Nucleic acid aptamer for accurate molecular typing of multi-parameter bladder cancer cells and application of nucleic acid aptamer

Abstract

The invention discloses a nucleic acid aptamer for accurate molecular typing of multi-parameter bladder cancer cells and application of the nucleic acid aptamer, and belongs to the technical field of biology. The technical problem to be solved in the invention is how to realize early accurate diagnosis of bladder cancer and molecular typing of bladder cancer in clinic. In order to solve the technical problem, the invention comprises nucleic acid aptamers including nucleic acid aptamers Seq12a, BCfsw1-3a, BCfsw1-4a, BCfsw1-10a, BCfsw2-19a and BCfsw2-19a, and a composition composed of the nucleic acid aptamers. According to the application, nucleic acid aptamer screening is carried out aiming at different levels of bladder cancer cells and bladder cancer clinical urine samples to obtain nucleic acid aptamer groups covering information of different types of bladder cancer, and cell molecular typing is realized on bladder cancer cells and normal cell lines; and the kit is preliminarily applied to clinical urine sample molecular typing and bladder cancer recurrence course monitoring.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to nucleic acid aptamers and applications thereof for accurate molecular typing of multi-parameter bladder cancer cells. Background Art

[0002] Bladder cancer is one of the most common malignant tumors of the urinary system and is more common in men than in women. Bladder cancer is prone to recurrence, invasion and metastasis. About 5% of newly diagnosed bladder cancer patients have developed distant metastases. Although most low-grade tumors have a low probability of progression and a high survival rate, short-term recurrences often occur after surgical treatment. Bladder cancer seriously threatens human health, but its diagnosis and treatment levels have almost stagnated. With the development of molecular biology, many molecular typing schemes for bladder cancer have been proposed. Molecular typing of bladder cancer can help predict patients' responsiveness to drugs and judge patients' prognosis. However, compared with other cancers, the molecular typing of bladder cancer is still in its infancy, and a unified, mature and feasible molecular typing scheme is needed to guide the diagnosis and treatment of bladder cancer.

[0003] Nucleic acid aptamers are single-stranded DNA or RNA fragments with specific three-dimensional conformations. They can identify a variety of target types, from small molecules to tumor cells. They are widely used in the discovery and identification of various disease biomarkers, and also provide new ideas and methods for the precise diagnosis and treatment of bladder cancer. Nucleic acid aptamers are called "scientists' antibodies". Compared with antibodies, nucleic acid aptamers have the advantages of low immunogenicity and easy modification. Nucleic acid aptamers are screened by various SELEX methods. According to the different SELEX objects, traditional screening methods can be divided into: small molecule screening, cell screening, protein screening, tissue screening, in vivo screening, etc. This application mainly uses cell screening (Cell-SELEX) technology to screen specific DNA nucleic acid aptamers. Cell-SELEX is a technology that uses the whole cell as a target to screen specific DNA aptamers. It can identify the natural conformation of membrane proteins and realize the screening of multi-target nucleic acid aptamers. At present, nucleic acid aptamers have been used to molecularly type a variety of cancers, including molecular recognition of different leukemia subtypes, molecular typing of 6 cancer exosomes, and so on. There has been no research on the molecular typing of bladder cancer using aptamers. The multi-parameter aptamer panel has broad application prospects for molecular typing of bladder cancer. Some aptamers have been reported for bladder cancer, a tumor with a high incidence, such as EBA, a aptamer that specifically binds to EN2, SPL3C, a aptamer that specifically binds to CKAP4, and TB-5, a aptamer that specifically binds to NCL. However, due to the high heterogeneity of bladder cancer, these aptamers targeting a single marker cannot meet the precise diagnosis of bladder cancer for the time being. In addition, aptamers screened in cell lines are often difficult to reflect the actual situation of clinical samples, and sometimes aptamers obtained in cell screening are difficult to bind to clinical samples.

[0004] Therefore, screening different clinical samples to obtain nucleic acid aptamer probe combinations containing more clinical sample information is of great significance for the detection of clinical samples and the discovery of markers. Summary of the invention

[0005] The technical problem to be solved by this application is: how to achieve early and accurate diagnosis of bladder cancer and molecular typing of bladder cancer in clinical practice. To solve this technical problem, this application provides the following technical solutions:

[0006] The present application provides a nucleic acid aptamer composition, which includes at least a nucleic acid aptamer Seq12a, and the nucleic acid aptamer Seq12a is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.21.

[0007] Furthermore, the nucleic acid aptamer is a composition, and the nucleic acid aptamer composition also includes all or part of the following six nucleic acid aptamers:

[0008] (A3) Nucleic acid aptamer BCfsw1-3a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.3;

[0009] (A4) Nucleic acid aptamer BCfsw1-4a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.4;

[0010] (A10) Nucleic acid aptamer BCfsw1-10a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.10;

[0011] (A17) Nucleic acid aptamer BCfsw2-19a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.17;

[0012] (A18) Nucleic acid aptamer BCfsw2-23a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.18;

[0013] (A1) Nucleic acid aptamer BCfsw1-1a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.1;

[0014] The part is one or more nucleic acid aptamers.

[0015] Furthermore, the nucleic acid aptamer composition also includes all or part of the following fourteen nucleic acid aptamers:

[0016] (A2) Nucleic acid aptamer BCfsw1-2a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.2;

[0017] (A5) Nucleic acid aptamer BCfsw1-5a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.5;

[0018] (A6) Nucleic acid aptamer BCfsw1-6a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.6;

[0019] (A7) Nucleic acid aptamer BCfsw1-7a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.7;

[0020] (A8) Nucleic acid aptamer BCfsw1-8a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.8;

[0021] (A9) Nucleic acid aptamer BCfsw1-9a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.9;

[0022] (A11) Nucleic acid aptamer BCfsw2-5a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.11;

[0023] (A12) Nucleic acid aptamer BCfsw2-6a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.12;

[0024] (A13) Nucleic acid aptamer BCfsw2-10a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.13;

[0025] (A14) Nucleic acid aptamer BCfsw2-14a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.14;

[0026] (A15) Nucleic acid aptamer BCfsw2-16a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.15;

[0027] (A16) Nucleic acid aptamer BCfsw2-17a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.16;

[0028] (A19) Nucleic acid aptamer BCfsw2-34a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.19;

[0029] (A20) Nucleic acid aptamer BCfsw2-35a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.20;

[0030] The part is one or more nucleic acid aptamers.

