The methods and compositions of donor DNA molecules

Abstract

We describe compositions of DNA donor molecules compatible with various gene insertion methods with major advantages for delivery, nuclear localization, and immune evasion. The modified DNA donor molecules are largely single stranded but contain short regions of double-strand DNA to reconstitute enzyme binding sites, and can be combined with other approaches to enhance donor recruitment into the nucleus.

Description

[0001] The Methods and Compositions of Donor DNA Molecules CLAIM OF PRIORITY This application claims the benefit of U.S. Provisional Patent Application Serial No.63 / 589,594, filed on October 11, 2023, and No.63 / 638,312, filed on April 24, 2024. The entire contents of the foregoing are hereby incorporated by reference. FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with Government support under Grant No. CA281401 awarded by the National Institutes of Health. The Government has certain rights in the invention. TECHNICAL FIELD We describe compositions of DNA donor molecules and their use with various gene insertion methods (e.g., recombinases or transposases) with advantages for delivery, nuclear localization, and evasion of mammalian cell innate immune response. The modified DNA donor molecules are either (1) fully single-stranded or (2) partially single stranded via short regions of double-strand DNA to reconstitute enzyme / protein binding sites, where either donor formulation can be combined with other approaches to enhance donor recruitment into the nucleus and / or integration kinetics and efficiencies. BACKGROUND The ability to install large DNA sequences into the genome is a transformative capability with various applications including cellular engineering, gene editing, and the insertion of therapeutic cDNAs or transgenes. The most commonly used enzymes for large DNA insertions are recombinases and transposases, which encompass several subclasses of protein families including tyrosine recombinases (e.g., Cre, Flp, etc.), large serine recombinases1(e.g., Bxb1, PhiC31, Pa01, etc.), bridge recombinases (e.g., IS110, IS1111)2,3, transposases (e.g., piggybac, sleeping beauty, Tn7, CRISPR- associated transposases (CASTs)4,5, etc.), among others. Ongoing studies continue to discover, characterize, and engineer recombinases or transposases from vast diversity that have increased utility in genome engineering approaches. SUMMARY For various genome editing applications, the nature of double-stranded DNA (dsDNA) donor molecules causes challenges for delivery into the nucleus, carries risks for unwanted off-target dsDNA integration into the genome, and can stimulate problematic immune sensing by cells. Most DNA donor molecules encoding changes or insertions of interest have traditionally been of the dsDNA form because the majority of DNA target enzymes (e.g., for binding, cleaving, recombining, etc.) recognize double-stranded rather than single-stranded DNA (ssDNA). Only recently have methods to produce circular ssDNA (cssDNA) become available, whereas the scalable generation of circular dsDNA molecules has been possible for decades. Here we develop an alternate DNA donor architecture to overcome these and other challenges of dsDNA donors, by designing hybrid DNA donors that are largely single stranded but that also contain a short segment(s) of dsDNA, where the dsDNA segments(s) encode(s) binding site for DNA targeting enzymes. Provided herein are substrate DNA molecules, and compositions comprising the substrate DNA donor molecules, wherein the substrate DNA molecules comprise (a) a circular single stranded DNA (cssDNA) donor molecule comprising a desired sequence and one or more recombinase recognition sequences or transposase left and / or right ends, or (b) a scoDNA comprising a circular single stranded DNA (cssDNA) donor molecule comprising a desired sequence and one or more recombinase recognition sequences or transposase left and / or right ends, wherein one or more substrate complementary oligonucleotides (SCOs) bearing complementarity to a portion of the ssDNA are annealed to the cssDNA to form one or more regions of double stranded DNA (dsDNA) sequence, wherein the one or more regions of dsDNA sequence comprise the recombinase recognition sequences or transposase left and / or right ends. In some embodiments, the recombinase recognition sequences comprise attP or attB, or the transposase left and / or right ends comprise LE or RE, LTRs, or ITRs. In some embodiments, the SCOs comprise one or more of: (i) a conjugated NLS (optionally a PNA or DNA-NLS), (ii) one or more chemical modifications and / or abasic sites for stability, optionally PS linkages, 5’ and / or 3’ terminal phosphates, RNA, 5-Methyl dC, 2’OMe, 2’MOE, inverted bases, or exNA, and / or one or more modified DNA or RNA bases or abasic site(s); (iii) DNA and / or RNA, various chemical modifications and / or abasic sites to recruit RNAseH, Flap endonucleases, DNA polymerases, or other endogenous repair machinery; and / or (iv) one or more bases (e.g., 1, 2, 4, 6, 8, or 10 consecutive or non-consecutive nt, or up to 1%, 2%, 5%, or 10% of the length of the SCO) that are mismatched with (lack complementarity to) the cssDNA. In some embodiments, the composition further comprises a recombinase (optionally Bxb1, eeBxb1, evoBxb1, Dn29, Pa01, BceInt, SacInt, SscInt, PhiC31, or Piv-family invertase) protein or a transposase (optionally piggybac, sleeping beauty, IS110-family transposase, or CRISPR-associated transposase (CAST)) protein, or mRNA or DNA encoding the recombinase protein or transposase protein. In some embodiments, the recombinase or transposase comprises one or more nuclear localization sequences (NLS), optionally a heterologous NLS (to facilitate nuclear localization of the scoDNA) and / or wherein the recombinase or transposase is engineered to increase integration activity and / or specificity. In some embodiments, the composition further comprises a single-stranded nucleic acid binding protein (ssNABP, optionally SSB, RPA, or Orf1p) complexed with the substrate DNA donor molecule. In some embodiments, the ssNABP comprises one or more nuclear localization sequences (NLS), optionally a heterologous NLS optionally wherein the ssNABP comprises one or more nuclear localization sequences (to facilitate nuclear localization and decreased secondary structure of the single stranded region of the scoDNA). In some embodiments, the composition further comprises an exogenously provided DNA-dependent DNA polymerase (optionally Phi29 or B103), optionally fused to the recombinase or transposase (to initiate second strand synthesis following scoDNA integration). In some embodiments, the substrate DNA donor is a scoDNA complexed with a sequence or structure specific ssDNA or RNA binding protein domain (Cdc13, HUH endonuclease, ssDNA or RNA binding Cas or OMEGA protein, Phage coat proteins, etc) or a binding protein domain that binds a chemical moiety (e.g., SNAP- tag, CLIP-tag, HALO-tag, monomeric or tetrameric streptavidin), and where the SCO annealed to the donor DNA molecule contains a corresponding sequence or chemical moiety that is bound by the binding protein domain. In some embodiments, the substrate DNA donor molecule is encapsulated in a nanoparticle, vesicle, or virus-like particle. Further, provided herein are compositions comprising a library comprising a plurality of substrate DNA donor molecules as described herein, wherein the plurality of substrate DNA donor molecules comprise a plurality of different desired sequences, optionally wherein the substrate DNA donor molecules comprise (a) a circular single stranded DNA (cssDNA) donor molecule comprising a desired sequence and one or more recombinase recognition sequences or transposase left and / or right ends, or (b) a scoDNA comprising a circular single stranded DNA (cssDNA) donor molecule comprising a desired sequence and one or more recombinase recognition sequences or transposase left and / or right ends, wherein one or more substrate complementary oligonucleotides (SCOs) bearing complementarity to a portion of the ssDNA are annealed to the cssDNA to form one or more regions of dsDNA sequences, wherein the one or more regions of dsDNA sequence comprise the recombinase recognition sequences or transposase left and / or right ends. Additionally, provided herein are methods of inserting a desired sequence at one or more selected sites in genomic DNA of a target cell. The methods comprise providing a target cell comprising a genome comprising one or more recombinase recognition sequences or transposase target sites; and contacting the cell with a substrate DNA donor molecule or composition as described herein, wherein the substrate DNA donor molecule comprises corresponding recombinase recognition sequence or transposase left and / or right ends, wherein the substrate DNA donor molecule encodes the desired sequence and the method comprises contacting the cell with the corresponding recombinase or transposase in the same or a separate composition, to integrate the desired sequence into the target cell genome at the recombinase recognition sequences or transposase target sites. Also provided herein are methods of inserting a desired sequence into a target cell genome. The methods comprise contacting or expressing in the target cell a recombinase or transposase with a circular single stranded DNA molecule (cssDNA), comprising the desired sequence to be inserted and recombinase recognition sequences or transposase left and / or right ends, where the cssDNA localizes to the nucleus, undergoes second strand synthesis, and is subsequently integrated into the host genome by the corresponding recombinase or transposase. In some embodiments, the methods further comprise first installing the one or more recombinase recognition sequences or transposase target sites at one or more selected sites in the target cell genome. In some embodiments, the recombinase recognition sequences or transposase target sites are installed using RNA-programmable polymerization (optionally click editing or prime editing). In some embodiments, the recombinase recognition sequences or transposase target sites are installed using RNA-programmable ligation. In some embodiments, the recombinase recognition sequences or transposase target sites are installed using nuclease-mediated homology directed repair or end- joining (optionally via CRISPR-Cas, OMEGA, or Fanzor nucleases). In some embodiments, the methods, further comprise administering small molecule inhibitors of TLR9, cGAS, or STING, or antagonistic inhibitory oligonucleotides targeting TLR9, cGAS, or STING. In some embodiments, the target cell is in vivo. In some embodiments, the target cell is in vitro. The cssDNA can optionally encode a sequence or structure to facilitate nuclear localization or second strand synthesis prior to integration (e.g., Anellovirus hairpin, Circovirus / geminivirus / nanovirus hairpin, M13 phage origin or fragment, or AAV ITR or a fragment thereof). In some embodiments, the double-stranded region encodes a binding site for a dsDNA-binding domain or enzyme (e.g., ZFs, TALEs, dCas9, TnpB / IscB, recombinase, transposase, or endogenous transcription factor), optionally fused with one or more NLS sequences, and the composition further comprises or the method further comprises contacting or expressing in the cell the double-stranded DNA binding domain that binds that sequence (if not endogenous). In some embodiments, the recombinase or transposase facilitates localization of the ssDNA to the nucleus, integrates the cargo at the target site, and exogenous or endogenous polymerase(s) conduct second strand synthesis. In some embodiments, the recombinase or transposase facilitates localization of the ssDNA to the nucleus, exogenous or endogenous polymerase(s) conducts second strand synthesis, and the recombinase or transposase integrates the cargo at the target site. In some embodiments, the double-stranded DNA binding domain facilitates nuclear localization of the circular ssDNA and second strand synthesis occurs from an annealed SCO or from a primer synthesized by an endogenous primase. In some embodiments, the cssDNA is supplied with a ssDNA or RNA binding protein (e.g., RPA, SSB, Orf1p, Cdc13, HUH endonuclease, ssDNA or RNA binding Cas or OMEGA protein, Phage coat proteins, etc) or a protein domain which binds a chemical moiety (e.g., SNAP-tag, CLIP-tag, HALO-tag, monomeric or tetrameric streptavidin), optionally fused with one or more NLS sequences (optionally also fused to an recombinase or transposase expressed in trans). In some embodiments, the cssDNA (or modified cssDNA as above) is integrated into the host genome via a recombinase or transposase, either before or after second strand synthesis. In some embodiments, the circular ssDNA (or modified circular ssDNA as above) is not integrated into the host genome, but expresses cargo episomally (e.g., mRNA, guide RNA, pegRNA, bridge RNA, siRNA, etc.) in the nucleus after second strand synthesis. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims. DESCRIPTION OF DRAWINGS FIGs.1A-D. INSTALL approaches. a, Schematic of the natural mechanism of integrative cssDNA viruses. b, INSTALL-1 using a fully ssDNA (i.e., cssDNA) for DNA integration. c, INSTALL-2 approach using a substrate complementary oligo (SCO) to reconstitute a recombinase recognition sequence (attP or attB) for DNA integration. Integration can occur prior to second-strand synthesis. d, INSTALL-2b approach using a SCO that does not reconstitute the binding site for the enzyme that is used to perform DNA integration, but may reconstitute other binding sites for other nucleic acid binding proteins or be used to enable primase independence. FIGs.2A-B. Example INSTALL-2 approach with recombinases. a, Schematic of an INSTALL DNA (cssDNA) molecule with a circular single stranded DNA (cssDNA substrate DNA donor molecule) and a single dsDNA region corresponding to an enzyme binding site (e.g., for use with recombinases). A short ssDNA substrate complementary oligo (SCO) is annealed to the cssDNA to form a short dsDNA recombinase recognition sequence (via the SCO). b, Schematic of INSTALL integration mechanism using recombinases. Integration of the cssDNA at the target site creates a ssDNA insertion, where a 3’ DNA end can be extended by endogenous DNA polymerases, leading to fill-in second-strand DNA synthesis of the encoded cargo. FIGs.3A-B. Example INSTALL-2 approach with transposases. a, Schematic of an INSTALL DNA (cssDNA) molecule with a circular single stranded DNA (cssDNA substrate DNA donor molecule) and a more than one dsDNA region corresponding to an enzyme binding site (e.g., for use with transposases, where the dsDNA regions are left transposon ends (LEs) and / or right transposon ends (REs)). Short ssDNA substrate complementary oligos (SCOs) are annealed to the cssDNA to form a short dsDNA transposase recognition sequences (via the SCOs). b, Schematic of INSTALL integration mechanism using transposases. Integration at the target site creates a 3’ DNA end that can be extended by endogenous DNA polymerases, leading to fill-in second-strand DNA synthesis of the encoded cargo. FIGs.4A-E. Bxb1-mediated DNA insertion in human cell lysates using INSTALL. a, Schematic of proof-of-concept INSTALL reactions in a human cell lysate with necessary reaction components. b, Junction PCR across attL using resulting DNA products from HEK293T lysate (which contained Bxb1 protein) reactions. Reactions used either cssDNA or scoDNA with an annealed SCO to reconstitute a short dsDNA Bxb1 attP sequence, and dsDNA pTarget which contained a 38 bp Bxb1 attB sequence. We performed both 18-cycle and 25-cycle junction PCR reactions to detect integration events. c, Nanopore sequencing of the insertion product when using scoDNA in lysate experiments. d, Timecourse of integration into a pTarget plasmid in HEK293T lysates assessed by ddPCR containing Bxb1 recombinase when using dsDNA, cssDNA (INSTALL-1), or scoDNA (INSTALL-2). e, Normalized integration efficiency (to the maximum value of the given condition) over time. Mean, s.d., and individual datapoints shown for n = 3 independent biological replicates. FIGs.5A-P. INSTALL-1 and INSTALL-2 activity in human cells. a, Schematic of creating attB and attP landing pad cell lines with recognition sequences for various recombinases b, Bxb1-mediated genomic Integration efficiency using INSTALL-1, INSTALL-2, or a dsDNA plasmid, as measured by ddPCR. HEK293T cells containing a lentivirally integrated Bxb1 attB site and a cssDNA containing a Bxb1 attP site and an M13 origin was used. c, Bxb1-mediated plasmid integration efficiency using INSTALL-1 or a dsDNA plasmid, as measured by ddPCR. A cssDNA containing a Bxb1 attP site and an M13 origin was used. d, Mean long-read sequencing error rate from PCR-enriched insertion products. The control consists of amplicons from a synthetic, sequence verified insertion product. e, Sanger sequencing of the attL integration junction on pTarget from INSTALL-1 experiments (SEQ ID NO:187). A cssDNA containing a Bxb1 attP site and an M13 origin was used. f, Integration efficiency assessed by ddPCR with dsDNA, INSTALL-1, and INSTALL-2 when using mRNA expression of Bxb1 and various donor dosages. g, Gel image showing in vitro produced cssDNA (that did not contain an M13 origin) and the dsDNA template from which it was derived. h, Long-read sequencing coverage of INSTALL-1 and INSTALL-2 insertion products into a lentiviral landing pad HEK 293T cell line. cssDNA utilized did not contain an M13 origin. i, Junction PCR products across full insertion from sequential plasmid delivery experiments when using dsDNA, INSTALL-1, and INSTALL-2. j, Integration efficiency with dsDNA, INSTALL-1, and INSTALL-2 when delivering donor and mRNA separately in respective commercial reagent or together in an mRNA-specific commercial reagent. k, Integration efficiencies measured by ddPCR when using dsDNA, cssDNA, orscoDNA donors for sequential plasmid codelivery in attP HEK 293T cells. l,Phylogenetic tree of tyrosine and serine recombinases that have been used in human cells in prior studies. m, Integration efficiency with dsDNA, INSTALL-1, and INSTALL-2 when using mRNA expression of various diverse recombinases mixed delivery or n, separate delivery. o, Schematic of human genome targeting recombinases, such as Dn29, which can integrate DNA into the human genome without pre-installation of the recombinase attachment site. p, Integration efficiencies measured by ddPCR when using 150 ng of dsDNA, cssDNA, or scoDNA donors with Dn29 in wild-type HEK 293T cells. Efficiencies summed from the top 5 loci previously reported1. Mean, s.d., and individual datapoints shown for n = 3 independent biological replicates. FIGs.6A-F. INSTALL function in nocodozole-arrested cells and various human cell types. a, Integration efficiency assessed by ddPCR with dsDNA, INSTALL-1, and INSTALL-2 when using mRNA expression of Bxb1 in untreated or nocodazole-treated HEK293T cells. For panels b and c, Integration efficiency assessed by ddPCR with dsDNA, INSTALL-1, and INSTALL-2 in b, HCT-116 cells or c, HeLa cells. d, Fold change in IL-6 mRNA expression when using dsDNA or cssDNA, analyzed via qPCR. e, Schematic of experimental workflow to quantify IL-6 mRNA levels when transfecting dsDNA, cssDNA, or scoDNA donors into primary human keratinocytes (left panel); Relative IL-6 mRNA transcript abundance, measured by RT-qPCR, when transfecting primary human keratinocytes with equimolar amounts of a CpG-minimized dsDNA, cssDNA, or scoDNA (right panel). f, Relative IL-6 mRNA in primary human keratinocytes 6 hours after transfection of different doses of equal masses of dsDNA, cssDNA, or scoDNA donors with lipofectamine 2000, as measured by RT-qPCR. Mean, s.d., and individual datapoints shown for n = 3 independent biological replicates. FIGs.7A-C. RNA-guided recombinase function in human cells and with INSTALL. a, Schematics of canonical protein-guided recombinase (e.g., Bxb1) and RNA-guided bridge recombinase mechanisms. b, Integration efficiency assessed by ddPCR after 72 hrs post transfection with dsDNA, INSTALL-1, and INSTALL-2 when using plasmid expression of IS621-NLS, plasmid expression of a bRNA containing