Compositions, systems and methods for modulating T cell function

Abstract

An epigenetically modified DNA targeting system, such as a CRISPR-Cas / guide RNA (gRNA) system, is provided that binds to or targets a target site in a gene or a regulatory element thereof in a T cell. In some aspects, the provided epigenetically modified DNA targeting system modulates T cell function, such as T cell phenotype or activity. In some aspects, also provided herein are methods and uses related to the provided compositions, such as modulating T cells, including in combination with methods of adoptive T cell therapy.

Description

Cross - Reference to Related Applications

[0001] This application claims priority to U.S. Provisional Application No. 63 / 408,081, filed on September 19, 2022, entitled "Compositions, Systems, and Methods for Modulating T Cell Function", U.S. Provisional Application No. 63 / 459,969, filed on April 17, 2023, entitled "Compositions, Systems, and Methods for Modulating T Cell Function", U.S. Provisional Application No. 63 / 466,678, filed on May 15, 2023, entitled "Compositions, Systems, and Methods for Modulating T Cell Function", U.S. Provisional Application No. 63 / 530,030, filed on July 31, 2023, entitled "Compositions, Systems, and Methods for Modulating T Cell Function", U.S. Provisional Application No. 63 / 532,345, filed on August 11, 2023, entitled "Compositions, Systems, and Methods for Modulating T Cell Function", and U.S. Provisional Application No. 63 / 581,949, filed on September 11, 2023, entitled "Compositions, Systems, and Methods for Modulating T Cell Function", the contents of which are incorporated herein by reference in their entirety. Incorporation by Reference of Sequence Listing

[0002] This application is filed with the Sequence Listing in electronic format. The Sequence Listing is provided as a file named 224742002240.xml, created on September 18, 2023, and having a size of 734,197 bytes. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety. Technical Field

[0003] In some aspects, the present disclosure relates to epigenetically modified DNA targeting systems, such as CRISPR-Cas / guide RNA (gRNA) systems, that bind to or target target sites in genes or their regulatory elements in T cells. In some aspects, the epigenetically modified DNA targeting systems of the present disclosure modulate T cell function, such as T cell phenotype or activity. In some aspects, the present disclosure relates to methods and uses related to the provided compositions, such as modulating T cells, including in combination with methods of adoptive T cell therapy. Background Art

[0004] The administration of T cells that target specific antigens, also known as adoptive cell therapy (ACT), is a promising approach for treating diseases such as cancer. However, current ACT treatments face challenges, including suboptimal T cell function, expansion, and persistence. Therefore, there is a need for new and improved methods to overcome such challenges. The content of the present disclosure addresses such needs and others. Summary of the Invention

[0005] The present disclosure provides an epigenetically modified DNA targeting system that includes at least one DNA targeting module for repressing transcription of one or more genes in T cells, wherein each of the at least one DNA targeting modules includes a fusion protein comprising: (a) a DNA binding domain capable of being targeted to a target site of one of the one or more genes, wherein the one or more genes are selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2; and (b) at least one transcriptional repressor effector domain for repressing transcription of one or more genes in T cells.

[0006] In some aspects, the present disclosure provides an epigenetically modified DNA targeting system that includes at least one DNA targeting module for repressing transcription of one or more genes in T cells, wherein each of the at least one DNA targeting modules includes a fusion protein comprising: (a) a DNA binding domain capable of being targeted to a target site of one of the one or more genes or their regulatory DNA elements in T cells, wherein the one or more genes are selected from the group consisting of CD5, KDM1A, CBLB, DGKZ, MYB, RASA2, ELOB, GATA3, CISH, PRDM1, MED12, and CCNC; and (b) at least one transcriptional repressor effector domain for repressing transcription of one or more genes in T cells.

[0007] The present disclosure also provides an epigenetically modified DNA targeting system that includes at least one DNA targeting module for increasing transcription of one or more genes in T cells, wherein each of the at least one DNA targeting modules includes a fusion protein comprising: (a) a DNA binding domain capable of being targeted to a target site of one of the one or more genes, wherein the one or more genes are selected from the group consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1; and (b) at least one transcriptional activator effector domain for increasing transcription of one or more genes in T cells.

[0008] In some aspects, provided herein is an epigenetically modified DNA targeting system that includes at least one DNA targeting module for increasing transcription of one or more genes in T cells, wherein each of the at least one DNA targeting module includes a fusion protein that includes (a) a DNA binding domain capable of being targeted to a target site in one of one or more genes or their regulatory DNA elements in T cells, wherein the one or more genes are selected from the group consisting of VAV1, IL2, and IL2RB; and (b) at least one transcriptional activator effector domain for increasing transcription of one or more genes in T cells.

[0009] In some of any of the provided embodiments, the transient delivery of the epigenetically modified DNA targeting system to T cells promotes an increase in T cell effector function upon T cell stimulation relative to T cell effector function in the absence of T cell stimulation. In some of any of the provided embodiments, the T cell effector function is characterized by an activity selected from the group consisting of IL-2 production, IFN-γ production, TNF-α production, T cell proliferation, or any combination of the foregoing. In some of any of the provided embodiments, the T cell effector function is characterized by IL-2 production. In some of any of the provided embodiments, the T cell effector function is characterized by IFN-γ production. In some of any of the provided embodiments, the T cell effector function is characterized by IL-2 production and IFN-γ production. In some of any of the provided embodiments, the T cell effector function is characterized by the multifunctional production of IL-2, IFN-γ, and TNF-α. In some of any of the provided embodiments, the T cell effector function is characterized by an activity further including T cell proliferation. In any of the embodiments herein, the T cell effector function is characterized by an activity further including killing of target cells. In any of the embodiments herein, the T cell effector function is characterized by an activity further including T cell persistence.

[0010] In some of any of the provided embodiments of the epigenetically modified DNA targeting system, an increase in T cell effector function is observed 48 hours or more after the transient delivery of the epigenetically modified DNA targeting system to T cells. In some of any of the provided embodiments, an increase in T cell effector function is observed for up to 6 days, up to 9 days, up to 12 days, up to 15 days, up to 21 days, up to 28 days, up to 35 days, up to 42 days, up to 49 days, up to 56 days, up to 63 days, up to 71 days, or more after the transient delivery of the epigenetically modified DNA targeting system to T cells.

[0011] In some of any of the provided embodiments of an epigenetically modified DNA targeting system, the T cell stimulation is with anti-CD3 and anti-CD28 activating reagents.

[0012] In any of the embodiments herein, the T cells express an engineered antigen receptor, optionally a chimeric antigen receptor (CAR) or a T cell receptor (eTCR). In some embodiments, the engineered antigen receptor is a chimeric antigen receptor (CAR) or an engineered T cell receptor (eTCR) directed against an antigen, and the T cell stimulation is antigen-specific stimulation of the CAR or eTCR, optionally wherein the T cell stimulation is with antigen-expressing target cells. In some of any of the provided embodiments of an epigenetically modified DNA targeting system, the T cells express a chimeric antigen receptor (CAR) directed against an antigen, and the T cell stimulation is antigen-specific stimulation of the CAR, optionally wherein the T cell stimulation is with antigen-expressing target cells.

[0013] In some of any of the provided embodiments of an epigenetically modified DNA targeting system, the T cell stimulation is a restimulation after at least one prior T cell stimulation of the T cells.

[0014] In some of any of the provided embodiments of an epigenetically modified DNA targeting system, the DNA targeting system does not introduce gene disruption or DNA breaks.

[0015] In some of any of the provided embodiments of an epigenetically modified DNA targeting system, the fusion protein of each DNA targeting module comprises a DNA binding domain selected from: a clustered regularly interspaced short palindromic repeat (Cas) protein or variant thereof; a zinc finger protein (ZFP); a transcription activator-like effector (TALE); a meganuclease; a homing nuclease; or an I-SceI enzyme or variant thereof. In some of any such embodiments, the DNA binding domain comprises a catalytically inactive variant of any of the foregoing.

[0016] In any of the embodiments herein, the at least one DNA targeting module is a single DNA targeting module targeting a target site of one of the one or more genes.

[0017] In some of any provided embodiments of an epigenetically modified DNA targeting system, the at least one DNA targeting module is a plurality of DNA targeting modules for targeting a plurality of target sites of the one or more genes or their regulatory elements. In any of the embodiments herein, the at least one DNA targeting module is a plurality of DNA targeting modules for repressing the transcription of one or more genes in T cells, wherein each DNA targeting module targets a target site of one of the one or more genes. In any of the embodiments herein, the at least one DNA targeting module is a plurality of DNA targeting modules for increasing the transcription of one or more genes in T cells, wherein each DNA targeting module targets a target site of one of the one or more genes. In some of any provided embodiments, the plurality of DNA targeting modules are 2, 3, 4, 5, or 6 DNA targeting modules.

[0018] In any embodiment herein, a plurality of DNA targeting modules for repressing transcription of one or more genes in T cells target at least a first gene and a second gene, wherein the first and second genes are independently selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2. In some of any provided embodiments, the plurality of DNA targeting modules target at least a first gene and a second gene, wherein the first and second genes are independently selected from the group consisting of CD5, KDM1A, CBLB, DGKZ, MYB, RASA2, ELOB, GATA3, CISH, PRDM1, MED12, and CCNC. In any embodiment herein, a plurality of DNA targeting modules for repressing transcription of one or more genes in T cells target at least a first gene and a second gene, wherein the first and second genes are independently selected from the group consisting of CBLB, CISH, MED12, MYB, PRDM1, and RASA2. In some embodiments, the plurality of DNA targeting modules for repressing transcription of one or more genes in T cells target at least a first gene, a second gene, and a third gene, wherein the first, second, and third genes are independently selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2. In some of any provided embodiments, the plurality of DNA targeting modules target at least a first gene, a second gene, and a third gene, wherein the first, second, and third genes are independently selected from the group consisting of CD5, KDM1A, CBLB, DGKZ, MYB, RASA2, ELOB, GATA3, CISH, PRDM1, MED12, and CCNC. In some embodiments, the plurality of DNA targeting modules for repressing transcription of one or more genes in T cells target at least a first gene, a second gene, and a third gene, wherein the first, second, and third genes are independently selected from the group consisting of CBLB, CISH, MED12, MYB, PRDM1, and RASA2.

[0019] In any embodiment of the present disclosure, the plurality of DNA targeting modules target a combination of genes selected from: CBLB and CCNC; CBLB and CD5; CBLB and CISH; CBLB and DGKZ; CBLB and ELOB; CBLB and FAS; CBLB and Fli1; CBLB and GATA3; CBLB and KDM1A; CBLB and MED12; CBLB and MYB; CBLB and PRDM1; CBLB and RASA2; CD5 and CISH; CD5 and MYB; CISH and DGKZ; CISH and MYB; CISH and RASA2; GATA3 and CD5; GATA3 and CISH; GATA3 and MYB; MED12 and CBLB; MED12 and CD5; MED12 and CISH; MED12 and DGKZ; MED12 and ELOB; MED12 and GATA3; MED12 and MYB; MED12 and PRDM1; MED12 and RASA2; MYB and RASA2; PRDM1 and CISH; PRDM1 and GATA3; PRDM1 and MYB; PRDM1 and RASA2; CD5, CISH and MYB; GATA3, CBLB and MYB; GATA3, CD5 and MYB; PRDM1, GATA3 and CISH, TGFBR2 and MED12; and TGFBR2, MED12 and CISH. In some of any provided embodiments, the plurality of DNA targeting modules target CBLB and MYB; CD5 and CISH; CD5, CISH and MYB; CD5 and MYB; CISH and DGKZ; CISH and MYB; CISH and RASA2; GATA3, CBLB and MYB; GATA3 and CD5; GATA3, CD5 and MYB; GATA3 and CISH; GATA3 and MYB; MYB and RASA2; PRDM1 and CISH; PRDM1 and GATA3; PRDM1, GATA3 and CISH; PRDM1 and MYB; PRDM1 and RASA2; CBLB and CCNC; and CBLB and MED12.

[0020] In any embodiment of the present disclosure, the plurality of DNA targeting modules target a combination of genes selected from: MED12 and CBLB; MED12 and CISH; CBLB and MYB; and CBLB and RASA2. In some embodiments, the first and second genes are CBLB and MYB. In some embodiments, the first and second genes are CBLB and MED12. In some embodiments, the first and second genes are CBLB and CCNC.

[0021] In any embodiment herein, a plurality of DNA targeting modules for increasing transcription of one or more genes in T cells target at least a first gene and a second gene, wherein the first and second genes are independently selected from the group consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1. In some of any of the provided embodiments, the plurality of DNA targeting modules target at least a first gene and a second gene, wherein the first and second genes are independently selected from the group consisting of VAV1, IL-2, and IL2RB. In any embodiment herein, a plurality of DNA targeting modules for increasing transcription of one or more genes in T cells target at least a first gene and a second gene, wherein the first and second genes are independently selected from the group consisting of EOMES, IL-2, LCP2, and TBX21. In any embodiment herein, a plurality of DNA targeting modules for increasing transcription of one or more genes in T cells target at least a first gene, a second gene, and a third gene, wherein the first, second, and third genes are independently selected from the group consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1. In any embodiment herein, a plurality of DNA targeting modules for increasing transcription of one or more genes in T cells target at least a first gene, a second gene, and a third gene, wherein the first, second, and third genes are independently selected from the group consisting of EOMES, IL-2, LCP2, and TBX21.

[0023] In any of the embodiments herein, the plurality of DNA targeting modules target a combination of genes selected from: BATF and IL-2; BATF and VAV1; CD28 and BATF; CD28 and EOMES; CD28 and IL-2; CD28 and LCP2; CD28 and TBX21; CD28 and VAV1; EOMES and BATF; EOMES and LCP2; EOMES and TBX21; EOMES and VAV1; EOMES and IL-2; LCP2 and BATF; LCP2 and IL-2; LCP2 and TBX21; LCP2 and VAV1; TBX21 and BATF; TBX21 and IL-2; TBX21 and TBX21; TBX21 and VAV1; and VAV1 and IL-2. In some of any of the provided embodiments, the first and second genes are IL2RB and VAV1. In some of any of the provided embodiments, the first and second genes are IL2 and VAV1. In some embodiments, the first and second genes are IL2 and LCP2. In some embodiments, the first and second genes are IL2 and TBX21. In some embodiments, the first and second genes are IL2 and EOMES.

[0024] In any of the embodiments herein, the target site of each of the gene or the one or more genes is in the gene and / or its regulatory DNA element. In some of any of the provided embodiments of the epigenetic modification DNA targeting system, the target site of each of the gene or the one or more genes is in its regulatory DNA element. In some of any of the provided embodiments, the regulatory DNA element is an enhancer or a promoter.

[0025] In any of the embodiments herein, the target site is within 1000 base pairs (bp) of the transcription start site of the gene. In some of any of the provided embodiments of the epigenetic modification DNA targeting system, the target site is within 500 base pairs (bp) of the transcription start site of the gene.

[0026] In some of the embodiments of any provided epigenetic modification DNA targeting system, the target sites are selected from: (a) the target site of CD5, which has the sequence shown in any of SEQ ID NO: 1-3, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (b) the target site of KDM1A, which has the sequence shown in any of SEQ ID NO: 4-6, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (c) the target site of CBLB, which has the sequence shown in any of SEQ ID NO: 10-12, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (d) the target site of DGKZ, which has the sequence shown in any of SEQ ID NO: 13-15, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (e) the target site of MYB1, which has the sequence shown in any of SEQ ID NO: 16-18, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (f) the target site of RASA2, which has the sequence shown in any of SEQ ID NO: 19-21, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (g) the target site of ELOB, which has the sequence shown in any of SEQ ID NO: 22-24, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (h) the target site of GATA3, which has the sequence shown in any of SEQ ID NO: 25-27, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (i) the target site of CISH, which has the sequence shown in any of SEQ ID NO: 28-30, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (j) the target site of PRDM1, which has the sequence shown in any of SEQ ID NO: 31-33, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (k) the target site of MED12, which has the sequence shown in any of SEQ ID NO: 80-90, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; and (l) the target site of CCNC, which has the sequence shown in any of SEQ ID NO: 102-112, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (m) the target site of FAS, which has the sequence shown in any of SEQ ID NO: 200-205 and 292-295, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing;(n)Target sites of Fli1, having the sequences shown in any of SEQ ID NOs: 206-211, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing; and (o) Target sites of TGFBR2, having the sequences shown in any of SEQ ID NOs: 300-302 and 306-308, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing.;

[0027] In some of any of the provided embodiments of the epigenetic modification DNA targeting system, the target sites are selected from: (a) the target site of CD5, which has the sequence shown in any of SEQ ID NO: 1-3 or its complementary sequence; (b) the target site of KDM1A, which has the sequence shown in any of SEQ ID NO: 4-6 or its complementary sequence; (c) the target site of CBLB, which has the sequence shown in any of SEQ ID NO: 10-12 or its complementary sequence; (d) the target site of DGKZ, which has the sequence shown in any of SEQ ID NO: 13-15 or the complementary sequence of any of the foregoing; (e) the target site of MYB1, which has the sequence shown in any of SEQ ID NO: 16-18 or the complementary sequence of any of the foregoing; (f) the target site of RASA2, which has the sequence shown in any of SEQ ID NO: 19-21 or the complementary sequence of any of the foregoing; (g) the target site of ELOB, which has the sequence shown in any of SEQ ID NO: 22-24 or the complementary sequence of any of the foregoing; (h) the target site of GATA3, which has the sequence shown in any of SEQ ID NO: 25-27 or the complementary sequence of any of the foregoing; (i) the target site of CISH, which has the sequence shown in any of SEQ ID NO: 28-30 or the complementary sequence of any of the foregoing; (j) the target site of PRDM1, which has the sequence shown in any of SEQ ID NO: 31-33 or the complementary sequence of any of the foregoing; (k) the target site of MED12, which has the sequence shown in any of SEQ ID NO: 80-90 or the complementary sequence of any of the foregoing; and (l) the target site of CCNC, which has the sequence shown in any of SEQ ID NO: 102-112 or the complementary sequence of any of the foregoing; (m) the target site of FAS, which has the sequence shown in any of SEQ ID NO: 200-205 and 292-295 or the complementary sequence of any of the foregoing; (n) the target site of Fli1, which has the sequence shown in any of SEQ ID NO: 206-211 or the complementary sequence of any of the foregoing; and (o) the target site of TGFBR2, which has the sequence shown in any of SEQ ID NO: 300-302 and 306-308 or the complementary sequence of any of the foregoing.

[0028] In any embodiment of the present text, (a) the target site is selected from the target sites of CBLB, which has the sequence shown in SEQ ID NO: 11 or its complementary sequence; (b) the target site is selected from the target sites of MYB, which has the sequence shown in SEQ ID NO: 18 or its complementary sequence; (c) the target site is selected from the target sites of RASA2, which has the sequence shown in SEQ ID NO: 19 or its complementary sequence; (d) the target site is selected from the target sites of CISH, which has the sequence shown in SEQ ID NO: 28 or its complementary sequence; (e) the target site is selected from the target sites of PRDM1, which has the sequence shown in SEQ ID NO: 33 or its complementary sequence; and (f) the target site is selected from the target sites of MED12, which has the sequence shown in SEQ ID NO: 81 or its complementary sequence.