[0031] The present application also provides any one of the following twenty-one nucleic acid aptamers:

[0032] (A21) Nucleic acid aptamer Seq12a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.21;

[0033] (A3) Nucleic acid aptamer BCfsw1-3a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.3;

[0034] (A4) Nucleic acid aptamer BCfsw1-4a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.4;

[0035] (A10) Nucleic acid aptamer BCfsw1-10a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.10;

[0036] (A17) Nucleic acid aptamer BCfsw2-19a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.17;

[0037] (A18) Nucleic acid aptamer BCfsw2-23a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.18;

[0038] (A1) Nucleic acid aptamer BCfsw1-1a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.1;

[0039] (A2) Nucleic acid aptamer BCfsw1-2a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.2;

[0040] (A5) Nucleic acid aptamer BCfsw1-5a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.5;

[0041] (A6) Nucleic acid aptamer BCfsw1-6a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.6;

[0042] (A7) Nucleic acid aptamer BCfsw1-7a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.7;

[0043] (A8) Nucleic acid aptamer BCfsw1-8a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.8;

[0044] (A9) Nucleic acid aptamer BCfsw1-9a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.9;

[0045] (A11) Nucleic acid aptamer BCfsw2-5a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.11;

[0046] (A12) Nucleic acid aptamer BCfsw2-6a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.12;

[0047] (A13) Nucleic acid aptamer BCfsw2-10a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.13;

[0048] (A14) Nucleic acid aptamer BCfsw2-14a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.14;

[0049] (A15) Nucleic acid aptamer BCfsw2-16a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.15;

[0050] (A16) Nucleic acid aptamer BCfsw2-17a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.16;

[0051] (A19) Nucleic acid aptamer BCfsw2-34a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.19;

[0052] (A20) Nucleic acid aptamer BCfsw2-35a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.20.

[0053] The present application also provides nucleic acid aptamer derivatives, wherein the nucleic acid aptamer derivatives are obtained by connecting fluorescein, anti-tumor drugs, radioactive elements, biological enzymes, biotin and / or nanomaterials to one end or the middle of the above-mentioned nucleic acid aptamer to obtain nucleic acid aptamer derivatives having the same function as the nucleic acid aptamer.

[0054] The present application also provides a nucleic acid aptamer derivative composition, which comprises at least two nucleic acid aptamer derivatives among the above-mentioned nucleic acid aptamer derivatives.

[0055] In some embodiments of the present application, fluorescein isothiocyanate (FITC) is linked to the single nucleic acid aptamer.

[0056] The present application also provides the above-mentioned nucleic acid aptamer, the above-mentioned nucleic acid aptamer derivative, the above-mentioned nucleic acid aptamer and / or the above-mentioned nucleic acid aptamer derivative in any of the following uses:

[0057] (B1) Use in the preparation of a product for screening or assisting in screening bladder cancer cells and / or bladder cancer patient samples;

[0058] (B2) use in identifying or assisting in identifying bladder cancer cells and / or bladder cancer patient samples;

[0059] (B3) Use in the preparation of products for molecular typing or auxiliary molecular typing of bladder cancer cells and / or bladder cancer patients;

[0060] (B4) application in molecular typing or auxiliary molecular typing of bladder cancer cells and / or bladder cancer patients;

[0061] (B5) Use in the preparation of a product for imaging bladder cancer cells and / or bladder cancer patient samples

[0062] (B6) Application in imaging bladder cancer cells and / or bladder cancer patient samples;

[0063] (B7) Application in the preparation of a drug for treating bladder cancer

[0064] (B8) Use as a drug in the treatment of bladder cancer;

[0065] (B9) Application in the preparation of products for bladder cancer related physiological and pathological research.

[0066] Furthermore, the products include but are not limited to: detection reagents, imaging reagents, drugs, and research models.

[0067] Specifically, in the present application, the products described in (B1) and (B3) can be biosensors. The working principle of the applications (B1) to (B4) is that when the nucleic acid aptamer specifically binds to the target substance, its configuration changes accordingly. This characteristic is used to develop an electrochemical sensor based on the change of nucleic acid aptamer configuration, namely an E-AB (Electrochemical aptamer-based) sensor. It has broad application prospects in the fields of medical diagnosis and so on.

[0068] Specifically, in the present application, the product described in (B5) can be an imaging agent. The working principle of (B5) and (B6) is that after the nucleic acid aptamer binds to the target substance, the real-time monitoring and imaging of the target molecule is achieved through signal transduction mechanisms such as fluorescence and chemiluminescence.

[0069] Specifically, in the present application, the product described in (B7) can be a drug delivery carrier or a drug. The applications described in (B7) and (B8) can be achieved through drug delivery. The working principle of drug delivery utilizes nucleic acid aptamers to bind to specific target cells or tissues for drug delivery. By combining drugs with nucleic acid aptamers, drugs can be accurately delivered to diseased cells or tissues, thereby improving the efficacy of drugs and reducing side effects.

[0070] In the present application, the bladder cancer cells and / or bladder cancer patient samples may be from a person having at least one of the following symptoms:

[0071] 1) Hematuria

[0072] 2) Ureteral obstruction with at least one of the following symptoms: low back pain, lower limb edema, bone pain, urinary retention and weight loss.

[0073] Furthermore, in the application, the bladder cancer cells include but are not limited to: human bladder cancer cell YTS-1, human bladder cancer cell T24, human bladder cancer cell 5637 and human bladder cancer cell KK47.

[0074] Furthermore, in the application, the bladder cancer patient sample includes but is not limited to: patient urine, sediment in patient urine, cells in patient urine, patient lesion sampling and / or patient urinary tract sampling.

[0075] The present application also provides a reagent, the active ingredients of which include the above-mentioned nucleic acid aptamer (composition), and its derivatives, the above-mentioned nucleic acid aptamer (any one of the above-mentioned twenty nucleic acid aptamers) and its derivatives.

[0076] The reagent can be used for capturing, enriching and / or purifying bladder cancer cells and samples, can also be used for bladder cancer imaging or bladder cancer detection and identification, can also be used for molecular typing of bladder cancer cells or patients, and can also be used for diagnosis or treatment of bladder cancer.

[0077] The present application also provides a method for identifying or assisting in identifying bladder cancer cells and / or bladder cancer patient samples, the method comprising contacting the above-mentioned aptamer (composition) and its corresponding aptamer derivative, the above-mentioned aptamer (any one of the above-mentioned twenty aptamers) and its corresponding aptamer derivative and / or the above-mentioned reagent with bladder cancer cells and / or bladder cancer patient samples to identify or assist in identifying bladder cancer cells and / or bladder cancer patient samples;

[0078] The present application also provides a method for molecular typing of bladder cancer cells and / or bladder cancer patients, the method comprising contacting the above-mentioned nucleic acid aptamer (composition) and its corresponding nucleic acid aptamer derivative, the above-mentioned nucleic acid aptamer (any one of the above-mentioned twenty nucleic acid aptamers) and its corresponding nucleic acid aptamer derivative and / or the above-mentioned reagent with bladder cancer cells and / or bladder cancer patient samples to perform molecular typing of bladder cancer cells and / or bladder cancer patients.

[0079] The bladder cancer described in this application includes, but is not limited to, urothelial (transitional cell) carcinoma, squamous cell carcinoma and adenocarcinoma, urachal carcinoma, Müllerian duct malignancy, neuroendocrine tumors (such as small cell carcinoma), mesenchymal tumors, mixed carcinomas, sarcomatoid carcinomas and metastatic carcinomas, etc.

[0080] T24 cells are human bladder urothelial carcinoma, a metastatic cell adenocarcinoma. YTS-1 cells are muscle-invasive bladder cancer cells. 5637 cells are human bladder cancer cells. KK47 cells are non-muscle-invasive bladder cancer cells.

[0081] This application screens nucleic acid aptamers for different levels of bladder cancer cells and clinical urine samples of bladder cancer, and obtains a nucleic acid aptamer group covering information of different types of bladder cancer, realizes cell molecular typing in bladder cancer cells and normal cell lines, and preliminarily applies it to molecular typing of clinical urine samples and monitoring of the recurrence course of bladder cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0082] Figure 1 During the screening process of the four types of cells, the nucleic acid library was screened separately and monitored by flow cytometry combined with the corresponding cells.