a target binding loop (TBL) targeting a T1 site or T2 site, and a pTarget plasmid containing a target site (T1 or T2). c, Integration efficiencies on a plasmid target in HEK 293T cells measured by ddPCR when using dsDNA, cssDNA, or scoDNA donors with mRNA codelivery for two previously reported target sites encoded on pTarget. Mean, s.d., and individual datapoints shown for n = 3 independent biological replicates. FIGs.8A-J. Optimization and engineering of RNA-guided Piv recombinases. a, Schematic of M. Lacunata piv inversion locus. b, Schematic of Piv invertase mechanism, which inverts a 2.2 kb segment of genomic DNA in bacteria to activate pillin expression in its host bacterium. c, Schematic of the M. Lacunata Piv recombinase ncRNA (SEQ ID NO:188), highlighting a binding loop in the ncRNA aligns to the characterized Piv invertase recognition sequence (SEQ ID NOs:189- 190). d, Integration using Piv recombinase and a first generation ncRNA on a plasmid target. e, Integration using Piv recombinase mutants encoding arginine amino acid substitutions. f, Integration using engineered Piv recombinase mutant harboring stacked amino acid substitutions. g, Integration using a Piv double mutant recombinase (R257R / E285R) with ncRNA v1 and ncRNA v2 at two different doses. h, Integration using additional Piv recombinase mutants generated via arginine amino acid substitutions added to Piv(R257R / E285R). i, Integration using Piv recombinase variant enzymes with amino acid substitutions added to Piv(R257R / E285R); ePiv is the variant enzyme with E257R / E285R / T290R substitutions when combined with ncRNA v2. j, Integration efficiencies on pTarget measured by ddPCR for dsDNA, cssDNA, or scoDNA donors in HEK 293T cells when using ePiv and ncRNA expression plasmids via sequential plasmid delivery. For data panels, mean, s.d., and individual datapoints shown for n = 3 independent biological replicates. FIGs.9A-D. One-pot INSTALL-2e-mediated targeted integration with CRISPR-Cas9 nuclease in primary human T-cells. a, Schematic of INSTALL-2e, which uses enhanced chemically modified SCOs (eSCOs) to minimize degradation and increase stability. DNAP, DNA polymerase (SEQ ID NO:191). b, Schematic of one-pot transfections for targeted DNA integration, comprising an SpCas9 nuclease ribonucleoprotein (RNP) complex, an ssODN encoding a recombinase attB or attP site, Bxb1 mRNA, and either dsDNA, cssDNA, or scoDNA in a single nucleofection. c, Integration efficiencies and landing pad conversion efficiencies (left and right panels, respectively) measured by ddPCR for dsDNA, cssDNA, or scoDNA donors when using one-pot DNA integration in primary human T-cells via SpCas9 RNP nuclease-based HDR and mRNA Bxb1-mediated recombination. d, HDR efficiencies measured by ddPCR to place Bxb1 attP site at RAB11A for one-pot integration experiments in primary human T-cells. Mean, s.d., and individual datapoints shown for n = 3 independent biological replicates. FIGs.10A-D. INSTALL using polymerization-based genome editing technologies for targeted DNA integration. a, Schematic of PASSIGE, which utilizes prime editing to install attP sites followed by recombinase-based attB- encoding cargo integration. b, Schematic of engineered Bxb1 constructs with different NLS configurations and / or mutations to improve integration efficiency6,7. BPNLS, bi- partite SV40 NLS8,9. c, Integration efficiencies in HEK 293T cells measured by ddPCR after 72 hrs when performing single-transfection PASSIGE experiments at the AAVS1 locus with various Bxb1 variants with or without an N- or C-terminal BPNLS. PEmax was used to insert a Bxb1 attP site at the AAVS1 locus, and the donor contained a Bxb1 attB site. d, Integration efficiencies measured by ddPCR for dsDNA, cssDNA, or scoDNA donors with PASSIGE in HEK 293T cells and when using sequential delivery of enzymes prior to the donor. FIGs.11A-K. INSTALL-mediated integration in vivo. a, Schematic of LNP components and formation to encapsulate mRNA, dsDNA, or scoDNA. b-d, Physical characterization of LNP properties, including hydrodynamic size (nm) and polydispersity index (PDI) (panel b), Zeta potential (mV) (panel c), and encapsulation efficiency by the RiboGreen assay (panel d). e, Schematic of in vivo INSTALL using a transgenic mouse containing a Bxb1 attP site at the Rosa26 safe harbor locus. f, Survival curve when injecting P3 mice with 1 mg / kg Bxb1 mRNA encapsulated with LNPs and either dsDNA or scoDNA LNPs at various doses. n = 8 mice for dsDNA, n = 8 mice for scoDNA at 0.7 mg / kg, and n = 7 mice for scoDNA at 1.4 mg / kg. g, Survival curves for various dsDNA doses that also contained a 1 mg / kg Bxb1 mRNA dose (SEQ ID NOs:192-193). h, Survival curve for a 2 mg / kg scoDNA dose that also contained a 1 mg / kg Bxb1 mRNA dose. i, Integration efficiencies assessed via ddPCR from bulk mouse livers harvested 7 days following injection when using 1 mg / kg Bxb1 mRNA and dsDNA or scoDNA with eSCO donors (INSTALL-2e). The maximal tolerable dose of dsDNA was used (0.35 mg / kg); for INSTALL-2e, 2 mg / kg scoDNA was used. Mean and s.d. shown for n = 5 mice for each condition. j, Junction PCR across the full-length inserted cargo for dsDNA and INSTALL-2e conditions. k, Coverage plot from the long-read nanopore sequencing result of the full-length product from panel j and Sanger sequencing of attR and attL junctions from successful in vivo integration. FIGs.12A-D. Example methods to facilitate cssDNA second strand synthesis and nuclear localization. a, Schematic of a strategy to facilitate second- strand synthesis in the nucleus and with the option of utilizing 3’ end-protected SCOs. Abasic site(s) or other DNA damage can be encoded on the SCO using modified DNA or RNA bases, which recruits nuclear-localized DNA factors involved in nucleotide excision repair (NER) and / or long-patch base excision repair (LP-BER) (including polymerase delta or epsilon). For panel b and c, schematic of a strategy to enable 3’ end protected SCOs using b, RNA base(s) in the SCO and RNAseH2 recruitment in the nucleus or c, Inverted base(s) in the SCO and 5’ flap endonuclease recruitment in the nucleus. d, Schematic of strategies to facilitate nuclear localization and reduced cssDNA secondary structure. A nuclear localization sequence (NLS) can be added to the recombinase, which will co-localize the recombinase and cssDNA into the nucleus (left panel; Example 1). Additionally, an NLS can be added to single-stranded binding protein (SSB) that can be coexpressed or preincubated with the cssDNA, enabling ssDNA selective donor localization into the nucleus without inhibiting recombinase binding of the dsDNA recognition sequence. FIG.13. Additional methods to facilitate and modulate INSTALL approaches. Illustrations of various cssDNA modifications to increase or modulate nuclear localization and / or second strand synthesis. Structural or compositional approaches can be used for the cssDNA and / or the SCO. DETAILED DESCRIPTION Most recombinases and transposases have evolved to integrate double- stranded DNA (dsDNA) substrate DNA donor molecules into their host’s genome. However, in therapeutic applications, the reliance on dsDNA donor templates is problematic due to strong, dsDNA length-dependent immune activation by cytosolic cGAS-STING10and the AIM2 inflammasome11, amongst other innate immunity pathways. This limitation largely restricts in vivo donor delivery to viral approaches that traffic DNA directly into the nucleus, which itself carries risks of random donor integration into the genome, cellular toxicity, an inability to redose (e.g., due to acquired immunity to the adeno-associated virus (AAV) capsid), a requirement for additional viral sequences that may be prone to silencing, and complex and expensive manufacturing. Additionally, transient expression of recombinase enzymes would be preferrable (e.g., via mRNA or RNP delivery), thereby complicating manufacturing and delivery strategies due to the need to separately deliver the enzyme and donor molecules. Together, these challenges motivate the need for safe, non-viral delivery of large DNA templates that minimizes immune responses and facilitate localization into the nucleus. The optimization of novel donor DNA formats capable of nuclear localization and immune evasion would enable a broader range of nonviral delivery strategies, towards efficient gene insertion via recombinases and transposases. Mammalian immune sensors for dsDNA detect pathogenic DNA from viruses or microbes as well as cytosolic self-DNA. Sensors including cyclic GMP-AMP synthase (cGAS), absent in melanoma 2 (AIM2), interferon-gamma inducible 16 (IFI16), DNA-dependent activator of IRFs (DAI), or RNA polymerase III lead to innate immune signaling via STING, the inflammasome, or other pathways12–19. Compared to dsDNA, single-stranded DNA (ssDNA) molecules may hold advantages, including evasion of dsDNA immune sensing, twice the molecular copy number for the same mass of DNA, a more transient half-life to minimize unwanted toxicity or integration, and a more flexible structure that may facilitate nuclear import20–22. Indeed, the primary cytosolic DNA sensor, cGAS, has greater than an order of magnitude weaker affinity for ssDNA than for dsDNA23, and both IFI16 and AIM2 fail to induce downstream immune response in the presence of ssDNA despite inducing strong immune activation for dsDNA24–27. Circular ssDNA (cssDNA) molecules are an emerging nucleic acid modality that are more resistant to exonucleases compared to linear ssDNA and may have several advantages over dsDNA or viral templates for non-viral genome engineering applications20–22,28. Various methods have therefore been explored to produce cssDNA molecules20,21,28–30, including more scalable phage-based bioproduction31,32. Improvements in cssDNA production have motivated their use for genome editing with CRISPR-Cas9 nucleases to facilitate homology directed repair (HDR) to incorporate a desired sequence into the human genome20,28. However, the paradigm of recombinases requiring dsDNA substrates for integration has thus far not motivated exploration of their compatibility with cssDNA molecules. In nature, various classes of cssDNA viruses infect either prokaryotic or eukaryotic cells, where only certain prokaryotic subclasses are known to perform integration reactions of their genetic material into host cells33(Fig.1a). Mechanistically, these sets of viruses co-opt host primases (or viral genomes already contain a DNA or RNA primer34) and / or host DNA-dependent polymerases for second strand DNA synthesis of the viral genome33. Integrating viruses can either encode a viral recombinase or transposase or co-opt a host recombinase (e.g., XerC / XerD) for viral genome integration into the host genome35,36. Therefore, prokaryotic viruses naturally conduct kilobase-scale recombinase or transposase- mediated DNA insertion from a cssDNA starting point via endogenous DNA polymerases (and optionally primases). Notably, integrons contained on bacterial conjugative plasmids can also use a specialized recombinase (homologous to XerC / XerD recombinases) to insert itself into an integron cassette, where replication of a holiday junction intermediate completes the insertion event37,38. Whether these mechanisms can be reconstituted directly in human cells is unknown. To overcome the challenges of dsDNA donor molecules, described herein is a series of methods using DNA donors that are fully or largely single stranded molecules should overcome many challenges of dsDNA donors, while enabling recombinase and transposase (and other effector)-mediated DNA integration using circular single-stranded nucleic acids. Due to their single-stranded DNA nature, cssDNAs enable DNA insertion with minimized risks of cytosolic dsDNA sensing by immune pathways (e.g., cGAS-STING), opening avenues for efficient, safe, scalable, and redosable gene insertion methodologies. One example of the present methods is called Integration via Nucleus Synthesized Template Addition of Large Lengths, or “INSTALL”, which encompasses the use of partly or fully ssDNA donor molecules that are paired with dsDNA-interacting proteins and enzymes (e.g., recombinases or transposases) for integration-based genome engineering. These methods rely on the nuclear translocation of the cssDNA with the subsequent ability of endogenous cellular DNA polymerases to reconstitute fully dsDNA donor molecules or to perform second-strand synthesis of the integrated ssDNA donor (Figs.1b-1d). We envision several approaches of using fully or partly cssDNA donors, including the method described herein as INSTALL-1, where a single-stranded DNA donor (e.g., a cssDNA) localizes to the nucleus, endogenous primases and DNA polymerases carry out second strand synthesis in the nucleus, and an exogenous recombinase or transposase inserts the donor molecule into a target site (i.e., second strand synthesis is required prior to integration) (Fig.1b). The purposeful constitution of short dsDNA regions on the cssDNA can be implemented (creating scoDNA molecules), including the methods INSTALL-2 or INSTALL-2b (Figs.1c and 1d, respectively) - where a ssDNA donor (e.g., cssDNA) also bears one or more short segments of dsDNA from annealing of substrate-complementary oligonucleotides (SCOs) that encode(s) desired enzyme / protein binding sites (e.g., recombinase attP / B, transposase LE / RE, endogenous or other exogenous factors, etc.) to facilitate nuclear localization, reduce cytosolic residency time, and / or to obviate the requirement for endogenous primase activity to initiate second-strand synthesis. If the SCO-mediated double-stranded portion encodes a binding site for an effector enzyme that is used to perform DNA insertion (e.g., recombinase or transposase; Fig.1c), the donor can localize to the nucleus and can be integrated into a genomic target site prior to second strand synthesis; alternatively, the SCO may initiate second-strand synthesis prior to engagement of the cssDNA with the recombinase or transposase (Fig.1d). In INSTALL-2, subsequent primer extension by endogenous DNA polymerases completes the integration event with improved kinetics. To create short segments of dsDNA on the cssDNA substrate DNA donor molecule, simple ssDNA SCOs can be annealed to the cssDNA. The methods described herein can also be combined with RNA-guided polymerization (e.g., click editing39, DNA polymerase editing40, prime editing41), RNA-guided ligation technologies42, or nuclease-driven (e.g., by CRISPR-Cas, OMEGA43, or Fanzor44nucleases) homology directed repair or end-joining to enable programmable gene insertion, where a recombinase binding site is preinstalled in a first step prior to DNA integration by the recombinase (see, e.g., Figs.9A-D, 10A-D). Bridge recombinases or other RNA-guided recombinases may also be used with INSTALL methods to facilitate RNA-programmed DNA insertion. Alternatively, natural or engineered recombinases or transposases can be used to integrate a DNA sequence at a desired targeted site(s). These strategies should minimize cytosolic dsDNA immune sensing while facilitating nuclear localization of the donor molecule, providing new donor DNA compositions for various strategies for large DNA delivery and non-viral DNA integration. Recombinases and Transposases Site-specific serine recombinases irreversibly integrate DNA sequences containing an attP attachment site into a target DNA sequence containing a corresponding attB attachment site. (Merrick et al., ACS Synth Biol.2018 Feb 16;7(2):299-310; Rutherford and Van Duyne, Curr Opin Struct Biol.2014 Feb:24:125-31). Recombinases that naturally, or have been engineered to, target a genome of interest at one or multiple sites can be used to integrate a donor of interest at that site(s) (where the genome contains a pseudo-attP and the donor contains an attB or the genome contains a pseudo-attB and the donnor contains an attP). Genome editing, e.g., using click editors (da Silva and Tou et al., bioRxiv.2023 Sep 13:2023.09.12.557440), prime editors (Zhao et al., Trends Biotechnol.2023 Aug;41(8):1000-1012; ref.4), or base editors (Hryhorowicz et al., Int J Mol Sci.2023 Sep 18;24(18):14233; Liu et al., Med Rev (Berl).2023 Feb 22;3(1):75-84) can be used to install attB or attP at specific sites in the genome to direct programmable DNA integration into a targeted genomic site of a target cell. Either the attB or attP is on the donor plasmid and the other is the edit on the target DNA (e.g., human genome) installed by genome editing technologies; for example, if an attP is installed on the target DNA (e.g., human genome), then the attB is on the donor that will be integrated, or vice versa (attB is isntalled on the target DNA and attP is on the donor). Recombinases encompass several subclasses of protein families including tyrosine recombinases (e.g., Cre, Flp; Meinke et al., Chem. Rev.2016, 116, 20, 12785–12820), large serine recombinases (e.g., BxbI, PhiC31, Pa01, BceInt, SacInt, SscInt, or Dn29; see Durrant et al., Nat Biotechnol.2023; 41(4): 488–499; Yarnall et al., Nature Biotechnology 41:500–512 (2023)), and bridge recombinases (Durrant, M.G., Perry, N.T., Pai, J.J. et al., Nature 630, 984–993 (2024)). Engineered recombinases can be used that have increased integration activity and / or specificity, e.g., eeBxb1 or evoBxb1 or other engineered Bxb1 variants (see, e.g., WO2024168147; Pandey et al., Nat Biomed Eng.2024 Jun 10. doi: 10.1038 / s41551- 024-01227-1; ref7) or the hyperactive Bxb1 integrases described in Hew et al., Nucleic Acids Res.2024 Aug 12;52(14):e64 (ref.45), e.g., C22Bxb1, in Huhtinen et al, BMC Biotechnol.2024 Jun 26;24(1):44 (ref.46), e.g., Bxb1 NPLCx2, or in Shin et al., ACS Synth. Biol.2021, 10, 7, 1715–1727 (ref.47), e.g., Bxb1 NP-C. As shown herein, Piv-family invertases, e.g., as described in Tobiason et al., J Biol Chem.1999 Apr 274(14):9698-706; Marrs et al., J Bacteriol.1990 Aug 172(8):4370-7; Buchner et al., J Bacteriol.2005 May 187(10):3431-7 (refs.48–50), can also be used as RNA- guided recombinases in the present methods. Alternatively, transposases can be used in place of a recombinase with the transposase Left End (LE) and Right End (RE) encoded on the donor (Anzalone et al., Nat. Biotechnol.38, 824–844 (2020)). If a transposase is site-specific, the transposase binding sequence can be preinstalled at a genomic site (e.g., randomly integrating or site-reprogrammable transposases include piggybac, sleeping beauty, type I CASTs, type V CASTs, etc.; see, e.g., Kovac et al., doi.org / 10.7554 / eLife.53868). Other transposases include, Tn7 (Shen et al, Nat Struct Mol Biol.2022 Feb;29(2):143-151), and CRISPR-associated transposases (CASTs, WO2023102176 and Refs.4,5). As above for the recombinase sites, genome editing methods can be used to insert LE and RE sequences into the genome of a target cell. Exemplary sequences for transposases and recombinases are provided below. Substrate DNA donor molecules: Circular single stranded DNA molecules (cssDNAs) and substrate complementary oligonucleotide-annealed DNA (scoDNA) The present methods use substrate DNA donor molecules comprising circular single stranded DNA molecule (cssDNA) comprising a desired sequence to be inserted, where the cssDNA can localize to the nucleus, undergo second strand synthesis, and be integrated into the host genome by the recombinase or transposase. The cssDNA also includes recognition sites for recombinase or transposes; these sites can be, e.g., 10-500 bp, 10-250, 10-200, 10-100, 10-150, or 25-50 bp long. Exemplary recombinase recognition sequences can comprise attP or attB, and transposase left and / or right ends can comprise LE or RE, LTRs, or ITRs. The desired sequences (which are intended to be inserted into the genome of a cell) can be, e.g., therapeutic transgenes, cDNA, or any other sequence, and can be, e.g., 100bp - 500,000 bp nt, e.g., at least 100 nt, 250 nt, 500 nt, 1000 nt, 1500 nt, 2 kb, or 2.5 kb, up to 5 kb, 7.5 kb, 10 kb, 20kb, 50 kb, 100kb, 200kb, 250 kb, 500 kb or more. Part of the circular ssDNA can be double-stranded. For example, part of the circular ssDNA can be made double-stranded by annealing a SCO, e.g., a DNA or RNA or DNA / RNA hybrid nucleic acid SCO that is at least partly complementary to part of the cssDNA, to form a scoDNA