[0029] In any embodiment of the present disclosure, the target site is selected from: (a) a target site of VAV1 having a sequence shown in any of SEQ ID NOs: 7-9, 156, and 170, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (b) a target site of IL2 having a sequence shown in SEQ ID NO: 78, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (c) a target site of BATF having a sequence shown in any of SEQ ID NOs: 172-174, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (d) a target site of CD28 having a sequence shown in any of SEQ ID NOs: 144-146 and 189-191, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (e) a target site of EOMES having a sequence shown in any of SEQ ID NOs: 147-149, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (f) a target site of IRF4 having a sequence shown in any of SEQ ID NOs: 175-177, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (g) a target site of LAT having a sequence shown in any of SEQ ID NOs: 184-186, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (h) a target site of LCP2 having a sequence shown in any of SEQ ID NOs: 150-152 and 187-188, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; and (i) a target site of TBX21 having a sequence shown in any of SEQ ID NOs: 153-155, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing.

[0030] In any embodiment herein, the target site is selected from: (a) the target site of VAV1 having the sequence shown in any of SEQ ID NO: 7-9, 156, and 170 or the complementary sequence of any of the foregoing; (b) the target site of IL2 having the sequence shown in SEQ ID NO: 78 or any complementary sequence of the foregoing; (c) the target site of BATF having the sequence shown in any of SEQ ID NO: 172-174 or the complementary sequence of any of the foregoing; (d) the target site of CD28 having the sequence shown in any of SEQ ID NO: 144-146 and 189-191 or the complementary sequence of any of the foregoing; (e) the target site of EOMES having the sequence shown in any of SEQ ID NO: 147-149 or the complementary sequence of any of the foregoing; (f) the target site of IRF4 having the sequence shown in any of SEQ ID NO: 175-177 or the complementary sequence of any of the foregoing; (g) the target site of LAT having the sequence shown in any of SEQ ID NO: 184-186 or the complementary sequence of any of the foregoing; (h) the target site of LCP2 having the sequence shown in any of SEQ ID NO: 150-152 and 187-188 or the complementary sequence of any of the foregoing; and (i) the target site of TBX21 having the sequence shown in any of SEQ ID NO: 153-155 or the complementary sequence of any of the foregoing.

[0031] In any embodiment herein, the target site is selected from: (a) the target site of IL-2 having the sequence shown in SEQ ID NO: 78 or any complementary sequence of the foregoing; (b) the target site of EOMES having the sequence shown in SEQ ID NO: 149 or any complementary sequence of the foregoing; (c) the target site of LCP2 having the sequence shown in SEQ ID NO: 151 or any complementary sequence of the foregoing; and (d) the target site of TBX21 having the sequence shown in SEQ ID NO: 155 or any complementary sequence of the foregoing.

[0032] In any embodiment herein, the DNA binding domain of each of the at least one DNA targeting module is a clustered regularly interspaced short palindromic repeat associated (Cas) protein or a variant thereof, and each of the at least one DNA targeting module further comprises at least one gRNA for targeting the DNA binding domain to the target site of the one or more genes.

[0033] In any embodiment of the present disclosure, the Cas protein or its variant is a deactivated (dCa) protein. In some embodiments, the dCas protein lacks nuclease activity. In some embodiments, the dCas protein is a dCas9 protein. In some embodiments, the dCas protein is a dCas12 protein. In some embodiments, the dCas9 protein is a Staphylococcus aureus dCas9 (dSaCas9) protein. In some embodiments, the dSaCas9 comprises at least one amino acid mutation selected from D10A and N580A, with reference to the position numbering of SEQ ID NO: 124. In some embodiments, the dSaCas9 protein comprises the sequence shown in SEQ ID NO: 125, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the dSaCas9 is as shown in SEQ ID NO: 125. In some embodiments, the dCas9 protein is a Streptococcus pyogenes dCas9 (dSpCas9) protein. In some embodiments, the dSpCas9 protein comprises at least one amino acid mutation selected from D10A and H840A, with reference to the position numbering of SEQ ID NO: 126. In some embodiments, the dSpCas9 protein comprises the sequence shown in SEQ ID NO: 127, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the dSpCas9 is as shown in SEQ ID NO: 127.

[0034] In any embodiment of the present disclosure, the gRNA comprises a gRNA spacer complementary to the target site of the gene.

[0035] In any embodiment of the present disclosure, the DNA targeting module is used to repress the transcription of the one or more genes, and the gRNA is selected from: (a) a gRNA targeting a target site of CD5 and comprising a gRNA spacer sequence targeting a sequence shown in any of SEQ ID NOs: 35 - 37 or at least 14 consecutive nucleotides thereof; (b) a gRNA targeting a target site of KDM1A and comprising a gRNA spacer sequence targeting a sequence shown in any of SEQ ID NOs: 38 - 40 or at least 14 consecutive nucleotides thereof; (c) a gRNA targeting a target site of CBLB and comprising a gRNA spacer sequence targeting a sequence shown in any of SEQ ID NOs: 44 - 46 or at least 14 consecutive nucleotides thereof; (d) a gRNA targeting a target site of DGKZ and comprising a gRNA spacer sequence targeting a sequence shown in any of SEQ ID NOs: 47 - 49 or at least 14 consecutive nucleotides thereof; (e) a gRNA targeting a target site of MYB and comprising a gRNA spacer sequence targeting a sequence shown in any of SEQ ID NOs: 50 - 52 or at least 14 consecutive nucleotides thereof; (f) a gRNA targeting a target site of RASA2 and comprising a gRNA spacer sequence targeting a sequence shown in any of SEQ ID NOs: 53 - 55 or at least 14 consecutive nucleotides thereof; (g) a gRNA targeting a target site of ELOB and comprising a gRNA spacer sequence targeting a sequence shown in any of SEQ ID NOs: 56 - 58 or at least 14 consecutive nucleotides thereof; (h) a gRNA targeting a target site of GATA3 and comprising a gRNA spacer sequence targeting a sequence shown in any of SEQ ID NOs: 59 - 61 or at least 14 consecutive nucleotides thereof; (i) a gRNA targeting a target site of CISH and comprising a gRNA spacer sequence targeting a sequence shown in any of SEQ ID NOs: 62 - 64 or at least 14 consecutive nucleotides thereof; (j) a gRNA targeting a target site of PRDM1 and comprising a gRNA spacer sequence targeting a sequence shown in any of SEQ ID NOs: 65 - 67 or at least 14 consecutive nucleotides thereof; (k) a gRNA targeting a target site of MED12 and comprising a gRNA spacer sequence targeting a sequence shown in any of SEQ ID NOs: 91 - 101 or at least 14 consecutive nucleotides thereof; (l) a gRNA targeting a target site of CCNC and comprising a gRNA spacer sequence targeting a sequence shown in any of SEQ ID NOs: 113 - 123 or at least 14 consecutive nucleotides thereof; (m) a gRNA targeting a target site of FAS and comprising a gRNA spacer sequence targeting a sequence shown in any of SEQ ID NOs: 212 - 217 and 296 - 299 or at least 14 consecutive nucleotides thereof;(n) A gRNA that targets the target site of Fli1 and contains a gRNA spacer sequence that contains the sequence shown in any of SEQ ID NOs: 218-223 or at least a 14-nt continuous portion thereof; and (o) A gRNA that targets the target site of TGFBR2 and contains a gRNA spacer sequence that contains the sequence shown in any of SEQ ID NOs: 303-305 and 309-311 or at least a 14-nt continuous portion thereof.;

[0036] In any embodiment of the present disclosure, the DNA targeting module is used to repress the transcription of the one or more genes, and the gRNA is selected from: (a) a gRNA targeting a target site of CD5 and comprising a gRNA spacer sequence shown in any one of SEQ ID NOs: 35-37; (b) a gRNA targeting a target site of KDM1A and comprising a gRNA spacer sequence shown in any one of SEQ ID NOs: 38-40; (c) a gRNA targeting a target site of CBLB and comprising a gRNA spacer sequence shown in any one of SEQ ID NOs: 44-46; (d) a gRNA targeting a target site of DGKZ and comprising a gRNA spacer sequence shown in any one of SEQ ID NOs: 47-49; (e) a gRNA targeting a target site of MYB and comprising a gRNA spacer sequence shown in any one of SEQ ID NOs: 50-52; (f) a gRNA targeting a target site of RASA2 and comprising a gRNA spacer sequence shown in any one of SEQ ID NOs: 53-55; (g) a gRNA targeting a target site of ELOB and comprising a gRNA spacer sequence shown in any one of SEQ ID NOs: 56-58; (h) a gRNA targeting a target site of GATA3 and comprising a gRNA spacer sequence shown in any one of SEQ ID NOs: 59-61; (i) a gRNA targeting a target site of CISH and comprising a gRNA spacer sequence shown in any one of SEQ ID NOs: 62-64; (j) a gRNA targeting a target site of PRDM1 and comprising a gRNA spacer sequence shown in any one of SEQ ID NOs: 65-67; (k) a gRNA targeting a target site of MED12 and comprising a gRNA spacer sequence shown in any one of SEQ ID NOs: 91-101; (l) a gRNA targeting a target site of CCNC and comprising a gRNA spacer sequence shown in any one of SEQ ID NOs: 113-123; (m) a gRNA targeting a target site of FAS and comprising a gRNA spacer sequence shown in any one of SEQ ID NOs: 212-217 and 296-299; (n) a gRNA targeting a target site of Fli1 and comprising a gRNA spacer sequence shown in any one of SEQ ID NOs: 218-223; and (o) a gRNA targeting a target site of TGFBR2 and comprising a gRNA spacer sequence shown in any one of SEQ ID NOs: 303-305 and 309-311.

[0037] In any embodiment of the present disclosure, the DNA targeting module is used to repress the transcription of the one or more genes, and the gRNA is selected from: (a) a gRNA targeting the target site of CBLB and comprising the gRNA spacer sequence shown in SEQ ID NO: 45; (b) a gRNA targeting the target site of MYB and comprising the gRNA spacer sequence shown in SEQ ID NO: 52; (c) a gRNA targeting the target site of RASA2 and comprising the gRNA spacer sequence shown in SEQ ID NO: 53; (d) a gRNA targeting the target site of CISH and comprising the gRNA spacer sequence shown in SEQ ID NO: 62; (e) a gRNA targeting the target site of PRDM1 and comprising the gRNA spacer sequence shown in SEQ ID NO: 67; and (f) a gRNA targeting the target site of MED12 and comprising the gRNA spacer sequence shown in SEQ ID NO: 92.

[0038] In any embodiment of the present disclosure, the DNA targeting module is used to increase the transcription of the one or more genes, and the gRNA is selected from: (a) a gRNA targeting a target site of VAV1 and comprising a gRNA spacer sequence targeting a target site of VAV1 and comprising a sequence shown in any of SEQ ID NOs: 41-43, 169, and 171 or at least 14 consecutive nucleotides thereof; (b) a gRNA targeting a target site of IL2 and comprising a gRNA spacer sequence targeting a target site of IL2 and comprising a sequence shown in SEQ ID NO: 79 or at least 14 consecutive nucleotides thereof; (c) a gRNA targeting a target site of BATF and comprising a gRNA spacer sequence targeting a target site of BATF and comprising a sequence shown in any of SEQ ID NOs: 178-180 or at least 14 consecutive nucleotides thereof; (d) a gRNA targeting a target site of CD28 and comprising a gRNA spacer sequence targeting a target site of CD28 and comprising a sequence shown in any of SEQ ID NOs: 157-159 and 197-199 or at least 14 consecutive nucleotides thereof; (e) a gRNA targeting a target site of EOMES and comprising a gRNA spacer sequence targeting a target site of EOMES and comprising a sequence shown in any of SEQ ID NOs: 160-162 or at least 14 consecutive nucleotides thereof; (f) a gRNA targeting a target site of IRF4 and comprising a gRNA spacer sequence targeting a target site of IRF4 and comprising a sequence shown in any of SEQ ID NOs: 181-183 or at least 14 consecutive nucleotides thereof; (g) a gRNA targeting a target site of LAT and comprising a gRNA spacer sequence targeting a target site of LAT and comprising a sequence shown in any of SEQ ID NOs: 192-194 or at least 14 consecutive nucleotides thereof; (h) a gRNA targeting a target site of LCP2 and comprising a gRNA spacer sequence targeting a target site of LCP2 and comprising a sequence shown in any of SEQ ID NOs: 163-165 and 195-196 or at least 14 consecutive nucleotides thereof; and (i) a gRNA targeting a target site of TBX21 and comprising a gRNA spacer sequence targeting a target site of TBX21 and comprising a sequence shown in any of SEQ ID NOs: 166-168 or at least 14 consecutive nucleotides thereof.

[0039] In any embodiment herein, the DNA targeting module is used to increase the transcription of the one or more genes, and the gRNA is selected from: (a) a gRNA targeting a target site of VAV1 and comprising the gRNA spacer sequence shown in any one of SEQ ID NOs: 41-43, 169, and 171; (b) a gRNA targeting a target site of IL2 and comprising the gRNA spacer sequence shown in SEQ ID NO: 79; (c) a gRNA targeting a target site of BATF and comprising the gRNA spacer sequence shown in any one of SEQ ID NOs: 178-180; (d) a gRNA targeting a target site of CD28 and comprising the gRNA spacer sequence shown in any one of SEQ ID NOs: 157-159 and 197-199; (e) a gRNA targeting a target site of EOMES and comprising the gRNA spacer sequence shown in any one of SEQ ID NOs: 160-162; (f) a gRNA targeting a target site of IRF4 and comprising the gRNA spacer sequence shown in any one of SEQ ID NOs: 181-183; (g) a gRNA targeting a target site of LAT and comprising the gRNA spacer sequence shown in any one of SEQ ID NOs: 192-194; (h) a gRNA targeting a target site of LCP2 and comprising the gRNA spacer sequence shown in any one of SEQ ID NOs: 163-165 and 195-196; and (i) a gRNA targeting a target site of TBX21 and comprising the gRNA spacer sequence shown in any one of SEQ ID NOs: 166-168.

[0040] In any embodiment herein, the DNA targeting module is used to increase the transcription of the one or more genes, and the gRNA is selected from: (a) a gRNA targeting a target site of IL-2 and comprising the gRNA spacer sequence shown in SEQ ID NO: 79; (a) a gRNA targeting a target site of EOMES and comprising the gRNA spacer sequence shown in SEQ ID NO: 162; (a) a gRNA targeting a target site of LCP2 and comprising the gRNA spacer sequence shown in SEQ ID NO: 164; and (a) a gRNA targeting a target site of TBX21 and comprising the gRNA spacer sequence shown in SEQ ID NO: 168;

[0041] In any embodiment herein, the gRNA comprises a spacer sequence having a length between 14 nt and 24 nt or between 16 nt and 22 nt. In any embodiment herein, the gRNA comprises a spacer sequence having a length of 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt.

[0042] In any embodiment herein, the gRNA further comprises the scaffold sequence shown in SEQ ID NO:69.

[0043] In any embodiment herein, the at least one transcriptional repressor effector domain is capable of reducing the transcription of the one or more genes.

[0044] In any embodiment herein, the transcriptional repressor effector domain is selected from the group consisting of the KRAB domain, the DNMT3A domain, the DNMT3L domain, the DNMT3B domain, the DNMT3A-DNMT3L fusion protein domain, the ERF repressor domain, the Mxi1 repressor domain, the SID4X repressor domain, the Mad-SID repressor domain, the LSD1 repressor domain, the EZH2 repressor domain, the SunTag domain, or a variant or portion of any of the foregoing domains, or a combination of any of the foregoing domains.

[0045] In any embodiment herein, the transcriptional repressor effector domain is the KRAB domain, the DNMT3A domain, or the DNMT3L domain, or a combination of any of the foregoing domains.

[0046] In any embodiment herein, the at least one transcriptional repressor effector domain comprises the KRAB domain or a variant or portion thereof that exhibits transcriptional repressor activity. In any embodiment herein, the at least one transcriptional repressor effector domain comprises the sequence shown in any one of SEQ ID NO:70, 235, and 355-358, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0047] In any embodiment herein, the at least one transcriptional repressor effector domain comprises the DNMT3A domain or a variant or portion thereof that exhibits transcriptional repressor activity. In any embodiment herein, the at least one transcriptional repressor domain comprises the sequence shown in SEQ ID NO:131 or 238, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0048] In any embodiment herein, the at least one transcriptional repressor domain comprises a DNMT3L domain or a variant or portion thereof that exhibits transcriptional repressor activity. In any embodiment herein, the at least one transcriptional repressor domain comprises the sequence shown in any one of SEQ ID NO: 133 and 240-242, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

[0049] In any embodiment herein, the at least one transcriptional repressor domain is a DNMT3A-DNMT3L fusion protein domain, a DNMT3B-DNMT3L fusion protein domain, or a variant thereof that exhibits transcriptional repressor activity. In any embodiment herein, the at least one transcriptional repressor domain comprises the sequence shown in any one of SEQ ID NO: 135, 137, or 363, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing. In any embodiment herein, the fusion protein comprises the sequence shown in any one of SEQ ID NO: 138-141, 332-351, and 365-384, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

[0050] In any embodiment herein, the at least one transcriptional activator effector domain is capable of increasing the transcription of the one or more genes.

[0051] In any embodiment herein, the at least one transcriptional activator effector domain is selected from the group consisting of: VP64 domain, p65 activation domain, p300 domain, Rta domain, CBP domain, VPR domain, VPH domain, HSF1 domain, TET protein domain, optionally wherein the TET protein is TET1, SunTag domain, or a domain, portion, variant, or truncation of any of the foregoing.

[0052] In any embodiment herein, the at least one transcriptional activator effector domain comprises at least one VP16 domain and / or a VP16 tetramer (“VP64”) or a variant thereof. In any embodiment herein, the at least one transcriptional activator effector domain comprises a VP64 domain or a variant or portion thereof that exhibits transcriptional activation activity. In any embodiment herein, the at least one transcriptional activator effector domain is VP64. In any embodiment herein, the at least one transcriptional activator domain comprises the sequence shown in SEQ ID NO:142, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to any of the foregoing. In any embodiment herein, the fusion protein comprises the sequence shown in SEQ ID NO:77, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0053] Also provided herein is a combination of epigenetically modified DNA targeting systems, the combination comprising at least 2 of the DNA targeting systems described herein, wherein each DNA targeting system represses the transcription of a different gene among the one or more genes.

[0054] Also provided herein is a combination of epigenetically modified DNA targeting systems, the combination comprising at least 2 of the DNA targeting systems described herein, wherein each DNA targeting system increases the transcription of a different gene among the one or more genes.