[0083] Figure 2 The abundance graphs of the top 100 sequences in the high-throughput sequencing of the cell screening enrichment library. A. The abundance graph of the top 100 sequences in the 10th round of YTS-1 cell screening. B. The abundance graph of the top 100 sequences in the 5th round of T24 cell screening. C. The abundance graph of the top 100 sequences in the 5th round of 5637 cell screening. D. The abundance graph of the top 100 sequences in the 4th round of KK47 cell screening.

[0084] Figure 3 Predicted secondary structures for 20 sequences.

[0085] Figure 4 Flow cytometric analysis of the binding of 20 sequences to cells.

[0086] Figure 5 is the equilibrium dissociation constant of nucleic acid aptamers BCfsw1-1a, BCfsw1-3a, BCfsw1-4a, BCfsw1-10a, BCfsw2-19a, and BCfsw2-23a.

[0087] Figure 6 Flow cytometric characterization of the screening libraries of urine screening rounds 1, 2, 4, and 5 and the positive and negative screens.

[0088] Figure 7 Urine samples for BCfsw1-1a detection. A. BCfsw1-1a binding to urine sediment of 5 patients with clinical pathological diagnosis of bladder cancer by flow cytometry. B. BCfsw1-1a binding to urine sediment of 5 healthy people by flow cytometry. C. Heat map of binding of 5 patients and 5 healthy people by aptamer BCfsw1-1a. Darker colors represent stronger binding of aptamer BCfsw1-1a to samples, and lighter colors represent weaker binding.

[0089] Figure 8 To detect urine samples using the bladder cancer clinical urine screening enrichment library. A. Flow cytometry binding of urine sediments of 9 patients with clinical pathological diagnosis of bladder cancer by urine screening fifth round enrichment library R5. B. Flow cytometry binding of urine sediments of 8 healthy people by urine screening fifth round enrichment library R5. C. Heat map of binding of 9 patients and 8 healthy people using screening fifth round enrichment library R5. The darker the color, the stronger the binding of the enrichment library to the sample, and the lighter the color, the weaker the binding.

[0090] Fig. 9 Cell molecular typing for universal bladder cancer aptamer probe package. A. Sequence difference analysis of high-throughput sequencing, the color of the circle indicates the Log2 value of the sequence copy number, the redder the color, the higher the copy number, the bluer the color, the lower the copy number. B. Sequence copy number analysis of 88 differential nucleic acid aptamers on bladder cancer cells YTS-1 and normal cells SV-HUC-1, the redder the color, the higher the copy number, the bluer the color, the lower the copy number. C. Six high-throughput sequencing correlation analysis, correlation analysis of differential nucleic acid aptamers in high-throughput sequencing of bladder cancer cells YTS-1. D. Correlation analysis of differential nucleic acid aptamers in high-throughput sequencing of normal cells SV-HUC-1. The darker the red, the higher the correlation, and the darker the blue, the lower the correlation. E. Sequence copy number analysis of differential nucleic acid aptamers on bladder cancer cells YTS-1, T24, KK47, 5637 and normal cells SV-HUC-1, the redder the color, the higher the copy number, and the bluer the color, the lower the copy number.

[0091] Fig.10 Seq12a sequence characterization. A. Flow cytometric binding of nucleic acid aptamer seq12a on YTS-1 and SV-HUC-1 cells. Random is a random control sequence. B. Equilibrium dissociation constant of nucleic acid aptamer seq12a.

[0092] Fig.11 Validation of the heat map of high-throughput sequencing of 20 sequences. A. Distribution of 20 sequences and flow cytometry binding on YTS-1 cells, T24 cells, KK47 cells, 5637 cells, and SV-HUC-1 cells. B. Heat map of copy number of high-throughput sequencing of 20 sequences, repeated four times. C. Correlation analysis of the four high-throughput sequencing results of 20 sequences, the darker the red, the higher the correlation, and the darker the blue, the lower the correlation.

[0093] Fig.12Correlation analysis between flow cytometry results and four high-throughput sequencing. A. Correlation analysis between flow cytometry results and four high-throughput sequencing in YTS-1 cells. B. Correlation analysis between flow cytometry results and four high-throughput sequencing in T24 cells. C. Correlation analysis between flow cytometry results and four high-throughput sequencing in SV-HUC-1 cells. D. Correlation analysis between flow cytometry results and four high-throughput sequencing in 5637 cells. Darker red means higher correlation, darker blue means lower correlation. DETAILED DESCRIPTION

[0094] With the rapid development of molecular biology and the continuous emergence of biological detection technologies, it is necessary and urgent to accurately classify bladder cancer through molecular characteristics to guide bladder cancer treatment. Molecular classification of bladder cancer helps clinicians predict patients' responsiveness to drugs and judge patients' prognosis. It is of great significance for the diagnosis and treatment of bladder cancer and also provides direction for precision treatment. Nucleic acid aptamers are single-stranded DNA or RNA fragments with specific three-dimensional conformations. They can recognize a variety of target types, from small molecules to tumor cells, and provide new ideas and methods for the precise diagnosis and treatment of bladder cancer.

[0095] This application uses Cell-SELEX technology to screen different levels of bladder cancer cell lines and urine exfoliated substances from clinical patient urine samples, and obtains a series of nucleic acid aptamers with good affinity to bladder cancer cells. Using the bladder cancer nucleic acid library, a bladder cancer nucleic acid aptamer probe package was constructed. This probe package can effectively distinguish bladder cancer cells of all levels and normal cells. The high-throughput sequencing results of the high-affinity nucleic acid aptamer probe are highly consistent with the flow typing results of its fluorescent labeling, indicating that the high-throughput sequencing technology based on molecular ID tags can achieve multi-parameter molecular typing of tumor cells. The nucleic acid aptamer probe package was further used for the detection of urine from bladder cancer patients and healthy people. It was found that the nucleic acid aptamer probe package can effectively distinguish urine samples from tumor patients and healthy patients, and there are significant changes before and after surgery. The nucleic acid aptamer probe package detection strategy provides a multi-parameter detection means and method for accurate molecular typing of bladder cancer, guiding medication, and prognosis of health.

[0096] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0097] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0098] The cell names, sources and culture media used in the following examples are shown in Table 1, and the operating steps of the examples are not repeated here.

[0099] Table 1 Cell lines used in this application

[0100] Cell lines Chinese name Culture medium YTS-1 Human bladder cancer cells (G4 grade) RPMI1640 T24 Human bladder cancer cells (G3 grade) Mccoy's 5A 5637 Human bladder cancer cells (G2 grade) DMEM KK47 Human bladder cancer cells (G1 grade) RPMI1640 SV-HUC-1 Immortalized human bladder epithelial cells Ham's F12K

[0101] The above five types of cells are all stored in the sample bank of Zhejiang Cancer Hospital.

[0102] The solution was prepared as follows:

[0103] (1) Washing Buffer: Add 2.5 mL of 1 M MgCl to 500 mL of DPBS solution. 2 and 2.25 g of D-glucose, mix well and store in a 4°C refrigerator.