donor molecule. The SCO can comprise one or more of: (i) one or more conjugated NLS (e.g., PNA or DNA-NLS), (ii) various chemical modifications and / or abasic sites for stability, and / or (iii) DNA and / or RNA, various chemical modifications and / or abasic sites to recruit RNAseH, Flap endonucleases, DNA polymerases, or other endogenous repair machinery. The SCO can include one or more bases or regions that are intentionally mismatched with the cssDNA to avoid long contiguous matched regions that might elicit an innate immune response. Optimization of the present methods can increase integration efficiency. For example, varying the length the SCO can optimize and control the length of dsDNA (which may largely also be shielded by the DNA binding enzyme, e.g., a recombinase), chemical modification(s) of the SCO (e.g., 3’ and / or 5’ end modification, internal stabilizing bases, DNA, RNA, 2’OMe, 2’MOE, PNA, LNA, exNAs, hybrids of various nucleic acids, inverted bases, 5’ and / or 3’ terminal phosphate, etc.), extended SCOs with paired and unpaired regions, or other structural alterations to the SCO. Unpaired bases between the SCO and cssDNA may particularly aid RNA-guided recombinases by preforming an unwound substrate. One potential SCO modification would involve the use of one or more abasic sites, which can recruit endogenous nucleotide excision repair (NER) factors and / or long-patch base excision repair (LP-BER) factors (including endogenous polymerase delta or polymerase epsilon) (Fig.12a). Modfied SCOs with a 3’ end that is incompetent for polymerase extension may reduce risk of cytosolic 3’ extension (and thus dsDNA formation which will invoke the dsDNA-sensing immune response) and SCO degradation (e.g., by TREX1) until nuclear localization has occurred (where NER / LP- BER machinery is localized), limiting activation of cystosolic immune sensing. Other nucleus-localized endogenous enzymes may also be leveraged to enable the use of 3’ end-protected (e.g., phosphorothioate linkages, extended nucleic acids (exNAs)51, or modified bases) and / or 3’ blocked SCOs (e.g., with a 3’ phosphate, inverted base, etc.) (Fig.12a-c, Fig.9). For example, inclusion of one or more RNA bases near the 3’ end of the SCO may be used to recruit endogenous RNAseH2, whose activity would remove the RNA base and initiate second-strand synthesis (Fig.12b, Fig.9). Inverted bases can also be used, whereby a 5’ flap can be formed from a 3’-3’ junction on the SCO. Such a 5’ flap can be cleaved by 5’ flap endonucleases (e.g., FEN1) in the nucleus to initiate second strand synthesis (Fig.12c). Alternatively, the SCO may be annealed anywhere on the cssDNA (to optionally act as a primer for second-strand synthesis and / or reconstitute dsDNA binding domain recognition sequences to facilitate nuclear localization (via endogenous or exogenously expressed DNA binding domains) (INSTALL-2b; Fig.1d). The structure and composition of the cssDNA itself and / or the SCO may also be modified to modulate INSTALL efficiencies and / or minimize immunogenicity of cssDNA or scoDNA donor molecules by reducing cytosolic residency time and / or minimizing long stretches of paired ssDNA. (Fig.13). For example, designed secondary structure in the cssDNA may act as binding regions for dsDNA or ssDNA binding domains (either endogenous or exogenously expressed proteins). Co- expression of a non-specific ssDNA or RNA binding protein domain, or fusion of a non-specific ssDNA or RNA binding domain to a recombinase that is expressed in the cell to carry out integration of the cssDNA or scoDNA, (e.g., Replication protein A, RPA52; single-stranded binding protein, SSB53,54; or a retrotransposase (e.g. LINE-1, R2, R1) Orf1p55) that is fused to one or more NLS peptides can facilitate nuclear localization of the cssDNA or scoDNA donor molecule, minimize immunogenic secondary structure, or protect the DNA molecule from innate immune sensors. These domains may also be precomplexed with the donor molecule prior to delivery into the target cell by incubation of purified protein with the cssDNA or scoDNA. Additionally or alternatively, the SCO may also contain a binding site for a sequence or structure specific ssDNA or RNA binding protein domain (e.g., HUH endonuclease56, telomere binding proteins57(e.g., Cdc13), phage coat proteins (MCP, PCP, Com, etc), etc.) or a chemical moiety that is specifically recognized by a protein binding domain (e.g., SNAP-tag, CLIP-tag, HALO-tag, monomeric or tetrameric streptavidin (e.g., mSA58,59)). Co-expression or fusion of a sequence or structure specific ssDNA or RNA binding protein domain with or to, respectively, the recombinase used to carry out integration of the scoDNA into the target cell genome or precomplexing of purified protein of this domain with the SCO before or after annealing to the cssDNA (to form scoDNA) prior to delivery into the target cell may also assist with nuclear localization and reduce cytosolic residency time if the protein used is fused to one or more NLS peptides. Alternatively, the SCO may be a peptide nucleic acid (PNA) containing an NLS or be covalently conjugated to an NLS peptide. The SCO can also have one or more chemical modification(s) (e.g., 3’ and / or 5’ end modification, internal stabilizing bases, RNA, PNA, LNA, exNAs, 2’ F-DNA, 2’OMe, 2’MOE, PS linkages, morpholinos, locked nucleic acids (LNAs), bridged nucleic acids (BNAs), 5-Methyl dC, abasic sites or damaged bases, etc.). For example, the SCO can comprise one or more modifications comprising: a modified sugar moiety, and / or a modified internucleoside linkage, and / or a modified nucleotide and / or combinations thereof. It is not necessary for all positions in a given oligonucleotide to be uniformly modified, and more than one of the modifications described herein can be incorporated in a single oligonucleotide or even at within a single nucleoside within an oligonucleotide. In some embodiments, the SCO are chimeric oligonucleotides that contain two or more chemically distinct regions, each made up of at least one nucleotide. These SCOs can, e.g., contain at least one region of modified nucleotides that confers one or more beneficial properties (such as, for example, increased nuclease resistance, increased uptake into cells, increased binding affinity for the target, decreased innate immune response, decreased or ablation of RNAseH activation). Chimeric SCOs can be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and / or oligonucleotide mimetics as described herein. Such compounds have also been referred to in the art as hybrids or gapmers. In some embodiments, the SCO comprises at least one nucleotide modified at the 2' position of the sugar, most preferably a 2'-O-alkyl, 2'-O-alkyl-O-alkyl or 2'- fluoro-modified nucleotide. In other preferred embodiments, RNA modifications include 2'-fluoro, 2'-amino and 2' O-methyl modifications on the ribose of pyrimidines, abasic residues or an inverted base at the 3' end of the RNA. Such modifications are routinely incorporated into oligonucleotides and these oligonucleotides have been shown to have a higher Tm (i.e., higher target binding affinity) than; 2'-deoxyoligonucleotides against a given target. A number of nucleotide and nucleoside modifications have been shown to make oligonucleotides into which they are incorporated more resistant to nuclease digestion than the native oligodeoxynucleotide; these modified oligos survive intact for a longer time than unmodified oligonucleotides. Specific examples of modified oligonucleotides include those comprising modified backbones, for example, phosphorothioates, phosphotriesters, extended nucleic acid (exNA) (WO2021195533), methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. Most preferred are oligonucleotides with phosphorothioate backbones and those with heteroatom backbones, particularly CH2-NH-O-CH2, CH,~N(CH3)~O~CH2(known as a methylene(methylimino) or MMI backbone], CH2 --O--N (CH3)-CH2, CH2 -N (CH3)-N (CH3)-CH2and O-N (CH3)- CH2-CH2backbones, wherein the native phosphodiester backbone is represented as O- P-- O- CH,); amide backbones (see De Mesmaeker et al. Ace. Chem. Res.1995, 28:366-374); morpholino backbone structures (see Summerton and Weller, U.S. Pat. No.5,034,506); peptide nucleic acid (PNA) backbone (wherein the phosphodiester backbone of the oligonucleotide is replaced with a polyamide backbone, the nucleotides being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone, see Nielsen et al., Science 1991, 254, 1497). Phosphorus-containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3'alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Morpholino-based oligomeric compounds are described in Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41(14), 4503-4510); Genesis, volume 30, issue 3, 2001; Heasman, J., Dev. Biol., 2002, 243, 209-214; Nasevicius et al., Nat. Genet., 2000, 26, 216-220; Lacerra et al., Proc. Natl. Acad. Sci., 2000, 97, 9591-9596; and U.S. Pat. No.5,034,506, issued Jul.23, 1991. In some embodiments, the morpholino-based oligomeric compound is a phosphorodiamidate morpholino oligomer (PMO) (e.g., as described in Iverson, Curr. Opin. Mol. Ther., 3:235-238, 2001; and Wang et al., J. Gene Med., 12:354-364, 2010; the disclosures of which are incorporated herein by reference in their entireties). Structural alterations can also be made to the SCO. One potential SCO modification would involve the use of one or more abasic sites, which can recruit endogenous nucleotide excision repair (NER) factors and / or long-patch base excision repair (LP-BER) factors (including endogenous polymerase delta or polymerase epsilon) (Fig.4a). Use with a 3’ end that is incompetent for polymerase extension may reduce risk of cytosolic 3’ extension (and thus dsDNA formation) until nuclear localization has occurred (where NER / LP-BER machinery is localized), limiting activation of cystosolic immune sensing. Methods of Use and Delivery The present methods can include delivering the cssDNA and optional SCO to the nucleus of a target cell, to integrate a sequence present in the cssDNA into the cell. The methods can include contacting the cell with the cssDNA or cssDNA / SCO complex, either naked or in a carrier, such as a lipid nanoparticle (LNP), liposome, exosome, virus-like particle, or a variant thereof (see, e.g., Zhou and Yao, Mol Biomed 4, 10 (2023). doi.org / 10.1186 / s43556-023-00115-5; Banskota et al., Cell. 2022 Jan 20; 185(2): 250–265.e16; US11020470; Raguram et al., Cell. Volume 185, Issue 15, 21 July 2022, Pages 2806-2827; WO2020252455; WO2022020800; WO2024108001; WO2024107959 and WO2024107983). The LNPs can comprise various lipids, including dioleoylphosphatidylethanolamine (DOPE); 1,2-distearoyl- sn-glycero-3-phosphocholine (DSPC); 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC); 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC); 1,2-dipalmitoyl-sn- glycero-3-phosphocholine (DPPC); 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC); and 1-stearoyl-2-oleoyl-sn-glycero-3-phosphocholine (SOPC). See also Jung et al., Theranostics.2022; 12(17): 7509–7531. In some embodiments, the LNPs comprise the MC-3 ionizable lipid60, have average sizes between 150-160 nm with a uniform size distribution (0.078-0.112) and a neutral zeta potential. In addition to the cssDNA / SCO DNA donor molecule, the methods include delivering into the cell the relevant recombinase or transposase to integrate the DNA donor molecule into the desired target site. The methods can include delivering a mRNA molecule encoding the recombinase or transposase, or To enhance nuclear localization of the cssDNA, various approaches can be pursued. For instance, the fusion of one or more nuclear localization sequence(s) (NLSs) on the recombinase may facilitate translocation of the cssDNA into the nucleus (Fig.12d). Alternatively, co-expression of single-stranded DNA binding protein (SSB) fused to one or more NLSs, or pre-incubation of the cssDNA with this fusion (e.g., thermostable SSBs when packaging into lipid nanoparticles), may coat the cssDNA with SSB-NLS proteins to facilitate nuclear localization of the cssDNA (in addition or alternatively to recombinase-NLS binding of the cssDNA; Fig.12d). Because the recombinase binding site is dsDNA when using a scoDNA donor (via the SCO), the SSB should not bind and thus permitting the dsDNA region to remain free for effector engagement. Furthermore, SSB may reduce dsDNA secondary structures in the cssDNA, minimizing risk of cytosolic dsDNA sensing, and protect the donor further from degradation. The cssDNA donors may also be recoded to minimize or insert customizable secondary structures, or be carefully recoded at the sequence level to minimize unmethylated CpG motif that may be a trigger for TLR9 ssDNA sensing in endosomes and / or CGT motifs that may trigger SLFN11 signaling in the nucleus61. To enhance nuclear localization of the scoDNA, several approaches can be pursued. For instance, the fusion of one or more nuclear localization sequence(s) (NLSs) on the recombinase may facilitate translocation of the scoDNA into the nucleus (Fig.4b). The nuclear localization sequences (NLSs), can be added, e.g., at the C- and / or N-terminus of the protein. Exemplary NLSs include SV40 large T antigen NLS (PKKKRRV (SEQ ID NO:1)); PKKKRKV (SEQ ID NO:2); KRTADGSEFES)PKKKRKV (SEQ ID NO: 3); and nucleoplasmin NLS (KRPAATKKAGQAKKKK (SEQ ID NO:4)). Other NLSs are known in the art; see, e.g., Cokol et al., EMBO Rep.2000 Nov 15; 1(5):411–415; Freitas and Cunha, Curr Genomics.2009 Dec; 10(8): 550–557. Alternatively, coexpression of a single-stranded nucleic acid binding protein (ssNABP), e.g., single stranded binding protein (SSB) or Orf1p (Guo et al., Biomolecules 2022, 12(9), 1187; Maffeo and Aksimentiev, Nucleic Acids Research 2017, 45(21):12125–12139; Ashton et al., BMC Molecular Biology volume 14, Article number: 9 (2013)), fused to one or more NLSs, or precinbuation of the scoDNA with this fusion, may coat the scoDNA with SSB-NLS proteins to facilitate nuclear localization of the scoDNA (in addition to recombinase-NLS binding of the scoDNA; Fig.4b). Because the recombinase binding site is dsDNA (via the SCO), the SSB should not bind there and thus would leave the dsDNA region free for effector engagement. Furthermore, SSB may reduce dsDNA secondary structures in the scoDNA, minimizing risk of cytosolic dsDNA sensing. The scoDNA may also be recoded to minimize or insert customizable secondary structures, or recoded to minimize unmethylated CpG motifs, the latter of which may be a trigger for TLR9 ssDNA sensing in endosomes. The methods can also include administering small molecule inhibitors of TLR9, cGAS, or STING, or antagonistic inhibitory oligonucleotides targeting TLR9, cGAS, or STING, e.g., to minimize immune responses to the dsDNA; see, e.g., Song et al., Acta Pharmacologica Sinica volume 44, pages791–800 (2023); Shukla et al., ACS Med. Chem. Lett.2018, 9, 12, 1156– 1159; Decout et al., Nature Reviews Immunology (21):548–569 (2021); Habas et al., Volume 2022 | Article ID 2337363; doi.org / 10.1155 / 2022 / 2337363; Lama et al., Nature Communications volume 10, Article number: 2261 (2019); Lamphier et al., Molecular Pharmacology March 2014, 85 (3) 429-440. The delivery of cssDNA or scoDNA alone or with a recombinase or transposase protein or DNA or mRNA encoding a recombinase or transposase into cells ex vivo or in vitro62,63can be performed through (but not limited to) cell electroporation / nucleofection, transfection (e.g. via lipid-based nanoparticles and reagents, polymer-based nanoparticles and reagents, protein-based nanoparticles and reagents, hybrid nanoparticles, or other similar delivery modalities), vesicles (e.g., microvesicles or extracellular vesicles) or exosomes, or with amphiphilic peptides64. Alternatively, the cssDNA or scoDNA can be delivered as described and the recombinase can also be expressed from a viral vector (e.g., Adenovirus, AdV; Adeno-associated virus, AAV; Lentivirus; Anellovirus; etc.). The delivery of cssDNA or scoDNA alone or with a recombinase or transposase protein or DNA or mRNA encoding a recombinase or transposase into cells in vivo62,63can be performed with (but not limited to) nanoparticle reagents (e.g. lipid nanoparticles, LNPs; polymeric nanoparticles; gold nanoparticles; dendrimers; protein nanoparticles; or hybrid nanoparticles), vesicles (e.g., microvesicles or extracellular vesicles) or exosomes, or virus-like particles. The cssDNA or scoDNA can be formulated into the same particles or vesicles from the recombinase protein, mRNA, or DNA; or alternatively, the cssDNA or scoDNA can be formulated into separate particles or vesicles from the recombinase protein, mRNA, DNA. Alternatively, the cssDNA or scoDNA can be delivered as described and the recombinase can also be expressed from a viral vector (e.g., Adenovirus, AdV; Adeno-associated virus, AAV; Lentivirus; Anellovirus; etc.). For both ex vivo / in vitro and in vivo delivery, both the cssDNA or scoDNA and the recombinase or transposase protein or DNA, mRNA, or virus that encodes the recombinase or transposase protein can be delivered at synchronous or asynchronous time points. The delivery of the cssDNA or scoDNA and / or the recombinase or transposase protein or mRNA, DNA, or virus encoding the recombinase or transposase protein may be repeated one or more times. Targeted Gene Insertion The present methods can be used for targeted gene insertion, e.g., when combined with RNA-programmable DNA polymerization technologies, where click editing39, DNA-polymerase editing40, prime editing or PASTE41,65,66, or other approaches (e.g., nuclease and HDR, ligase-mediated editing42) to pre-install recombinase binding sites (e.g., attP or attB sequences) at desired genomic regions. A recombinase can subsequently be used to integrate a cssDNA or scoDNA donor into the genome at the appropriately installed recombinase landing pad (also referred to herein as recombinase recognition sequences). Alternatively, the present methods can be coupled with bridge recombinases or other RNA-guided recombinases can be used to enable single-step, programmable gene insertion from cssDNA or scoDNA starting material. As metagenomic sequencing data continues to unveil vast recombinase diversity, and as recombinases are further characterized, exploring and implementing the present methods with all current and emerging approaches that rely on dsDNA donors represents a promising avenue for DNA integration applications. The cssDNA can include any desired sequence, including cDNA encoding a therapeutic gene. Optionally, the desired sequence in the cssDNA can be recoded to minimize or alter secondary structure or minimize CpG motifs. For example, if the cssDNA encodes a protein reading frame, substitutions could be made in the wobble positions of codons to be able to re-code the donor sequence, to minimize specific nucleotide contexts or minimize predicted secondary structures. In some embodiments, the regulatory elements and / or protein coding sequences can be recoded. Exemplary sequences In some embodiments, the sequence of a protein or nucleic acid used in a composition or method described herein is at least 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to a sequence set forth herein. To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). In a preferred embodiment, the length of a reference sequence aligned for comparison purposes is at least 80% of the length of the reference sequence, and in some embodiments is at least 90% or 100%. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleic acid “identity” is equivalent to amino acid or nucleic acid “homology”). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch ((1970) J. Mol. Biol.48:444-453 ) algorithm which has been incorporated into the GAP program in the GCG software package (available on the world wide web at gcg.com), using the default parameters, e.g., a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5. In some embodiments, the sequence of a protein or nucleic acid used in a composition or method described herein has up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid substitutions or deletions as compared to a sequence set forth herein. In some embodiments, the substitutions are conservative substitutions.

