prognosis of metastatic ovarian cancer

Abstract

The invention discloses application of PABPC3 as a marker for evaluating prognosis of metastatic ovarian cancer, and belongs to the technical field of biological diagnosis and medicine. Specifically, differential genes in an in-situ ovarian cancer and a metastatic ovarian cancer in a database are screened, and are combined with differential genes related to ovarian cancer prognosis in a pan-cancer database, so that a gene PABPC3 with remarkable differential expression is obtained. The influence of the gene PABPC3 on the activity, migration ability and the like of ovarian cancer cells is researched through cell experiments and in-vivo experiments, and the feasibility of the marker in evaluation of ovarian cancer prognosis is proved. Meanwhile, the invention also discovers that the expression of the knock-down gene PABPC3 can inhibit the metastasis of cancer cells. Therefore, the invention provides a novel strategy for detecting and treating ovarian cancer metastasis, which is expected to overcome the defects of the traditional detection and treatment mode, and provides a new choice for clinic.

Description

Technical Field

[0001] The present invention relates to use of PABPC3 as a marker for evaluating the prognosis of metastatic ovarian cancer, and belongs to the technical field of biological diagnosis and medicine. Background Art

[0002] Ovarian cancer is one of the deadliest malignancies affecting women, and its high mortality rate is mainly due to the aggressive metastatic nature of the disease, which causes most patients to be diagnosed at an advanced stage. The challenges of tumor metastasis and drug resistance complicate treatment and significantly reduce survival rates. Therefore, there is an urgent need for detection indicators that can evaluate the efficacy of chemotherapy treatment for metastatic ovarian cancer and predict patient prognosis.

[0003] Poly(A) binding proteins (PABPs) are a family of conserved proteins found in yeast and humans. They are multifunctional protein regulators that participate in various aspects of mRNA homeostasis, including polyadenylation, nonsense-mediated decay (NMD), stress response, mRNA translation initiation control, and mRNA quality monitoring, and play an important role in promoting translation initiation. Poly(A) binding protein cytoplasmic 3 (PABPC3, also known as tPABP, poly(A) binding protein cytoplasmic 3) is a polynucleotide binding protein found in the cytoplasm. Current studies have shown that during spermatogenesis, PABPC3 is expressed in spermatids and round spermatids, and its expression level varies in different types of non-obstructive azoospermia (NOA) patients, which can be used as a potential biomarker for NOA. There are also reports that PABPC3 can promote the proliferation and migration of osteosarcoma, but there are no reports on the role of PABPC3 in ovarian cancer. Summary of the invention

[0004] To solve the above problems, the present invention compares the differential genes between primary ovarian cancer and metastatic ovarian cancer in the database and the genes related to prognosis, takes the intersection to obtain the significantly differential gene PABPC3, and confirms its effect on cell healing and migration by knocking out and overexpressing the gene. Finally, in vivo experiments show that PABPC3 is expressed at a high level in ovarian cancer, especially in metastatic lesions. The higher the PABPC3 level, the worse the prognosis, which can promote the progression of the tumor and significantly affect the invasiveness and drug resistance of tumor cells, confirming that PABPC3 can be used as a detection indicator for the prognosis of ovarian cancer.

[0005] The first object of the present invention is to provide the use of the PABPC3 gene as a marker for assessing the prognosis of ovarian cancer. In other words, the use of the PABPC3 gene in preparing a product for assessing the prognosis of ovarian cancer.

[0006] Furthermore, the prognosis includes ovarian cancer metastasis risk and / or chemotherapy resistance.

[0007] The second object of the present invention is to provide a kit for evaluating the prognosis of ovarian cancer, wherein the kit is capable of detecting the expression level of the PABPC3 gene.

[0008] Furthermore, the kit contains substances necessary for quantifying the PABPC3 gene; preferably, the substances necessary for quantifying the PABPC3 gene include primers for amplifying the PABPC3 gene.

[0009] Furthermore, the detection step includes:

[0010] S1. Extract genomic DNA of the sample to be tested and quantify the PABPC3 gene therein;

[0011] S2. Determine the prognosis of ovarian cancer based on the expression level of PABPC3 gene.

[0012] The third object of the present invention is to provide the use of primers for amplifying the PABPC3 gene in preparing a kit for evaluating the prognosis of ovarian cancer.