[0055] The present disclosure also provides a guide RNA (gRNA) that targets a target site of a gene selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2. In some embodiments, the target site of the gene is in the gene or its regulatory DNA element. In some embodiments, the regulatory DNA element is an enhancer or a promoter. In some embodiments, the target site is within 1000 base pairs (bp) of the transcription start site of the gene. In some embodiments, the target site is within 500 base pairs (bp) of the transcription start site of the gene. In any embodiment herein, the target site is selected from: (a) a target site of CD5 having a sequence shown in any of SEQ ID NO: 1-3, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (b) a target site of KDM1A having a sequence shown in any of SEQ ID NO: 4-6, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (c) a target site of CBLB having a sequence shown in any of SEQ ID NO: 10-12, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (d) a target site of DGKZ having a sequence shown in any of SEQ ID NO: 13-15, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (e) a target site of MYB having a sequence shown in any of SEQ ID NO: 16-18, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (f) a target site of RASA2 having a sequence shown in any of SEQ ID NO: 19-21, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (g) a target site of ELOB having a sequence shown in any of SEQ ID NO: 22-24, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (h) a target site of GATA3 having a sequence shown in any of SEQ ID NO: 25-27, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (i) a target site of CISH having a sequence shown in any of SEQ ID NO: 28-30, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (j) a target site of PRDM1 having a sequence shown in any of SEQ ID NO: 31-33, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing;(k) Target sites of MED12, having the sequences shown in any one of SEQ ID NO: 80 - 90, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (l) Target sites of CCNC, having the sequences shown in any one of SEQ ID NO: 102 - 112, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (m) Target sites of FAS, having the sequences shown in any one of SEQ ID NO: 200 - 205 and 292 - 295, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (n) Target sites of Fli1, having the sequences shown in any one of SEQ ID NO: 206 - 211, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; and (o) Target sites of TGFBR2, having the sequences shown in any one of SEQ ID NO: 300 - 302 and 306 - 308, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing.;

[0056] In any embodiment of the present disclosure, the target site is selected from: (a) a target site of CD5 having a sequence shown in any one of SEQ ID NOs: 1-3 or its complementary sequence; (b) a target site of KDM1A having a sequence shown in any one of SEQ ID NOs: 4-6 or its complementary sequence; (c) a target site of CBLB having a sequence shown in any one of SEQ ID NOs: 10-12 or its complementary sequence; (d) a target site of DGKZ having a sequence shown in any one of SEQ ID NOs: 13-15 or the complementary sequence of any one of the foregoing; (e) a target site of MYB having a sequence shown in any one of SEQ ID NOs: 16-18 or the complementary sequence of any one of the foregoing; (f) a target site of RASA2 having a sequence shown in any one of SEQ ID NOs: 19-21 or the complementary sequence of any one of the foregoing; (g) a target site of ELOB having a sequence shown in any one of SEQ ID NOs: 22-24 or the complementary sequence of any one of the foregoing; (h) a target site of GATA3 having a sequence shown in any one of SEQ ID NOs: 25-27 or the complementary sequence of any one of the foregoing; (i) a target site of CISH having a sequence shown in any one of SEQ ID NOs: 28-30 or the complementary sequence of any one of the foregoing; (j) a target site of PRDM1 having a sequence shown in any one of SEQ ID NOs: 31-33 or the complementary sequence of any one of the foregoing; (k) a target site of MED12 having a sequence shown in any one of SEQ ID NOs: 80-90 or the complementary sequence of any one of the foregoing; (l) a target site of CCNC having a sequence shown in any one of SEQ ID NOs: 102-112 or the complementary sequence of any one of the foregoing; (m) a target site of FAS having a sequence shown in any one of SEQ ID NOs: 200-205 and 292-295 or the complementary sequence of any one of the foregoing; (n) a target site of Fli1 having a sequence shown in any one of SEQ ID NOs: 206-211 or the complementary sequence of any one of the foregoing; and (o) a target site of TGFBR2 having a sequence shown in any one of SEQ ID NOs: 300-302 and 306-308 or the complementary sequence of any one of the foregoing.

[0057] In any embodiment of the present disclosure, the target site is selected from: (a) the target site of CBLB having the sequence shown in SEQ ID NO: 11 or the complementary sequence of any one of the foregoing; (b) the target site of MYB having the sequence shown in SEQ ID NO: 18 or the complementary sequence of any one of the foregoing; (c) the target site of RASA2 having the sequence shown in SEQ ID NO: 19 or the complementary sequence of any one of the foregoing; (d) the target site of CISH having the sequence shown in SEQ ID NO: 28 or the complementary sequence of any one of the foregoing; (e) the target site of PRDM1 having the sequence shown in SEQ ID NO: 33 or the complementary sequence of any one of the foregoing; and (f) the target site of MED12 having the sequence shown in SEQ ID NO: 81 or the complementary sequence of any one of the foregoing. In any embodiment of the present disclosure, the gRNA is selected from: (a) a gRNA targeting the target site of CD5 and comprising a gRNA spacer sequence containing the sequence shown in any one of SEQ ID NOs: 35-37 or at least 14 consecutive nucleotides thereof; (b) a gRNA targeting the target site of KDM1A and comprising a gRNA spacer sequence containing the sequence shown in any one of SEQ ID NOs: 38-40 or at least 14 consecutive nucleotides thereof; (c) a gRNA targeting the target site of CBLB and comprising a gRNA spacer sequence containing the sequence shown in any one of SEQ ID NOs: 44-46 or at least 14 consecutive nucleotides thereof; (d) a gRNA targeting the target site of DGKZ and comprising a gRNA spacer sequence containing the sequence shown in any one of SEQ ID NOs: 47-49 or at least 14 consecutive nucleotides thereof; (e) a gRNA targeting the target site of MYB and comprising a gRNA spacer sequence containing the sequence shown in any one of SEQ ID NOs: 50-52 or at least 14 consecutive nucleotides thereof; (f) a gRNA targeting the target site of RASA2 and comprising a gRNA spacer sequence containing the sequence shown in any one of SEQ ID NOs: 53-55 or at least 14 consecutive nucleotides thereof; (g) a gRNA targeting the target site of ELOB and comprising a gRNA spacer sequence containing the sequence shown in any one of SEQ ID NOs: 56-58 or at least 14 consecutive nucleotides thereof; (h) a gRNA targeting the target site of GATA3 and comprising a gRNA spacer sequence containing the sequence shown in any one of SEQ ID NOs: 59-61 or at least 14 consecutive nucleotides thereof; (i) a gRNA targeting the target site of CISH and comprising a gRNA spacer sequence containing the sequence shown in any one of SEQ ID NOs: 62-64 or at least 14 consecutive nucleotides thereof;(j) A gRNA targeting the target site of PRDM1 and comprising a gRNA spacer sequence containing the sequence shown in any of SEQ ID NOs: 65 - 67 or at least 14 consecutive nt thereof; (k) A gRNA targeting the target site of MED12 and comprising a gRNA spacer sequence containing the sequence shown in any of SEQ ID NOs: 91 - 101 or at least 14 consecutive nt thereof; (l) A gRNA targeting the target site of CCNC and comprising a gRNA spacer sequence containing the sequence shown in any of SEQ ID NOs: 113 - 123 or at least 14 consecutive nt thereof; (m) A gRNA targeting the target site of FAS and comprising a gRNA spacer sequence containing the sequence shown in any of SEQ ID NOs: 212 - 217 and 296 - 299 or at least 14 consecutive nt thereof; (n) A gRNA targeting the target site of Fli1 and comprising a gRNA spacer sequence containing the sequence shown in any of SEQ ID NOs: 218 - 223 or at least 14 consecutive nt thereof; and (o) A gRNA targeting the target site of TGFBR2 and comprising a gRNA spacer sequence containing the sequence shown in any of SEQ ID NOs: 303 - 305 and 309 - 311 or at least 14 consecutive nt thereof.;

[0058] In any embodiment of the present disclosure, the gRNA is selected from: (a) a gRNA that targets a target site of CD5 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 35-37; (b) a gRNA that targets a target site of KDM1A and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 38-40; (c) a gRNA that targets a target site of CBLB and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 44-46; (d) a gRNA that targets a target site of DGKZ and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 47-49; (e) a gRNA that targets a target site of MYB and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 50-52; (f) a gRNA that targets a target site of RASA2 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 53-55; (g) a gRNA that targets a target site of ELOB and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 56-58; (h) a gRNA that targets a target site of GATA3 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 59-61; (i) a gRNA that targets a target site of CISH and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 62-64; (j) a gRNA that targets a target site of PRDM1 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 65-67; (k) a gRNA that targets a target site of MED12 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 91-101; (l) a gRNA that targets a target site of CCNC and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 113-123; (m) a gRNA that targets a target site of FAS and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 212-217 and 296-299; (n) a gRNA that targets a target site of Fli1 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 218-223; and (o) a gRNA that targets a target site of TGFBR2 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 303-305 and 309-311.

[0059] In any embodiment herein, the gRNA is selected from: (a) a gRNA targeting a target site of CBLB and comprising the gRNA spacer sequence shown in SEQ ID NO: 45; (b) a gRNA targeting a target site of MYB and comprising the gRNA spacer sequence shown in SEQ ID NO: 52; (c) a gRNA targeting a target site of RASA2 and comprising the gRNA spacer sequence shown in SEQ ID NO: 53; (d) a gRNA targeting a target site of CISH and comprising the gRNA spacer sequence shown in SEQ ID NO: 62; (e) a gRNA targeting a target site of PRDM1 and comprising the gRNA spacer sequence shown in SEQ ID NO: 67; and (f) a gRNA targeting a target site of MED12 and comprising the gRNA spacer sequence shown in SEQ ID NO: 91.

[0060] In any embodiment herein, the gRNA comprises a spacer sequence having a length between 14 nt and 24 nt or between 16 nt and 22 nt. In any embodiment herein, the gRNA comprises a spacer sequence having a length of 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt.

[0061] In any embodiment herein, the gRNA further comprises the scaffold sequence shown in SEQ ID NO: 69.

[0062] Also provided herein is a guide RNA (gRNA) that targets a target site of a gene selected from the group consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1. In some embodiments, the target site of the gene is in the gene or its regulatory DNA element. In some embodiments, the regulatory DNA element is an enhancer or a promoter.

[0063] In any embodiment herein, the target site is within 1000 base pairs (bp) of the transcription start site of the gene. In any embodiment herein, the target site is within 500 base pairs (bp) of the transcription start site of the gene.

[0064] In any embodiment of the present disclosure, the target site is selected from: (a) a target site of VAV1 having a sequence shown in any of SEQ ID NOs: 7-9, 156, and 170, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (b) a target site of IL2 having a sequence shown in SEQ ID NO: 78, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (c) a target site of BATF having a sequence shown in any of SEQ ID NOs: 172-174, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (d) a target site of CD28 having a sequence shown in any of SEQ ID NOs: 144-146 and 189-191, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (e) a target site of EOMES having a sequence shown in any of SEQ ID NOs: 147-149, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (f) a target site of IRF4 having a sequence shown in any of SEQ ID NOs: 175-177, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (g) a target site of LAT having a sequence shown in any of SEQ ID NOs: 184-186, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; (h) a target site of LCP2 having a sequence shown in any of SEQ ID NOs: 150-152 and 187-188, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing; and (i) a target site of TBX21 having a sequence shown in any of SEQ ID NOs: 153-155, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing.

[0065] In any embodiment of the present disclosure, the target site is selected from: (a) the target site of VAV1, which has the sequence shown in any one of SEQ ID NOs: 7-9, 156, and 170 or the complementary sequence of any of the foregoing; (b) the target site of IL2, which has the sequence shown in SEQ ID NO: 78 or any complementary sequence of the foregoing; (c) the target site of BATF, which has the sequence shown in any one of SEQ ID NOs: 172-174 or the complementary sequence of any of the foregoing; (d) the target site of CD28, which has the sequence shown in any one of SEQ ID NOs: 144-146 and 189-191 or the complementary sequence of any of the foregoing; (e) the target site of EOMES, which has the sequence shown in any one of SEQ ID NOs: 147-149 or the complementary sequence of any of the foregoing; (f) the target site of IRF4, which has the sequence shown in any one of SEQ ID NOs: 175-177 or the complementary sequence of any of the foregoing; (g) the target site of LAT, which has the sequence shown in any one of SEQ ID NOs: 184-186 or the complementary sequence of any of the foregoing; (h) the target site of LCP2, which has the sequence shown in any one of SEQ ID NOs: 150-152 and 187-188 or the complementary sequence of any of the foregoing; and (i) the target site of TBX21, which has the sequence shown in any one of SEQ ID NOs: 153-155 or the complementary sequence of any of the foregoing.

[0066] In any embodiment of the present disclosure, the target site is selected from: (a) the target site of IL-2, which has the sequence shown in SEQ ID NO: 78 or any complementary sequence of the foregoing; (b) the target site of EOMES, which has the sequence shown in SEQ ID NO: 149 or any complementary sequence of the foregoing; (c) the target site of LCP2, which has the sequence shown in SEQ ID NO: 151 or any complementary sequence of the foregoing; and (d) the target site of TBX21, which has the sequence shown in SEQ ID NO: 155 or any complementary sequence of the foregoing.

[0067] In any embodiment of the present text, the gRNA is selected from: (a) a gRNA that targets a target site of VAV1 and contains a gRNA spacer sequence that contains the sequence shown in any of SEQ ID NOs: 41-43, 169, and 171 or a continuous portion of at least 14 nt thereof; (b) a gRNA that targets a target site of IL2 and contains a gRNA spacer sequence that contains the sequence shown in SEQ ID NO: 79 or a continuous portion of at least 14 nt thereof; (c) a gRNA that targets a target site of BATF and contains a gRNA spacer sequence that contains the sequence shown in any of SEQ ID NOs: 178-180 or a continuous portion of at least 14 nt thereof; (d) a gRNA that targets a target site of CD28 and contains a gRNA spacer sequence that contains the sequence shown in any of SEQ ID NOs: 157-159 and 197-199 or a continuous portion of at least 14 nt thereof; (e) a gRNA that targets a target site of EOMES and contains a gRNA spacer sequence that contains the sequence shown in any of SEQ ID NOs: 160-162 or a continuous portion of at least 14 nt thereof; (f) a gRNA that targets a target site of IRF4 and contains a gRNA spacer sequence that contains the sequence shown in any of SEQ ID NOs: 181-183 or a continuous portion of at least 14 nt thereof; (g) a gRNA that targets a target site of LAT and contains a gRNA spacer sequence that contains the sequence shown in any of SEQ ID NOs: 192-194 or a continuous portion of at least 14 nt thereof; (h) a gRNA that targets a target site of LCP2 and contains a gRNA spacer sequence that contains the sequence shown in any of SEQ ID NOs: 163-165 and 195-196 or a continuous portion of at least 14 nt thereof; and (i) a gRNA that targets a target site of TBX21 and contains a gRNA spacer sequence that contains the sequence shown in any of SEQ ID NOs: 166-168 or a continuous portion of at least 14 nt thereof.

[0068] In any embodiment herein, the gRNA is selected from: (a) a gRNA targeting a target site of VAV1 and comprising the gRNA spacer sequence shown in any of SEQ ID NOs: 41-43, 169, and 171; (b) a gRNA targeting a target site of IL2 and comprising the gRNA spacer sequence shown in SEQ ID NO: 79; (c) a gRNA targeting a target site of BATF and comprising the gRNA spacer sequence shown in any of SEQ ID NOs: 178-180; (d) a gRNA targeting a target site of CD28 and comprising the gRNA spacer sequence shown in any of SEQ ID NOs: 157-159 and 197-199; (e) a gRNA targeting a target site of EOMES and comprising the gRNA spacer sequence shown in any of SEQ ID NOs: 160-162; (f) a gRNA targeting a target site of IRF4 and comprising the gRNA spacer sequence shown in any of SEQ ID NOs: 181-183; (g) a gRNA targeting a target site of LAT and comprising the gRNA spacer sequence shown in any of SEQ ID NOs: 192-194; (h) a gRNA targeting a target site of LCP2 and comprising the gRNA spacer sequence shown in any of SEQ ID NOs: 163-165 and 195-196; and (i) a gRNA targeting a target site of TBX21 and comprising the gRNA spacer sequence shown in any of SEQ ID NOs: 166-168.

[0069] In any embodiment herein, the gRNA is selected from: (a) a gRNA targeting a target site of IL-2 and comprising the gRNA spacer sequence shown in SEQ ID NO: 79; (b) a gRNA targeting a target site of EOMES and comprising the gRNA spacer sequence shown in SEQ ID NO: 162; (c) a gRNA targeting a target site of LCP2 and comprising the gRNA spacer sequence shown in SEQ ID NO: 164; and (d) a gRNA targeting a target site of TBX21 and comprising the gRNA spacer sequence shown in SEQ ID NO: 168.

[0070] In any embodiment herein, the gRNA comprises a spacer sequence having a length between 14 nt and 24 nt or between 16 nt and 22 nt. In some embodiments, the gRNA comprises a spacer sequence having a length of 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt.

[0071] In any embodiment herein, the gRNA further comprises the scaffold sequence shown in SEQ ID NO: 69.

[0072] The present disclosure also provides a combination of gRNAs, comprising: two or more gRNAs, each selected from gRNAs targeting target sites of genes selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2, or two or more gRNAs, each selected from gRNAs targeting target sites of genes selected from the group consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1. In some embodiments, the two gRNAs comprise the spacer sequences shown in SEQ ID NO:92 and 45; SEQ ID NO:92 and 62; SEQ ID NO:45 and 52; and SEQ ID NO:45 and 53; SEQ ID NO:92 and 304; SEQ ID NO:92, 304, or 62. In some embodiments, the two gRNAs comprise the spacer sequences shown in SEQ ID NO:79 and 164; SEQ ID NO:79 and 168; SEQ ID NO:79 and 162.

[0073] The present disclosure also provides a Cas guide RNA (gRNA) combination, comprising: (a) a clustered regularly interspaced short palindromic repeat (Cas) protein or a variant thereof; and (b) at least one gRNA as described herein. In some embodiments, the at least one gRNA targets a target site of a gene selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2.

[0074] The present disclosure also provides a Cas guide RNA (gRNA) combination, comprising: (a) a clustered regularly interspaced short palindromic repeat (Cas) protein or a variant thereof; and (b) at least one gRNA. In some embodiments, the at least one gRNA targets a target site of a gene selected from the group consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1.

[0075] In any embodiment of the present disclosure, the Cas protein or its variant is a deactivated (dCas) protein. In some embodiments, the dCas protein lacks nuclease activity. In some embodiments, the dCas protein is a dCas9 protein. In some embodiments, the dCas protein is a dCas12 protein. In some embodiments, the dCas9 protein is a Staphylococcus aureus dCas9 (dSaCas9) protein. In some embodiments, the dSaCas9 comprises at least one amino acid mutation selected from D10A and N580A, with reference to the position numbering of SEQ ID NO: 124. In some embodiments, the dSaCas9 protein comprises the sequence shown in SEQ ID NO: 125, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the dSaCas9 is as shown in SEQ ID NO: 125. In some embodiments, the dCas9 protein is a Streptococcus pyogenes dCas9 (dSpCas9) protein. In some embodiments, the dSpCas9 protein comprises at least one amino acid mutation selected from D10A and H840A, with reference to the position numbering of SEQ ID NO: 126. In some embodiments, the dSpCas9 protein comprises the sequence shown in SEQ ID NO: 127, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. In some embodiments, the dSpCas9 is as shown in SEQ ID NO: 127.

[0076] The present disclosure also provides a polynucleotide encoding an epigenetic modification DNA targeting system described herein.

[0077] The present disclosure also provides a polynucleotide encoding at least one DNA targeting module of an epigenetic modification DNA targeting system described herein.

[0078] The present disclosure also provides a polynucleotide encoding a fusion protein and at least one gRNA of an epigenetic modification DNA targeting system described herein.

[0079] The present disclosure also provides a polynucleotide encoding a gRNA described herein. In some embodiments, the polynucleotide encodes a combination of gRNAs described herein.

[0080] The present disclosure also provides a polynucleotide encoding a Cas-gRNA combination described herein.

[0081] The present disclosure also provides two or more polynucleotides that together encode: an epigenetically modified DNA targeting system described herein, at least one DNA targeting module of the epigenetically modified DNA targeting system described herein, a fusion protein of the epigenetically modified DNA targeting system described herein and at least one gRNA, a combination of gRNAs described herein, and / or a Cas-gRNA combination described herein.