[0104] (2) Binding Buffer: 1 mL of Binding Buffer is composed of 880 μL of Washing Buffer, 100 μL of 10 mg / L herring sperm DNA (HsDNA), and 20 μL of 5 mg / L bovine serum albumin (BSA). It is prepared and used immediately.

[0105] (3) 5×Mix component for PCR amplification: contains primers, dNTPs, Taq enzyme, 10×Buffer and H 2 The upstream primer is PTSS and the downstream primer is PTSAB.

[0106] The DPBS in the following examples is a product of Biosharp, and its product number is BL310A.

[0107] The enzyme-free digestion solution in the following examples is a product of Shanghai Yuanye Biotechnology Co., Ltd., and its product number is Yuanye R20103-100ml.

[0108] In this application, all H 2 O is DEPC H 2 O, all consumables used are sterilized by high temperature steam.

[0109] The quantitative tests in the following examples were repeated three times unless otherwise specified, and the results were averaged.

[0110] The following examples used GraphPad Prism, Python, and R language statistical software to process the data. The experimental results were expressed as mean ± standard deviation and tested using t-test. P < 0.05 (*) indicated a significant difference, and P < 0.001 (***) indicated a very significant difference.

[0111] Example 1: Screening and characterization of four bladder cancer cell aptamers

[0112] 1. Cell culture

[0113] Four bladder cancer cells, YTS-1, T24, KK47, and 5637, were used as positive screening cells in subsequent nucleic acid aptamer screening. One normal bladder epithelial cell, SV-HUC-1, was used as negative screening cell in subsequent nucleic acid aptamer screening. The cells were cultured at 37°C and 5% CO. 2 and 95% humidity, the culture medium is shown in Table 1. All cells were authenticated by short tandem repeat sequences (STR) and checked for mycoplasma contamination every 3 months.

[0114] 2. Aptamer Screening

[0115] When screening four types of bladder cancer cell aptamers, the same nucleic acid library and primers were used, which were designed as follows:

[0116] Random nucleic acid library (LibTS2): AAGGAGCAGCGTGGAGGATA-N 45 -CTCATGGACGTGCTGGTGAC, where N represents any random nucleotide of A, T, C, or G; forward primer (PTSS): 5'-FAM-AAGGAGCAGCGTGGAGGATA-3'; reverse primer (PTSAB): 5'-Biotin-GTCACCAGCACGTCCATGAG-3'. The random nucleic acid library (LibTS2) and primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0117] Dissolve 2OD nucleic acid library with 100uL DPBS, denature at 95°C for 5min, 4°C for 10min, and renature at room temperature for 15min to obtain the library for later use.

[0118] Before screening, 5×10 6Positive screening cells (YTS-1, T24, 5637 and KK47) and negative screening cells (SV-HUC-1) were inoculated in 10 cm culture dishes. After 48 hours, when the cells grew to 80% density, the culture medium was removed, washed once with DPBS, and digested separately with enzyme-free digestion solution in a 37°C incubator. After digestion, the cells were washed twice with 2 mL of washing buffer and collected. The treated negative screening cells were incubated with the library at 4°C in 1 mL of binding buffer (the incubation time corresponds to the negative screening time in Table 2-5). After the incubation, the supernatant was collected by centrifugation at 1200 rpm / min for 3 minutes. The supernatant contained ssDNA that was not bound to the negative screening cells. This supernatant was incubated with positive screening cells at 4°C (the incubation time corresponds to the positive screening time in Table 2-5). After the incubation of the supernatant with the positive screening cells, it was washed with washing buffer and centrifuged at 1200 rpm / min for 3 minutes to collect the cell pellet.

[0119] (2) Add 160 μL ddHO to the cell pellet 2 O, denature at 95℃ for 10min to dissociate the ssDNA bound to the cells, and collect the supernatant by centrifugation at 1200rpm / min for 3min. Use the collected supernatant as a template, add 5×Mix (containing forward primer PTSS and reverse primer PTSAB) to prepare PCR for preliminary amplification. After the optimal number of PCR cycles is determined by nucleic acid electrophoresis characterization, in order to meet the needs of the next round of screening, the screened library is further amplified according to the steps of preliminary amplification. Since the reverse primer PTSAB is modified with biotin, the PCR product is incubated with streptavidin sugar beads (cytiva17511301) by utilizing the strong binding of streptavidin to biotin, and a nucleic acid chain without biotin will be eluted, and the eluted single-stranded DNA is desalted with a desalting column (cytiva 17085301). After quantification by UV spectrophotometer NanoDrop, the sample was dried using a vacuum concentrator and the dry powder was collected and stored in a -80°C refrigerator to be used as the library for the next round of screening or for high-throughput sequencing.

[0120] (3) 10 rounds of screening were performed using normal bladder epithelial cells SV-HUC-1 as negative sieve cells and cells YTS-1 as positive sieve cells; 5 rounds of screening were performed using normal bladder epithelial cells SV-HUC-1 as negative sieve cells and T24 cells as positive sieve cells; 5 rounds of screening were performed using normal bladder epithelial cells SV-HUC-1 as negative sieve cells and 5637 cells as positive sieve cells; 4 rounds of screening were performed using normal bladder epithelial cells SV-HUC-1 as negative sieve cells and KK47 cells as positive sieve cells. The specific pressure changes during the screening process are shown in Tables 2, 3, 4, and 5.

[0121] Table 2 Changes in pressure for YTS-1 cell screening

[0122]

[0123] Table 3 Changes in T24 cell screening pressure

[0124]

[0125] Table 4 KK47 cell screening pressure changes

[0126]

[0127] Table 5 5637 cell screening pressure changes

[0128]

[0129] During the screening process, the enriched library was monitored by flow cytometry, such as Figure 1 As shown in the figure, the stronger the FITC fluorescence shift on the horizontal axis, the higher the degree of binding between the cells and the screening library. For the screening of YTS-1 cells, the binding between the screening library and the cells gradually increased with the increase in the number of screening rounds, and the library achieved a greater binding in the 10th round. The other three cells also had a greater binding with the corresponding cells in the last round.

[0130] 3. Database construction

[0131] Four cells were selected for the last round of library screening and incubated with the corresponding cells at 4°C for 30 min. After the incubation, the cells were washed twice with washing buffer and 1000 cells were sorted by flow cytometry. The cells were washed with washing buffer and centrifuged at 1200 rpm / min for 3 min to collect the cell pellet. 160 μL ddH 2O, denature at 95℃ for 10min to dissociate the ssDNA bound to the cells, centrifuge at 1200rpm / min for 3min to collect the supernatant. Add 2μM TSLK (sequence: AGG CAG ACA AGA CAG GT GTC ACC AGC ACG TCC A, final concentration 80nM), 2μM UMI1-5 (UMI1: CCTGTCTTGTCTGCCTACCT, UMI2: CCTGTCTTGTCTGCCTAGAT, UMI3: CCTGTCTTGTCTGCCTTACT, UMI4: CCTGTCTTGTCTGCCTTGAT, UMI5: CCTGTCTTGTCTGCCTTCGT, final concentration 80nM respectively), 1×DNALigase Buffer to the collected supernatant, mix well, put into PCR instrument at 95℃ for 3min, 55℃ for 3min, leave at room temperature for a few minutes, add 10×T4 DNAbuffer, mix well, and leave at room temperature for 20min. Then add T4 DNA Ligase, mix well, leave at room temperature for 30min to harvest the product. The product was inactivated in a PCR instrument at 65°C for 10 min to inactivate T4 DNA Ligase to obtain a ligation complex. 6 μL 5×Mix (upstream primer PTSS: 5'-FAM-AAGGAGCAGCGTGGAGGATA-3', downstream primer HTSP2w: TGGTGCGAATTCTGAGAGGT) was added to the above ligation complex, mixed and then PCR amplified, the annealing temperature was set to 57°C, and the number of cycles was set to 15. The products after library construction were entrusted to Hangzhou Ruipu Gene Technology Co., Ltd. for high-throughput sequencing.