[0002] #, SEQ ID NO: Table 2. Plasmids

[0003] #, SEQ ID NO: #, SEQ ID NO: Table 5. Bridge RNAs (bRNAs) and piv ncRNAs #, SEQ ID NO: Table 6. Substrate complementary oligos (SCOs) #, SEQ ID NO: Table 9. ddPCR primers #, SEQ ID NO: Table 10. Single-stranded oligonucleotides for HDR (ssODNs) #, SEQ ID NO: Table 11. Synthetic sgRNAs (Synthego) #, SEQ ID NO: Table 12. PASSIGE epegRNA sequences (tevopreQ1 epegRNA) #, SEQ ID NO: Table 13. Exemplary Single stranded Binding Proteins

[0004] #, SEQ ID NO: Table 14. Exemplary HUH endonuclease amino acid sequences #, SEQ ID NO: *nonanucleotide sequence is bolded where known, additional sequence from 5' and 3' stem sequence flanking nonanucleotide sequence Table 15. Additional Exemplary domains for SCO binding

[0005] #, SEQ ID NO: mSA-H, (monomeric streptavidin); eMA, enhanced monomeric avidin Cdc13 reference: Hughes et al., Proc Natl Acad Sci U S A.2000 Jun 6;97(12):6457- 62. HUH endonuclease reference: Tompkins et al., Nucleic Acids Res.2021 Jan 25;49(2):1046-1064; Lovendahl et al., J Am Chem Soc.2017 May 24; 139(20): 7030–7035. RNA binding Cas proteins: Ozcan et al., Nature.2021 Sep;597(7878):720-725, Abudayyeh et al., Science.2016 Aug 5;353(6299):aaf5573. EXAMPLES The invention is further described in the following examples, which do not limit the scope of the invention described in the claims. Methods The following materials and methods were used in the example below. In vitro generation of circular ssDNA molecules cssDNA molecules were generated by a nick-and-digest method similar to as previously described30. Briefly, plasmids or minicircle templates for cssDNA production containing an Nt.BbvCI restriction enzyme site on the desired strand to be degraded were maxiprepped (Qiagen) and used fresh or stored at 4 °C for a maximum of 1 week before use. The nick-and-digest reactions were generally performed in 100 µL reactions in a PCR strip tube containing 12 µg of template plasmid DNA, 10 µL 10x Cutsmart Buffer, 5 µL 1:10 diluted Exonuclease III (50U) (NEB), 5 µL Exonuclease I (100U) (NEB), 5 µL Nt.BbvCI (50U) (NEB), and H2O up to a total volume of 100 µL. Reactions were placed into a thermocycler with the following program: 37 °C for 90 min, 80 °C for 20 min, and hold at 10 °C. Two 100 µL reactions were then combined into Eppendorf tubes and ethanol precipitated by adding 0.1 volumes (20 µL) of 3M sodium acetate and 3 volumes (600 µL) of ice cold ethanol (mixing gently by pipetting up and down) and letting the mixture incubate at - 20 °C for at least 2 hrs. Precipitated DNA was pelleted by centrifugation at 13,000 rpm at 4 °C for 30 min, supernatant was removed, and two wash steps with 75% ice- cold Ethanol were performed (centrifuging at 13000 rpm at 4°C for 10 min between each wash) . After air drying, DNA was resuspended in 15 µL of duplex buffer (IDT), analyzed on an agarose gel to ensure only cssDNA was present, and stored at 4 °C until use. Generation of cssDNA via M13 phage production Donor template sequences for recombinases or transposases were constructed as dsDNA and cloned into a phagemid vector with split f1 origin as previously described67. The phagemid contains the packaging sequence located between two f1- ori sequences for initiation or termination ssDNA production. cssDNA molecules were produced similar to as previously described31. Briefly, XL1-Blue E. coli cells were co-transformed with the M13 helper plasmid and phagemid containing double- stranded donor template and selected on agar plates with kanamycin (50 μg / mL) and carbenicillin (100 μg / mL). A single colony was selected and grown for ~24 hours at 37 °C and 225 rpm in 250 mL 2xYT media (1.6% tryptone, 1% yeast extract, 0.25% NaCl) to reach OD600 between 2.5-3.0. The bacterial cultures were pelleted by centrifugation at 10,000 x g at 4 °C for 30 min, and the phage particles in the supernatant were precipitated with PEG-8000 (final concentration 4%) with 0.5 M NaCl for 1 hour at 4 °C. The precipitated phage particles were then pelleted by centrifugation at 14,000 x g at 4 °C for 15 min. The phage–PEG / NaCl precipitates were redispersed in 1 X Tris-Buffered Saline (TBS) buffer and centrifuged again. The pellet was lysed in 20 mM MOPS, 1M Guanidine-HCl and 2% Triton X-100 at 80°C for 1 hr. The cssDNA released from the phage were then extracted with NucleoBond Xtra Midi EF kit (Macherey-Nagel) following the manufacturer's instructions. The concentration of cssDNA was determined by Nanodrop for ssDNA and the yields were ~10 μg per mL of liquid culture. Ratios of absorbance (A260 nm / A280 nm and 260nm / 230nm) reflect consistent purity (1.8 and > 2, respectively) from serial preps. Recombinant cssDNA molecules were verified by Sanger sequencing using staggered sequencing primers for complete coverage of the plasmids. Human cell culture Human HEK 293T and HeLa cells (CRL-3216 and CCL-2, respectively; ATCC) were cultured at 37 °C with 5% CO2 in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum and 1% penicillin–streptomycin (Thermo Fisher Scientific). HCT 116 cells (CCL-247; ATCC) were cultured at 37 °C with 5% CO2in McCoy’s medium supplemented with 10% heat-inactivated fetal bovine serum and 1% penicillin–streptomycin (Thermo Fisher Scientific). Primary Epidermal Keratinocytes (HEKa, PCS-200-011; ATCC) were cultured at 37 °C with 5% CO2 in Dermal Cell Basal Medium (ATCC) supplemented with keratinocyte growth kit components (ATCC), according to the manufacturer’s instructions. In vitro biochemical integration assay using Bxb1 protein from HEK 293T cell lysates To generate human cell lysates containing Bxb1 protein, approximately 150,000 HEK 293T cells were seeded in 48-well plates and transfected with 600 ng of Bxb1 expression plasmid (EMK569) ~20 h after seeding. Transfected cells were incubated for 48 h at 37 °C, and then the cell lysate was harvested by removing culture medium and adding 100 µL gentle lysis buffer (20 mM Hepes pH 7.5, 100 mM KCl, 5 mM MgCl2, 5% (vol / vol) glycerol, 1 mM dithiothreitol, 0.1% (vol / vol) Triton X-100, and 1x SigmaFast Protease Inhibitor Cocktail (EDTA-free; MilliporeSigma) where 1x solution is 1 tablet per 100 mL) to each well and placed on a rocker for 20 min at 4 °C. Suspended cells were placed in a 96-well PCR plate, vortexed vigorously for 3–5 s, and briefly spun down in a centrifuge to remove cell debris. Lysates were then aliquoted into PCR-strip tubes and snap frozen using liquid nitrogen for storage at -80 °C until use. For lysate-based integration assays, 25 ng of pTarget and 80 ng of dsDNA or 40 ng of cssDNA or scoDNA (equimolar donor) were added to 15 µL HEK 293T cell lysate aliquots and incubated for 2 hrs at 37 °C. Reactions were then heat inactivated by incubation at 80 °C for 10 min. For time-course lysate reaction experiments, 40 ng pTarget and 200 ng of dsDNA or 100 ng cssDNA or scoDNA (equimolar donor) was used in 100 µL reactions. At each time-point, 10 µL was removed and heat inactivated at 80 °C for 10 min. Heat inactivated reactions were then cleaned up using 0.8x paramagnetic beads, prepared as previously described68,69. The resulting DNA was then used as input into junction PCRs and ddPCR (Tables 8-9). Junction PCRs were performed by amplifying cleaned DNA with Q5 high fidelity DNA polymerase (NEB) using a 30-cycle PCR reaction, comprising 20 ng of template as input into 20 µL PCR reactions. Thermal cycling conditions were: 98 °C for 2 min; 30 cycles of 98 °C for 10 sec, 65 °C for 15 sec, 72 °C for 1 min; and a final extension of 72 °C for 3 min. mRNA production An in vitro transcription template was cloned to encode the human codon optimized Bxb1, BceINT, Pa01, SacINT, or IS621 coding sequence into pIVT- nCas9(H840A) (Addgene plasmid 207455), which is a vector containing a CleanCap reagent AG-compatible T7 promoter backbone, 5’ and 3’ UTRs, and a 110-nt poly(A) tract. The cloned plasmid was linearized with Esp3I (NEB) and column purified with a QIAquick PCR purification kit (Qiagen). The linearized template was transcribed using a HiScribe T7 mRNA Kit with Cleancap Reagent AG (NEB) with replacement of UTP by N1-methylpseudo-UTP (Trilink Biotechnologies) according to the manufacturer’s instructions. The resulting mRNA was purified using a Monarch RNA Cleanup Kit (NEB). scoDNA preparation scoDNA was prepared by mixing the SCO and corresponding cssDNA in duplex buffer (IDT) at a 3:1 to 10:1 molar ratio. Mixtures were then placed in a thermocycler and the following annealing protocol was run: 95 °C for 3 min, then a slow negative temperature ramp of -1°C / sec to a final temperature of 10°C. For scoDNA used in in vivo experiments, scoDNA was prepared by mixing SCO and respective cssDNA in duplex buffer (IDT) at a 3:1 molar ratio. Alternatively, mixtures of SCO and cssDNA in a 1.7 mL centrifuge tube were heated at 95 °C for 3 min in a heat block, then removed and placed at room temperature for 15 min, before storage at 4 °C until use. HEK 293T, HCT 116, or HeLa cell transfections 20,000 HEK 293T cells were seeded in 96-well plates ~20 hours prior to transfection. For experiments using Bxb1 plasmid expression in the attB or attP HEK 293T cell lines, transfections were performed using a ratio of 0.5 µL TransIT-X2 (Mirus) per 100 ng of DNA with 80 ng of Bxb1 expression plasmid and 12.5-200 ng of cssDNA or scoDNA donor. For plasmid targeting experiments, wild-type HEK 293T cells were transfected with the same transfection reagent and recombinase and donor plasmids, but also including 40 ng of pTarget. For sequential experiments in attP HEK 293T cells, 80 ng of Bxb1 expression plasmid was transfected (0.5 µL TransIT-X2 (Mirus) per 100 ng of DNA) followed by 50-200 ng of dsDNA, cssDNA, or scoDNA 48 hrs later. For sequential delivery PASSIGE experiments, 80 ng of PEmax plasmid70, 15 ng each pegRNA plasmid, and 80 ng of Bxb1 expression plasmid were transfected first, followed by 300 ng of dsDNA, cssDNA, or scoDNA donor molecules ~48 hrs later. For all-in-one PASSIGE experiments, 150 ng of donor was used with the same amounts of PEmax, pegRNA, and Bxb1 plasmids as described for sequential transfections. For sequential delivery experiments, cells were harvested 24 hrs after the donor DNA transfection. For experiments using mRNA expression of recombinases (i.e., Bxb1, Pa01, BceINT, SacINT) in attB or attP HEK 293T cells, two transfection protocols were utilized including “mixed” or “separate” approaches. For the “mixed” protocol, 150 ng of recombinase-encoded mRNA and 150 ng of dsDNA, cssDNA, or scoDNA donors were complexed together with 0.6 µL of TransIT-mRNA (Mirus) and 0.3 µL of boost reagent (Mirus) and added to cells. For the “separate” protocol, 150 ng of recombinase-encoded mRNA was complexed with 0.3 µL of TransIT-mRNA and 0.3 µL of boost reagent and added to cells. Separately, 150 ng of dsDNA, cssDNA, or scoDNA was complexed with 0.75 µL of TransIT-X2 and added to the cells. For experiments with mRNA expression of Bxb1 in attP or attB HEK 293T cells (when comparing integration in nocodozole-treated vs untreated cells), attP or attB HCT-116 cells, or attP or attB HeLa cells, transfections for HEK 293T and HCT- 116 cells were performed between 20-24 hours following seeding of 2.2 x104cells per well in 96-well plates. For replication-stalled HEK 293T cells, 35 ng / mL of nocodazole (Sigma-Aldrich) was added to the cells during seeding (see expanded description, below, and fig. S7B). For HeLa cells, 8 x 103cells were seeded in 96-well plates 20-24 hours prior to transfection. Standard transfections followed a “separate” protocol described above, which included 150 ng of donor plasmid (dsDNA, cssDNA, or scoDNA donors) in a final volume of 5 µL of Duplex Buffer (Integrated DNA Technologies) and a 150 ng of Bxb1-encoding mRNA. For bridge recombinase experiments using plasmid codelivery, 70 ng of IS621 recombinase plasmid and 50 ng of bRNA plasmid were cotransfected with 20 ng of pTarget plasmid and 100 ng of pDonor (using 1.2 µL of TransIT-X2). For bridge recombinase experiments using mRNA-encoded IS621, 150 ng of IS621 mRNA was complexed with 0.3 µL of TransIT-mRNA and 0.3 µL of boost reagent and added to cells. Separately, 100 ng of pDonor (either dsDNA, cssDNA, or scoDNA), 50 ng of bRNA plasmid, and 25 ng of pTarget was complexed with 0.9 µL of TransIT-X2 and added to the cells. For Piv recombinase experiments using plasmid codelivery, 70 ng of piv recombinase plasmid, 30 ng of ncRNA plasmid, 15 ng of pTarget, and 85 ng of pDonor was complexed with 1 µL of TransIT-X2 and delivered to cells. For sequential delivery piv recombinase experiments, 70 ng of ePiv plasmid and 30 ng of ncRNA plasmid was complexed with 0.5 µL of TransIT-X2 and delivered to cells. Next, 270 ng of pDonor and 30 ng of pTarget was complexed with 1.5 µL of TransIT- X2 and delivered to cells ~48 hrs after the first transfection. Cells were harvested ~24 hrs after the pDonor and pTarget transfection. Transfected cells for codelivery experiments were incubated at 37 °C for 72 h for experiments using plasmid expression of recombinase or for 48 h for experiments using mRNA expression of recombinase, cell culture media was removed, and cells were lysed by addition of 100 µL lysis buffer (20 mM Hepes pH 7.5, 100 mM KCl, 5 mM MgCl2, 5% (vol / vol) glycerol, 1 mM dithiothreitol, 0.1% (vol / vol) Triton X- 100). The lysis reaction was and incubated at 65 °C for 6 min followed by 98 °C for 2 min. A mixture of genomic DNA (gDNA) and plasmid (for plasmid targeting experiments) or gDNA only (for genome targeting experiment) was extracted by performing a bead clean-up on the lysate using 1x paramagnetic beads, then used as input into junction PCRs and / or ddPCRs (using PCR and ddPCR conditions described above). If applicable, PCR products were sequenced via long-read sequencing (Oxford Nanopore Technologies) via Primordium PCR sequencing service. Nocodazole treatment and cell cycle analysis 24 x 105HEK 293T cells expressing the BxbI attP recombination site were seeded in 12 well-plates in 1 mL of culture media per well. Each well was treated with different concentrations of nocodazole (Sigma-Aldrich) or vehicle control (DMSO) for 24 hours. After treatment, cells were detached from the plate with trypsin (Gibco) and pelleted down by centrifuging at 200xg for 5 minutes at 4oC. Cells were then washed once in cold Posphate-Buffered Saline (PBS, Gibco) and fixed with ice- cold 70% ethanol, added dropwise while gently vortexing. Cells were incubated for 30 minutes at 4oC, washed twice with PBS (centrifuging at 850xg for 5minutes at 4oC) and resuspended in 200 µL of a 1 mg / mL stock concentration of Propidium Iodite (Thermo Fischer Scientific) and 1 µL of RNAseA (stock concentration 10 mg / mL, Thermo Fischer Scientific). Fluorescence was measured on a MACSQuant®VYB Flow Cytometer from Miltenyi Biotec and analysis was performed with FlowJo software. Cytokine analysis HeLa cells were transfected, as described above, with 150 ng of double- stranded, or single-stranded donor plasmid.24 hours after transfection, total RNA was extracted using the RNeasy kit (Qiagen) following the manufacturer’s protocol. cDNA was produced using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs) with 6 µL of input RNA and following the manufacturer’s protocol. RT-qPCR was performed using Fast SYBR Green Master mix (Fischer Scientific) a LightCycler 480 (Roche) and the following primers (5’-3’): IL-6 Forward: agacagccactcacctcttcag (SEQ ID NO:183) IL-6 Reverse: ttctgccagtgcctctttgctg (SEQ ID NO:184) GAPDH Forward: gtctcctctgacttcaacagcg (SEQ ID NO:185) GAPDH Reverse: accaccctgttgctgtagccaa (SEQ ID NO:186) Measurement of gene expression was calculated using the delta-delta-Ct method, normalizing to GAPDH. Transfections for HEKa cells (to measure cytokine response to donors) were performed between 20-24h following seeding of 1x104cells per well in 96-well plates. Transfections followed a ratio of 1:2:3 of DNA:P3000:Lipofectamine 3000 (Thermo Fisher Scientific). Briefly, 50 ng, 100 ng or 200 ng of donor plasmid were incubated with P3000 reagent (0.2 µL per 100ng total DNA) in a final volume of 5 µL of Opti-MEM (Thermo Fischer Scientific). Lipofectamine 3000 was mixed gently into this mixture (0.3 µL per 100 ng total DNA), followed by an incubation of 15 minutes at room-temperature after which the mix was added to the cells. Donor plasmid was either double-stranded, single-stranded (cssDNA), or single-stranded and pre-annealed to a 40 nt single-stranded oligonucleotide SCO (scoDNA) at a molar ratio of plasmid:oligonucleotide of 1:5 (3 minutes 95oC, ramp down to 10oC at 0.1oC / second). 