[0082] The present disclosure also provides a polynucleotide gRNA combination that includes: a) a polynucleotide encoding a fusion protein of at least one DNA targeting module of the epigenetically modified DNA targeting system described herein for repressing transcription of one or more genes, and one or more gRNAs selected from the gRNAs described herein; or b) a polynucleotide encoding a fusion protein of at least one DNA targeting module of the epigenetically modified DNA targeting system described herein for increasing transcription of one or more genes, and one or more gRNAs selected from the gRNAs described herein. In some embodiments, the polynucleotide encoding the fusion protein is mRNA.

[0083] The present disclosure also provides a vector that includes a polynucleotide described herein.

[0084] The present disclosure also provides a vector that includes two or more polynucleotides described herein.

[0085] The present disclosure also provides a vector that includes a polynucleotide gRNA combination described herein.

[0086] The present disclosure also provides a vector that includes a polynucleotide gRNA combination described herein.

[0087] In any embodiment herein, the vector is a viral vector. In some embodiments, the vector is an adeno-associated virus (AAV) vector. In some embodiments, the vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9.

[0088] In any embodiment herein, the vector is a non-viral vector. In some embodiments, the non-viral vector is selected from: lipid nanoparticles, liposomes, exosomes, or cell-penetrating peptides. In some embodiments, the non-viral vector is lipid nanoparticles.

[0089] In any embodiment herein, the vector exhibits immunocyte tropism, optionally wherein the vector exhibits T cell tropism.

[0090] The present disclosure also provides a modified T cell comprising a DNA targeting system described herein, a combination of DNA targeting systems described herein, a gRNA described herein, a combination of gRNAs described herein, a CRISPR Cas-gRNA combination described herein, a polynucleotide described herein, two or more polynucleotides described herein, or a polynucleotide gRNA combination described herein.

[0091] The present disclosure also provides a modified T cell comprising an epigenetic or phenotypic modification resulting from exposure to a DNA targeting system described herein, a combination of DNA targetings described herein, a gRNA described herein, a combination of gRNAs described herein, a CRISPR Cas-gRNA combination described herein, a polynucleotide described herein, two or more polynucleotides described herein, a polynucleotide gRNA combination described herein, or a vector described herein.

[0092] In any embodiment herein, the modified T cell is derived from a cell from a subject. In any embodiment herein, the modified T cell is derived from a primary T cell. In any embodiment herein, the modified T cell is derived from a T cell progenitor, a pluripotent stem cell, or an induced pluripotent stem cell. In any embodiment herein, the modified T cell further comprises an engineered T cell receptor (eTCR) or a chimeric antigen receptor (CAR).

[0093] The present disclosure also provides a method of repressing transcription of one or more genes in a T cell, the method comprising introducing into the T cell a DNA targeting system described herein, a combination of DNA targeting systems described herein, a gRNA described herein, a combination of gRNAs described herein, a Cas-gRNA combination described herein, a polynucleotide described herein, two or more polynucleotides described herein, a polynucleotide gRNA combination described herein, or a vector described herein. In some embodiments, repression of transcription of the one or more genes promotes an increase in T cell effector function upon T cell stimulation relative to T cell effector function in the absence of T cell stimulation.

[0094] The present invention also provides a method for increasing the transcription of one or more genes in T cells, the method comprising introducing into the T cells the DNA targeting system described herein, a combination of the DNA targeting systems described herein, the gRNA described herein, a combination of the gRNAs described herein, the Cas-gRNA combination described herein, the polynucleotide described herein, two or more polynucleotides described herein, the polynucleotide gRNA combination described herein, or the vector described herein. In some embodiments, relative to the effector function of T cells in the absence of T cell stimulation, increasing the transcription of the one or more genes promotes an increase in the effector function of T cells upon T cell stimulation.

[0095] The present invention also provides a method for enhancing the effector function of T cells, the method comprising introducing into the T cells the DNA targeting system described herein, a combination of the DNA targeting systems described herein, the gRNA described herein, a combination described herein, the CRISPR Cas-gRNA combination described herein, the polynucleotide described herein, two or more polynucleotides described herein, the polynucleotide gRNA combination described herein, or the vector described herein.

[0096] In any embodiment herein, the effector function of the T cells is increased as compared to T cells that have not been introduced with the DNA targeting system described herein, a combination of the DNA targeting systems described herein, the gRNA described herein, a combination of the gRNAs described herein, the CRISPR Cas-gRNA combination described herein, the polynucleotide described herein, two or more polynucleotides described herein, the polynucleotide gRNA combination described herein, or the vector described herein.

[0097] In any embodiment herein, the T cells are T cells in a subject and the method is performed in vivo. In any embodiment herein, the T cells are T cells from a subject, or cells derived from a subject, and the method is performed ex vivo. In any embodiment herein, the T cells are primary T cells. In some embodiments herein, the T cells are derived from T cell progenitors, pluripotent stem cells, or induced pluripotent stem cells.

[0098] In any embodiment herein, the introduction is by transient delivery into the T cells. In some embodiments, the transient delivery comprises electroporation, transfection, or transduction.

[0099] In any embodiment herein, the DNA targeting system according to any one of claims 1-95, the combination of DNA targeting systems described herein, the gRNA described herein, the combination of gRNAs described herein, the CRISPR Cas-gRNA described herein, the polynucleotide described herein, two or more polynucleotides described herein, the polynucleotide gRNA combination described herein, or the vector described herein are transiently expressed and / or transiently present in T cells.

[0100] In any embodiment herein, the introduction represses the transcription of one or more genes in the T cells, the genes selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2.

[0101] In any embodiment herein, the introduction increases the transcription of one or more genes in the T cells, the genes selected from the group consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1.

[0102] Also provided herein are modified T cells produced by the methods described herein.

[0103] Also provided herein is a method of treating a disease or disorder in a subject, the method comprising administering to the subject the modified T cells described herein.

[0104] Also provided herein is a method of increasing T cell persistence in the T cells of a subject, the method comprising administering to the subject or its T cells the DNA targeting system described herein, the combination of DNA targeting systems described herein, the gRNA described herein, the combination of gRNAs described herein, the CRISPR Cas-gRNA combination described herein, the polynucleotide described herein, two or more polynucleotides described herein, the polynucleotide gRNA combination described herein, or the vector described herein. In some embodiments, the T cells are from adoptive T cell therapy for treating a disease or disorder in a subject. In some embodiments, the T cell therapy comprises T cells expressing a recombinant receptor specific for a target antigen. In some embodiments, the administration is before, simultaneous with, or after the administration of the adoptive T cell therapy. In some embodiments, the administration is at a time after the adoptive T cell therapy is administered in the subject and after the number or effector function of the T cells of the adoptive T cell therapy in the subject has decreased or is suspected of decreasing.

[0105] The present disclosure also provides a method of treating a disease or disorder in a subject, the method comprising administering to the subject: a T cell therapy comprising cells expressing a recombinant receptor specific for a target antigen associated with the disease or disorder; and a DNA targeting system described herein, a combination of DNA targeting systems described herein, a gRNA described herein, a combination of gRNAs described herein, a CRISPR Cas-gRNA combination described herein, a polynucleotide described herein, two or more polynucleotides described herein, a polynucleotide gRNA combination described herein, or a vector described herein. In some embodiments, the recombinant receptor is an engineered T cell receptor (eTCR) or a chimeric antigen receptor (CAR).

[0106] In any embodiment herein, the target antigen is a tumor antigen. In some embodiments, the disease or disorder is cancer. In some embodiments, the cancer is a hematological malignancy or a solid tumor. In any embodiment herein, the disease or disorder is an autoimmune disorder and / or an inflammatory disorder.

[0107] In any embodiment herein, the administration results in the transient delivery of any of the following into the T cells: the DNA targeting system, the combination of DNA targeting systems, the gRNA, the combination of gRNAs, the CRISPR Cas-gRNA combination, the polynucleotide, the two or more polynucleotides, the polynucleotide gRNA combination, or the vector.

[0108] In any embodiment herein, the administration represses the transcription of one or more genes in the T cells, the genes selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2.

[0109] In any embodiment herein, the administration represses the transcription of one or more genes in the T cells, the genes selected from the group consisting of CBLB, CISH, MED12, MYB, PRDM1, and RASA2.

[0110] In any embodiment herein, the administration increases the transcription of one or more genes in the T cells, the genes selected from the group consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1.

[0111] In any embodiment of the present disclosure, the administration increases the transcription of one or more genes in the T cells, and the genes are selected from the group consisting of EOMES, IL-2, LCP2, and TBX21. Brief Description of the Drawings

[0112] Figure 1A An exemplary workflow of a transient CRISPR screen is shown. Cells are transfected with a gRNA library. After enriching the transfected cells, an epigenome editor (such as dCas fused to an effector domain (such as a transcriptional repressor, transcriptional activator, etc.)) is transiently transfected into the cells, such as by electroporation. Then, the cells are screened for the desired phenotype. Figure 1B An exemplary plot showing the expression of IL-2 and IFNg in cells as evaluated by flow cytometry is shown, where the boxes represent populations sorted according to different phenotypes.

[0113] Figure 2 An exemplary CRISPRi screen plot of gRNAs and genes that regulate IL-2 expression, IFNg expression, and / or proliferation is shown. In particular, the figure shows gRNAs that affect IL-2 expression. The dots represent individual gRNAs. The left gRNAs are gRNAs that target genes whose repression results in a decrease in IL-2 expression, while the right gRNAs are gRNAs that target genes whose repression results in an increase in IL-2 expression. The dots represent individual gRNAs. The x-axis represents the log2 fold change in gRNA abundance in IL-2+ sorted cells compared to unsorted cells. The y-axis represents significance (-log10 adjusted p-value).

[0114] Figure 3 A plot of an exemplary CRISPRi screen of gRNAs and genes that regulate IL-2 expression, IFNg expression, and / or proliferation is shown. In particular, the figure shows gRNAs that affect proliferation. The dots represent individual gRNAs. The left plot gRNAs are gRNAs that target genes whose repression results in a decrease in proliferation, while the right plot gRNAs are gRNAs that target genes whose repression results in an increase in proliferation. The x-axis represents the log2 fold change in gRNA abundance in unsorted cells 6 days after electroporation with an epigenome editor for transient expression of transcriptional repression compared to the cells before electroporation. The y-axis represents significance (-log10 adjusted p-value).

[0115] Figure 4 The number of gRNA hits in a CRISPRi screen of gRNAs and genes that regulate T cell phenotypes is shown under specified conditions at day 9, day 12, or both day 9 and day 12.

[0116] Figure 5Plot showing an exemplary CRISPRa screen of gRNAs and genes that modulate IL-2 expression, IFNg expression, and / or proliferation. In particular, the plot shows gRNAs that affect IL-2 expression. The dots represent individual gRNAs. The left-side gRNAs are those targeting genes whose activation results in decreased IL-2 expression, while the right-side gRNAs are those targeting genes whose activation results in increased IL-2 expression. The x-axis represents the log2 fold change in gRNA abundance in IL-2+ sorted cells versus unsorted cells. The y-axis represents significance (-log10 adjusted p-value).

[0117] Figure 6A Shows the percentage knockdown (KD%) of MED12 expression, as assessed by RT-qPCR, after transient delivery of dSpCas9-KRAB and the indicated gRNAs targeting MED12 or non-targeting gRNAs (NT1, NT2), or dSpCas9-KRAB alone. Results are shown at 48 hours and 6 days post-transfection, and for T cells from two different donors.

[0118] Figure 6B Shows the expression of MED12, as assessed by RT-qPCR, after transient delivery of dSpCas9-KRAB and the indicated gRNAs targeting MED12 in T cells (left) and CAR T cells (right). Control conditions for the left panel include cells delivered with dSpCas9-KRAB and non-targeting gRNAs (NT1, NT2) and dSpCas9-KRAB alone. Control conditions for the right panel include cells not expressing CAR (mock) and cells not treated with the DNA targeting system. Results are shown at 48 hours (left), 72 hours, and 7 days post-transfection. Results are normalized to the dSpCas9-KRAB alone condition (left panel) or the mock condition (right panel).

[0119] Figure 6C Shows the percentage knockdown (KD%) of CCNC expression, as assessed by RT-qPCR, after transient delivery of dSpCas9-KRAB and the indicated gRNAs targeting CCNC or non-targeting gRNAs (NT1, NT2), or dSpCas9-KRAB alone. Results are shown at 48 hours and 6 days post-transfection, and for T cells from two different donors.

[0120] Figure 6DShows the percentage of knockdown (KD%) of FAS expression, as assessed by intracellular cytokine staining (IC) and flow cytometry, after transient delivery of dSpCas9-KRAB and the indicated FAS-targeting gRNA, dSpCas9-KRAB alone, or mock delivery. Results are shown at 72 hours and 7 days post-transfection, and for T cells from two different donors. The upper panel shows exemplary flow cytometry plots assessing FAS expression in CD3+ T cells after delivery of dSpCas9-KRAB alone or dSpCas9-KRAB and the FAS-targeting gRNA.

[0121] Figure 7A Shows flow cytometry plots assessing IL-2 expression in CD3+ Her2 CAR T cells after stimulation and transient delivery of dSpCas9-2xVP64 and the IL-2-targeting gRNA (IL-2_1, targeting SEQ ID NO:78). Results are shown for CAR T cells from 2 different donors. CAR T cells were stimulated with SKOV3 or 143B cells. Different control conditions exclude CAR, gRNA, or stimulation, as indicated.

[0122] Figure 7B Shows the expression of quantified IL-2 (IL-2+ cell %) in Her2 CAR T cells after stimulation and transient delivery of dSpCas9-2xVP64 and the IL-2-targeting gRNA (IL-2_1, targeting SEQ ID NO:78), as assessed by flow cytometry. Control conditions exclude CAR (mock transduction), gRNA, or stimulation, as indicated.

[0123] Figure 7C Shows IL-2 expression in CAR T cells after delivery of the DNA targeting system for IL2 activation. The left panel shows IL-2 expression in Her2 CAR T cells at 72 hours and 7 days post-transient delivery of the DNA targeting system comprising dSpCas9-2xVP64 and the IL-2-targeting gRNA (IL-2_1, targeting SEQ ID NO:78), as assessed by RT-qPCR. Control conditions include cells not expressing CAR (mock) or CAR T cells not delivered with the DNA targeting system (CAR only). Expression levels were normalized to mock control cells. The right panel shows IL-2 expression in control cells (CAR only) and CAR T cells delivered with the DNA targeting system for IL-2 activation after stimulation with tumor cells expressing the Her2 antigen, as assessed by ICS and flow cytometry.

[0124] Figures 8A - 8CShows flow cytometry plots for evaluating IL-2 ( Figure 8A ), IFNg ( Figure 8B ), or TNFa ( Figure 8C ) expression in CD3+ Her2 CAR T cells after stimulation and transient delivery of dSpCas9-2xVP64 and gRNA targeting VAV1 (VAV1_5, targeting SEQ ID NO: 170). Results from CAR T cells from 2 different donors are shown. CAR T cells were stimulated with SKOV3 or 143B cells. Different control conditions exclude CAR, gRNA, or stimulation, as indicated.

[0125] Figure 9A Shows the percentage of multifunctional cells (IL-2+ / IFNg+ / TNFa+ cells) in Her2 CAR T cells as evaluated by flow cytometry after stimulation and transient delivery of dSpCas9-2xVP64 and gRNA targeting IL-2 (IL-2_1, targeting SEQ ID NO: 78) or gRNA targeting VAV1 (VAV1_5, targeting SEQ ID NO: 170). Control conditions exclude CAR (mock transduction), gRNA, or stimulation, as indicated.

[0126] Figure 9B Shows the percentage of Her2 CAR T cells expressing IL-2 over several days after stimulation and transient delivery of dSpCas9-2xVP64 and gRNA targeting IL-2 (IL-2_1, targeting SEQ ID NO: 78) or gRNA targeting VAV1 (VAV1_5, targeting SEQ ID NO: 170). Figure 9C Shows flow cytometry plots for evaluating IL-2 expression in Her2 CAR T cells before and after stimulation and transient delivery of gRNA and effector system.

[0127] Figures 10A - 10B Shows flow cytometry plots and mean fluorescence intensity (MFI) for evaluating IL-2 and IFNg expression in CD4+ ( Figure 10A ) or CD8+ ( Figure 10B ) Her2 CAR T cells after stimulation and transient delivery of dSpCas9-2xVP64 and the indicated gRNA targeting CBLB or control non-targeting gRNA. Flow cytometry plots can be used to quantify the percentage of cells with a specific phenotype (such as IL-2+), and to quantify the mean fluorescence intensity (MFI), as shown below.

[0128] Figure 11AShows a heatmap representing the relative levels of intracellular cytokine expression in Her2 CAR T cells after stimulation and transient delivery of dSpCas9-2xVP64 and the specified gRNAs (as assessed by ICS and flow cytometry). Cytokine expression was quantified based on the percentage of Her2 CAR T cells with the specified phenotypes (such as CD4+ / IL-2+, CD4+ / IFNg+ / TNFa+) as assessed by flow cytometry, and log2 fold changes were calculated relative to a control condition (non-targeting_sp_1) using a non-targeting gRNA. As shown in the legend, the darker the color, the higher the corresponding cytokine expression. For all cytokine expression measurements, a cumulative score was made for each condition and ranked from low to high cytokine expression.

[0129] Figure 11B Shows exemplary results of a serial stimulation killing assay. Using the Incucyte automated tracking system, the growth of target cells expressing the antigen labeled with a fluorescent marker was quantified based on overall fluorescence. Target cells expressing the antigen were co-cultured with CAR T cells that transiently delivered a DNA targeting system for activating IL-2, CAR T cells that transiently delivered a DNA targeting system for repressing MED12, CAR T cells without a DNA targeting system (CAR only), or cells not expressing CAR (mock). Serial stimulations (shown as stimulation 1, stimulation 2, and stimulation 3) were performed by replacing the CAR T cells with fresh target cells at a CAR T cell:target cell ratio of 1:4.

[0130] Figure 11C Shows Figure 11B Quantification of the fold expansion (left) and IL-2 secretion (right) of CAR T cells and control cells after the second stimulation in the experiment shown in

[0131] Figure 12A Describes flow cytometry plots of intracellular cytokine staining (ICS) for IL-2 and IFN-g after transient transfection of T cells with only the control dSpCas9-2xVP64 effector (without a targeting gRNA) or gRNAs that independently target VAV1 (VAV1_5) or IL-2 (IL-2_1) bound to dSpCas9-2xVP64.

[0132] Figure 12B Describes flow cytometry plots of ICS for IL-2 and IFN-g after transient transfection of T cells with the dSpCas9-2xVP64 effector and gRNAs targeting both VAV1 and IL-2.

[0133] Figure 12CDescribes the percentage of IL-2+ cells (left panel) or IL-2+, IFNg+ and TNFα+ cells (right panel) after transfection of T cells from one of two donors with only the dSpCas9-2xVP64 effector (without the targeting gRNA), dSpCas9-2xVP64 binding to VAV1 or IL-2, or dSpCas9-2xVP64 binding to a gRNA that simultaneously targets VAV1 and IL-2.