[0013] The fourth object of the present invention is to provide a use of a substance that inhibits PABPC3 gene expression in the preparation of a drug for treating ovarian cancer.

[0014] Furthermore, substances that inhibit the expression of PABPC3 gene include but are not limited to siRNA, shRNA, lentivirus and the like.

[0015] Furthermore, the ovarian cancer therapeutic drug is used to prevent or treat the metastasis of ovarian cancer, and / or improve the drug resistance generated during the treatment of ovarian cancer.

[0016] The fifth object of the present invention is to provide a composition for treating ovarian cancer, comprising a substance that inhibits the expression of the PABPC3 gene; optionally, further comprising a pharmaceutically acceptable carrier.

[0017] Furthermore, the composition is a pharmaceutical composition.

[0018] Furthermore, the pharmaceutical composition also contains pharmaceutically acceptable excipients.

[0019] Furthermore, the auxiliary materials include one or more of fillers, excipients, stabilizers, diluents, binders, disintegrants, lubricants, glidants, wetting agents, effervescent agents, colorants, sweeteners, flavoring agents, preservatives, dispersants, film formers, plasticizers, pore formers, opacifiers, retardants, and solvents.

[0020] Furthermore, the composition consists of 0.1-100% of active ingredients (substances that inhibit PABPC3 gene expression) and 99.9-0% of auxiliary materials.

[0021] Beneficial effects of the present invention:

[0022] At present, there is no clear and effective marker for ovarian cancer metastasis in clinical use. The present invention has discovered a new detection index, PABPC3, through a large number of screenings. PABPC3 is used as an indicator of chemotherapy resistance and prognosis of metastatic ovarian cancer for detection, thereby characterizing the patient's chemotherapy resistance characteristics and possible prognostic problems, so as to prompt clinicians to adopt personalized or different chemotherapy regimens for treatment, so as to reduce the possible emergence of chemotherapy resistance and improve the patient's survival. At the same time, the present invention also found that knocking out PABPC3 in cancer cells reduces its expression level, can reduce the healing ability of cancer cells and inhibit the migration of cancer cells, which indicates that it has certain potential in the treatment of ovarian cancer and can be used as a strong candidate for ovarian cancer treatment drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The differentially expressed genes were screened out through single-cell sequencing of ovarian cancer samples combined with the pan-cancer data of the TCGA database.

[0024] Figure 2 The survival rate of patients with different expression levels of PABPC3 was analyzed.

[0025] Figure 3-4 To investigate the effect of knocking down PABPC3 on ovarian cancer cell migration in the SKOV3 ovarian cancer cell line.

[0026] Figure 5-6 To investigate the effect of overexpression of PABPC3 gene in ID8 ovarian cancer cell line on the migration of ovarian cancer cells.

[0027] Figure 7 The migration ability of ovarian cancer cell lines overexpressing PABPC3 in mice.

[0028] Figure 8 The cell viability results of ovarian cancer cells with different expression levels of ID8 after treatment with chemotherapeutic drugs.

[0029] Fig. 9 The difference in viability of ovarian cancer cell ID8 overexpressing PABPC3 after treatment with different chemotherapeutic drugs.

[0030] Fig.10 To evaluate the survival of ovarian cancer patients after chemotherapy using public databases.

[0031] Fig.11To group clinically derived ovarian cancer metastasis samples by PABPC3 expression levels and analyze their relationship with prognosis. DETAILED DESCRIPTION

[0032] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0033] The scheme involved in the present invention is as follows:

[0034] At present, the treatment of ovarian cancer mainly includes surgical treatment, chemotherapy, targeted therapy, etc. Surgical treatment is usually the first choice, aiming to remove the tumor as much as possible, especially for early-stage patients, and may achieve a cure through total hysterectomy and bilateral salpingo-oophorectomy. Postoperative recurrence and metastasis of ovarian cancer are one of the main factors leading to the high mortality rate of patients. Although surgical treatment can remove the tumor to a certain extent, many patients still face the risk of recurrence after surgery. For advanced or recurrent ovarian cancer, cytoreductive surgery is usually used to reduce the tumor burden, combined with chemotherapy, especially regimens based on platinum chemotherapy drugs (such as cisplatin and carboplatin).