6 hours after transfection, lysates were prepared using the Cells-to-CT 1-Step Power SYBR Green kit (Invitrogen), following the manufacturer’s recommendations. RT-qPCR was then performed using primers for IL-6 and GAPDH1, following the manufacturer’s recommendations using a QuantStudio 7 Pro (Thermo Fisher Scientific). Measurement of gene expression was performed using the Design and Analysis software (v2.8.0) and calculated using the delta-delta-Ct method, normalizing to GAPDH. One-pot integration in human iPSCs and primary human T-cells Leukopacks were obtained from healthy human adults after informed consent from the Massachusetts General Hospital Blood Transfusion Service. T cells were isolated using the RosetteSep Human T Cell Enrichment Cocktail (Stem Cell Technologies), following the manufacturer’s recommendations. Isolated T-cells were frozen and stored in liquid nitrogen. Immediately after thawing, T cells were stimulated for 48 hours on anti- CD3 / CD28-coated tissue culture plates. Coating of polystyrene 24-well tissue culture plates (Corning) was performed overnight with 500 µL / well of sterile ddH2O supplemented with 1 µg / mL anti CD3-monoclonal antibody (mAb) (clone OKT3: Invitrogen) and 1 µg / mL of anti-CD28 mAb (clone CD28.2; BioLegend). Before cell seeding, coated 24-well plates were washed twice with PBS, without letting the wells dry out. T-cells were seeded at 1.5x106cells per well in complete XVivo medium (Lonza) (5% fetal bovine serum, 50 µM 2-mercaptoethanol, 10mM N-acetyl L- cysteine) and supplemented with 500 U mL-1of recombinant human IL-2 (PeproTech, Catalog# 200-02). Reaction mixtures for one-pot recombination in T cells were assembled with 0.5 µL of poly(L-glutamic acid) (PGA, 100 µg / mL; Sigma-Aldrich), 0.48 µL of a 100 µM (suspended in TE buffer) synthetic gRNA targeting RAB11A (Synthego; Table 11), and 1.25 µL of 20 µM recombinant Streptococcus pyogenes Cas9 protein (EnGenRSpy Cas9 NLS, NEB) was added and mixed thoroughly by pipetting. The mixture was incubated for 15 minutes at room-temperature to allow for ribonucleoprotein (RNP) complex formation and placed on ice afterwards. In separate tubes, 2 µg of dsDNA, cssDNA, or scoDNA donor plasmids were prepared. scoDNA donors were prepared by annealing 40 nt single-stranded oligonucleotides to cssDNAs at a molar ratio of 1:5 cssDNA:SCO for INSTALL-2 and INSTALL-2e, in a thermocycler for 3 minutes at 95 °C, then ramp down to 10 °C at -0.1 °C / second. To prepare the electroporation mixture, 0.5 µL of a 2 µg / µL Alt-R HDR donor oligo containing 50 nucleotides of genome homology on each side of the att side insertion (IDT) was added to the donor mixtures, followed by 2.23 µL of RNP mix and 1 µL of Bxb1 mRNA (at 1µg / µL). For T cell electroporation, 1x106anti-CD3 and anti-CD28-stimulated primary human T cells per reaction were resuspended, pooled, and centrifuged at 100 g for 8 minutes at room temperature. Cells were resuspended in 15 µL of P3 nucleofection solution (Lonza) and transferred to the tubes containing the recombinase donor, ssODN HDR donor, Cas9 RNP, and Bxb1. The time following mixing and prior to electroporation was kept as minimal as possible. The mixture was transferred to a 16- well cuvette and electroporation was performed using the EH-115 pulse on a 4D- Nucleofector (Lonza). Immediately following electroporation, 90 µL of pre-warmed complete XVivo medium (Lonza) (5% fetal bovine serum, 50 µM 2-mercaptoethanol, 10mM N-acetyl L-cysteine), supplemented with 500 U mL-1of recombinant human IL-2 (PeproTech, Catalog# 200-02) was added to each well and the strip was incubated at 37 °C with 5% CO2 for 30 minutes. After incubation, resuspended cells were transferred to 96-well round bottom plates, containing 150 µL of pre-warmed complete XVivo medium (Lonza) (5% fetal bovine serum, 50 µM 2-mercaptoethanol, 10mM N-acetyl L-cysteine) supplemented with 500 U mL-1of recombinant human IL-2 (PeproTech, Catalog# 200-02) and 0.5 µM of Alt-R-HDR-Enhancer (IDT). Each nucleofection reaction was divided by three wells (approximately 30 µL / well), which corresponds to a cell density of approximately 3x105cells per well. Approximately 24 hours after electroporation, half of the medium was removed and replaced by the same volume of fresh complete XVivo medium supplemented with 500 U mL-1of recombinant human IL-2. Three days after electroporation, the 96-well round bottom plate was centrifuged at 300 g for 5 minutes and the cell pellets were resuspended in 100 µL of lysis buffer for genomic DNA extraction. Assessment of integration efficiency via ddPCR For plasmid targeting experiments with BxbI, extracted DNA was diluted 1:1000 prior to use in digital droplet PCR (ddPCR) reactions. For genome targeting experiments from HEK 293T cells harboring a synthetic attB or attP landing pad, DNA was used undiluted or was diluted 1:10. For IS621 plasmid targeting expreriments, extracted DNA was diluted 1:100 to count templates and undiluted to count insertion products. Insertion events were measured using target-specific primers and a donor-specific probe. ddPCR reactions contained 20 pg of plasmid DNA or 2 ng gDNA, 250 nM each primer, 900 nM probe, and ddPCR supermix for probes (no dUTP) (BioRad) in 20 μL reactions, and droplets were generated using a QX200 Automated Droplet Generator (BioRad). Thermal cycling conditions were: 1 cycle of (95 °C for 10 min), 40 cycles of (94 °C for 30 sec, 58 °C for 1 min), 1 cycle of (98 °C for 10 min), hold at 4 °C. PCR products were analyzed using a QX200 Droplet Reader (BioRad) and absolute quantification of inserts was determined using QuantaSoft (v1.7.4). Total template DNA was also analyzed, and integration efficiencies were calculated by inserts / template*100. Long-read Nanopore sequencing to determine polymerase fidelity To assess polymerase fidelity, a synthetic insertion product was first constructed into a plasmid (pTarget). This insertion product, as well as experimental plasmid-targeted integration products were amplified using a 40-cycle PCR reaction, comprising of 25 ng of synthetic template of 100 ng of genomic DNA. The PCR products were gel purified and the resulting DNA was then subject to Oxford Nanopore Technologies (ONT)-specific ligation-based library preparation (Oxford Nanopore Technologies, SQK-LSK114) as per the manufacturers instructions. The final pooled library was loaded onto an R10.4.1 flow cell and sequenced for 48 hrs. Resulting reads were analyzed using the “wf-amplicon” workflow in EPI2ME (v 5.1.8), which calculates the average error-rate and coverage (among other statistics) compared to a reference sequence for uploaded reads. LNP formulation for in vivo INSTALL LNPs were synthesized by mixing an aqueous phase (10 mM Sodium acetate buffer, pH 5.2, Sigma) containing the nucleic acid of interest (dsDNA, cssDNA, scoDNA, or mRNA) with an organic phase (ethanol, Thermo Fisher Scientific) containing four components (DLin-MC3-DMA (MC3) (Cayman) / Cholesterol (Sigma) / DOPE 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine(Avanti Polar Lipids Inc) / polyethylene glycol (PEG)-DMG (1,2-dimyristoyl-rac-glycerol) (Avanti Polar Lipids Inc)) in a lipid molar ratio 50:38.5:10:1.5, 34:1 wt:wt (total lipids:nucleic acid) and aqueous to organic volume ratio 3:1. LNPs were then transferred into a dialysis tube (3500 MwCO; Sigma) against 1x PBS pH 7.4 to remove the ethanol. To reach the desired injected dose, LNPs were concentrated using Amicon Ultra Centrifugal Filters (10,000 MWCO; Sigma). Characterization of LNPs Self-assembled LNPs were characterized for their physical properties of size (nm), polydispersity index (PDI), and Zeta potential (mV) utilizing Zeta sizer Nano ZS (Malvern Instruments Ltd). Encapsulation efficiency was measured using the modified Quant iT RiboGreen assay (Thermo Fisher Scientific). Briefly, self- assembled LNP samples were suspended in TE buffer for detection of non-assembled nucleic acids or TE supplemented with 2% Triton-X100 (for LNP disruption) for detection of supplemented total nucleic acid. LNP samples or PBS in buffer (100 μL) were measured to detect the fluorescence signal of the RiboGreen dye using Tecan Infinite M200 Pro plate reader (Ex. / Em.485nm / 528nm). Encapsulation efficiency was calculated according to: %EE= 1-(CTE / CTE-Triton) where the concentration was calculated from a calibration curve using nucleic acid standards. P3 attP mouse retroorbital injections and genomic DNA isolation All mouse experiments were conducted in accordance with the ethical standards and regulations of the Mass General Brigham Institutional Animal Care and Use Committee (IACUC), in line with guidelines from the United States Department of Agriculture and the United States Public Health Service. The study was approved under IACUC protocol 2018N000067 at Massachusetts General Hospital. Mice were maintained on a normal chow diet and housed under a regular 12-hour light / 12-hour dark cycle with ad libitum access to water. B6.RosaBxb-GT / GA P3 mice71(JAX strain 036152) attP mice were retro-orbitally injected with Bxb1 mRNA and DNA containing LNPs at the stated amounts (1 mg / kg Bxb1 mRNA and variable amounts of either dsDNA or scoDNA). Seven days later, mice were sacrificed, and livers were harvested. Tissue extractions were performed using an Agencourt DNAdvance tissue extraction kit (Beckman Coulter A48705) following the manufacturer’s instructions. Resulting genomic DNA was used as input into ddPCR for efficiency analysis and junction PCRs for sequencing analysis as described above. Example 1. INSTALL-1 and INSTALL-2 in cellulo To pilot our INSTALL approaches, we generated Bxb1 recombinase protein by transfecting a plasmid encoding Bxb1 into HEK 293T cells and harvesting Bxb1- containing human cell lysates 48 hours later (Fig.4a). We also generated a target plasmid (pTarget) containing the Bxb1 attB sequence, and produced a substrate DNA donor molecule plasmid (encoding a stuffer cargo sequence) containing an attP site (Fig.4a). This original precursor dsDNA donor plasmid was: (1) converted into cssDNA via an enzymatic protocol (similar to as previously described30) for use in the INSTALL-1 method (Fig.1b), and (2) was also converted into a circular partly double-stranded (scoDNA) by annealing a 52 nucleotide (nt) SCO to the attP region of the cssDNA, resulting in a largely single stranded cssDNA molecule but with a short double-stranded region encompassing the attP site (for use in the INSTALL-2 method; Fig.1c). The SCO used for our initial cssDNA contained a 3’ phosphate, which should block endogenous polymerase-mediated extension that would synthesize the second strand of the donor. This step to block endogenous polymerization from the SCO attempted to ensure that integration events were from integration reactions utilizing the scoDNA, and not from a cssDNA that had been converted to dsDNA by polymerase mediated extension prior to complexing with the recombinase (though it’s possible that an endogenous primase may evict the SCO during second strand synthesis). To determine whether the cssDNA could support integration into a dsDNA target, we performed biochemical reactions with the human cell lysate containing Bxb1 protein, the dsDNA attB-encoding pTarget, and either cssDNA or SCO- annealed scoDNA substrate DNA donor molecules (Fig.4a). Reactions proceeded for 2 h at 37 °C prior to analysis. An 18-cycle junction PCR across the expected attL end revealed a band only in the scoDNA substrate DNA donor molecule condition and not in the cssDNA condition, demonstrating functional insertion of the scoDNA into pTarget at the expected site (Fig.4b). Notably, a band was eventually observed in the cssDNA substrate DNA donor molecule condition (no SCO, so an entirely single- stranded substrate DNA donor molecule) when >25-cycle PCRs were used (Fig.4b). Given that recombinases are not known to be able to utilize cssDNA donors for integration, these results suggest that cellular primase could prime the cssDNA donor and cellular DNA polymerase could conduct second strand synthesis without a pre- annealed SCO to create a dsDNA donor (akin to many integrative cssDNA viruses use of host primase). Integration using the cssDNA was likely kinetically slower and less efficient than when using the scoDNA because second strand synthesis must be completed at least spanning the attP site prior to integration. Long-read sequencing of the product when using scoDNA showed the full-length insertion into pTarget (Fig. 4c). To compare the integration kinetics when using dsDNA, cssDNA, or scoDNA donors, we conducted a timecourse experiment to assess integration efficiencies into pTarget with each of the three substrate DNA donor molecules in reactions containing Bxb1 protein from HEK 293T lysates (Figs.4a,d). The use of dsDNA or scoDNA (INSTALL-2) led to similar integration kinetics and absolute efficiencies quantified by ddPCR. The use of cssDNA (INSTALL-1) led to substantially lower integration overall, which supports our prior junction PCR data, suggests that primase concentration in lysate may be limiting, and thus supports the essential role of the SCO to reconstitute a short dsDNA region to enable integration from largely ssDNA molecules. Next, we created a cssDNA donor encoding a CMV promoter to drive expression of an EGFP coding sequence (pCMV-EGFP) using a M13 phagemid- based process72. We then utilized this cssDNA-pCMV-EGFP to perform experiments to validate that INSTALL functions in human cells and to determine their efficiencies. We transfected a plasmid encoding Bxb1 recombinase and either a cssDNA (INSTALL-1) or a scoDNA with a 60 bp SCO (containing a 3’-OH that can be extended by polymerases) annealed to the Bxb1 attP site (INSTALL-2) into HEK 293T cells harboring a landing pad with the Bxb1 attB sequence (created by lentiviral integration of the reporter sequence) (Fig.5a). As soon as 24 hrs after transfection, GFP was highly visible across nearly all cells – suggesting that second strand synthesis had occurred on both INSTALL-1 and INTALL-2 cssDNA(+)-pCMV- EGFP donor configurations in cells. After 72 hrs, we extracted genomic DNA and performed digital droplet PCR (ddPCR) to quantify Bxb1-mediated integration efficiency at the attB site of our reporter landing pad, which revealed efficient DNA integration with both INSTALL-1 and INSTALL-2 donors (Fig.5b). Notably, INSTALL-2 was more efficient at lower donor dosages, potentially owing to various mechanisms including facilitated nuclear localization of the scoDNA (by the recombinase being able to bind the SCO:cssDNA site and trafficking the donor into the nucleus), integration kinetics (due to Bxb1 being able to recognize the dsDNA attP site on the scoDNA sooner than on the cssDNA that is beholden to primase / polymerase activity to reconstitute the attP site), or other mechanisms. Since HEK 293T cells are a rapidly dividing cell line (and presumably neither nuclear localization nor primase expression are therefore limiting factors to complete these reactions), we anticipated minimal differences between INSTALL-1 and INSTALL-2. Analogous experiments using a dsDNA donor as a control revealed higher levels of integration compared to both INSTALL-1 and INSTALL-2 (Fig.5b), potentially due to more rapid Bxb1 binding to the dsDNA donor, integration of a preformed dsDNA cargo on the donor, and delayed expression of Bxb1 from a plasmid vector relative to cssDNA degradation (which occurs faster than dsDNA plasmid). An experiment using dsDNA plasmid donor or a cssDNA (INSTALL-1) donor, a plasmid expressing Bxb1 recombinase, and a pTarget plasmid also showed higher integration efficiency when using dsDNA compared to cssDNA (INSTALL-1) (Fig.5c). In prokaryotes and eukaryotes, cssDNA viral genomes are known to co-opt high fidelity DNA polymerases for second-strand synthesis34,73. Therefore, we investigated whether second-strand synthesis on cssDNA donors in human cells is a high-fidelity process. To attempt to measure the error rate of second-strand synthesis in human cells, we PCR enriched the insertion product from plasmid-targeted integration events in human cells as well as from a synthetic sequence-verified insertion mimic as a control (a plasmid ‘product’ cloned to have the same insertion product). Long-read nanopore sequencing of the PCR products revealed no difference in error rate between the control and experimental insertion products, demonstrating that high fidelity DNA-dependent polymerases are likely carrying out second-strand synthesis in human cells (e.g., Pol^ or Polδ), leading to low error-rate integration events (Fig.5d). The integration products sequenced by long-read sequencing were consistent with the expected insertion junctions and a complete and correct cargo. We also verified the insertion product by sanger sequencing (Fig.5e), which also revealed the anticipated insertion junctions and correctly inserted cargo. Furthermore, INSTALL-1 and INSTALL-2 were comparably efficient to dsDNA when expressing Bxb1 from mRNA and when using a range of donor dosages (Fig. 5f). This may be because integration events when using plasmid expression of recombinase continues for a longer time when using dsDNA than ssDNA (which has a shorter half-life than dsDNA) – i.e., no integration occurs past a certain timepoint defined by cssDNA degradation despite continued recombinase expression – whereas when using mRNA expression of recombinase, integration is limited by the length of time protein is expressed from the mRNA instead of the degradation of the dsDNA, cssDNA, or scoDNA donors. Since M13 phage DNA naturally recruits endogenous primase and polymerase in a poorly understood process73,74, we wondered whether the M13 origin encoded on some of our cssDNA molecules (in Fig.5 but not in Fig.4) is required for INSTALL to function in human cells. We transfected our initial cssDNA (which does not contain the M13 origin) into our HEK 293T attB landing pad cells along with a Bxb1 expression plasmid. Integration was also observed (verified