[0134] Figures 13A - 13B Shows a heatmap representing the relative levels of intracellular cytokine expression, cytokine secretion, proliferation, and target cell killing activity in Her2 CAR T cells after stimulation and transient delivery of dSpCas9-2xVP64 or dSpCas9-KRAB and the gRNA, for Her2 CAR T cells derived from a first donor ( Figure 13A ) and a second donor ( Figure 13B ). As described in Example 5, multiple rounds of stimulation were performed and cells electroporated with different DNA targeting systems were evaluated based on multiple readouts of T cell effector function after stimulation, including intracellular cytokine expression (by ICS), cytokine secretion, proliferation, and target cell killing. Readouts of T cell effector function were quantified after the first, second, and / or third stimulation (shown as Stimulation 1, Stimulation 2, or Stimulation 3 in the figure). ICS was only performed after the first stimulation. Results are presented as Log2 fold change compared to control cells transfected with non-targeting RNA (NT). As shown in the legend, the darker the color, the greater the enhancement of the measured T cell effector function. Based on all measurements, a cumulative score was performed for each condition and ranked from low to high T cell effector function.

[0135] Figure 14 Shows a heatmap indicating the relative levels of intracellular cytokine expression in Her2 CAR T cells after stimulation and transient delivery of a combination of dSpCas9-2xVP64 and 2 gRNAs targeting the designated genes. When the targeted genes are the same, the same gRNA is delivered at twice the concentration. Cytokine expression was quantified based on the percentage of Her2 CAR T cells with the designated phenotype (such as CD8+ / IL-2+ / IFNg+ / TNFa+) as evaluated by ICS and flow cytometry, and the log2 fold change was calculated relative to the control condition of non-targeting gRNA (NT+NT). As shown in the legend, the darker the color, the higher the corresponding cytokine expression. Based on all cytokine expression measurements, a cumulative score was performed for each condition and ranked from low to high cytokine expression.

[0136] Figures 15A - 15BShows a heatmap indicating the relative levels of proliferation and cytokine expression in Her2CAR T cells after stimulation and transient delivery of dSpCas9-2xVP64 or dSpCas9-KRAB and a gRNA or combination thereof targeting the designated gene. Cytokine expression was quantified as the percentage of Her2 CAR T cells with the designated phenotype (e.g., CD4+ / IL-2+ / IFNg+ / TNFa+) as assessed by ICS and flow cytometry. Proliferation was quantified as the fold change in Her2CAR T cell number before and after stimulation as described herein. For each cytokine or proliferation phenotype value, the log2 fold change relative to a control condition of non-targeting gRNA ( Figure 15A is non-targeting_sp_1; Figure 15B is dCas only). As shown in the legend, the darker the color, the greater the corresponding increase in proliferation and cytokine expression. For all cytokine and proliferation measurements, each condition was cumulatively scored and ranked from lowest to highest cytokine expression and proliferation.

[0137] Figure 16 Shows the fold expansion (i.e., proliferation) of Her2 CAT cells after stimulation and transient delivery of dSpCas9-2xVP64 or dSpCas9-KRAB and the designated gRNA. Results are shown for Her2CAR T cells from two different donors after a first stimulation with antigen-expressing target cells. Negative control conditions included CAR T cells with dCas effector and no gRNA delivery, CAR T cells not delivered with the DNA targeting system (CAR only), and cells not expressing CAR (mock).

[0138] Figure 17 Shows the levels of the cytokines IL-2 or IFNg secreted by Her2CAR T cells after stimulation and transient delivery of dSpCas9-2xVP64 or dSpCas9-KRAB and the designated gRNA. Results are shown for Her2 CAR T cells from two different donors after a first stimulation with antigen-expressing target cells. Negative control conditions included CAR T cells with dCas effector and no gRNA delivery, CAR T cells not delivered with the DNA targeting system (CAR only), and cells not expressing CAR (mock).

[0139] Figure 18Shows the killing activity of the calculated killing index in Her2 CAR T cells after a third stimulation with target cells expressing the antigen, following the transient delivery of dSpCas9-2xVP64 or dSpCas9-KRAB and the indicated gRNAs. Negative control conditions include CAR T cells delivered with a dCas effector and no gRNA, CAR T cells not delivered with a DNA targeting system (only CAR), and cells not expressing CAR (mock).

[0140] Figures 19A - 19B Shows a heatmap indicating the relative levels of quantified T cell effector functions in Her2 CAR T cells after stimulation and transient delivery of dSpCas9-2xVP64 or dSpCas9-KRAB and the indicated gRNAs. Results are shown for cells from a first donor ( Figure 19A ) and a second donor ( Figure 19B ). The T cell effector functions evaluated include intracellular cytokine expression, secreted cytokine expression, proliferation, and killing, which were measured as described in Example 5. As shown in the figure, T cell effector functions were quantified after the first, second, and / or third stimulation with target cells expressing the antigen. For each quantified T cell effector function, the results are shown as the log2 fold change relative to the negative control condition (only CAR, i.e., CAR T cells not delivered with a DNA targeting system). As shown in the legend, the darker the color, the greater the measured enhancement of the T cell effector function. Based on all measurements, each condition was cumulatively scored and ranked from lowest to highest T cell effector function.

[0141] Figures 20A - 20C Shows the results from CAR T cells electroporated with gRNAs targeting the indicated genes and mRNA encoding dSpCas9-2xVP64 for activation or dSpCas9-KRAB for repression. For all results, experiments were performed using CAR T cells from two different donors, and the respective results for the two donors were plotted (triangles), with the mean indicated by a vertical line. Figure 20A Shows the fold expansion of CAR T following electroporation (production) of the DNA targeting system and after the first, second, and third rounds of stimulation with target cells expressing the Her2 antigen. Figure 20B Shows the CAR T cell target cell killing index after the first and second rounds of stimulation. Figure 20C Shows CAR T cell cytokine production, as evaluated by ICS and flow cytometry, on day 9 after electroporation with the DNA targeting system and after the first stimulation with target cells expressing the Her2 antigen.

[0142] Figures 21A - 21CShows the results from stimulated CAR T cells delivered with a DNA targeting system for repressing TGF-β receptor 2 (TGFBR2). The DNA targeting system includes a specified gRNA targeting TGFBR2 and dSpCas9-KRAB (SEQ ID NO: 332) or DNMT3A / L-XTEN80-dSpCas9-KRAB (SEQ ID NO: 337). Control cells include cells with only dSpCas9, cells not expressing CAR (mock), or CAR T cells not stimulated with antigen-expressing cells (CAR only). Figure 21A Shows the expression of TGFBR2 48 hours after electroporation with the DNA targeting system. Figure 21B Shows the IFNγ secreted by CAR T cells 24 hours after the second stimulation of cells expressing the Her2 antigen in the presence of 10 ng / mL TGFβ. Figure 21C Shows the fold expansion of stimulated CAR T cells after the second stimulation of cells expressing the Her2 antigen in the presence of 10 ng / mL TGFβ.

[0143] Figures 21D - 21G Shows the results from stimulated CAR T cells delivered with a DNA targeting system for repressing TGF-β receptor 2 (TGFBR2). CAR T cells were electroporated to transiently express a DNA targeting system consisting of dSpCas9-KRAB-DNMT3A / L and a specified gRNA targeting TGFBR2. Negative control cells were electroporated with dSpCas9-KRAB-DNMT3A / L and a non-targeting gRNA (non-targeting), not electroporated with the DNA targeting system (CAR only), or did not express CAR (mock). Figure 21D Shows the percentage of TGFBR2-negative cells at specified days after electroporation. Figure 21E Shows the fold expansion of CAR T cells after stimulation in anti-CD3 / anti-CD28-coated wells and exposure to a specified concentration of TGF-β, where the expansion was normalized to the condition of 0 ng / mL TGF-β. Figure 21F Shows the IFNγ produced by CAR T cells in response to exposure to 10 ng / mL TGF-β. The horizontal dashed line indicates the CAR only control condition. Figure 21G Shows the levels of cytokines secreted by stimulated CAR T cells after exposure to a specified concentration of TGF-β, where the levels of secreted cytokines were normalized to the condition of 0 ng / mL.

[0144] Figures 22A - 22D Shows the time course of the in vivo evaluation experiment of CAR T cells delivered with a DNA targeting system for IL-2 activation or for MED12 or CBLB repression (Figure 22A ) and results Figures 22B - 22D ) In vivo experiments were performed on immunodeficient mice implanted with tumor cells expressing the antigen (NCI-H1975) and injected with CAR T cells. Figure 22A Shows the timing and details of tumor implantation, CAR T cell injection, and tracking. Figure 22B Shows the experimental results from CAR T cells delivered using a DNA targeting system for IL2 activation (dSpCas9-2xVP64 and gRNA IL-2_1, targeting SEQ ID NO:78), including animal survival (left panel), tumor growth (middle panel), and levels of circulating CAR T cells (right panel). Figure 22C Shows the experimental results from CAR T cells delivered using a DNA targeting system for MED12 repression (dSpCas9-KRAB and gRNA MED12_2, targeting SEQ ID NO:81), including animal survival (left panel), tumor growth (middle panel), and levels of circulating CAR T cells (right panel). Figure 22D Shows the experimental results from CAR T cells delivered using a DNA targeting system for CBLB repression (dSpCas9-KRAB and gRNA CBLB_2, targeting SEQ ID NO:11), including tumor growth (left panel) and levels of circulating CAR T cells (right panel). Control mice were injected with CAR T cells without delivery of the DNA targeting system (CAR only), or with T cells not expressing CAR (mock T cells), or no T cells were injected (tumor only).

[0145] Figure 23 Shows MED12 expression on days 4 and 21 after electroporation with gRNA targeting MED12 (MED12_2, targeting SEQ ID NO:81) and mRNA encoding dSpCas9 (control; no transcriptional repressor effector domain), dSpCas9-KRAB (SEQ ID NO:332), or DNMT3A / L-XTEN80-dSpCas9-KRAB (SEQ ID NO:337), as assessed by RT-qPCR. Expression levels (expressed as fold change in expression) were normalized to the expression level in T cells electroporated with the same fusion protein but without non-targeting gRNA (dashed line at 1.0).

[0146] Figures 24A - 24FShows results from CAR T cells delivered with a DNA targeting system comprising the indicated gRNA targeting MED12 and dSpCas9-KRAB (SEQ ID NO:332) or DNMT3A / L-XTEN80-dSpCas9-KRAB (SEQ ID NO:337). Control cells include cells delivered with DNMT3A / L-XTEN80-dSpCas9-KRAB without gRNA delivery, cells delivered with DNMT3A / L-XTEN80-dSpCas9-KRAB and non-targeting gRNA delivery, and T cells that do not express CAR (mock). Figure 24A Shows MED12 expression on day 10 after electroporation with the DNA targeting system, as evaluated by qRT-PCR. Figure 24B Shows MED12 expression at days 2, 7, 10, and 14 after electroporation. Figure 24C Shows expression of CD25 in CAR T cells at days 3, 7, 10, and 14 after electroporation, as evaluated by flow cytometry. Figure 24D Shows secreted IFN-γ expression 24 hours after a second stimulation of CAR T cells with Her2-positive NCI-H1975 tumor cells, and Figure 24E Shows secreted IL-2 expression 24 hours after a second stimulation of CAR T cells with Her2-positive NCI-H1975 tumor cells. Figure 24F Shows proliferation after a second stimulation with antigen-expressing cells (fold expansion normalized to fold expansion of CAR-only control).

[0147] Figure 25 Shows the time course of exemplary dSpCas9 protein expression after electroporation of mRNA encoding the dSpCas9 protein. Results are shown for electroporation with dSpCas9 protein with non-targeting gRNA, gRNA targeting a gene in the cell, or no electroporation (control). Expression was evaluated based on the associated GFP tag, and results indicate the percentage of GFP+ cells as evaluated by flow cytometry at the indicated time points.

[0148] Figures 26A - 26B Shows the arrangement of fusion proteins for transcriptional repression for targeting ( Figure 26A ), and the experimental results from testing the ability of the fusion proteins to mediate maintenance of targeted gene repression ( Figure 26B ). Figure 26A Shows 4 different arrangements of the dSpCas9 fusion protein from the N-terminus to the C-terminus, the fusion protein comprising multiple domains selected from DNMT3A, DNMT3B, DNMT3L, and the KRAB or EZH2 domain (shown as [KRAB]).Figure 26B Shows MED12 expression at 4 days and 21 days in T cells electroporated with gRNA targeting MED12 (MED12_2, targeting SEQ ID NO:81) and mRNA encoding a fusion protein having each of the 4 different arrangements, the fusion protein comprising a repression domain selected from the following (shown as [KRAB]): the KRAB domain from KOX1 (KOX1(2 - 99)) (SEQ ID NO:355; the KRAB domain used in the dSpCas9 fusion protein of the previous example), the KRAB domain from KOX1 (KOX1(1 - 72)) (SEQ ID NO:356), the KRAB domain from ZIM3 (SEQ ID NO:357), the KRAB domain from ZNF324 (SEQ ID NO:358), and the EZH2 domain (SEQ ID NO:359). The mRNA encoding the fusion protein also includes an N-terminal FLAG epitope and a C-terminal P2A-mCherry domain to assess the expression of the fusion protein. For each experimental condition, MED12 expression was normalized to the expression level of T cells electroporated with the same fusion protein but with a non-targeting gRNA.

[0149] Figure 27A Shows the expression of the designated gene as assessed by RT-qPCR in CAR T cells 72 hours after transient delivery of a dSpCas9 fusion protein for repression (e.g., dSpCas9-KRAB-DNMT3A / L) and a gRNA targeting the designated gene and / or a control non-targeting gRNA (“NT guide”).

[0150] Figure 27B Shows IL-2 expression measured by ICS and flow cytometry. IL-2 expression was determined based on the percentage of live T cells that were IL-2+ after each designated stimulation and was quantified as the fold change relative to control cells delivered with a non-targeting gRNA.

[0151] Figure 27C Shows IL-2 expression before and after TGF-β treatment and transient delivery of a DNA targeting system for multiplexed repression of MED12 and TGFBR2.

[0152] Figures 28A - 28BShows the killing of tumor cells by Her2 CAR T cells over time, where the Her2 CAR T cells were delivered mRNA encoding the dSpCas9-2xVP64 effector fusion protein, SpCas9 IL-2 targeting gRNA, and SpCas9 TBX21 targeting gRNA or the dSpCas9-KRAB-DNMT3A / L effector fusion protein, SpCas9 MED12 targeting gRNA, and SpCas9 CBLB targeting gRNA.

[0153] Figure 29A and Figure 29B Shows the experimental results of in vivo evaluation of CAR T cells in a mouse tumor model, where the CAR T cells have been transiently delivered a single or multiplex DNA targeting system for IL-2, LCP2, EOMES, or TBX21 activation, and the CAR T cells were administered to mice at a low dose ( Figure 29A ) or a high dose ( Figure 29B ).

[0154] Figure 30A and Figure 30B Shows the experimental results of in vivo evaluation of CAR T cells in a mouse tumor model, where the CAR T cells have been transiently delivered a single or multiplex DNA targeting system for MED12, CBLB, and / or CISH repression, and the CAR T cells were administered to mice at a low dose ( Figure 30A ) or a high dose ( Figure 30B ). Detailed Description

[0155] The present disclosure provides an epigenetically modified DNA targeting system, wherein the DNA targeting system comprises at least one DNA targeting module, the DNA targeting module consisting of a fusion protein comprising: (a) a DNA binding domain capable of being targeted to a target site of one or more genes or their regulatory DNA elements; and (b) at least one effector domain capable of modulating the transcription of the one or more genes. In some embodiments, the target site is in a gene or its regulatory region, which gene or its regulatory region is found herein to be a negative regulator of T cell function following transient transcriptional regulation of the gene, such as a target site in CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and / or RASA2. In some such embodiments, the at least one effector domain is a transcriptional repressor domain, such as KRAB or DNMT3A / 3L or a combination thereof. In some embodiments, the target site is in a gene or its regulatory region, which gene or its regulatory region is found herein to be a positive regulator of T cell function following transient transcriptional regulation of the gene, such as a target site in BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and / or VAV1. In some such embodiments, the at least one effector domain is a transcriptional activator domain, such as VP64. In some embodiments, the target site is within 1000 base pairs of the transcription start site (TS) of any such gene, for example, the target site can be within the regulatory region (such as a promoter or enhancer) of any such gene.

[0156] In some embodiments, the DNA targeting system is a synthetic transcription factor capable of modulating gene transcription in a targeted manner (such as reducing (or downregulating) or increasing (or upregulating)). In some embodiments, the DNA binding domain of the DNA targeting system is a nuclease-inactivated clustered regularly interspaced short palindromic repeat (Cas) protein (such as a dCas protein) or a variant thereof complexed with a guide RNA (gRNA). Also provided is a gRNA for targeting a target site in a gene or its regulatory DNA element in T cells, wherein the gene is any of the genes provided herein, which are found to promote T cell function upon transient epigenetic regulation of gene transcription. Also provided is a CRISPR-Cas / gRNA combination consisting of a gRNA and a nuclease-inactivated Cas (such as dCas9). Also provided herein are polynucleotides encoding the DNA targeting system or the fusion protein of the DNA targeting system, as well as vectors and cells comprising the same. Also provided herein are methods of using the epigenetically modified DNA targeting system for modulating T cell transcription or phenotype or function, and the resulting modified cells.

[0157] In some embodiments, the DNA targeting system comprises at least one DNA targeting module, wherein each DNA targeting module of the system is a component of the DNA targeting system capable of independently targeting one target site of a provided target gene. In some embodiments, each DNA targeting module comprises: (a) a DNA binding domain capable of being targeted to the target site of the provided target gene; and (b) an effector domain capable of regulating (e.g., repressing or activating) the transcription of a gene.

[0158] In some embodiments, the DNA targeting system comprises a single DNA targeting module for targeting the repression of a single gene. In some embodiments, the gene is CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, or RASA2. In some embodiments, the gene is CBLB, CISH, MED12, MYB, PRDM1, or RASA2. In some embodiments, the DNA targeting module comprises: (a) a DNA binding domain capable of being targeted to the target site of a target gene or regulatory element; and (b) an effector domain capable of reducing the transcription of a gene.

[0159] In some embodiments, the DNA targeting system comprises multiple DNA targeting modules, wherein each DNA targeting module is for targeting the repression of a different gene. In some embodiments, the DNA targeting system is a multiplex DNA targeting system, i.e., targeting the target sites of more than one gene. Thus, the term DNA targeting system can include a multiplex epigenetically modified DNA targeting system containing more than one DNA targeting module. The multiplex epigenetically modified DNA targeting system comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12 DNA targeting modules. In some embodiments, the multiple DNA targeting modules target multiple target sites of one or more genes, such as 2, 3, 4, or more genes selected from CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2.

[0160] In some embodiments, the DNA targeting system comprises a single DNA targeting module for targeting and activating or increasing the expression of a single gene. In some embodiments, the gene is BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, or VAV1. In some embodiments, the gene is EOMES, IL-2, LCP2, or TBX21. In some embodiments, the DNA targeting module comprises (a) a DNA binding domain capable of being targeted to a target site of a target gene or regulatory element; (b) an effector domain capable of activating gene transcription.

[0161] In some embodiments, the DNA targeting system comprises multiple DNA targeting modules, wherein each DNA targeting module is for targeting and activating or increasing the expression of a different gene. In some embodiments, the DNA targeting system is a multiplex DNA targeting system, i.e., targeting to target sites of more than one gene. Thus, the term DNA targeting system can include a multiplex epigenetically modified DNA targeting system containing more than one DNA targeting module. The multiplex epigenetically modified DNA targeting system comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12 DNA targeting modules. In some embodiments, the multiple DNA targeting modules target multiple target sites of one or more genes, such as 2 or 3 genes, selected from BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1.