[0035] Recurrence of ovarian cancer usually manifests as distant metastasis, especially metastasis to the liver, abdominal cavity, and lymph nodes. Since the symptoms of ovarian cancer are often not obvious in the early stages, many patients are already in the late stages when obvious symptoms appear, which greatly reduces the effectiveness of treatment. The metastasis mechanism of ovarian cancer is complex, mainly through peritoneal dissemination, lymphatic metastasis, and hematogenous metastasis. During the metastasis process, tumor cells interact with the surrounding tumor microenvironment to promote cell migration and invasion. Moreover, metastatic ovarian cancer is usually resistant to chemotherapy, with limited treatment effects, and a significantly reduced survival rate after recurrence. Due to the widespread spread of tumors and the development of drug resistance, patients with advanced ovarian cancer often face a lower survival rate.

[0036] For the metastasis mechanism of ovarian cancer, existing research focuses on the initial stage of the tumor, while the genetic changes, cell-cell interactions and dynamic changes of the tumor microenvironment during the metastasis process have not been fully understood. In particular, there is a lack of systematic research and in-depth biomarker exploration in terms of gene expression, epigenetic changes and immune escape mechanisms in metastatic lesions. At present, the main clinical diagnosis methods for ovarian cancer metastasis include imaging examination, tumor marker detection and tissue biopsy. Imaging examinations mainly include CT scans, MRI and ultrasound examinations, which are used to assess tumor size, location and abdominal metastasis, but in occult metastasis types such as peritoneal metastasis, it is easy to lead to missed diagnosis or misdiagnosis. Due to the high heterogeneity of ovarian cancer, tissue biopsy may not fully reflect the complexity of metastasis, resulting in inaccurate judgment of metastatic lesions. Therefore, there is an urgent need for a biomarker that can characterize the chemotherapy resistance characteristics and possible prognostic problems of such patients, so as to prompt clinicians to adopt personalized or different chemotherapy regimens for treatment, so as to reduce the emergence of possible chemotherapy resistance and improve the survival of patients.

[0037] Based on the above problems, in the present invention:

[0038] By combining single-cell sequencing of ovarian cancer samples with differentially expressed genes from the pan-cancer data of the TCGA database, PABPC3 was screened out to be significantly elevated in metastatic ovarian cancer. Survival analysis showed that ovarian cancer patients with high expression of PABPC3 had a lower survival rate. PABPC3 was knocked down in the SKOV3 ovarian cancer cell line, and Transwell and scratch experiments were performed to verify that low expression of PABPC3 would limit the migration of ovarian cancer cells. In another ID8 cell line, overexpression of the PABPC3 gene can promote the migration of ovarian cancer cells. Further, verification was performed in an animal model, and the results showed that ovarian cancer cell lines overexpressing PABPC3 had more obvious migration ability in mice, and the tumor area was larger in liver and lung tissues.

[0039] To study whether PABPC3 affects the chemotherapy resistance of ovarian cancer, the CCK8 assay was used to detect the activity of ovarian cancer cells after treatment with chemotherapy drugs such as carboplatin, paclitaxel, and PRAP1 inhibitors. The results showed that ovarian cancer cells with high expression of PABPC3 had stronger drug resistance. Next, we used cases of ovarian cancer patients in the public database to evaluate their survival after chemotherapy. We found that after treatment with drugs such as carboplatin and paclitaxel, the higher the level of PABPC3 in the patient's body, the worse the prognosis. In addition, we performed PABPC3 histochemical staining on some clinical samples and divided the patients into high-expression PABPC3 group and low-expression PABPC3 group according to the level of PABPC3 in their tissues. The survival curves also showed obvious differences, and patients with high expression of PABPC3 had a worse prognosis.

[0040] In summary, the present invention proves the use of PABPC3 as a marker for evaluating chemotherapy and prognosis of metastatic ovarian cancer through discovery-verification experiments. Specifically, it is found that the level of PABPC3 in ovarian cancer will significantly affect the metastasis of ovarian cancer, and high levels of PABPC3 will promote the metastasis of ovarian cancer cells to other organs. After inhibiting the level of PABPC3, the migration ability of ovarian cancer cell lines can be significantly reduced. In the commonly used mouse model, it is also found that cell lines with high expression of PABPC3 have higher proliferation activity and migration ability in mice. In ovarian cancer cell lines, chemotherapy drugs are used to treat them, and it is found that cell lines with high expression of PABPC3 have higher drug resistance activity; PABPC3 immunohistochemical staining is performed on clinically derived ovarian cancer tissues, and clinical cases are divided into high expression PABPC3 group and low expression PABPC3 group, which proves that patients with high expression of PABPC3 have worse prognosis and survival, indicating that PABPC3 can indeed be used as a new indicator for the evaluation and diagnosis of metastatic ovarian cancer, and has good clinical application prospects.