[0132] 4. Analysis of high-throughput sequencing results

[0133] (1) Data extraction: Python is used for data processing to extract nucleic acid aptamer sequences from high-throughput sequencing files. First, the sequence of the library to which it belongs is determined based on the downstream fixed sequence of the library. Then, different screening rounds are distinguished based on different barcodes, and finally the count of each nucleic acid aptamer in each round of the library is obtained.

[0134] (2) Data preprocessing for differential analysis: Preliminary elimination of nucleic acid aptamer sequences with a number less than the number of samples × 100. This time, the Limma package was used for differential analysis. The DGEList object was constructed based on the expression matrix and filtered by CPM (count-per-million), that is, the original read counts were divided by the total number of reads multiplied by 1 × 10 6 ;

[0135] (3) Differential analysis: Then use the calcNormFactors function to standardize the data to eliminate the effects caused by sample preparation or library construction and sequencing. Select the TMM standardization method and use the voom function to convert the matrix into log2 CPM. Use the lmFit linear model to fit the data, and contrast.fit and eBayes to obtain the final differential analysis results. Define the p value (optimized significance level) after differential analysis as 0.05, log 2 The FC value (difference value) is 1;

[0136] (4) Heat map analysis: Heat map analysis uses the heatmap package of R language to extract the differential aptamers obtained from the previous correlation analysis from the original data. Before data display, the scale parameter is set to "row" to standardize the row data, and the row-like data are clustered to finally obtain the display results of the differential aptamers.

[0137] Figure 2 The figure shows the copy number distribution in the library construction results. The horizontal axis is the top 100 sequences in the sequencing results arranged by copy number, and the vertical axis is the copy number of the obtained sequence. Figure 2 Middle A shows the first 100 sequences screened and sequenced in YTS-1 cells, with copy numbers ranging from 444 to 130153, among which BCfsw2-5a has the highest copy number in YTS-1 cells, which is 130153; Figure 2 Middle B shows the T24 copy number ranging from 688 to 402401, among which BCfsw1-1 has the highest copy number in T24 cells, which is 402401; Figure 2 Middle C is the first 100 sequences screened and sequenced in 5637 cells, with copy numbers ranging from 666 to 139483, among which BCfsw1-3 has the highest copy number in 5637 cells, which is 139483; Figure 2 Middle D shows the copy numbers of the first 100 genes screened and sequenced in KK47 cells, ranging from 493 to 423425, among which BCfsw1-1 has the highest copy number of 423425 in T24 cells.

[0138] 5. Aptamer Optimization and Characterization

[0139] (1) Optimization and synthesis of nucleic acid aptamers

[0140] The copy numbers were arranged from high to low, and the top 20 sequences with the highest enrichment were selected. They were truncated and optimized according to the sequence characteristics. The specific sequence names and base compositions after optimization are shown in Table 6. The secondary structures of the 20 sequences were predicted using the Mfold website (http: / / www.unafold.org / mfold / applications / dna-folding-form.php). The results are shown in Figure 3All 20 sequences were labeled with the fluorescent molecule FITC (fluorescein isothiocyanate) at the 5' end, which was synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. and purified by HPLC.

[0141] Table 6 Nucleic acid aptamer sequence base composition and copy number information

[0142]

[0143]

[0144] (2) Binding of 20 sequences to cells

[0145] According to the results of high-throughput sequencing analysis, the 20 selected and synthesized sequences were combined with four bladder cancer cells (YTS-1, T24, 5637 and KK47) and one normal cell (SV-HUC-1) for flow cytometry characterization. First, the required cells were cultured to the logarithmic growth phase, digested with enzyme-free digestion solution, washed twice with DPBS and counted to ensure that the number of cells in a sample was 5×10 5 About. Add 20pmol of 20 sequences and negative control nucleic acid aptamer (Ctrl: AAGGAGCAGCGTGGAGGATA-N40-CTCATGGACGTGCTGGTGAC) to each sample, with a concentration of 5μM, volume 4μL), add Binding Buffer and incubate with cells at 4℃ in the dark for 30min. After incubation, wash the cells twice with 200μL Washing Buffer, resuspend the cells with 200μL Washing Buffer for detection. The experimental data were processed using FlowJo software to compare the average fluorescence intensity of each cell binding to the nucleic acid aptamer.

[0146] The binding of 20 sequences to cells is shown in Figure 4 As shown, the nucleic acid aptamer BCfsw1-1a binds to both cancer cells and normal cells, and BCfsw1-3a, BCfsw1-4a, BCfsw1-10a, BCfsw2-19a, and BCfsw2-23a bind to different types of bladder cancer cells to different degrees. Among them, the nucleic acid aptamer BCfsw1-1a showed strong binding in all cells; BCfsw2-19a and BCfsw2-23a can specifically recognize bladder cancer cell YTS-1 without binding to other cells. This shows that nucleic acid aptamers that can recognize multiple bladder cancer cells have been successfully screened and obtained, and it is expected that these nucleic acid aptamers can be used to distinguish cells of different bladder cancer types.

[0147] (3) Affinity of the six aptamers for binding to cells

[0148] The affinity of aptamer binding to cells is usually measured by the dissociation constant K d To reflect the value, first dilute the FITC fluorescence-labeled nucleic acid aptamer according to the concentration gradient, and the final concentrations are 0nM, 0.78nM, 1.56nM, 3.125nM, 6.25nM, 12.5nM, 25nM, 50nM, 100nM, 200nM, and 400nM. Incubate with YTS-1 cells at 4°C for 30min in a 100μL Binding Buffer incubation system. After incubation, wash twice with Washing Buffer, and then suspend with 200μL Washing Buffer. Finally, load the sample and measure the binding strength by flow cytometry, with blank cells as the control. The experimental data are processed using FlowJo software to compare the average fluorescence intensity of each cell binding to the nucleic acid aptamer. The flow cytometry data were processed with FlowJo software and plotted with GraphPad Prism 9 software, with the abscissa being the single-stranded DNA concentration (nM) and the ordinate being the average fluorescence intensity after deducting the cell autofluorescence value. The binding dissociation constant of the nucleic acid aptamer was calculated using the formula Y=BmaxX / (Kd+X). In the formula, Bmax is the maximum specific binding, using the same units as Y. Kd is the equilibrium dissociation constant, using the same units as X.