[0162] In some embodiments, any two DNA targeting modules of the DNA targeting system comprise different (i.e., non-overlapping) compositions. In some embodiments, the different DNA targeting modules of the DNA targeting system comprise different (i.e., non-overlapping) compositions. For example, the DNA targeting system can comprise a first DNA targeting module and a second DNA targeting module, the first DNA targeting module comprising a first fusion protein comprising a DNA binding domain targeting a first target site (such as a ZFN- or TALE-based DNA binding domain), and the second DNA targeting module comprising a second fusion protein comprising a second DNA binding domain targeting a second target site (such as a ZFN- or TALE-based DNA binding domain).

[0163] In some embodiments, any two DNA targeting modules of the DNA targeting system can comprise a shared (i.e., overlapping) composition. In some embodiments, different DNA targeting modules of the DNA targeting system comprise a shared (i.e., overlapping) composition. For example, in one aspect, a DNA targeting system can comprise a first DNA targeting module and a second DNA targeting module, the first DNA targeting module comprising: (a) a fusion protein comprising a Cas protein and a transcriptional effector (such as a repressor) domain; (b) a first gRNA complexed with the Cas protein and targeting a first target site; the second DNA targeting module comprising: (a) the fusion protein of the first DNA targeting module; and (b) a second gRNA complexed with the Cas protein and targeting a second target site. It will be understood that providing two or more different gRNAs for a given Cas protein can enable the same Cas protein to be targeted to the target sites of the two or more gRNAs. Conversely, different Cas protein variants (such as SpCas9 and SaCas9) are compatible with different gRNA scaffold sequences and PAMs. Thus, it is possible to engineer a single DNA targeting system comprising multiple non-overlapping CRISPR / Cas-based DNA targeting modules.

[0164] The provided embodiments relate to compositions and methods for promoting T cell function (such as one or more T cell effector functions) by epigenetically modifying target sites in one or more target genes. In some embodiments, the methods can be used in association with T cell therapies, such as in association with adoptive T cell therapy. In some embodiments, modulating the transcription of the one or more genes increases or improves one or more T cell phenotypes or functions. In some embodiments, T cell effector function is increased, such as the ability to produce cytokines (e.g., IL-2 or IFN-γ (IFNg)), the ability to proliferate T cells, the ability of T cells to kill target cells, or the ability of T cells to exhibit a sustained immune response. In certain embodiments, modulation of the one or more genes improves T cell effector function upon or after T cell stimulation (including after a series of stimulations that mimic the conditions of repeated antigen experiences as occur in vivo).

[0165] The administration of T cells targeting specific antigens, also known as "adoptive cell therapy" (ACT), is a promising approach for treating diseases such as cancer. However, current ACT treatments face challenges, including suboptimal T cell function, expansion, and persistence. In addition, the persistence and functionality of transferred T cells can vary significantly between different T cell subsets and between T cells from different patients. Recent clinical trials of ACT have shown that the ability of T cells to persist in circulation depends on the differentiation stage of the T cells, including the ability to retain networks of transcription factors and metabolic regulators (Pilipow K. et al., Journal of Clinical Investigation Insight 2018; 3(18):e122299). T cells transferred to patients are typically terminally differentiated and thus unable to persist long-term, ultimately limiting effective anti-tumor responses. For example, although the first CAR-T cell therapy was approved by the FDA as a cell and gene therapy in 2017, patients who experience cancer relapse or non-responsiveness to treatment often suffer from a lack of CAR T cell persistence (Mueller et al., Blood (2018)). In addition, durable benefits of CAR T cell therapy have not been found in solid tumors.

[0166] In preclinical and clinical settings, strategies to overcome such challenges and enhance the persistence, expansion, and anti-tumor activity of chimeric antigen receptor (CAR)-engineered T cells have been tested. For example, strategies for optimizing ex vivo T cell culture conditions have been explored, including adding cytokines during manufacturing (Besser M.J., Cytotherapy 2009; 11(2):206-17), expressing cytokines and / or receptors by CAR T cells (Krenciute G., Cancer Immunol Res. 2017 07; 5(7):571-581), using pharmacological inhibitors to suppress signaling pathways such as AKT (Urak R. et al., Journal of Immunotherapy Cancer 2017 Mar 21; 5:26) or PI3K (Peterson C.T et al., Blood Advances 2018 Feb 13; 2(3):210-223), immune exhaustion, and checkpoint blockade (Cherkassky L. et al., Journal of clinical investigation 2016 Aug 1; 126(8):3130-44). However, existing strategies have not been entirely satisfactory. In some cases, the aforementioned strategies have caused cytokine toxicity or the development of lymphoproliferative diseases, raising questions about alternative approaches.

[0167] The provided embodiments relate to the identification of genomic locations that are epigenetically modified in T cells to affect or promote T cell effector functions upon T cell stimulation, including functions induced or dependent on TCR and / or CAR in an induced or dependent manner, such as demonstrated by assessing the ability of the cells to produce IL-2 and / or IFNγ, to proliferate, or to kill target cells. In some embodiments, the stimulation conditions or stimulants include one or more reagents capable of stimulating or activating the intracellular signaling domains of the TCR complex, such as ligands. In some aspects, the reagent initiates or starts the TCR / CD3 intracellular signaling cascade in T cells. Such reagents can include antibodies (e.g., antibodies specific for TCR components and / or costimulatory receptors, such as anti-CD3, anti-CD28, e.g., antibodies conjugated to a solid support such as beads) and / or one or more cytokines. In some embodiments, the one or more reagents are PMA or ionomycin. In some embodiments, the T cell stimulation is antigen-specific stimulation, wherein the cells are stimulated by a reagent that provides an antigen or an epitope thereof that is specific for or recognizable by an antigen receptor (such as CAR) expressed on the T cells. For example, the stimulant can include target cells expressing the antigen. In certain embodiments, the phenotype is or includes the production or secretion of cytokines (such as IL-2 or IFN-γ) in response to T cell stimulation. The production and / or secretion of cytokines contribute to the immune response and involve different processes, including the induction of antiviral proteins and the induction of T cell proliferation. Cytokines are not pre-formed factors but are rapidly produced and secreted in response to cell activation. The production or secretion of cytokines can be measured, detected, and / or quantified by any suitable technique known in the art.

[0168] In some embodiments, the T cell function is the production of one or more cytokines. In certain embodiments, the production of the one or more cytokines is measured, detected, and / or quantified by intracellular cytokine staining. Intracellular cytokine staining (ICS) by flow cytometry is a technique well-suited for studying cytokine production at the single cell level. It detects the production and accumulation of intracellular (such as within the endoplasmic reticulum) cytokines after cell stimulation, enabling the identification of positive or negative cell populations for specific cytokine production or the isolation of high-producing and low-producing cells based on a threshold. ICS can also be combined with other flow cytometry protocols for immunophenotyping using cell surface markers or MHC multimers to obtain cytokine production in specific cell subsets, making it a flexible and versatile method. Other single cell techniques for measuring or detecting cytokine production include, but are not limited to, ELISPOT, limiting dilution, and T cell cloning.

[0169] Notably, the target genes and target sites thereof of the present disclosure are identified by a screening method involving transient delivery, wherein the DNA binding domain-effector fusion protein (also referred to as "epi-editor") is transiently delivered to the T cells (i.e., delivered by a method that results in transient expression and / or presence of the fusion protein in the T cells), followed by primary or serial stimulation of the T cells to evaluate the effect on functional T cell cytokines. It has been found herein that the transient delivery of the epigenetic modification DNA targeting system allows for the identification of genomic target sites that have a significant impact on T cell function, but does not require the permanent presence of the epigenetic modification DNA targeting system and / or stable knockdown or knockout of the target gene. This approach is advantageous because it can identify safer target genes and target sites because their regulation does not rely on permanent integrations of editors, such as by lentiviral transduction. In addition, the transient screening strategy allows for the identification of target genes and their target sites where the action of the epigenetic modification DNA targeting system is persistent and not masked by permanent integration into the genome and expression therein. This is contrary to other screening approaches that employ lentiviral delivery of DNA systems (Schmidt et al., 2022 Science, 375, DOI: 10.1126 / science.abj4008; Freimer et al. 2022 Nature Genetics, 54:1133-1144).

[0170] The provided embodiments can be used to target genes that, when transcriptionally altered by epigenetic modification, can greatly facilitate or enhance T cell function, including T cell persistence and effector activity required for function. Such T cell properties are expected to result in durable effector functions, with better fitness / proliferation benefits, and the ability to produce pro-proliferative cytokines (such as IL-2) and / or cytotoxic cytokines (such as IFNγ) upon TCR or antigen stimulation. In particular, the provided embodiments provide an epigenetic modification DNA targeting system (i.e., "epi-editing system") and method that can provide durable effector functions with better fitness. This approach provides a substantial clinical solution to circumvent problems of T cell persistence, poor function, and / or exhaustion. In addition, the epigenetic modification of cells does not modify DNA at the sequence level, thereby avoiding the safety associated with gene editing approaches. The ability to epigenetically control the differentiation fate of T cells provides an advantageous method for increasing the percentage or number of T cells in a T cell population.

[0171] All publications mentioned in this application (including patent documents, scientific articles, and databases) are hereby incorporated by reference in their entirety for all purposes as if each individual publication were incorporated by reference separately. If the definitions set forth herein conflict or are inconsistent with the definitions set forth in patents, applications, published applications, and other publications incorporated by reference herein, the definitions set forth herein shall control over the definitions incorporated by reference herein.

[0172] The section headings used herein are for organizational purposes only and shall not be construed as limiting the subject matter described. I. DNA Targeting Systems

[0173] In some embodiments, a DNA targeting system is provided that is capable of specifically targeting a target site of at least one gene (i.e., the target gene) and modulating the transcription of the at least one gene. In some embodiments, the at least one gene is one or more genes in lymphocytes (such as T cells). In some embodiments, the target site of the gene is a target site in the gene or its regulatory DNA element. In some embodiments, the transcriptional modulation is to reduce the transcription of each target gene. In some embodiments, the transcriptional modulation is to increase the transcription of each target gene. In the provided embodiments, for each target gene targeted, the DNA targeting system comprises a fusion protein that comprises a DNA binding domain that binds to the target site of the gene and an effector domain for modulating the transcription of the gene. In some embodiments, the provided DNA targeting system is capable of modulating the transcription of at least one gene in the cell, such as repressing or increasing. In some embodiments, the transcriptional modulation of gene expression by the DNA targeting system provided herein can promote or improve the function of the lymphocytes. In certain embodiments, the provided DNA targeting system promotes T cell function, such as one or more T cell effector functions, by epigenetically modifying the target site in the one or more target genes.

[0174] In some embodiments, the at least one effector domain is a transcriptional repressor effector domain for repressing the transcription of each of the at least one gene (e.g., repressing or reducing the transcription of the gene compared to the transcription of the gene in the absence of a DNA targeting system), such as any effector domain for transcriptional repression described in Section I.E.1. In some embodiments, the effector domain is a transcriptional repressor effector domain, and the one or more genes are selected from the group consisting of: CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2. In some embodiments, the effector domain is a transcriptional repressor effector domain, and the one or more genes are selected from the group consisting of: CBLB, CISH, MED12, MYB, PRDM1, and RASA2.

[0175] In some embodiments, the effector domain directly or indirectly results in a reduction in the transcription of the gene. In some embodiments, the effector domain induces, catalyzes, or results in transcriptional repression. In some embodiments, the effector domain induces transcriptional repression. In some aspects, the effector domain is selected from the group consisting of a KRAB domain, an ERF repressor domain, an MXI1 domain, a SID4X domain, a MAD-SID domain, a DNMT family protein domain (such as DNMT3A or DNMT3B), a fusion of one or more DNMT family proteins or their domains (such as DNMT3A / L, which comprises a fusion of the DNMT3A and DNMT3L domains), LSD1, EZH2, a partial or full functional fragment of any of the foregoing, or any combination of the foregoing. In some embodiments, the effector domain is KRAB. In some embodiments, the effector domain is DNMT3A / L.

[0176] In some embodiments, the at least one effector domain is a transcriptional activator effector domain for increasing the transcription of each of the at least one gene (e.g., activating or increasing the transcription of the gene compared to the transcription of the gene in the absence of a DNA targeting system), such as any effector domain for transcriptional activation described in Section I.E.2. In some embodiments, the effector domain is a transcriptional activator effector domain, and the one or more genes are selected from the group consisting of: BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1. In some embodiments, the effector domain is a transcriptional activator effector domain, and the one or more genes are selected from the group consisting of: EOMES, IL-2, LCP2, and TBX21.

[0177] In some embodiments, the effector domain directly or indirectly causes an increase in transcription of the gene. In some embodiments, the effector domain induces, catalyzes, or causes transcriptional activation. In some embodiments, the effector domain induces transcriptional activation. In some aspects, the effector domain comprises: a VP64 domain, a p65 activation domain, a p300 domain, an Rta domain, a CBP domain, a VPR domain, a VPH domain, an HSF1 domain, a TET protein domain, optionally wherein the TET protein is TET1, a SunTag domain, or any of the foregoing domains, portions, variants, or truncations. In some embodiments, the effector domain is VP64.

[0178] In some embodiments, the DNA targeting system comprises a fusion protein comprising: (a) at least one DNA binding domain capable of being targeted to the target site; and (b) at least one effector domain capable of regulating transcription of the gene. In some embodiments, the at least one effector domain is a transcriptional repressor effector domain. In some embodiments, the at least one effector domain is a transcriptional activator effector domain. The fusion protein can be any suitable fusion protein, such as those described in Section I.F.

[0179] In some embodiments, the DNA binding domain comprises or is derived from a CRISPR-associated (Cas) protein, a zinc finger protein (ZFP), a transcription activator-like effector (TALE), a meganuclease, a homing endonuclease, an I-SceI enzyme, or a variant thereof. In some embodiments, the DNA binding domain comprises a catalytically inactivated (such as nuclease inactivated or nuclease dead) variant of any of the foregoing domains. In some embodiments, the DNA binding domain comprises a deactivated Cas9 (dCas9) protein or a variant thereof, which is catalytically inactivated such that nuclease activity is inactivated and DNA cannot be cleaved. The DNA binding domain can be any suitable DNA binding domain, such as those described in Sections I.C and I.D.

[0180] In some embodiments, the DNA binding domain comprises or is derived from a Cas protein or a variant thereof, such as a nuclease-inactivated Cas or dCas (such as dCas9), and the DNA targeting system comprises one or more guide RNAs (gRNAs), such as a combination of gRNAs (such as two gRNAs or three gRNAs). In some embodiments, the gRNA comprises a spacer sequence capable of targeting and / or hybridizing to the target site. In some embodiments, the gRNA is capable of complexing with the Cas protein or a variant thereof. In some aspects, the gRNA directs or recruits the Cas protein or a variant thereof to the target site. The gRNA can be any suitable gRNA, for example, as described in Section I.C.2.

[0181] In some embodiments, the DNA targeting system is used to repress the transcription of the at least one gene, such as any of those described in Section I.B.2, and the fusion protein of its DNA targeting module is a dCas9-KRAB fusion protein. In some embodiments, the fusion protein is a dCas9-KRAB-DNMT3A / L fusion protein. In some embodiments, the fusion protein is any of those described herein (such as in Section I.F).

[0182] In some embodiments, the DNA targeting system is used to increase the transcription of the at least one gene, such as any of those described in Section I.B.3, and the fusion protein of its DNA targeting module is a dCas9-VP64 fusion protein, such as a dCas9-2xVP64 fusion protein. In some embodiments, the fusion protein is any of those described herein (such as in Section I.F).

[0183] Exemplary compositions and features of the DNA targeting system are provided in the subsections below. A. DNA Targeting Module and Multiplex DNA Targeting System

[0184] In some embodiments, the DNA targeting system comprises at least one DNA targeting module, wherein each DNA targeting module of the system is a component of the DNA targeting system capable of independently targeting one target site of the target gene. In some embodiments, each DNA targeting module includes (a) a DNA binding domain capable of being targeted to the target site; and (b) an effector domain for regulating the transcription of the gene. In some embodiments, the DNA targeting system comprises a single DNA targeting module for targeted transcriptional regulation of a single gene.

[0185] In some embodiments, the DNA targeting module is a CRISPR / Cas-based DNA targeting module. In some embodiments, in the CRISPR / Cas-based DNA targeting module, the DNA binding domain of the fusion protein is a Cas protein or a variant thereof (such as a dCas protein, such as dCas9), and the DNA targeting module further comprises a gRNA for targeting the DNA binding domain to the target site.

[0186] In some embodiments, the DNA targeting module is a zinc finger protein (ZFP)-based DNA targeting module. In some embodiments, in the ZFP-based DNA targeting module, the DNA binding domain of the fusion protein is an engineered zinc finger protein (eZFP).

[0187] In some embodiments, the DNA targeting module is a transcription activator-like effector (TALE)-based DNA targeting module. In some embodiments, in the TALE-based DNA targeting module, the DNA binding domain of the fusion protein is an engineered TALE.

[0188] In some embodiments, the DNA targeting system comprises a plurality of DNA targeting modules, wherein each DNA targeting module targets a different target site. In some embodiments, one or more target sites are for different genes. In some embodiments, one or more target sites are for the same gene. In some embodiments, the DNA targeting system is a multiplex DNA targeting system, i.e., it is targeted to target sites of more than one gene. Thus, the term DNA targeting system may include a multiplex epigenetic modification DNA targeting system, which includes more than one DNA targeting module. In some embodiments, the multiplex epigenetic modification DNA targeting system comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 30 or more DNA targeting modules. In some embodiments, the multiplex epigenetic modification DNA targeting system comprises 2 DNA targeting modules. In some embodiments, the multiplex epigenetic modification DNA targeting system comprises 3 DNA targeting modules.

[0189] In some embodiments, any two DNA targeting modules of the DNA targeting system can comprise distinct (i.e., non-overlapping) compositions. For example, the DNA targeting system can comprise a first DNA targeting module and a second DNA targeting module, the first DNA targeting module comprising a first fusion protein having a DNA binding domain (such as a ZFN- or TALE-based DNA binding domain) that targets a first target site, and the second DNA targeting module comprising a second fusion protein having a second DNA binding domain (such as a ZFN- or TALE-based DNA binding domain) that targets a second target site.

[0190] In some embodiments, any two DNA targeting modules of the DNA targeting system can comprise shared (i.e., overlapping) compositions. For example, the DNA targeting system can comprise: i) a first DNA targeting module comprising (a) a fusion protein comprising a Cas protein and an effector domain; and (b) a first gRNA complexed with the Cas protein and targeting a first target site; and ii) a second DNA targeting module comprising (a) the fusion protein of the first DNA targeting module, and (b) a second gRNA complexed with the Cas protein and targeting a second target site. It will be understood that providing two or more different gRNAs for a given Cas protein can target the Cas protein to the target sites of the two or more gRNAs. Conversely, as described herein, different Cas protein variants (such as SpCas9 and SaCas9) are compatible with different gRNA scaffold sequences and PAMs. Thus, it is possible to engineer a single DNA targeting system comprising multiple non-overlapping CRISPR / Cas DNA-based targeting modules.