[0041] Therefore, PABPC3 can be used as an indicator to evaluate the metastatic characteristics and prognosis of ovarian cancer. The higher its level in patients, the higher the risk of metastasis and chemotherapy resistance. In clinical practice, corresponding preventive and therapeutic measures can be taken for patients with high PABPC3 expression levels.

[0042] The present invention provides the use of the PABPC3 gene as a marker for evaluating the prognosis of ovarian cancer.

[0043] Preferably, the prognosis includes ovarian cancer metastasis risk or chemotherapy resistance.

[0044] Based on the above findings, the present invention provides a kit for evaluating the prognosis of ovarian cancer, wherein the kit can detect the expression level of the PABPC3 gene.

[0045] Preferably, the kit contains substances necessary for quantifying the PABPC3 gene, such as primers for amplifying the PABPC3 gene.

[0046] Preferably, the detection step includes but is not limited to:

[0047] S1. Extract sample genomic DNA and quantify the PABPC3 gene therein;

[0048] S2. Determine the prognosis of ovarian cancer based on the expression level of PABPC3 gene.

[0049] Preferably, the quantitative method includes but is not limited to real-time fluorescence quantitative PCR (qPCR) and the like.

[0050] Preferably, the kit or primers of the present invention can detect PABPC3 genes in different species as needed, preferably humans, and the Gene ID of human PABPC3 is 5042. If it is necessary to use the kit or primers of the present invention for detecting other target species, those skilled in the art can find sequences homologous to the genes listed in the present invention in the target species, and set primers according to conventional methods to achieve detection.

[0051] The present invention also provides the use of a substance for inhibiting the expression of the PABPC3 gene in the preparation of a drug for treating ovarian cancer.

[0052] Preferably, the substance that inhibits the expression of the PABPC3 gene includes, but is not limited to, siRNA, shRNA, lentivirus, etc. More preferably, the substance targets and reduces the expression of the PABPC3 gene in tumor cells.

[0053] Preferably, the ovarian cancer therapeutic drug is used to prevent or treat the metastasis of ovarian cancer, and / or improve the drug resistance generated during the treatment of ovarian cancer.

[0054] The present invention also provides a composition for treating ovarian cancer. Preferably, the composition is a pharmaceutical composition, which contains the above-mentioned substance that inhibits the expression of the PABPC3 gene, and may also contain other effective ingredients, and a pharmaceutically acceptable carrier. Generally, these substances can be formulated in a non-toxic, inert and pharmaceutically acceptable aqueous carrier medium, wherein the pH is generally about 5-8, preferably about 6-8, and the pH value may vary with the properties of the formulated substance, and the technician can adjust it as needed. The formulated pharmaceutical composition can be administered by conventional routes, including (but not limited to): intratumoral, intravenous, or local administration.

[0055] The pharmaceutical composition of the present invention contains a safe and effective amount (such as 0.001-99wt%, preferably 0.01-90wt%, more preferably 0.1-80wt%) of the above-mentioned substance for inhibiting PABPC3 gene expression of the present invention and a pharmaceutically acceptable carrier. Such carriers include (but are not limited to): fillers, excipients, stabilizers, diluents, adhesives, lubricants, surfactants or combinations thereof. The pharmaceutical preparation should match the mode of administration. The pharmaceutical composition of the present invention can be prepared in the form of an injection, for example, by conventional methods using physiological saline or an aqueous solution containing glucose and other adjuvants. Pharmaceutical compositions such as injections and solutions are preferably manufactured under sterile conditions. The amount of active ingredient administered is a therapeutically effective amount. In addition, the polypeptide of the present invention can also be used with other therapeutic agents.