[0149] like Figure 5 As shown, all six aptamers have strong affinity with cells, with the affinity less than 100nM, and the lowest affinity can be as low as 0.032nM, which has a good affinity level. Among them, the Kd value of BCfsw1-1a is 61.46±9.37nM, the Kd value of BCfsw1-3a is 35.02±9.16nM, the Kd value of BCfsw1-4a is 28.13±1.56nM, the Kd value of BCfsw1-10a is 7.19±1.35nM, the Kd value of BCfsw2-19a is 0.032±0.005nM, and the Kd value of BCfsw2-23a is 6.15±2.68nM. These aptamers have certain application potential in the early diagnosis and treatment of bladder cancer.

[0150] Example 2: Screening of nucleic acid aptamers for clinical urine characteristic substances of bladder cancer and detection and analysis of urine exudate substances

[0151] 1. Urine sample source and processing

[0152] Ten experimental bladder cancer urine samples were obtained from Zhejiang Cancer Hospital (numbers P1-P10). Four healthy human urine samples were obtained from the Hangzhou Institute of Medicine, Chinese Academy of Sciences (numbers H1-H4). Sample collection criteria: Morning urine greater than 30 mL was collected from patients with clinical pathological diagnosis of primary or recurrent bladder cancer, and patients undergoing transurethral resection of the bladder were collected 2 days after surgery. Morning urine of healthy people was greater than 30 mL.

[0153] The urine sample was transferred to a 50 mL centrifuge tube and centrifuged at 10,000 g for 30 min. After centrifugation, the supernatant was removed and the urine precipitate was washed once with 200 μL DPBS. 90 μL of cell lysis buffer was added to 10 μL of urine detached material for 30 min to fully lyse the urine detached material. The protein content in the urine detached material was quantified using the Novozyme BCA protein quantification kit. The sample was centrifuged and aliquoted and stored in a -80 °C refrigerator without repeated freezing and thawing.

[0154] 2. Screening and high-throughput sequencing

[0155] The enriched library obtained by screening bladder cancer cell lines and the new random library LibTS2 were used as the primary library for screening, and the mixed urine exfoliated substances of 10 bladder cancer patients were used as targets (positive screening), and the mixed urine exfoliated substances of 3 healthy people were used as negative screening. Referring to the operation steps of step "3, cell screening", the cells were replaced with urine exfoliated substances for nucleic acid aptamer screening. Since urine exfoliated cells cannot be quantified, the quantitative protein method was used to control the amount of positive and negative screen input in each round of screening.

[0156] In each round of screening, the screening pressure was increased by gradually reducing the input and incubation time of positive screening urine shedding materials and libraries, increasing the input and incubation time of negative screening urine shedding materials, and increasing the number of washes. The specific changes in pressure during the screening process are shown in Table 7.

[0157] After 5 rounds of screening, the libraries screened in rounds 1-5 were characterized by flow cytometry. Figure 6 As shown, the negative screening samples had weak binding to the library, and the library and the positive screening samples reached maximum enrichment in the 5th round, indicating that the obtained library can specifically identify the urine exfoliated substances of bladder cancer patients but not the urine exfoliated substances of healthy people.

[0158] The fifth round enrichment library was connected to the UMI library, and the connected products were sent to Hangzhou Ruipu Gene Technology Co., Ltd. for sequencing and analysis.

[0159] Table 7 Changes in urine screening pressure

[0160]

[0161] 3. Enrichment library to detect urine exudate

[0162] The fifth round of screening enrichment library was subjected to high-throughput sequencing analysis and found that the nucleic acid aptamer sequence corresponding to BCfsw1-1a was highly enriched. This sequence also showed high copy and bound to all cells in the cell screening sequencing results of Example 1. Because BCfsw1-1a is highly enriched in the library, and the above results show that the enriched library can distinguish between patient and healthy samples, BCfsw1-1a was tried to detect urine. The inventors of this application collected urine from 5 patients and 5 healthy people (different from the samples used for screening) and tested them with BCfsw1-1a. The results are as follows Figure 7 As shown, it was found that BCfsw1-1a could not distinguish between urine of bladder cancer patients and urine of healthy subjects, and it may bind to a target that is widely expressed in patients and normal subjects.

[0163] BCfsw1-1a cannot distinguish between patients and healthy people, so we tried to use the fifth round of urine screening enrichment library R5 to directly test urine samples. We collected urine from 9 patients and 8 healthy people and tested them. Figure 8 As shown in the figure, R5 has strong binding to 7 patient samples, and no binding or weak binding to most healthy samples. This indicates that the library R5 in the fifth round of urine screening can distinguish between healthy urine and bladder cancer patient urine, and has the potential to be used to detect clinical bladder cancer patient urine shed substances. The enriched library is expected to be used for the detection of clinical samples, and the specific sequences in the library may contain more information.

[0164] Example 3: Construction of bladder cancer aptamer probe package and its application in bladder cancer cell typing

[0165] 1. Construction of nucleic acid aptamer probe kit

[0166] Take 10pmol of the first round ssDNA library and 20pmol of the last round ssDNA library from four cells, and add 10pmol of the first round ssDNA library and 2pmol of the last round ssDNA library from the urine of clinical patients, and mix them evenly. Take 2μL of the mixed library as a PCR template, perform two PCR amplifications, and prepare single strands to obtain a universal enrichment library probe package for bladder cancer, named C+CU library.

[0167] 2. Flow cytometry sorting and library construction

[0168] (1) Cell preparation: Prepare four bladder cancer cells YTS-1, KK47, 5637, T24 and one normal bladder epithelial tissue cell SV-HUC-1 in advance and allow them to grow stably and in the logarithmic growth phase. Remove the culture medium and wash twice with 2 mL of washing buffer. Digest with enzyme-free cell digestion solution in a 37°C incubator. After digestion, wash twice with 2 mL of washing buffer, collect the cells and count them to ensure that the number of each cell type is not less than 2×10 5 indivual.

[0169] (2) Library preparation: The prepared C+CU library was diluted with DPBS to a concentration of 2 μM, denatured at 95°C for 10 min, cooled on ice for 5 min, and renatured at room temperature for 15 min for later use.

[0170] (3) The five types of cells prepared in step (1) were resuspended in 200 μL of binding buffer respectively, and 100 μL of the system cells were added to each Eppendorf tube. 10 μL of the probe package library prepared in step (2) was taken to the Eppendorf tube so that each cell had a blank cell control and an experimental group, wherein the blank group was used to adjust the voltage in the flow cytometry sorting experiment. The library and cells were mixed evenly and incubated at 4°C for 30 minutes, and the mixture was shaken every 3-5 minutes to mix evenly.

[0171] (4) After incubation, wash twice with 200 μL of washing buffer and resuspend for testing. Collect 1000 cells in each tube of 8-tube PCR.

[0172] (5) Library construction: The sorted cells were denatured at 95°C for 10 min. 2 μM TSLK (final concentration 80 nM), 2 μM UMI (final concentration 80 nM), and 1× DNA Ligase Buffer were added and mixed, then placed in a PCR instrument at 95°C for 3 min, 55°C for 3 min, and placed at room temperature for a few minutes. 10× T4 DNA buffer was added and mixed thoroughly, and then placed at room temperature for 20 min. T4 DNA Ligase was added and mixed, and then placed at room temperature for 30 min. The product of the previous step was placed in a PCR instrument at 65°C for 10 min to inactivate T4 DNA Ligase. A certain proportion of 5×Mix (upstream primer is PTSS: 5'-FAM-AAGGAGCAGCGTGGAGGATA-3', downstream primer is HTSP2w: TGGTGCGAATTCTGAGAGGT) was added to the above-mentioned ligation complex, mixed, and PCR amplification was performed. The annealing temperature was set to 57°C and the number of cycles was set to 15.