[0191] In some aspects, provided herein is an epigenetically modified DNA targeting system comprising multiple DNA targeting modules for regulating the transcription of one or more genes. In some embodiments, the multiple DNA targeting modules comprise a first DNA targeting module for regulating the transcription of a first gene among the one or more genes, and a second DNA targeting module for regulating the transcription of a second gene among the one or more genes. In some embodiments, each DNA targeting module comprises a fusion protein comprising: (a) a DNA binding domain for targeting a target site of the target gene of the DNA targeting module, and (b) at least one effector domain. In some embodiments, each DNA targeting module comprises a transcriptional repressor effector domain for repressing the transcription of the at least one gene. In some embodiments, each DNA targeting module comprises a transcriptional activator effector domain for increasing the transcription of the at least one gene. B. Target Genes and Target Sites for Promoting Lymphocyte (e.g., T Cell) Activation and Function

[0192] In some aspects, provided herein are target sites in one or more target genes, wherein regulation of the target genes promotes T cell activation or function. In some embodiments, any of the provided DNA targeting systems are used to target the target sites.

[0193] In some embodiments, the target sites are in genes where decreased expression of the genes promotes T cell activation or function, such as any one or more of the target genes described in Section I.B.2. In some embodiments, the target sites are target sites in genes selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2. In some embodiments, the target site is a target site in the CBLB gene. In some embodiments, the target site is a target site in the CISH gene. In some embodiments, the target site is a target site in the MED12 gene. In some embodiments, the target site is a target site in the MYB gene. In some embodiments, the target site is a target site in the PRDM1 gene. In some embodiments, the target site is a target site in the RASA2 gene.

[0194] In some embodiments, the target sites are in genes where increased expression of the genes promotes T cell activation or function, such as any one or more of the target genes described in Section I.B.3. In some embodiments, the target sites are target sites in genes selected from the group consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1. In some embodiments, the target site is a target site in the EOMES gene. In some embodiments, the target site is a target site in the IL-2 gene. In some embodiments, the target site is a target site in the LCP2 gene. In some embodiments, the target site is a target site in the TBX21 gene.

[0195] In some embodiments, the target site is targeted by a DNA targeting system, such as by the DNA targeting module of any DNA targeting system described herein. In some embodiments, the target site is a target site of a gene (such as a target gene). In some embodiments, the target site of the gene is in the gene or its regulatory DNA element. In some embodiments, the target site is a target site in the gene. In some aspects, the gene is a target gene. In some embodiments, the target gene is a gene in a cell. In some embodiments, the cell is an immune cell, such as a T cell. In some embodiments, provided herein is a DNA targeting system for multiplex epigenetic modification that targets a combination of at least two target genes or their regulatory DNA elements described herein.

[0196] In some embodiments, the DNA targeting system targets or binds to a target site in a gene, such as any gene described herein. In some embodiments, the target site is located in the gene and / or its regulatory DNA element. In some embodiments, the regulatory DNA element is a sequence to which a gene regulatory protein can bind and affect the transcription of the gene. In some embodiments, the regulatory DNA element is a cis, trans, distal, proximal, upstream or downstream regulatory DNA element of the gene. In some embodiments, the regulatory DNA element is a promoter or enhancer of the gene. In some embodiments, the target site is located within the promoter, enhancer, exon, intron, untranslated region (UTR), 5'UTR or 3'UTR of the gene. In some embodiments, the regulatory DNA element is a promoter. In some embodiments, the promoter is a nucleotide sequence that binds to RNA polymerase to initiate transcription of the gene. In some embodiments, the promoter is a nucleotide sequence located within about 100 bp, about 500 bp, about 1000 bp or more of the transcription start site of the gene. In some embodiments, the promoter is within 500 bp of the transcription start site of the gene. In some embodiments, the target site is located within a sequence of unknown or known function that is suspected of being able to control gene expression. 1. Lymphocytes and regulated effector functions

[0197] In some embodiments, the provided DNA targeting system and / or DNA targeting provides for transcriptional regulation to repress or increase the expression of at least one target gene. In some embodiments, the target gene is a gene whose expression regulates an intracellular phenotype. In some embodiments, the target gene is capable of regulating a phenotype in T cells. In some embodiments, the regulated expression (such as increased transcription or decreased transcription) of the gene regulates the phenotype. In some embodiments, the regulated expression of the gene promotes enhanced T cell effector function upon T cell stimulation. In some embodiments, the increased T cell effector function is enhanced compared to T cells in which gene expression is not regulated with the provided DNA targeting system. Methods for regulating T cell function or the function of other lymphocytes with the provided DNA targeting system are further described below and in Section IV.

[0198] In some embodiments, the gene is regulated by a DNA targeting system, such as any DNA targeting system provided herein. In some embodiments, the DNA targeting system is transiently delivered to the cell. In some embodiments, the delivery of the DNA targeting system, such as by transient delivery, promotes enhanced T cell effector function upon T cell stimulation. In some embodiments, the T cell effector function is enhanced compared to comparable T cells to which the DNA targeting system was not delivered.

[0199] In some aspects, transient delivery refers to any delivery method that results in the expression and / or presence of one or more components of the DNA targeting system in the cell for a limited period of time. For example, the delivery of mRNA encoding a fusion protein of the DNA targeting system (such as by electroporation) into the cell results in the transient expression of the fusion protein in the cell, such as until the mRNA is degraded. In other instances, the DNA targeting system can be expressed from one or more nucleic acids encoding the DNA targeting system, where the nucleic acids encoding the DNA targeting system do not integrate into the genome of the cell and are ultimately degraded and / or removed from the cell, such that the expression of the DNA targeting system no longer persists. In other instances, one or more components of the DNA targeting system (such as a fusion protein and optionally a gRNA) can be synthesized in vitro and directly delivered into the cell (such as by electroporation) without an expression vector, which results in the transient presence of the DNA targeting system, such as until the fusion protein and / or gRNA are degraded. In some aspects, transient delivery is different from methods of non-transient delivery that result in stable expression, such as methods involving the integration of an expression vector of the DNA targeting system or its components into the genome of the cell.

[0200] In some embodiments, the DNA targeting system is delivered to the cell (such as a T cell), for example, by transient delivery, to promote the phenotype of the cell (such as a T cell). In some embodiments, the phenotype is enhanced activation or function in the cell (such as a T cell). In some embodiments, the DNA targeting system is delivered to the cell (such as a T cell), such as by transient delivery, to promote enhanced activation or function in the cell (such as a T cell). In some embodiments, the phenotype is enhanced T cell effector function upon T cell stimulation. In some embodiments, the T cell effector function is enhanced compared to T cells that have not received the epigenetically modified DNA targeting system. In some embodiments, reduced expression (such as transcription) of the one or more target genes (such as the target genes described in Section I.B.2) results in enhanced T cell effector function upon T cell stimulation. In some embodiments, increased expression (such as transcription) of the one or more target genes (such as the target genes described in Section I.B.3) results in enhanced T cell effector function upon T cell stimulation. In some embodiments, the T cell effector function is characterized by an activity selected from the group consisting of IL-2 production, IFN-γ production, TNF-α production, T cell proliferation, or any combination of the foregoing.

[0201] In some embodiments, the provided DNA targeting system promotes or enhances improved T cell effector function that can occur following in vitro, ex vivo, or in vivo stimulation. In some embodiments, the T cell stimulation is polyclonal T cell stimulation. In some embodiments, the T cell stimulation is with anti-CD3 and anti-CD28 activating reagents. In some embodiments, the T cell stimulation is antigen-specific activity mediated or induced by specific binding of an antigen to an antigen receptor on the surface of the T cell. In some embodiments, the T cell expresses a chimeric antigen receptor (CAR) or an engineered T cell receptor (eTCR) specific for an antigen, and the T cell stimulation is antigen-specific stimulation of the CAR or eTCR. In some embodiments, the T cell is stimulated with target cells expressing the antigen. In some embodiments, T cell stimulation occurs when the T cell contacts a cell expressing the antigen. In some embodiments, the T cell stimulation is restimulation after at least one prior T cell stimulation. In some embodiments, the T cells are stimulated prior to assessing T cell effector function or phenotype, followed by transient delivery of the provided DNA targeting system.

[0202] In some embodiments, a cell composition comprising T cells is stimulated with an anti-CD3 / anti-CD28 activating reagent for a period of time, and effector function is measured at one or more time points during or after incubation. In some embodiments, such activating reagents have anti-CD3 / anti-CD28 coated on a support such as magnetic beads or other matrices. Exemplary activating reagents are Dynabeads TM or T Cell TransAct TM . In some embodiments, the T cells are incubated with the activating reagent for 3 hours to 72 hours, such as 12 hours to 48 hours, for example 12 hours, 18 hours, 24 hours, 36 hours or 48 hours, or any value between any of the foregoing. In some embodiments, the effector function of the cells can be directly evaluated, such as the ability to produce cytokines or proliferate. In some embodiments, the supernatant of the culture can be collected and the amount of soluble factors (such as cytokines) detected. In some embodiments, the T cells can be collected and re-exposed to the activating reagent to monitor cytolytic activity. In some embodiments, the cells can be restimulated one or more times, such as by serial stimulation methods, and the effector function serially evaluated after each stimulation.

[0203] In certain embodiments, the antigen-specific activity is measured by incubating a cell composition comprising T cells expressing the antigen receptor (such as a CAR) with cells expressing the antigen for a period of time, and effector function is measured at one or more time points during or after the incubation. In some embodiments, the T cells are incubated with an antigen-specific agent (such as cells expressing the antigen) for 3 hours to 96 hours, such as 12 hours to 72 hours, for example 12 hours, 24 hours, 48 hours, 72 hours or any value between any of the foregoing. In some embodiments, the effector function of the cells can be directly evaluated, such as the ability to produce cytokines or proliferate. In some embodiments, the supernatant of the culture can be collected and the amount of soluble factors (such as cytokines) detected. In some embodiments, the T cells can be collected and re-exposed to the antigen-expressing target cells to monitor cell killing (cytolytic activity) of the target cells. In some embodiments, the cells can be restimulated one or more times, such as by serial stimulation methods, and the effector function serially evaluated after each stimulation. In some embodiments, T cells having an engineered antigen receptor (such as a CAR) are incubated with a constant number of cells expressing the antigen, such as at an effector cell to target cell (E:T) ratio of 1:4 to 4:1, such as at a ratio of 1:4, 1:3, 1:2 or 1:1.

[0204] In some embodiments, the cells (such as T cells) exhibit increased cytokine production. In some embodiments, the increased cytokine production occurs upon T cell stimulation. In some embodiments, T cell effector function is characterized by cytokine production. In some embodiments, the cytokine production is increased by at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 2-fold, 5-fold, 10-fold, 50-fold, 100-fold or more compared to cells not delivered the epigenetic modification DNA targeting system. In some embodiments, the cytokine production is the production of IL-2, IFN-γ, TNF-α, or a combination thereof. In some embodiments, T cell effector function is characterized by IL-2 production. In some embodiments, the cells (such as T cells) exhibit increased IL-2 production. In some embodiments, T cell effector function is characterized by IFN-γ production. In some embodiments, the cells (such as T cells) exhibit increased IFN-γ production. In some embodiments, T cell effector function is characterized by IL-2 and IFN-γ production. In some embodiments, the cells (such as T cells) exhibit increased IL-2 production and increased IFN-γ production. In some embodiments, T cell effector function is characterized by the multifunctional production of IL-2, IFN-γ, and TNF-α. In some embodiments, the cells (such as T cells) exhibit increased IL-2, IFN-γ, and TNF-α production.

[0205] Suitable techniques for measuring the production or secretion of soluble factors (such as cytokines) are known in the art. The production and / or secretion of soluble factors can be measured by determining the concentration or amount of the extracellular amount of the factor, or by determining the amount of transcriptional activity of the gene encoding the factor. Suitable techniques include, but are not limited to, the following assays: immunoassays, aptamer-based assays, histological or cytological assays, mRNA expression level assays, enzyme-linked immunosorbent assay (ELISA), immunoblotting, immunoprecipitation, radioimmunoassay (RIA), immunostaining, flow cytometry assays, surface plasmon resonance (SPR), chemiluminescence detection, lateral flow immunoassay, inhibition assay or affinity assay, protein microarray, high performance liquid chromatography (HPLC), Meso Scale Discovery (MSD) electrochemiluminescence and bead-based multiplex immunoassay (MIA). In some embodiments, the suitable techniques can employ a detectable binding reagent that specifically binds to the soluble factor.

[0206] In some embodiments, the cytokine production is measured as the percentage of cytokine-positive cells, such as by intracellular cytokine staining (IC) and flow cytometry. Intracellular cytokine staining (IC) by flow cytometry is a technique well-suited for studying cytokine production at the single-cell level. It detects the production and accumulation of cytokines within the endoplasmic reticulum following cell stimulation, enabling the identification of cell populations that are positive or negative for the production of a specific cytokine, or the separation of high-producing and low-producing cells based on a threshold. ICS can also be used in combination with other flow cytometry protocols for immunophenotyping using cell surface markers or MHC multimers to obtain cytokine production of specific cell subsets, making it an extremely flexible and versatile method. Other single-cell techniques for measuring or detecting cytokine production include, but are not limited to, ELISPOT, limiting dilution, and T cell cloning.

[0207] In some embodiments, the cytokine production is measured as the amount of cytokine secreted from the cells, such as by ELISA. ELISA is a plate-based assay technique designed to detect and quantify substances such as peptides, cytokines, antibodies, and hormones. In ELISA, soluble factors such as cytokines must be immobilized on a solid surface and then complexed with an antibody conjugated to an enzyme. Detection is accomplished by incubating with a substrate to assess the activity of the conjugated enzyme, which generates a detectable signal.

[0208] In some embodiments, the T cell effector function is characterized by further comprising the activity of T cell proliferation. In some embodiments, the cells (such as T cells) exhibit increased proliferation. In some embodiments, the increased proliferation occurs upon T cell stimulation. In some embodiments, the proliferation is increased by at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 2-fold, 5-fold, 10-fold, 50-fold, 100-fold, or more compared to cells that have not been delivered the epigenetic modification DNA targeting system. In some embodiments, the proliferation is measured as the increase in the number of cells before and after stimulation. In some embodiments, the increased proliferation is measured as the number of cells after stimulation in the cell population delivered the epigenetic modification DNA targeting system compared to the number of cells after stimulation in the cell population that has not been delivered the epigenetic modification DNA targeting system. In some embodiments, the cells (such as T cells) do not exhibit increased proliferation.

[0209] In some embodiments, the T cell effector function is characterized by an activity that further comprises killing of target cells. In some embodiments, the cells (such as T cells) exhibit enhanced killing of target cells. In some embodiments, the enhanced killing of target cells occurs upon T cell stimulation. In some embodiments, the stimulation is effected by contacting the cells (such as T cells) with target cells. In some embodiments, the T cells are incubated with antigen-expressing target cells at a ratio between 4:1 and 1:4 (including 4:1 and 1:4), such as a ratio of 1:4, 1:3, 1:2, or 1:1. In some embodiments, the killing of target cells is enhanced by at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 2-fold, 5-fold, 10-fold, 50-fold, 100-fold, or more compared to cells that have not been delivered the epigenetic modification DNA targeting system. In some embodiments, the killing is measured by the ability to kill target cells when the cells are contacted with the target cells. The killing of target cells can be measured by any suitable assay, such as those described in the examples herein. In some embodiments, the killing is measured in an in vitro assay in which cells delivered the epigenetic modification DNA targeting system are co-cultured with the target cells, and the number of target cells is measured over time. In some embodiments, a decrease in the number and / or proliferation of target cells indicates killing of the target cells. Cytolytic activity can be measured by directly or indirectly measuring the number of target cells over time. For example, prior to incubation with cells expressing an antigen receptor (such as a CAR), the target cells can be incubated with a detectable marker, such as a marker that is detectable after the target cells are lysed or a marker that is detectable in live target cells. Such readings directly or indirectly provide the number of target cells and / or target cell death and can be measured at different time points during the assay. A decrease in the number of target cells and / or an increase in target cell death indicates the cytolytic activity of the cells. Suitable methods for performing cytolytic assays are known in the art and include, but are not limited to, chromium-51 release assays, non-radioactive chromium assays, flow cytometry assays using fluorescent dyes such as carboxyfluorescein succinimidyl ester (CFSE), PKH-2, and PKH-26.

[0210] In some embodiments, the T cell effector function is characterized by an activity that further comprises T cell persistence. In some embodiments, the cells (such as T cells) exhibit increased persistence (such as T cell persistence). In some embodiments, persistence involves the ability of the cells to remain present and / or maintain an immune response in the presence of target cells. In some embodiments, persistence can be measured in vitro or in vivo, such as after administration of the cells to a subject. Persistence can be measured by any suitable method, such as the methods described in Section IV.

[0211] In some embodiments, the ability of T cells to persist can be measured as a pharmacokinetic property of the cell composition following administration to a subject. In some embodiments, the pharmacokinetic parameters can include exposure, number, concentration, persistence, and proliferation. In some cases, pharmacokinetics can be evaluated by measuring the following parameters after administration, such as the maximum (peak) plasma concentration (C max ), the peak time (i.e., when the maximum plasma concentration (C max ) occurs; T max ), the minimum plasma concentration (i.e., the minimum plasma concentration between doses of a therapeutic agent, such as CAR+T cells; C min ), the elimination half-life (T 1 / 2 ), and the area under the curve (i.e., the area under the curve generated by plotting time versus plasma concentration of the therapeutic agent CAR+T cells; AUC). Parameters of engineered T cell administration can be measured in samples of blood from a subject. For example, nucleic acid-based methods such as quantitative PCR (qPCR) or flow cytometry-based methods, or other assays such as immunoassays, ELISA, or chromatography / mass spectrometry-based assays can be used.

[0212] In some aspects, nucleic acid-based methods, such as quantitative PCR (qPCR), are used to evaluate the number of cells expressing an antigen receptor (such as CAR-expressing cells for administration of T cell-based therapies) in a sample of blood or serum or organ or tissue of a subject (such as a disease site, such as a tumor sample). In some aspects, persistence is quantified as the number of copies of DNA or plasmid encoding a receptor (such as CAR) per microgram of DNA, or the number of cells expressing an antigen receptor (such as CAR) per microliter of sample (such as blood or serum), or the total number of peripheral blood mononuclear cells (PBMCs) or white blood cells or T cells per microliter of sample. In some embodiments, the primers or probes for qPCR or other nucleic acid-based methods are specific for binding, recognizing, and / or amplifying nucleic acids and / or plasmids and / or other components or elements of a vector encoding an antigen receptor (including regulatory elements such as promoters, transcriptional and / or post-transcriptional regulatory elements or response elements, or markers such as surrogate markers). In some embodiments, the primers can be specific for a regulatory element, such as the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).

[0213] In some embodiments, any of the phenotypes described herein are observed after stimulation (such as T cell stimulation), such as increased IL-2 production, increased IFN-γ production, increased IL-2 production and increased IFN-γ production, increased production of IL-2, IFN-γ, and TNF-α, increased proliferation or no increased proliferation, increased target cell killing, and / or increased persistence.

[0214] In some embodiments, the phenotype (such as any phenotype described herein, including enhanced T cell effector function) occurs 48 hours or more after transient delivery of the epigenetically modified DNA targeting system to T cells. In some embodiments, the phenotype (such as enhanced T cell effector function) occurs up to 6 days, up to 9 days, up to 12 days, up to 15 days, up to 21 days, up to 28 days, up to 35 days, up to 42 days, up to 49 days, up to 56 days, up to 63 days, up to 71 days or more after transient delivery of the epigenetically modified DNA targeting system to T cells.