by nanopore sequencing) with this non-M13 cssDNA donor (Figs.5g, 5h), indicating that the M13 origin is not required for second strand synthesis. Analogous experiments using plasmid encoded Bxb1 and our attP HEK 293T cell line (Fig.5a) demonstrated full length integration events when using PCR across the full length product (Fig.5i). Due to potential differences in encapsulation efficiency when using DNA vs mRNA specific nanoparticle reagents, we also observed that separate delivery of DNA and RNA using their respective reagent (instead of all-in-one when using only the mRNA specific reagent) led to higher integration efficiency (Fig.5j). To further evaluate the impact of recombinase expression kinetics against donor half-life, we performed experiments in attB HEK 293T cells expressing Bxb1 from plasmid which likely requires a longer time frame of ~16-24 hours for protein expression75, at which point the more transient cssDNA-based donors might be largely degraded (Fig.5k). We observed higher relative integration efficiency with a dsDNA donor compared to cssDNA or scoDNA at equal mass when Bxb1 was expressed more slowly from a plasmid (Fig.5k), supporting the more transient nature of cssDNA-based donors. Together, these experiments demonstrate that INSTALL is effective for DNA integration into the human genome, and that recombinase expression and donor half- life kinetics impact relative integration efficiencies between donor types and enzyme delivery formats. While Bxb1 is one of the most commonly used recombinases for gene integration approaches45,71,76–78, recent studies have discovered and characterized diverse LSRs that can efficiently recombine DNA in human cells76,79(Fig.5l). To investigate whether alternate LSRs are compatible with INSTALL, we generated mRNAs encoding Pa01, BceINT, or SacINT recombinases and co-delivered them with dsDNA, cssDNA, or scoDNA donors into an attB HEK 293T cell line – using either mixed delivery (Fig.5m) or separate delivery (Fig.5n) as described above. We observed similar performance of each recombinase relative to Bxb1, with scoDNA typically leading to higher integration compared to dsDNA (Fig.5m, 5n). In addition to landing pad LSRs, we also investigated the LSR Dn29 that was recently demonstrated to integrate into several defined endogenous human target sites79without the need for landing pad pre-installation (Fig.5o). Dn29 was compatible with INSTALL approaches and achieved ~4% integration with scoDNA compared to ~2% with dsDNA (Fig.5p), suggesting that recombinase engineering will be required to increase absolute integration efficiencies. Our results demonstrates that INSTALL is compatible with diverse landing pad and human genome targeting recombinases, with increased integration efficiencies when co-delivering the donor and recombinase mRNA even in immune deficient HEK 293T cells16,80. Because nucleic acids can rapidly accumulate in the nucleus during cell division, we wondered how conditions using dsDNA, cssDNA (INSTALL-1), and scoDNA (INSTALL-2) compared in non-dividing cells, which may have abrogated nuclear entry of nucleic acids. We hypothesized that the more flexible nature of ssDNA employed in INSTALL-1 or INSTALL-2 may more easily cross the nuclear membrane when compared to dsDNA. To test this, we treated an attP HEK 293T reporter cell line with nocodazole, which causes cell cycle arrest in G2 / M phase, and tested dsDNA, INSTALL-1, and INSTALL-2 (using Bxb1 mRNA and a 40bp SCO for INSTALL-2 which reconstitutes a Bxb1 attB site). We observed higher efficiencies for INSTALL-1 and INSTALL-2 over dsDNA in both untreated and treated cells (Fig.6a). Furthermore, dsDNA donor conditions showed decreased efficiencies in treated cells compared to untreated cells whereas INSTALL-1 and INSTALL-2 were unaffected – demonstrating that cssDNA and scoDNA may more easily pass through the nuclear membrane (Fig.6a). Notably, primase concentration may still be high in G2 / M phase, so INSTALL-2 may exhibit additional advantages over INSTALL-1 in canonically non-dividing or slowly-dividing cell types. When these three conditions were tested in HCT-116 or HeLa cells, we observed that the INSTALL mechanism was active across these diverse cell types, with INSTALL-2 showing generally higher efficiencies (Fig.6b, c). qPCR-generated cytokine analysis of IL-6 mRNA transcripts, indicative of innate immune response activation, in HeLa cells demonstrated minimal immune activation when using cssDNA but a ~3 fold elevation above control when using dsDNA (Fig.6d), which supports prior studies comparing immune response and viability of cells treated with ssDNA versus dsDNA72,81,82. In a separate experiment, we transfected CpG- minimized dsDNA, cssDNA, or scoDNA substrate DNA donor molecules into primary human keratinocytes and measured relative IL-6 mRNA abundance. With scoDNA we observed comparable levels of IL-6 mRNA expression to the cssDNA control, whereas dsDNA led to a >4-fold increase when delivering equimolar amounts of DNA (Fig.6e), or a 2.7-fold increase over cssDNA at equal mass (Fig.6f). These results are consistent with prior studies that demonstrated the dsDNA length- dependent activation of cGAS-STING83,84, suggesting that short partially duplexed regions of an scoDNA maintain similar immune quiescence as cssDNA. We also tested whether IS621 bridge recombinases3could be implemented with INSTALL in human cells (Fig.7a). We constructed a plasmid which expresses human codon optimized IS621-NLS, two pTarget plasmids, each containing a target site (T1 or T2), a donor plasmid, and two bridge RNA (bRNA) plasmids which expresses a bRNA containing a donor binding loop (DBL) targeted to a site on the donor plasmid and a target binding loop (TBL) which binds either T1 or T2. Use of a dsDNA donor plasmid, a cssDNA donor plasmid (for INSTALL-1), or a scoDNA donor plasmid containing a 40bp SCO (for INSTALL-2) demonstrated productive bRNA-mediated integration into pTarget whereas conditions lacking a bRNA showed no integration into pTarget (Fig. 7b). For both targets, INSTALL-2 was superior to INSTALL-1. In a separate experiment, co-delivery of IS621-NLS mRNA and dsDNA or INSTALL donors in HEK 293T cells led to similar levels of integration into two separate plasmid target sites (Fig, 7c), revealing compatibility of IS110 elements with cssDNA and scoDNA donor molecules. Further efforts to engineer or explore the natural diversity of bridge recombinases will be necessary to improve integration efficiencies. Example 2. INSTALL with RNA-guided Piv invertases We then investigated alternate recombinases with structural homology to IS110 recombinases, hypothesizing that Piv invertases may also be RNA-guided48–50(Fig.8a, 8b). Piv invertases are known to invert a 2.2 kb segment of DNA in Moraxella lacunata and Moraxella bovis in response to environmental stimuli to conditionally express pillin or change pillin types, respectively85,86(Fig.8a, 8b). Despite Piv invertases serving a very different biological role than IS110 elements, their structural homology to the recombinases of these mobile genetic elements suggest that they may share mechanistic features, such as RNA-dependent recombination87. To identify a putative non-coding RNA (ncRNA) that may direct Piv recognition of its target sequence, we first identified ^70 promoters in non-coding regions using Sigma70Pred88within a 1 kb region upstream and downstream of the inversion cassette and scanned potential regions that have sequences that align to the characterized “Inv” site for M. lacunata Piv86in a manner akin to IS110 bRNA-tDNA recognition. We identified a putative ncRNA containing a 5’ hairpin and a target binding loop (containing complementarity to the characterized Inv site) (Fig.8c) akin to the structure of IS110 element bRNAs. To investigate if Piv was RNA-dependent, we first transfected a plasmid encoding a human codon optimized Piv invertase with either a plasmid expressing the putative ncRNA or an SpCas9 sgRNA (as control) along with pTarget and pDonor, each containing a Piv recognition site, into HEK 293T cells. ddPCR analysis of insertion products revealed ~0.25% integration into pTarget only in the presence of the canonical ncRNA (ncRNA v1) (Fig.8d). Towards engineering Piv variant enzymes with increased integration efficiencies, we structurally aligned Piv invertase folded with AlphaFold389with the cryo-EM structure of E. coli IS1621 recombinase90. Using this model, we identified negatively charged amino acid side chains that make putative protein-DNA contacts and mutated those positions to positively charged arginine residues (Fig.8e). Three amino acid substitutions in Piv improved activity >2-fold compared to wild-type Piv, including E66R, E257R, and E285R. We tested engineered Piv variant enzymes harboring combinations of these beneficial mutations, where the E257R / E285R double mutant led to a ~3.6-fold increase in integration efficiency into pTarget (Fig.8f). Next, we hypothesized that the ncRNA was suboptimal in human cells. To explore improved ncRNA variants, we truncated putative unpaired bases on the 5’ and 3’ end of the ncRNA, producing ncRNA v2 (Figs.8c, 8g). When testing integration with the Piv(E257R / E285R) variant enzyme combined with ncRNA v1 or v2 at two pTarget to pDonor plasmid ratios in HEK 293T cells, we observed that ncRNA v2 substantially increased efficiencies and that a dose containing a lower ratio of pTarget to pDonor was more optimal, now reaching nearly 8% integration into plasmid targets in human cells (Fig.8g). Notably, scrambling the target binding loop of ncRNA v1 in this comparison to create a non-targeting (NT) ncRNA led to no observable integration (Fig.8g). Using the ncRNA v2 construct and our optimized pTarget to pDonor ratio, we performed a second round of targeted Piv mutagenesis using our Piv(E257R / E285R) variant enzyme. We generated 31 additional variant Piv enzymes by mutating negatively charged, polar uncharged, or lysine residues to arginine (Fig.8h). Several additional single mutations improved the integration efficiency of Piv(E257R / E285R), including K922R, Q286R, T290R, and Q312R (Fig.8h). Assessment of stack mutants harboring the beneficial mutations led to an engineered Piv mutant (ePiv) comprised of E257R, E285R, and T290R substitutions that reached ~12% integration into a plasmid target in human cells (Fig.8i). Together, we demonstrate that Piv mutants are RNA-dependent recombinases like IS110 elements and that engineering efforts can increase their efficiencies. We then assessed the compatibility of ePiv with INSTALL in sequential delivery experiments in HEK 293T cells, where the donor was delivered ~48 hours after the other plasmid components. Use of scoDNA for INSTALL-2 with ePiv resulted in comparable integration to the dsDNA donor, albeit at low efficiencies in this setup (Fig.8j). Our collective results demonstrate that diverse protein-guided and RNA-guided recombinases are compatible with INSTALL in human cells. Example 3. INSTALL-1, INSTALL-2, and INSTALL-2e with CRISPR- Cas based genome editors. We investigated whether INSTALL could enable kilobase-scale DNA integration when paired with CRISPR-Cas genome editors in primary human cells. With INSTALL-2, exonuclease-mediated degradation of the SCO prior to recombinase binding could convert the scoDNA into cssDNA, obviating the advantages of INSTALL-2 over INSTALL-1. Although 3’ end protection of the SCO with modified bases (e.g., phosphorothioate bonds; PS) could minimize SCO degradation, incorporation of chemically modified DNA into the genome could be problematic. We therefore hypothesized that an RNA base upstream of the PS modification combined with a 3’ end incompetent for DNA extension (e.g., with a 3’ inverted dT) could enable RNAseH2-mediated cleavage of the 3’-end protection in the nucleus, presumably after integration, and extension from the liberated 3’ hydroxyl only after RNAseH2-cleavage. We term these modified, enhanced SCOs as “eSCOs” and this method using scoDNA with eSCOs as INSTALL-2e (Fig.9a). Comparison of dsDNA, INSTALL-1, INSTALL-2, and INSTALL-2e in primary human T-cells via one-pot Cas9 / HDR-mediated attP installation and Bxb1-mediated recombination (Fig.9b) revealed that all three INSTALL conditions achieved higher levels of integration and att site conversion than dsDNA (Fig.9c), despite comparable levels of attP site installation by HDR (Fig.9d). INSTALL-2e with the modified eSCO resulted in the highest levels of integration, with a ~4.2-fold increase in integration efficiency compared to dsDNA and a ~1.6-fold improvement compared to INSTALL-2 (Fig.9c). Example 4. INSTALL with polymerase-based genome editing technologies While our results demonstrate INSTALL compatibility with CRISPR-Cas nuclease-base genome editors, the use of nucleases to insert the recombinase attachment site may limit this approach because of DSB-induced toxicity or the ineffectiveness of HDR in certain cell types91–97. Advances in polymerase-based genome writing technologies may obviate these challenges to enable recombinase recognition sequence installation in more diverse cell types and without requiring DSBs40,41,76,77,98,99. Indeed, use of prime editing to install Bxb1 att sites followed by recombination with a dsDNA donor, termed PASSIGE or PASTE, can insert kilobase-sized sequences into the genome76–78(Fig.10a). To explore the synergy of INSTALL with PASSIGE, we first assessed recently reported engineered Bxb1 variants with increased integration efficiency45,78and various NLS configurations (Fig.10b). Comparison of 9 different Bxb1 constructs in a PASSIGE experiment in HEK 293T cells revealed superior integration with the NLS-Bxb1 architecture (Fig. 10c), which we used for subsequent experiments. To then explore the synergy of INSTALL with PASSIGE, we then transfected plasmids expressing PEmax and pairs of pegRNA targeting AAVS1 or ACTB78for Bxb1 attP site insertion in HEK 293T cells, where dsDNA, INSTALL-1, INSTALL-2, and INSTALL-2e donors were delivered ~48 hours later. We observed that all INSTALL approaches outperformed dsDNA for programmable integration, with INSTALL-2 and -2e resulting in ~4-fold increased integration compared to dsDNA at both AAVS1 and ACTB sites (Fig.10d). Notably, similar to how 3’ end-protection of linear ssDNA donors facilitates HDR by preventing TREX1-mediated DNA degradation100, INSTALL-2e will be most effective at potentiating integration in TREX1-positive primary human T-cells but less so in TREX1-negative cell types like HEK 293T cells. Together, our results demonstrate that INSTALL is compatible with diverse recombinases in dividing, cell cycle stalled, and primary human cells, and can be combined with various CRISPR-based genome editing technologies for targeted DNA integration. Example 5. INSTALL in vivo Given the advantages of INSTALL in cells, we sought to perform additional in vivo experiments in mice to further investigate potential advantages of INSTALL. We first formulated lipid nanoparticles (LNPs) designed for liver delivery utilizing the FDA-approved MC-3 ionizable lipid60. LNPs encapsulating mRNA, dsDNA, and scoDNA were synthesized and characterized by size, PDI and zeta potential, resulting in nanoparticle sizes ranging between 150-160 nm with a uniform size distribution (0.078-0.112) and a neutral zeta potential (Fig.11a-c). We observed similar encapsulation efficiency (>80%) across each nucleic acid type (Fig.11d). Using these formulations for LNP-encapsulated Bxb1 mRNA and dsDNA or scoDNA donors, we performed retroorbital injections into P3 mice harboring a Bxb1 attP site at the Rosa26 locus71(Fig.11e). At a dose of 0.7 mg / kg scoDNA and 1 mg / kg Bxb1 mRNA, all INSTALL-2 treated mice remained alive and were healthy after 7 days (Fig.11f). In a striking contrast, all mice treated with 0.7 mg / kg dsDNA and the same dose of mRNA were deceased by day 3, with many severely fatigued or deceased within the first few hours post-injection (Fig.11f). Notably, an increased scoDNA dose of 1.4 mg / kg was also well-tolerated (now reaching 4x the donor copies of 0.7 mg / kg dsDNA that was lethal to mice), and all mice remained alive and healthy throughout the 7-day observation period with similar physical behaviors and phenotypes to PBS-treated controls (Fig.11f). Due to the increased immunogenicity of dsDNA and resulting dose-limiting toxicity, we wondered whether the more immune stealth nature of scoDNA in INSTALL-2 might enable recombinase-mediated integration in vivo. We first determined the maximal tolerable dose of dsDNA to be 0.35 mg / kg, where all mice remained alive after 7 days (Fig.11g), which further contrasted with good tolerability of scoDNA at a much higher dose of 2 mg / kg (Fig.11h). Next, we conducted P3 retro-orbital injections into attP mice with 1 mg / kg Bxb1 mRNA and either 0.35 mg / kg dsDNA or a higher dose of 2 mg / kg scoDNA with an eSCO (INSTALL-2e), representing a ~11.4-fold higher copy number of donor versus dsDNA (Fig.11g, 11h). After 7 days, we were unable to detect integration in livers of mice injected with dsDNA donors or PBS controls (Fig.11i). In contrast, we were able to detect integration in mice subjected to INSTALL-2e (Fig.11i), and PCR amplification across the insertion revealed the complete ~2 kb product (Fig.11j). Furthermore, both long-read sequencing of the ~2kb PCR product and Sanger sequencing of junction PCR products demonstrated the expected insertion (Fig.11k). Together, our results demonstrate that INSTALL can enable recombinases to function in vivo via systemically administered DNA, with minimized dose-limiting toxicity compared to dsDNA. Future efforts to engineer recombinases and optimize INSTALL should improve integration efficiencies to potentiate non-viral applications in vivo. References 1. Durrant, M. G. et al. Systematic discovery of recombinases for efficient integration of large DNA sequences into the human genome. Nat Biotechnol (2022) doi:10.1038 / s41587-022-01494-w. 2. Post, V. & Hall, R. M. Insertion sequences in the IS1111 family that target the attC recombination sites of integron-associated gene cassettes: IS targeting the attC sites of gene cassettes. FEMS Microbiology Letters 290, 182–187 (2008). 