[0173] 3. Bladder cancer cell typing based on bladder cancer aptamer probe package

[0174] The C+CU probe package library contains thousands of aptamers. After incubation with bladder cancer cells and normal cells, the aptamers bound to the cells are separated and sequenced by high-throughput sequencing to obtain the aptamer base sequence and copy number. The sequencing results are analyzed by bioinformatics to analyze the expression of aptamers in bladder cancer cells and compared with normal cells.

[0175] First, a bladder cancer cell YTS-1 and a normal cell SV-HUC-1 cell were combined with the probe package library and sequenced. Bioinformatics analysis was performed to obtain 88 differential nucleic acid aptamers ( Fig. 9 A in the middle). The color of each point in the volcano plot corresponds to the average log2 value of the cancer sample, mainly considering the aptamers in the upper left and upper right regions, that is, the difference ratio between the cancer cell sample and the normal cell sample is large and significant, which can be used to distinguish the two groups of samples. Fig. 9 As shown in B, the red group represents six repeated experiments of YTS-1, and the green group represents six repeated experiments of SV-HUC-1. Each different vertical block represents the expression of different nucleic acid aptamers on the cell. The darker the red, the stronger the binding, and the darker the blue, the weaker the binding. The results show that the binding patterns of the C+CU probe package on YTS-1 and SV-HUC-1 are significantly different, and can significantly distinguish bladder cancer cells YTS-1 from normal bladder epithelial tissue cells SV-HUC-1. The experiment was repeated six times to distinguish bladder cancer from normal cells, and the experimental results can be repeated ( Fig. 9 (in BD).

[0176] To further verify the ability of the probe kit to identify other types of bladder cancer cells, the same experiment was performed on five cell types using the probe kit and sequenced. Fig. 9 As shown in Figure E, the probe package is expressed differently on different cells, and can clearly distinguish cells of different bladder cancer grades. Therefore, the C+CU nucleic acid aptamer probe package constructed in this paper can be used to perform cell molecular typing between bladder cancer cells and normal cells and four different types of bladder cancer cells.

[0177] In addition, the seq12a sequence with the largest binding difference in YTS-1 and SV-HUC-1 cells was synthesized, and the binding characterization of seq12a to YTS-1 and SV-HUC-1 cells was detected by flow cytometry according to the method in Example 1, and it was found that it bound to bladder cancer cells but not to normal cells, which was consistent with Fig. 9 The results of sequencing in B were consistent. The equilibrium dissociation constant of seq12a and YTS-1 cells was determined by referring to the method in Example 1. The results showed that its Kd was 0.79±0.18nM ( Fig.10 ).

[0178] seq12a sequence: ACGTGGAGGATATCCCTCACGTCTTGACAGCCGTAATGACTAATGCTG GCCACG (SEQ ID NO. 21). The fluorescent molecule FITC (fluorescein isothiocyanate) was labeled at the 5' end of seq12a, which was synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. and purified by HPLC.

[0179] In order to verify the accuracy of the sequencing results, the binding of the 20 sequences synthesized above in the flow cytometer was compared with the results of four high-throughput sequencing. The 20 sequences synthesized above are all present in the bladder cancer nucleic acid aptamer probe package, and their expression in four bladder cancer cells and one normal cell was verified by flow cytometry and high-throughput sequencing. The expression heat map analysis in five cells is shown in Figure 2. Fig.11 shown. Fig.11 Figure A in the middle shows the binding status verified by flow cytometry. Fig.11 Figure B is the correlation analysis of four repeated experiments. Fig.11 Figure C in the middle shows the binding results analyzed by high-throughput sequencing. The experiment was repeated four times and the four experiments had a high correlation ( Fig.12 ). The results showed that the expression patterns of the 20 aptamers in four bladder cancer cells and normal cells were different, which was basically consistent with the above experimental combination. The overall trend of the high-throughput sequencing results was basically consistent with the flow cytometry results. For example, BCfsw1-1a bound to each cell in the flow cytometry characterization and had the strongest binding in KK47 cells, and showed the same result in the high-throughput sequencing combination. In addition, the sensitivity of high-throughput sequencing is higher than that of flow cytometry, and some aptamers that did not bind in the flow cytometry characterization still had a high copy number in high-throughput sequencing.

[0180] The main goal of this study is to screen nucleic acid aptamers for different types of bladder cancer cell lines and clinical urine samples of bladder cancer patients and construct bladder cancer nucleic acid aptamer probe packages to explore the possibility of preliminary molecular typing and clinical monitoring of bladder cancer. Based on this, this application mainly completed the following aspects of work:

[0181] (1) In order to obtain universal bladder cancer aptamers, this application screened aptamers based on Cell-SELEX technology to specifically recognize different types of bladder cancer cells, such as YTS-1 cells, T24 cells, 5637 cells, and KK47 cells. Through high-throughput sequencing and sequence optimization, 20 highly enriched aptamers were selected and characterized by specificity and affinity using flow cytometry. Among them, 6 aptamers showed good affinity with bladder cancer cells, with the highest affinity reaching the picomolar level. Among them, the aptamer BCfsw1-1a has strong binding on all cells; BCfsw2-19a specifically recognizes YTS-1 cells but not other cells, and shows a good affinity level (Kd = 0.032 ± 0.005 nM).

[0182] (2) In order to further obtain nucleic acid aptamers that can be used in clinical practice, the present application collected urine samples from 10 patients with clinical pathological diagnosis of bladder cancer and 3 urine samples from healthy people. After corresponding pre-treatment, the urine exudates of bladder cancer patients were used as targets and the urine samples of healthy people were used as negative screens. After 5 rounds of screening, an enriched library that specifically identifies the urine exudates of patients was obtained.

[0183] (3) The present application uses the enriched library obtained by cell screening and urine screening to construct a bladder cancer nucleic acid aptamer probe package (C+CU library). The probe package contains multiple nucleic acid aptamers that recognize different levels of bladder cancer cell lines. The high-throughput sequencing results show that it can distinguish bladder cancer cells from normal cells, which is consistent with the flow cytometry results. In addition, this probe package can also be used to perform differential analysis on cells, and differentially bound sequences can be selected. The present application performed differential analysis on bladder cancer cells YTS-1 and normal cells SV-HUC-1, selected the seq12 sequence with the largest binding difference in the two cells, and truncated and synthesized seq12a. It was found that seq12a can specifically recognize YTS-1 cells but not SV-HUC-1 cells, and has good specificity and affinity (Kd=0.79±0.18nM). Finally, the present application also attempts to use this probe package to perform clinical patient and healthy person typing and clinical course monitoring, and the experimental results have certain reference value.