[0056] When using a pharmaceutical composition, a safe and effective amount of the drug is administered to an individual. The specific dosage should also take into account factors such as the route of administration and the patient's health condition, which are all within the skills of a skilled physician.

[0057] Example 1 Screening of differentially expressed genes

[0058] In order to explore the changes in gene expression levels after ovarian cancer metastasis, the ovarian cancer single-cell data were classified and grouped, and the epithelial cell group was selected for further analysis, divided into ovarian cancer in situ group and metastasis group. The differential genes between the two groups were screened through bioinformatics analysis, and a total of 4348 genes were screened. At the same time, through TCGA pan-cancer data analysis, genes with significant differences in patient prognosis were screened, and a total of 323 differential genes were obtained. The intersection genes of the two were taken and sorted according to the size of the P value. The results showed that PABPC3 ranked first as the most significant differential gene ( Figure 1 ). Based on the high and low expression of the PABPC3 gene, ovarian cancer patients in the TCGA database were divided into two groups for survival analysis. The results showed that patients with high PABPC3 had a worse prognosis ( Figure 2 ), suggesting that PABPC3 may be a target gene that can affect the prognosis of patients.

[0059] Example 2 PABPC3 knockdown can slow the migration of ovarian cancer cells

[0060] The human ovarian cancer cell line SKOV3 was used for analysis. First, the PABPC3 gene expression was knocked down by siRNA technology to reduce the level of PABPC3 in the cell line. SKOV3 cells were seeded in six-well plates and cultured to 30-40% confluence before siRNA transfection. The siRNA solutions used for transfection were siPABPC3#1 (sequence: GCGTATGTGAACTTCCAGCAT) and siPABPC3#2 (sequence: GCCACTAAAGCAGTTACAGAA). Using Lipofectamine 2000 transfection reagent, siRNA and transfection reagent were mixed in Opti-MEM serum-free medium, incubated for 15 minutes to form a transfection complex, and then added to the cells and cultured for 24 hours. After 24 hours, the medium was replaced with complete medium containing 10% fetal bovine serum (FBS) and cultured for 48 hours. The transfection efficiency was verified by real-time quantitative PCR (RT-qPCR) to confirm the reduction in the expression level of the PABPC3 gene.

[0061] Next, the effect of PABPC3 knockdown on cell migration ability was evaluated by Transwell migration assay. The transfected SKOV3 cells (PABPC3 knockdown group and control group) were resuspended in serum-free McCoy's 5A medium, and 1×104 cells were inoculated into the upper chamber of a 24-well Transwell chamber (Corning, 3422) per well. 600 μL of McCoy's 5A medium containing 10% FBS was added to the lower chamber as a chemokine to promote cell migration. The chamber was placed in an incubator and incubated for 42 hours, during which the cells were allowed to migrate to the lower layer. After the incubation, the upper culture medium was discarded, the chamber was washed three times with PBS, and then the cells were fixed with 75% ethanol for 10 minutes, and then stained with crystal violet staining solution for 5 minutes. Finally, the unmigrated cells in the upper layer were removed with a wet cotton swab, and five random fields of view were selected under a microscope to count the number of cells that migrated to the lower layer. In order to further verify the effect of PABPC3 on cell migration, a scratch experiment was also performed. An appropriate amount of SKOV3 cells were inoculated in a 12-well plate to just cover the entire bottom of the culture dish. After the cells adhered to the wall, serum-free culture medium was replaced, and a gun tip was used to gently scratch a scar in each well to form a clear scratch area. After the scratch, the wound healing was observed at 0 hours, 24 hours, and 48 hours respectively. At each time point, images of the wound healing area were taken using a microscope, and the degree of wound closure was counted. The results showed that after knocking down PABPC3, the wound healing ability of the cells was significantly weakened ( Figure 3 ), indicating that the cell migration ability was significantly reduced ( Figure 4 These two experiments showed that after knocking down PABPC3, the migration ability of SKOV3 cells was significantly weakened, the number of migrating cells decreased, and the wound healing ability was reduced, further proving the important role of PABPC3 in the migration of ovarian cancer cells.