3. Durrant, M. G. et al. Bridge RNAs direct modular and programmable recombination of target and donor DNA. Preprint at doi.org / 10.1101 / 2024.01.24.577089 (2024). 4. Klompe, S. E., Vo, P. L. H., Halpin-Healy, T. S. & Sternberg, S. H. Transposon- encoded CRISPR–Cas systems direct RNA-guided DNA integration. Nature 571, 219–225 (2019). 5. Strecker, J. et al. RNA-guided DNA insertion with CRISPR-associated transposases. Science 365, 48–53 (2019). 6. Hew, B. E. et al. Directed evolution of hyperactive integrases for site specific insertion of transgenes. Nucleic Acids Research gkae534 (2024) doi:10.1093 / nar / gkae534. 7. Pandey, S. et al. Efficient site-specific integration of large genes in mammalian cells via continuously evolved recombinases and prime editing. Nat. Biomed. Eng 1– 18 (2024) doi:10.1038 / s41551-024-01227-1. 8. Wu, J., Corbett, A. H. & Berland, K. M. The Intracellular Mobility of Nuclear Import Receptors and NLS Cargoes. Biophysical Journal 96, 3840–3849 (2009). 9. Suzuki, K. et al. In vivo genome editing via CRISPR / Cas9 mediated homology- independent targeted integration. Nature 540, 144–149 (2016). 10. Motwani, M., Pesiridis, S. & Fitzgerald, K. A. DNA sensing by the cGAS– STING pathway in health and disease. Nat Rev Genet 20, 657–674 (2019). 11. Lugrin, J. & Martinon, F. The AIM 2 inflammasome: Sensor of pathogens and cellular perturbations. Immunological Reviews 281, 99–114 (2018). 12. Hornung, V. & Latz, E. Intracellular DNA recognition. Nat Rev Immunol 10, 123–130 (2010). 13. Carpenter, S. & O’Neill, L. A. J. From periphery to center stage: 50 years of advancements in innate immunity. Cell 187, 2030–2051 (2024). 14. Zahid, A., Ismail, H., Li, B. & Jin, T. Molecular and Structural Basis of DNA Sensors in Antiviral Innate Immunity. Front. Immunol.11, 613039 (2020). 15. Zhang, W. et al. DNA-dependent Activator of Interferon-regulatory Factors (DAI) Promotes Lupus Nephritis by Activating the Calcium Pathway *. Journal of Biological Chemistry 288, 13534–13550 (2013). 16. Sun, L., Wu, J., Du, F., Chen, X. & Chen, Z. J. Cyclic GMP-AMP Synthase Is a Cytosolic DNA Sensor That Activates the Type I Interferon Pathway. Science 339, 786–791 (2013). 17. Wu, J. et al. Cyclic GMP-AMP Is an Endogenous Second Messenger in Innate Immune Signaling by Cytosolic DNA. Science 339, 826–830 (2013). 18. Decout, A., Katz, J. D., Venkatraman, S. & Ablasser, A. The cGAS–STING pathway as a therapeutic target in inflammatory diseases. Nat Rev Immunol 21, 548– 569 (2021). 19. Motwani, M., Pesiridis, S. & Fitzgerald, K. A. DNA sensing by the cGAS– STING pathway in health and disease. Nat Rev Genet 20, 657–674 (2019). 20. Xie, K. et al. Circular Single-Stranded DNA Is a Superior Homology-Directed Repair Donor Template for Efficient Genome Engineering. biorxiv.org / lookup / doi / 10.1101 / 2022.12.01.518578 (2022) doi:10.1101 / 2022.12.01.518578. 21. Cao, X., Tang, L. & Song, J. Circular Single-Stranded DNA: Discovery, Biological Effects, and Applications. ACS Synth. Biol.13, 1038–1058 (2024). 22. Tang, L. et al. Circular single-stranded DNA as switchable vector for gene expression in mammalian cells. Nat Commun 14, 6665 (2023). 23. Kranzusch, P. J., Lee, A. S.-Y., Berger, J. M. & Doudna, J. A. Structure of Human cGAS Reveals a Conserved Family of Second-Messenger Enzymes in Innate Immunity. Cell Reports 3, 1362–1368 (2013). 24. Kumari, P., Russo, A. J., Shivcharan, S. & Rathinam, V. A. AIM2 in health and disease: Inflammasome and beyond. Immunological Reviews 297, 83–95 (2020). 25. Roberts, T. L. et al. HIN-200 Proteins Regulate Caspase Activation in Response to Foreign Cytoplasmic DNA. Science 323, 1057–1060 (2009). 26. Unterholzner, L. et al. IFI16 is an innate immune sensor for intracellular DNA. Nat Immunol 11, 997–1004 (2010). 27. Garg, A., Stallings, C. M. & Sohn, J. Filament assembly underpins the double- stranded DNA specificity of AIM2-like receptors. Nucleic Acids Research 51, 2574– 2585 (2023). 28. Iyer, S. et al. Efficient Homology-Directed Repair with Circular Single-Stranded DNA Donors. The CRISPR Journal (2022) doi:10.1089 / crispr.2022.0058. 29. Lin, C. et al. In vivo cloning of artificial DNA nanostructures. Proc Natl Acad Sci U S A 105, 17626–17631 (2008). 30. Wrenbeck, E. E. et al. Plasmid-based one-pot saturation mutagenesis. Nat Methods 13, 928–930 (2016). 31. Shepherd, T. R., Du, R. R., Huang, H., Wamhoff, E.-C. & Bathe, M. Bioproduction of pure, kilobase-scale single-stranded DNA. Sci Rep 9, 6121 (2019). 32. Wong, S., Jimenez, S. & Slavcev, R. A. Construction and characterization of a novel miniaturized filamentous phagemid for targeted mammalian gene transfer. Microb Cell Fact 22, 124 (2023). 33. Krupovic, M. & Forterre, P. Single‐stranded DNA viruses employ a variety of mechanisms for integration into host genomes. Annals of the New York Academy of Sciences 1341, 41–53 (2015). 34. Bonnamy, M., Blanc, S. & Michalakis, Y. Replication mechanisms of circular ssDNA plant viruses and their potential implication in viral gene expression regulation. mBio 14, e01692-23 (2023). 35. Huber, K. E. & Waldor, M. K. Filamentous phage integration requires the host recombinases XerC and XerD. Nature 417, 656–659 (2002). 36. Castillo, F., Benmohamed, A. & Szatmari, G. Xer Site Specific Recombination: Double and Single Recombinase Systems. Front. Microbiol.8, (2017). 37. Francia, M. V., Zabala, J. C., De La Cruz, F. & García Lobo, J. M. The IntI1 Integron Integrase Preferentially Binds Single-Stranded DNA of the attC Site. J Bacteriol 181, 6844–6849 (1999). 38. Escudero, J. A. et al. Unmasking the ancestral activity of integron integrases reveals a smooth evolutionary transition during functional innovation. Nat Commun 7, 10937 (2016). 39. Joana Ferreira da Silva et al. Click editing enables programmable genome writing using DNA polymerases and HUH endonucleases. bioRxiv 2023.09.12.557440 (2023) doi:10.1101 / 2023.09.12.557440. 40. Liu, B. et al. Targeted genome editing with a DNA-dependent DNA polymerase and exogenous DNA-containing templates. Nat Biotechnol (2023) doi:10.1038 / s41587-023-01947-w. 41. Anzalone, A. V. et al. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 576, 149–157 (2019). 42. Nan, A. X. et al. Ligase-mediated programmable genomic integration (L-PGI): an efficient site-specific gene editing system that overcomes the limitations of reverse transcriptase-based editing systems. Preprint at doi.org / 10.1101 / 2024.09.27.615478 (2024). 43. Altae-Tran, H. et al. The widespread IS200 / IS605 transposon family encodes diverse programmable RNA-guided endonucleases. Science 374, 57–65 (2021). 44. Saito, M. et al. Fanzor is a eukaryotic programmable RNA-guided endonuclease. Nature 620, 660–668 (2023). 45. Hew, B. E. et al. Directed evolution of hyperactive integrases for site specific insertion of transgenes. Nucleic Acids Research 52, e64–e64 (2024). 46. Huhtinen, O., Prince, S., Lamminmäki, U., Salbo, R. & Kulmala, A. Increased stable integration efficiency in CHO cells through enhanced nuclear localization of Bxb1 serine integrase. BMC Biotechnology 24, 44 (2024). 47. Shin, S., Kim, S. H., Lee, J. S. & Lee, G. M. Streamlined Human Cell-Based Recombinase-Mediated Cassette Exchange Platform Enables Multigene Expression for the Production of Therapeutic Proteins. ACS Synth. Biol.10, 1715–1727 (2021). 48. Tobiason, D. M., Lenich, A. G. & Glasgow, A. C. Multiple DNA Binding Activities of the Novel Site-specific Recombinase, Piv, from Moraxella lacunata. Journal of Biological Chemistry 274, 9698–9706 (1999). 49. Marrs, C. F., Rozsa, F. W., Hackel, M., Stevens, S. P. & Glasgow, A. C. Identification, cloning, and sequencing of piv, a new gene involved in inverting the pilin genes of Moraxella lacunata. J Bacteriol 172, 4370–4377 (1990). 50. Buchner, J. M., Robertson, A. E., Poynter, D. J., Denniston, S. S. & Karls, A. C. Piv Site-Specific Invertase Requires a DEDD Motif Analogous to the Catalytic Center of the RuvC Holliday Junction Resolvases. Journal of Bacteriology 187, 3431–3437 (2005). 51. Yamada, K. et al. Extended Nucleic Acid (exNA): A Novel, Biologically Compatible Backbone that Significantly Enhances Oligonucleotide Efficacy in vivo. Preprint at doi.org / 10.1101 / 2023.05.26.542506 (2023). 52. Chen, R. & Wold, M. S. Replication protein A: Single‐stranded DNA’s first responder: Dynamic DNA‐interactions allow replication protein A to direct single‐ strand DNA intermediates into different pathways for synthesis or repair. BioEssays 36, 1156–1161 (2014). 53. Meyer, R. R. & Laine, P. S. The single-stranded DNA-binding protein of Escherichia coli. Microbiol Rev 54, 342–380 (1990). 54. Rapley, R. Enhancing PCR amplification and sequencing using DNA-binding proteins. Mol Biotechnol 2, 295–298 (1994). 55. Naufer, M. N., Furano, A. V. & Williams, M. C. Protein-nucleic acid interactions of LINE-1 ORF1p. Seminars in Cell & Developmental Biology 86, 140–149 (2019). 56. Chandler, M. et al. Breaking and joining single-stranded DNA: the HUH endonuclease superfamily. Nat Rev Microbiol 11, 525–538 (2013). 57. Croy, J. E. & Wuttke, D. S. Themes in ssDNA recognition by telomere-end protection proteins. Trends in Biochemical Sciences 31, 516–525 (2006). 58. Lim, K. H., Huang, H., Pralle, A. & Park, S. Stable, high‐affinity streptavidin monomer for protein labeling and monovalent biotin detection. Biotech & Bioengineering 110, 57–67 (2013). 59. DeMonte, D., Drake, E. J., Lim, K. H., Gulick, A. M. & Park, S. Structure‐based engineering of streptavidin monomer with a reduced biotin dissociation rate. Proteins 81, 1621–1633 (2013). 60. Adams, D. et al. Patisiran, an RNAi Therapeutic, for Hereditary Transthyretin Amyloidosis. N Engl J Med 379, 11–21 (2018). 61. Zhang, P. et al. Schlafen-11 and -9 are innate immune sensors for intracellular single-stranded DNA. Preprint at doi.org / 10.1101 / 2024.02.24.581893 (2024). 62. Paunovska, K., Loughrey, D. & Dahlman, J. E. Drug delivery systems for RNA therapeutics. Nat Rev Genet 23, 265–280 (2022). 63. Madigan, V., Zhang, F. & Dahlman, J. E. Drug delivery systems for CRISPR- based genome editors. Nat Rev Drug Discov 22, 875–894 (2023). 64. Foss, D. V. et al. Peptide-mediated delivery of CRISPR enzymes for the efficient editing of primary human lymphocytes. Nat. Biomed. Eng 7, 647–660 (2023). 65. Ioannidi, E. I. et al. Drag-and-Drop Genome Insertion without DNA Cleavage with CRISPR-Directed Integrases. biorxiv.org / lookup / doi / 10.1101 / 2021.11.01.466786 (2021) doi:10.1101 / 2021.11.01.466786. 66. Anzalone, A. V. et al. Programmable deletion, replacement, integration and inversion of large DNA sequences with twin prime editing. Nat Biotechnol 40, 731– 740 (2022). 67. Cha, T.-G. et al. Genetic Control of Aerogel and Nanofoam Properties, Applied to Ni–MnO Cathode Design. Advanced Functional Materials 31, 2010867 (2021). 68. Rohland, N. & Reich, D. Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Genome Res.22, 939–946 (2012). 69. Kleinstiver, B. P. et al. Engineered CRISPR–Cas12a variants with increased activities and improved targeting ranges for gene, epigenetic and base editing. Nature Biotechnology 37, 276–282 (2019). 70. Chen, P. J. et al. Enhanced prime editing systems by manipulating cellular determinants of editing outcomes. Cell 184, 5635-5652.e29 (2021). 71. Low, B. E., Hosur, V., Lesbirel, S. & Wiles, M. V. Efficient targeted transgenesis of large donor DNA into multiple mouse genetic backgrounds using bacteriophage Bxb1 integrase. Sci Rep 12, 5424 (2022). 72. Keqiang Xie et al. Circular single-stranded DNA is a superior homology-directed repair donor template for efficient genome engineering. bioRxiv 2022.12.01.518578 (2022) doi:10.1101 / 2022.12.01.518578. 73. Geider, K. & Kornberg, A. Conversion of the M13 viral single strand to the double-stranded replicative forms by purified proteins. J Biol Chem 249, 3999–4005 (1974). 74. Masai, H. & Arai, K. Frpo: A Novel Single-Stranded DNA Promoter for Transcription and for Primer RNA Synthesis of DNA Replication. Cell 89, 897–907 (1997). 75. Kim, S., Kim, D., Cho, S. W., Kim, J. & Kim, J.-S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res.24, 1012–1019 (2014). 76. Yarnall, M. T. N. et al. Drag-and-drop genome insertion of large sequences without double-strand DNA cleavage using CRISPR-directed integrases. Nat Biotechnol 41, 500–512 (2023). 77. Anzalone, A. V. et al. Programmable deletion, replacement, integration and inversion of large DNA sequences with twin prime editing. Nat Biotechnol 40, 731– 740 (2022). 78. Pandey, S. et al. Efficient site-specific integration of large genes in mammalian cells via continuously evolved recombinases and prime editing. Nat. Biomed. Eng (2024) doi:10.1038 / s41551-024-01227-1. 79. Durrant, M. G. et al. Systematic discovery of recombinases for efficient integration of large DNA sequences into the human genome. Nat Biotechnol 41, 488– 499 (2023). 80. Reus, J. B., Trivino-Soto, G. S., Wu, L. I., Kokott, K. & Lim, E. S. SV40 Large T Antigen Is Not Responsible for the Loss of STING in 293T Cells but Can Inhibit cGAS-STING Interferon Induction. Viruses 12, 137 (2020). 81. Shy, B. R. et al. Hybrid ssDNA Repair Templates Enable High Yield Genome Engineering in Primary Cells for Disease Modeling and Cell Therapy Manufacturing. 2021.09.02.458799 biorxiv.org / content / 10.1101 / 2021.09.02.458799v1 (2021) doi:10.1101 / 2021.09.02.458799. 82. Roth, T. L. et al. Reprogramming human T cell function and specificity with non- viral genome targeting. Nature 559, 405–409 (2018). 83. Luecke, S. et al.CGAS is activated by DNA in a length‐dependent manner. EMBO Reports 18, 1707–1715 (2017). 84. Andreeva, L. et al. cGAS senses long and HMGB / TFAM-bound U-turn DNA by forming protein–DNA ladders. Nature 549, 394–398 (2017). 85. Buchner, J. M., Robertson, A. E., Poynter, D. J., Denniston, S. S. & Karls, A. C. Piv site-specific invertase requires a DEDD motif analogous to the catalytic center of the RuvC Holliday junction resolvases. J Bacteriol 187, 3431–3437 (2005). 86. Tobiason, D. M., Lenich, A. G. & Glasgow, A. C. Multiple DNA Binding Activities of the Novel Site-specific Recombinase, Piv, from Moraxella lacunata. Journal of Biological Chemistry 274, 9698–9706 (1999). 87. Durrant, M. G. et al. Bridge RNAs direct programmable recombination of target and donor DNA. Nature 630, 984–993 (2024). 88. Patiyal, S., Singh, N., Ali, M. Z., Pundir, D. S. & Raghava, G. P. S. Sigma70Pred: A highly accurate method for predicting sigma70 promoter in Escherichia coli K-12 strains. Front. Microbiol.13, 1042127 (2022). 89. Abramson, J. et al. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature 630, 493–500 (2024). 90. Hiraizumi, M. et al. Structural mechanism of bridge RNA-guided recombination. Nature 630, 994–1002 (2024). 91. Yeh, C. D., Richardson, C. D. & Corn, J. E. Advances in genome editing through control of DNA repair pathways. Nature Cell Biology 21, 1468–1478 (2019). 92. van Overbeek, M. et al. DNA Repair Profiling Reveals Nonrandom Outcomes at Cas9-Mediated Breaks. Molecular Cell 63, 633–646 (2016). 93. Kosicki, M., Tomberg, K. & Bradley, A. Repair of double-strand breaks induced by CRISPR–Cas9 leads to large deletions and complex rearrangements. Nat Biotechnol 36, 765–771 (2018). 94. Leibowitz, M. L. et al. Chromothripsis as an on-target consequence of CRISPR– Cas9 genome editing. Nat Genet 53, 895–905 (2021). 95. Alanis-Lobato, G. et al. Frequent loss of heterozygosity in CRISPR-Cas9–edited early human embryos. Proceedings of the National Academy of Sciences 118, e2004832117 (2021). 96. Enache, O. M. et al. Cas9 activates the p53 pathway and selects for p53- inactivating mutations. Nature Genetics 52, 662–668 (2020). 97. Morgens, D. W. et al. Genome-scale measurement of off-target activity using Cas9 toxicity in high-throughput screens. Nat Commun 8, 15178 (2017). 98. Ferreira Da Silva, J. et al. Click editing enables programmable genome writing using DNA polymerases and HUH endonucleases. Nat Biotechnol (2024) doi:10.1038 / s41587-024-02324-x. 99. Anzalone, A. V., Koblan, L. W. & Liu, D. R. Genome editing with CRISPR–Cas nucleases, base editors, transposases and prime editors. Nature Biotechnology 38, 824–844 (2020). 100. Karasu, M. E. et al. Removal of TREX1 activity enhances CRISPR–Cas9- mediated homologous recombination. Nat Biotechnol (2024) doi:10.1038 / s41587- 024-02356-3. OTHER EMBODIMENTS It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