[0184] In summary, this application successfully screened and obtained a nucleic acid aptamer probe package that specifically recognizes bladder cancer cells and clinical urine samples and conducted a series of verifications, obtaining nucleic acid aptamers that can distinguish bladder cancer from healthy people; through differential analysis, high-affinity and specific nucleic acid aptamers were obtained; through research and development of new diagnostic technologies based on nucleic acid aptamers, it is expected to improve the early diagnosis rate and treatment effect of bladder cancer, and reduce the recurrence rate and mortality rate of patients.

[0185] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A nucleic acid aptamer composition, characterized in that: The nucleic acid aptamer composition at least includes nucleic acid aptamer Seq12a, and the nucleic acid aptamer Seq12a is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.

21.

2. The nucleic acid aptamer composition according to claim 1, characterized in that The nucleic acid aptamer composition further includes all or part of the following six nucleic acid aptamers: (A3) Nucleic acid aptamer BCfsw1-3a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.3; (A4) Nucleic acid aptamer BCfsw1-4a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.4; (A10) Nucleic acid aptamer BCfsw1-10a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.10; (A17) Nucleic acid aptamer BCfsw2-19a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.17; (A18) Nucleic acid aptamer BCfsw2-23a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.18; (A1) Nucleic acid aptamer BCfsw1-1a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.1; The part is one or more nucleic acid aptamers.

3. The nucleic acid aptamer composition according to claim 2, characterized in that: The nucleic acid aptamer composition also includes all or part of the following 14 nucleic acid aptamers: (A2) Nucleic acid aptamer BCfsw1-2a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.2; (A5) Nucleic acid aptamer BCfsw1-5a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.5; (A6) Nucleic acid aptamer BCfsw1-6a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.6; (A7) Nucleic acid aptamer BCfsw1-7a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.7; (A8) Nucleic acid aptamer BCfsw1-8a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.8; (A9) Nucleic acid aptamer BCfsw1-9a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.9; (A11) Nucleic acid aptamer BCfsw2-5a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.11; (A12) Nucleic acid aptamer BCfsw2-6a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.12; (A13) Nucleic acid aptamer BCfsw2-10a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.13; (A14) Nucleic acid aptamer BCfsw2-14a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.14; (A15) Nucleic acid aptamer BCfsw2-16a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.15; (A16) Nucleic acid aptamer BCfsw2-17a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.16; (A19) Nucleic acid aptamer BCfsw2-34a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.19; (A20) Nucleic acid aptamer BCfsw2-35a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.20; The part is one or more nucleic acid aptamers.

4. A nucleic acid aptamer, characterized in that The nucleic acid aptamer is any one of the following twenty nucleic acid aptamers: (A21) Nucleic acid aptamer Seq12a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.21; (A3) Nucleic acid aptamer BCfsw1-3a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.3; (A4) Nucleic acid aptamer BCfsw1-4a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.4; (A10) Nucleic acid aptamer BCfsw1-10a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.10; (A17) Nucleic acid aptamer BCfsw2-19a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.17; (A18) Nucleic acid aptamer BCfsw2-23a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.18; (A1) Nucleic acid aptamer BCfsw1-1a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.1; (A2) Nucleic acid aptamer BCfsw1-2a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.2; (A5) Nucleic acid aptamer BCfsw1-5a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.5; (A6) Nucleic acid aptamer BCfsw1-6a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.6; (A7) Nucleic acid aptamer BCfsw1-7a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.7; (A8) Nucleic acid aptamer BCfsw1-8a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.8; (A9) Nucleic acid aptamer BCfsw1-9a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.9; (A11) Nucleic acid aptamer BCfsw2-5a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.11; (A12) Nucleic acid aptamer BCfsw2-6a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.12; (A13) Nucleic acid aptamer BCfsw2-10a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.13; (A14) Nucleic acid aptamer BCfsw2-14a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.14; (A15) Nucleic acid aptamer BCfsw2-16a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.15; (A16) Nucleic acid aptamer BCfsw2-17a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.16; (A19) Nucleic acid aptamer BCfsw2-34a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.19; (A20) Nucleic acid aptamer BCfsw2-35a: a single-stranded DNA molecule whose nucleotide sequence is SEQ ID NO.

20.

5. A nucleic acid aptamer derivative, characterized in that: The aptamer derivative is obtained by connecting fluorescein, anti-tumor drugs, radioactive elements, enzymes, biotin and / or nanomaterials to one end or the middle of the aptamer described in claim 4 to obtain a aptamer derivative having the same function as the aptamer.

6. A nucleic acid aptamer derivative composition, characterized in that: The nucleic acid aptamer derivative composition comprises at least two nucleic acid aptamer derivatives of the nucleic acid aptamer derivatives according to claim 5.

7. Application, characterized in that, The application is the application of the nucleic acid aptamer composition according to any one of claims 1 to 3, the nucleic acid aptamer according to claim 4, the nucleic acid aptamer derivative according to claim 5 and / or the nucleic acid aptamer derivative composition according to claim 6 in any of the following: (B1) Use in the preparation of a product for screening or assisting in screening bladder cancer cells and / or bladder cancer patient samples; (B2) use in identifying or assisting in identifying bladder cancer cells and / or bladder cancer patient samples; (B3) Use in the preparation of products for molecular typing or auxiliary molecular typing of bladder cancer cells and / or bladder cancer patients; (B4) application in molecular typing or auxiliary molecular typing of bladder cancer cells and / or bladder cancer patients; (B5) Use in the preparation of a product for imaging bladder cancer cells and / or bladder cancer patient samples (B6) Application in imaging bladder cancer cells and / or bladder cancer patient samples; (B7) Application in the preparation of a drug for treating bladder cancer (B8) Use as a drug in the treatment of bladder cancer; (B9) Application in the preparation of products for bladder cancer related physiological and pathological research.

8. The use according to claim 7, characterized in that: The bladder cancer cells include but are not limited to: human bladder cancer cell YTS-1, human bladder cancer cell T24, human bladder cancer cell 5637 and human bladder cancer cell KK47; Furthermore, the bladder cancer patient sample includes, but is not limited to: patient urine, sediment in patient urine, cells in patient urine, patient lesion sampling and / or patient urinary tract sampling.

9. A reagent, the active ingredients of which include the nucleic acid aptamer composition according to any one of claims 1 to 3, the nucleic acid aptamer according to claim 4, the nucleic acid aptamer derivative according to claim 5 and / or the nucleic acid aptamer derivative composition according to claim 6.

10. A method as described in any of the following, (C1) A method for identifying or assisting in identifying bladder cancer cells and / or bladder cancer patient samples, the method comprising contacting bladder cancer cells and / or bladder cancer patient samples with the nucleic acid aptamer composition according to any one of claims 1 to 3, the nucleic acid aptamer according to claim 4, the nucleic acid aptamer derivative according to claim 5, the nucleic acid aptamer derivative composition according to claim 6, and / or the reagent according to claim 9 to identify or assist in identifying bladder cancer cells and / or bladder cancer patient samples; (C2) A method for molecular typing of bladder cancer cells and / or bladder cancer patients, the method comprising contacting bladder cancer cells and / or bladder cancer patient samples with the nucleic acid aptamer composition described in any one of claims 1 to 3, the nucleic acid aptamer described in claim 4, the nucleic acid aptamer derivative described in claim 5, the nucleic acid aptamer derivative composition described in claim 6 and / or the reagent described in claim 9 to molecularly type the bladder cancer cells and / or bladder cancer patients.

Images