[0062] Example 3 Overexpression of PABPC3 can promote the migration of ovarian cancer cells

[0063] The mouse ovarian cancer cell line ID8 was used for analysis. First, the PABPC3 plasmid (PABPC3 is human, Gene ID: 5042) was transferred into the ID8 cell line by lentiviral transfection to achieve overexpression of PABPC3. HEK293T cells were packaged using a lentiviral vector containing the PABPC3 gene, and the viral supernatant was collected and transfected into ID8 cells. When the cell density reached 30-40%, the viral solution was added for transfection. After 48 hours, puromycin was used to screen for the ID8 cell line that stably overexpressed PABPC3, and the overexpression effect was verified by Western blot.

[0064] Next, the effect of PABPC3 overexpression on the migration ability of ID8 cells was evaluated by Transwell migration assay. ID8 cells overexpressing PABPC3 and control group cells (cells not transfected or transfected with empty vector) were resuspended in serum-free DMEM medium, and 1×104 cells were inoculated into the upper chamber of a 24-well Transwell chamber (Corning, 3422) per well. 600 μL of culture medium containing 10% FBS was added to the lower chamber. The chamber was placed in an incubator and incubated for 30 hours. After the incubation, the upper culture medium was discarded, the chamber was washed three times with PBS, and then the cells were fixed with 75% ethanol for 10 minutes, and then stained with crystal violet staining solution for 5 minutes. Five random fields of view were selected under the microscope, and the number of cells that migrated to the lower layer was counted. In addition, the effect of PABPC3 overexpression on cell migration was further verified using a scratch assay. An appropriate amount of ID8 cells was inoculated in a six-well plate to cover the entire bottom of the culture dish. After the cells adhered to the wall, serum-free DMEM medium was added, and a scar was gently scratched in each well using a pipette tip to form a clear scratch area. After scratching, the wound healing was observed at 0 hours, 4.5 hours, 9 hours, and 13.5 hours. At each time point, images of the wound healing area were taken using a microscope, and the degree of wound closure was counted. The results showed that after overexpression of PABPC3, the wound healing ability was significantly enhanced ( Figure 5 ), indicating that overexpression of PABPC3 promoted the migration ability of ID8 cells. At the same time, after overexpression of PABPC3, the migration ability of ID8 cells was significantly enhanced, and the number of migrating cells increased ( Figure 6 ), and the wound healing ability was improved, further proving the promoting role of PABPC3 in the migration of ovarian cancer cells.

[0065] Example 4 Overexpression of PABPC3 can promote the development of ovarian cancer in vivo

[0066] Nude mice were used for tumor metastasis model experiments. First, luciferase-labeled ID8 cells and ID8 cell lines overexpressing PABPC3 were injected into nude mice by intraperitoneal injection to establish an ovarian cancer tumor metastasis model. ID8 cells overexpressing PABPC3 and control group ID8 cells (cells not transfected or transfected with an empty vector) were injected into the peritoneal cavity of nude mice, with 5×106 cells injected per mouse, and randomly divided into groups (n=6 / group). The luciferase activity in mice was measured on the 12th, 22nd and 29th days after injection. To this end, before each measurement, mice were injected with luciferin (Meilunbio, MB1834-2), and then fluorescent images of mice were taken using the IVIS imaging system (Perkin Elmer, IVIS Lumina XR III) to evaluate luciferase activity. By regularly measuring the luciferase activity in mice, it was found that the luciferase activity of mice in the PABPC3 overexpression group increased significantly over time, while the fluorescence intensity of mice in the control group only increased slowly. This indicates that ID8 cells overexpressing PABPC3 have a stronger metastatic ability in mice and a faster metastatic rate. On day 29, the mice were killed and the organs were removed for tumor counting. Particular attention was paid to liver tissue, which was analyzed histologically by H&E staining. The staining results showed that in the group overexpressing PABPC3, the tumor area in the liver was larger and the tumor metastasis was obvious ( Figure 7 ). These results indicate that overexpression of PABPC3 significantly enhances the metastatic ability of ovarian cancer cells in vivo.