WHAT IS CLAIMED IS:

1. A composition comprising a substrate DNA donor molecule comprising (a) a circular single stranded DNA (cssDNA) donor molecule comprising a desired sequence and one or more recombinase recognition sequences or transposase left and / or right ends, or (b) a scoDNA comprising a circular single stranded DNA (cssDNA) donor molecule comprising a desired sequence and one or more recombinase recognition sequences or transposase left and / or right ends, wherein one or more substrate complementary oligonucleotides (SCOs) bearing complementarity to a portion of the ssDNA are annealed to the cssDNA to form one or more regions of double stranded DNA (dsDNA) sequence, wherein the one or more regions of dsDNA sequence comprise the recombinase recognition sequences or transposase left and / or right ends.

2. The composition of claim 1, wherein the recombinase recognition sequences comprise attP or attB, or the transposase left and / or right ends comprise LE or RE, LTRs, or ITRs.

3. The composition of claim 1 or 2, wherein the SCOs comprise one or more of: (i) a conjugated nuclear localisation sequences (NLS), (ii) one or more chemical modifications and / or abasic sites for stability, optionally PS linkages, 5’ and / or 3’ terminal phosphates, RNA, 5-Methyl dC, 2’OMe, 2’MOE, inverted bases, or exNA, and / or one or more modified DNA or RNA bases or abasic site(s); (iii) DNA and / or RNA, various chemical modifications and / or abasic sites to recruit RNAseH, Flap endonucleases, DNA polymerases, or other endogenous repair machinery; and / or (iv) one or more bases of the SCO that are mismatched with the cssDNA.

4. The composition of any of claims 1 to 3, further comprising a recombinase (optionally Bxb1, eeBxb1, evoBxb1, Dn29, Pa01, BceInt, SacInt, SscInt, PhiC31, or Piv-family invertase) protein or a transposase (optionally piggybac, sleeping beauty, IS110-family transposase, or CRISPR-associated transposase (CAST)) protein, or mRNA or DNA encoding the recombinase protein or transposase protein.

5. The composition of claim 4, wherein the recombinase or transposase comprises one or more nuclear localization sequences (NLS), optionally a heterologous NLS(to facilitate nuclear localization of the scoDNA) and / or wherein the recombinase or transposase is engineered to increase integration activity and / or specificity.

6. The composition of claims 1 to 5, further comprising a single-stranded nucleic acid binding protein (ssNABP, optionally SSB, RPA, or Orf1p) complexed with the substrate DNA donor molecule.

7. The composition of claim 6, wherein the ssNABP comprises one or more nuclear localization sequences (NLS), optionally a heterologous NLS optionally wherein the ssNABP comprises one or more nuclear localization sequences (to facilitate nuclear localization and decreased secondary structure of the single stranded region of the scoDNA).

8. The composition of claim 4 or 5, further comprising an exogenously provided DNA-dependent DNA polymerase (optionally Phi29 or B103), optionally fused to the recombinase or transposase (to initiate second strand synthesis following scoDNA integration).

9. The composition of claims 1-8, wherein the substrate DNA donor is a scoDNA complexed with a sequence or structure specific ssDNA or RNA binding protein domain (Cdc13, HUH endonuclease, ssDNA or RNA binding Cas or OMEGA protein, Phage coat proteins, etc) or a binding protein domain that binds a chemical moiety (e.g., SNAP-tag, CLIP-tag, HALO-tag, monomeric or tetrameric streptavidin), and where the SCO annealed to the donor DNA molecule contains a corresponding sequence or chemical moiety that is bound by the binding protein domain.

10. The composition of any of claims 1 to 9, wherein the substrate DNA donor molecule is encapsulated in a nanoparticle, vesicle, or virus-like particle.

11. A method of inserting a desired sequence at one or more selected sites in genomic DNA of a target cell, the method comprising: providing a target cell comprising a genome comprising one or more recombinase recognition sequences or transposase target sites; and contacting the cell with the composition of one of claims 1-10, wherein the substrate DNA donor molecule comprises corresponding recombinase recognition sequence or transposase left and / or right ends, wherein the substrate DNA donor molecule encodes the desired sequence and the method comprises contacting the cell with the corresponding recombinase or transposase in the same or a separatecomposition, to integrate the desired sequence into the target cell genome at the recombinase recognition sequences or transposase target sites.

12. A method of inserting a desired sequence into a target cell genome, the method comprising contacting or expressing in the target cell a recombinase or transposase with a circular single stranded DNA molecule (cssDNA), comprising the desired sequence to be inserted and recombinase recognition sequences or transposase left and / or right ends, where the cssDNA localizes to the nucleus, undergoes second strand synthesis, and is subsequently integrated into the host genome by the corresponding recombinase or transposase.

13. The method of claim 11 or 12, further comprising first installing the one or more recombinase recognition sequences or transposase target sites at one or more selected sites in the target cell genome.

14. The method of claim 13, wherein the recombinase recognition sequences or transposase target sites are installed using RNA-programmable polymerization (optionally click editing or prime editing).

15. The method of claim 13, wherein the recombinase recognition sequences or transposase target sites are installed using RNA-programmable ligation.

16. The method of claim 13, wherein the recombinase recognition sequences or transposase target sites are installed using nuclease-mediated homology directed repair or end-joining (optionally via CRISPR-Cas, OMEGA, or Fanzor nucleases).

17. The method of any of claims 11 to 16, further comprising administering small molecule inhibitors of TLR9, cGAS, or STING, or antagonistic inhibitory oligonucleotides targeting TLR9, cGAS, or STING.

18. The method of any of claims 11-17, wherein the target cell is in vivo.

19. The method of any of claims 11-17, wherein the target cell is in vitro.

20. A library comprising a plurality of substrate DNA donor molecules comprising (a) a circular single stranded DNA (cssDNA) donor molecule comprising a desired sequence and one or more recombinase recognition sequences or transposase left and / or right ends, or (b) a scoDNA comprising a circular single stranded DNA (cssDNA) donor molecule comprising a desired sequence and one or more recombinase recognition sequences or transposase left and / or right ends, wherein one or more substrate complementary oligonucleotides (SCOs) bearing complementarity to a portion of the ssDNA are annealed to the cssDNA to formone or more regions of dsDNA sequences, wherein the one or more regions of dsDNA sequence comprise the recombinase recognition sequences or transposase left and / or right ends, wherein the plurality of substrate DNA donor molecules comprise a plurality of different desired sequences.