[0067] Example 5 Overexpression of PABPC3 can increase chemotherapy resistance in ovarian cancer cells

[0068] To investigate the effect of PABPC3 on chemoresistance of ovarian cancer cells, we used carboplatin, paclitaxel, a commonly used first-line chemotherapeutic drug, and olaparib, a PARP inhibitor widely used in the treatment of ovarian cancer in recent years, to treat ID8 cells and ID8 cell lines overexpressing PABPC3. ID8 cells overexpressing PABPC3 and control group ID8 cells were seeded in 96-well plates, and treated with different concentrations of drugs when the cells grew to 70-80% confluence. The drug concentration gradient was carboplatin (0, 10, 20, 50 μg / mL), paclitaxel (0, 0.01, 0.02, 0.05 μg / mL), and olaparib (0, 10, 20, 50 μM). All cell groups were first cultured in the presence of drugs for 24 hours, and then replaced with normal culture medium and continued to culture until the fourth day. The CCK8 method was used to evaluate cell viability after drug treatment. The specific operation is to add CCK8 reagent (New Cyme, C6005) 24 hours and 4 days after drug treatment, respectively, and incubate in a 37°C incubator for 1 hour. Then use an enzyme reader to detect the absorbance (OD value) of each well at 450nm, and calculate the viability of each group of cells. After 24 hours of treatment, on the 4th day, it was observed that the cell viability of the overexpression PABPC3 group was significantly higher than that of the control group, indicating that overexpression of PABPC3 significantly enhanced the viability of cells ( Figure 8 ). In addition, within 48 hours of treatment with different drugs, ID8 cells overexpressing PABPC3 showed higher cell viability in the paclitaxel, carboplatin, and olaparib treatment groups, especially at higher doses of the drug, the difference in viability was particularly obvious ( Fig. 9 ). Compared with the control group, cells overexpressing PABPC3 showed stronger drug tolerance, further demonstrating the important role of PABPC3 in chemoresistance of ovarian cancer cells.

[0069] Example 6 Effect of PABPC3 levels on prognosis in clinical patients

[0070] To further investigate the role of PABPC3 in clinical prognosis, we analyzed the overall survival data of chemotherapy patients based on PABPC3 levels. Using samples of ovarian cancer patients from the database, we found that patients with high PABPC3 expression had significantly shorter overall survival (P < 0.05) regardless of whether they were treated with carboplatin, docetaxel, or a combination of carboplatin and paclitaxel. Fig.10 ).

[0071] In addition, to further validate our findings, we established a cohort of 66 patients with metastatic ovarian cancer, and performed immunohistochemical staining on tissues from metastatic lesions of clinical patients (clinical samples were derived from ovarian cancer patients from the First Affiliated Hospital of Soochow University) to explore the expression level of PABPC3 in the tissues. During tissue section processing, conventional paraffin embedding and sectioning techniques were first used, and immunohistochemical staining was performed using anti-PABPC3 antibodies. The samples were grouped according to the expression of PABPC3 (low PABPC3 and high PABPC3), and the progression-free survival was analyzed. The results showed that compared with the PABPC3 low expression group, the progression-free survival of the PABPC3 high expression group was significantly shortened ( Fig.11 ), further demonstrated the important role of PABPC3 in ovarian cancer metastasis and suggested the potential of PABPC3 as a marker for poor prognosis in ovarian cancer.

[0072] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. Use of the PABPC3 gene as a marker for assessing the prognosis of ovarian cancer.

2. The use according to claim 1, characterized in that The prognosis includes risk of ovarian cancer metastasis and / or chemotherapy resistance.

3. A kit for evaluating the prognosis of ovarian cancer, characterized in that: The kit can detect the expression level of the PABPC3 gene.

4. The kit according to claim 3, characterized in that The kit contains substances necessary for quantifying the PABPC3 gene.

5. The kit according to claim 4, characterized in that The detection steps include: S1. Extract genomic DNA of the sample to be tested and quantify the PABPC3 gene therein; S2. Determine the prognosis of ovarian cancer based on the expression level of PABPC3 gene.

6. The kit according to claim 3, characterized in that The kit contains primers for amplifying the PABPC3 gene.

7. Application of primers for amplifying the PABPC3 gene in the preparation of a kit for evaluating the prognosis of ovarian cancer.

8. Use of substances that inhibit PABPC3 gene expression in the preparation of drugs for the treatment of ovarian cancer.

9. The use according to claim 8, characterized in that: Substances that inhibit PABPC3 gene expression include siRNA, shRNA or lentivirus.

10. A composition for treating ovarian cancer, characterized in that: Contains substances that inhibit the expression of the PABPC3 gene; Optionally, it also contains a pharmaceutically acceptable carrier.

Images