[0215] In some aspects, the phenotype is a phenotype characterized by the cell surface phenotype of the cell. In some embodiments, the phenotype comprises the expression of one or more cell surface markers selected from IL-2+, TNFa+, IFNg+ or any combination thereof. In some embodiments, the phenotype is a phenotype of T cells, such as CD3+ T cells, which may be CD4+ T cells or CD8+ T cells. Thus, in some embodiments, the phenotype comprises the expression of one or more cell surface markers selected from CD3+, CD4+, CD8+, IL-2+, TNFa+, IFNg+ or any combination thereof. In some aspects, the phenotype comprises the expression of IL-2+. In some embodiments, the phenotype comprises the expression of IL-2- and IFNg+.

[0216] It should be understood that the provided embodiments of the epigenetically modified DNA targeting system are not limited to regulating the expression of target genes and promoting phenotypes in T cells, but can also be used to regulate target genes in any one or more of the lymphocytes described herein. In addition to T cells, lymphocytes can include NK cells, NKT cells, and any cells differentiated from stem cells into such lymphocytes and / or from progenitor cells (such as common lymphoid progenitor cells (CLP)). In some embodiments, the lymphocytes are differentiated from stem cells, such as hematopoietic stem cells or progenitor cells, or progenitor cells. In some embodiments, the lymphocytes are transdifferentiated from non-pluripotent cells of non-hematopoietic lineages.

[0217] In some embodiments, the lymphocytes for regulation are isolated or enriched populations of lympho-immune cells, such as isolated or enriched populations of T, NK, and / or NKT cells. In some embodiments, the cells for regulation are isolated or enriched T cells. In some embodiments, the cells for regulation are isolated or enriched NK cells. In some embodiments, the cells for regulation are isolated or enriched NKT cells. In some embodiments, any number of techniques known to those skilled in the art can be employed, such as Ficoll TMSeparation method to obtain a separated or enriched population or subset of immune cells containing regulatory T, NK, and / or NK T cells from a unit of blood. In one embodiment, T, NK, or NK T cells in the circulating blood of an individual are obtained by apheresis and separated from other nucleated white blood cells, red blood cells, and platelets, such as by Ficoll TM or separation by affinity-based selection. In some embodiments, the cells are primary cells. In some embodiments, the primary cells are separated or enriched from a peripheral blood sample of a subject (such as a human subject).

[0218] In some embodiments, the regulatory lymphocytes are differentiated in vitro from stem cells or progenitor cells. In some embodiments, the lymphocytes (such as T, NK, or NKT cells or their lineages) can be differentiated from stem cells, hematopoietic stem cells or progenitor cells (HSC) or progenitor cells. The progenitor cells can be CD34+ hematopoietic endothelial cells, multipotent progenitor cells, T cell progenitor cells, NK cell progenitor cells, or NKT cell progenitor cells. In some embodiments, the progenitor cells are lymphoid progenitor cells, such as common lymphoid progenitor cells, early thymic progenitor cells, pre-T cell progenitor cells, pre-NK progenitor cells, T progenitor cells, NK progenitor cells, or NKT progenitor cells. The stem cells can be pluripotent stem cells, such as induced pluripotent stem cells (iPSC) and embryonic stem cells (ESC). iPSC is a non-naturally occurring reprogrammed pluripotent cell. Once the cells of a subject are reprogrammed to a pluripotent state, the cells can be programmed or differentiated into the desired cell type or subtype, such as T cells, NK cells, or NKT cells.

[0219] In some embodiments, iPSC are differentiated into T, NK, or NKT cells through a multi-stage differentiation platform, where cells at different developmental stages can be induced to form a hematopoietic phenotype, ranging from mesodermal stem cells to fully differentiated T, NK, or NKT cells (see, for example, U.S. Patent No. 10,626,372).

[0220] In some embodiments, a population or subset of lymphoid cells is transdifferentiated in vitro from non-pluripotent cells of non-hematopoietic fate into hematopoietic lineage cells, or from non-pluripotent cells of a first hematopoietic cell type into a different hematopoietic cell type, which can be a T, NK, or NKT progenitor cell or a fully differentiated specific type of immune cell, such as T, NK, or NKT cells (see, for example, U.S. Patent No. 9,376,664 and U.S. Application No. 15 / 072,769, the disclosures of which are incorporated herein by reference in their entireties). In some embodiments, the non-pluripotent cells of non-hematopoietic fate are somatic cells, such as skin fibroblasts, adipose tissue-derived cells, and human umbilical vein endothelial cells (HUVEC). The somatic cells that can be used for transdifferentiation can be immortalized somatic cells.

[0221] Currently, various strategies for inducing pluripotency or enhancing efficiency in cells are being sought (Takahashi, K., and Yamanaka, S., Cell 126, 663 - 676 (2006); Takahashi et al., Cell 131, 861 - 872 (2007); Yu et al., Science 318, 1917 - 1920 (2007); Zhou et al., Cell Stem Cell 4, 381 - 384 (2009); Kim et al., Cell Stem Cell 4, 472 - 476 (2009); Yamanaka et al., 2009; Saha, K., Jaenisch, R., Cell Stem Cell 5, 584 - 595 (2009)), and for improving the efficiency of reprogramming (Shi et al., Cell Stem Cell 2, 525 - 528 (2008a); Shi et al., Cell Stem Cell 3, 568 - 574 (2008b); Huangfu et al., Nat Biotechnol 26, 795 - 797 (2008a); Huangfu et al., Nat Biotechnol 26, 1269 - 1275 (2008b); Silva et al., Plos Bio 6, e253. Doi:10.1371 / journal.Pbio.0060253 (2008); Lyssiotis et al., PNAS 106, 8912 - 8917 (2009); Ichida et al., Cell Stem Cell 5, 491 - 503 (2009); Maherali, N., Hochedlinger, K., Curr Biol 19, 1718 - 1723 (2009b); Esteban et al., Cell Stem Cell, 6, 71 - 79 (2010); and Feng et al., Cell Stem Cell 4, 301 - 312 (2009)), the disclosures of which are hereby incorporated by reference in their entirety.

[0222] It should be understood that cells that are positive (+) for a particular cell surface marker are cells that express the marker at a detectable level on their surface. Similarly, it should be understood that cells that are negative (-) for a particular cell surface marker are cells that express the marker at an undetectable level on their surface. Antibodies and other binding entities can be used to detect the expression level of the marker protein to identify or detect a given cell surface marker. Suitable antibodies can include polyclonal, monoclonal, fragments (such as Fab fragments), single-chain antibodies, and other forms of specific binding molecules. The above antibody reagents for cell surface markers are readily known to those skilled in the art. Some well-known methods for assessing the expression level of surface markers or proteins can be used, such as detection by affinity-based methods, such as immunoaffinity-based methods, such as in the case of surface markers, such as by flow cytometry. In some embodiments, the tag is a fluorophore, and the method for detecting or identifying surface markers on cells (such as T cells) is by flow cytometry. In some embodiments, different tags are used for each of the different markers by multicolor flow cytometry. In some embodiments, surface expression can be determined by flow cytometry, for example, by staining with an antibody that specifically binds to the marker and detecting the binding of the antibody to the marker.

[0223] In some embodiments, a cell (such as a T cell) is positive (pos or +) for a particular marker if a detectable particular marker is present on or within the cell, and the marker can be an intracellular marker or a surface marker. In some embodiments, surface expression is positive if the surface expression level detected by flow cytometry is significantly higher than the staining level detected by the same procedure with an isotype-matched control under other identical conditions, and / or is substantially similar or in some cases higher than the level of cells known to be positive for the marker and / or higher than the level of cells known to be negative for the marker.

[0224] In some embodiments, a cell (such as a T cell) is negative (neg or -) for a particular marker if no detectable particular marker is present on or within the cell, and the marker can be an intracellular marker or a surface marker. In some embodiments, surface expression is negative if the surface expression level detected by flow cytometry is not significantly higher than the staining level detected by the same procedure with an isotype-matched control under other identical conditions, and / or is lower than the level of cells known to be positive for the marker and / or is similar to the level of cells known to be negative for the marker.

[0225] In some aspects, the phenotype can be characterized by one or more functions of the cell. In some aspects, the phenotype is characterized by the multifunctional activity of T cells to produce more than one T cell-stimulating cytokine, such as determined in a multifunctional cytokine secretion assay after stimulation of T cells with a stimulant. In some embodiments, the T cells are multifunctional for producing two or more cytokines. In some embodiments, the T cells are multifunctional for producing two or more cytokines selected from interferon-γ (IFN-γ), interleukin-2 (IL-2), and TNF-α. In some embodiments, the multifunctional T cells produce IFN-γ, IL-2, and TNF-α. In some embodiments, the stimulant is a non-specific or antigen-independent T cell stimulant. In some embodiments, the non-specific or antigen-independent T cell stimulant is a polyclonal stimulant. In some embodiments, the non-specific or antigen-independent stimulant comprises PMA / ionomycin, anti-CD3 / anti-CD28, phytohemagglutinin (PHA), or concanavalin A (ConA). In some embodiments, the non-specific or antigen-independent T cell stimulant comprises PMA / ionomycin.

[0226] In specific embodiments, the production of the one or more cytokines is measured, detected, and / or quantified by intracellular cytokine staining. Intracellular cytokine staining (IC) using flow cytometry is a technique well-suited for studying cytokine production at the single cell level. It detects the production and accumulation of cytokines within the endoplasmic reticulum after cell stimulation, enabling the identification of cell populations that are positive or negative for the production of a specific cytokine, or the separation of high-producing and low-producing cells based on a threshold. In some embodiments, as described above, the stimulation can be performed using non-specific stimulation, e.g., stimulation that is not antigen-specific. For example, PMA / ionomycin can be used for non-specific cell stimulation. ICS can also be combined with other flow cytometry protocols for immunophenotyping using cell surface markers or MHC multimers to obtain cytokine production of specific cell subsets, making it an extremely flexible and versatile method. Other single cell techniques for measuring or detecting cytokine production include, but are not limited to, ELISPOT, limiting dilution, and T cell cloning. In some embodiments, assays for measuring the multifunctional cytokine secretion of multiple cytokines may include multiplex assays or other assays for assessing multifunctionality (see, e.g., Xue et al., (2017) Journal for ImmunoTherapy of Cancer 5:85). 2. Genes and Target Sites for Reducing Transcription

[0227] In some embodiments, the DNA targeting system represses (such as reduces) transcription of one or more target genes selected from the group consisting of: CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2. In some embodiments, provided herein are target sites for one or more genes, reduction of transcription of which promotes a phenotype in a cell. In some embodiments, provided herein are target sites for one or more genes, reduction of transcription of which promotes an increase in T cell effector function. In some embodiments, the reduction in transcription promotes an increase in T cell effector function upon T cell stimulation. In some embodiments, the one or more genes are selected from CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, or RASA2. In some embodiments, the one or more genes are selected from CBLB, CISH, MED12, MYB, PRDM1, and RASA2.

[0228] In some embodiments, the DNA targeting system comprises a plurality of DNA targeting modules. In some embodiments, each DNA targeting module targets a target site. In some embodiments, the plurality of DNA targeting modules target at least a first gene and a second gene, wherein the first and second genes are independently selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2. In some embodiments, the plurality of DNA targeting modules target a first gene and a second gene, wherein the first and second genes are independently selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2.

[0229] In some embodiments, the plurality of DNA targeting modules target at least a first gene, a second gene, and a third gene, wherein the first, second, and third genes are independently selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2. In some embodiments, the plurality of DNA targeting modules target a first gene, a second gene, and a third gene, wherein the first, second, and third genes are independently selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2.

[0230] In some embodiments, the DNA targeting system targets a combination of genes shown in Table 1. In some embodiments, the plurality of DNA targeting modules target a combination of genes shown in Table 1. In some embodiments, transcription of each gene in the combination is repressed by the DNA targeting system. Table 1. Combinations of genes targeted by a DNA targeting system for multiplex epigenetic modification to reduce transcription of target genes

[0231] In some embodiments, the DNA targeting system targets target sites of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and / or RASA2. In some embodiments, the target site comprises a sequence selected from any one of SEQ ID NO: 1-6, 10-33, 80-90, 102-112, 200-211, 292-295, 300-302, and 306-308, or a continuous portion of at least 14 nucleotides thereof, or the complementary sequence of any of the foregoing sequences. In some embodiments, the target site is a continuous portion of 15, 16, 17, 18, or 19 nucleotides in any one of SEQ ID NO: 1-6, 10-33, 80-90, 102-112, 200-211, 292-295, 300-302, and 306-308, or the complementary sequence of any of the foregoing sequences. In some embodiments, the target site is a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to all or a continuous portion of the target site sequence described above. In some embodiments, the target site is the sequence shown in any one of SEQ ID NO: 1-6, 10-33, 80-90, 102-112, 200-211, 292-295, 300-302, and 306-308. In some embodiments, the target site is the sequence shown in Table 5.

[0232] In some embodiments, the DNA targeting system targets target sites of CBLB, CISH, MED12, MYB, PRDM1, and / or RASA2.

[0233] In some embodiments, the DNA targeting system targets a target site of CBLB. In some embodiments, the target site for regulating the transcription of CBLB is within the coordinates chr3:105868857-105868876. In some embodiments, the target site is within the coordinates chr3:105868757-105868976. In some embodiments, the target site is within the coordinates chr3:105868807-105868926. In some embodiments, the target site is within the coordinates chr3:105868837-105868896. In some embodiments, the target site is at or includes the coordinates chr3:105868857-105868876. In some embodiments, the target site of CBLB is within 500 bp of the genomic coordinate chr3:105,655,461 of the human genome assembly GRCh38 (hg38) (e.g., +500 of 105,655,461 or -500 of 105,655,461 or a position between the foregoing). In some embodiments, the target site is within 400 bp, 300 bp, 200 bp, 100 bp, 80 bp, 60 bp, 50 bp, 40 bp, 30 bp, or 20 bp of the genomic coordinate chr3:105,655,461. In some embodiments, the target site is within approximately 80 bp of the genomic coordinate chr3:105,655,461. In some embodiments, the target site is in the -40 to +40 region of the genomic coordinate chr3:105,655,461. In some embodiments, the target site is within 20 bp of the genomic coordinate chr3:105,655,461. In some embodiments, the gRNA targets a target site in the -10 to +10 region of the genomic coordinate chr3:105,655,461. In some embodiments, any such target site contains or spans the genomic coordinate chr3:105,655,461, which is the transcription start site (TSS) of CBLB. In some embodiments, the target site contains the sequence shown in SEQ ID NO:11 or a continuous portion of at least 14 nucleotides thereof, or the complementary sequence of any of the foregoing. In some embodiments, the target site is a continuous portion of SEQ ID NO:11 that is 15, 16, 17, 18, or 19 nucleotides in length, or the complementary sequence of any of the foregoing. In some embodiments, the target site is a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to all or a continuous portion of the target site sequence described above. In some embodiments, the target site is the sequence shown in SEQ ID NO:11.

[0234] In some embodiments, the DNA targeting system targets a target site of CISH. In some embodiments, the target site for regulating the transcription of CISH is within the coordinates chr3:50,611,749-50,611,768. In some embodiments, the target site is within the coordinates chr3:50,611,649-50611868. In some embodiments, the target site is within the coordinates chr3:50,611,699-50611818. In some embodiments, the target site is within the coordinates chr3:50,611,729-50611788. In some embodiments, the target site is at or includes the coordinates chr1:50,611,749-50,611,768. In some embodiments, the target site of CISH is within 500 bp (e.g., +500 of 50,606,489 or -500 of 50,606,489 or a position between the foregoing) of the human genome assembly GRCh38 (hg38) genomic coordinate chr3:50,606,489. In some embodiments, the target site is within 400 bp, 300 bp, 200 bp, 100 bp, 80 bp, 60 bp, 50 bp, 40 bp, 30 bp, or 20 bp of the genomic coordinate chr3:50,606,489. In some embodiments, the target site is within approximately 80 bp of the genomic coordinate chr3:50,606,489. In some embodiments, the target site is in the -40 to +40 region of the genomic coordinate chr3:50,606,489. In some embodiments, the target site is located within 20 bp of the genomic coordinate chr3:50,606,489. In some embodiments, the gRNA targets a target site in the -10 to +10 region of the genomic coordinate chr3:50,606,489. In some embodiments, any such target site contains or spans the genomic coordinate chr3:50,606,489, which is the CISH transcription start site (TS). In some embodiments, the target site contains the sequence shown in SEQ ID NO:28 or a continuous portion of at least 14 nucleotides thereof, or the complementary sequence of any of the foregoing. In some embodiments, the target site is a continuous portion of SEQ ID NO:28 that is 15, 16, 17, 18, or 19 nucleotides in length, or the complementary sequence of any of the foregoing. In some embodiments, the target site is a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity with all or a continuous portion of the target site sequence described above. In some embodiments, the target site is the sequence shown in SEQ ID NO:28.

[0235] In some embodiments, the DNA targeting system targets a target site of MED12. In some embodiments, the target site for regulating the transcription of MED12 is within the coordinates ChrX:71,118,489-71,118,508. In some embodiments, the target site is within the coordinates ChrX:71,118,389-71,118,608. In some embodiments, the target site is within the coordinates ChrX:71,118,439-71,118,558. In some embodiments, the target site is within the coordinates ChrX:71,118,469-71,118,528. In some embodiments, the target site is at or includes the coordinates ChrX:71,118,489-71,118,508. In some embodiments, the target site of MED12 is within 500 bp of the genomic coordinate ChrX:71,118,596 of the human genome assembly GRCh38 (hg38) (e.g., +500 of 71,118,596 or -500 of 71,118,596 or a position between the foregoing). In some embodiments, the target site is within 400 bp, 300 bp, 200 bp, 100 bp, 80 bp, 60 bp, 50 bp, 40 bp, 30 bp, or 20 bp of the genomic coordinate chr3:50,606,489. In some embodiments, the target site is within approximately 80 bp of the genomic coordinate ChrX:71,118,596. In some embodiments, the target site is in the -40 to +40 region of the genomic coordinate 71,118,596. In some embodiments, the target site is located within 20 bp of the genomic coordinate ChrX:71,118,596. In some embodiments, the gRNA targets a target site in the -10 to +10 region of the genomic coordinate ChrX:71,118,596. In some embodiments, any such target site contains or spans the genomic coordinate ChrX:71,118,596, which is the transcription start site (TSS) of MED12. In some embodiments, the target site contains the sequence shown in SEQ ID NO:81 or a continuous portion of at least 14 nucleotides thereof, or the complementary sequence of any of the foregoing. In some embodiments, the target site is a continuous portion of SEQ ID NO:81 that is 15, 16, 17, 18, or 19 nucleotides in length, or the complementary sequence of any of the foregoing. In some embodiments, the target site is a sequence that has or has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity with all or a continuous portion of the target site sequences described herein. In some embodiments, the target site is the sequence shown in SEQ ID NO:81.

[0236] In some embodiments, the DNA targeting system targets a target site of MYB. In some embodiments, the target site for regulating the transcription of MYB is within the coordinates chr6:135,181,383-135,181,402. In some embodiments, the target site is within the coordinates chr6:135,181,283-135,181,502. In some embodiments, the target site is within the coordinates chr6:135,181,333-135,181,452. In some embodiments, the target site is within the coordinates chr6:135,181,363-135,181,422. In some embodiments, the target site is at or includes the coordinates chr6:135,181,383-135,181,402. In some embodiments, the target site of MYB is within 500 bp of the genomic coordinate chr6:135,181,308 of the human genome assembly GRCh38 (hg38) (e.g., +500 of 135,181,308 or -500 of 135,181,308 or a position between the foregoing). In some embodiments, the target site is within 400 bp, 300 bp, 200 bp, 100 bp, 80 bp, 60 bp, 50 bp, 40 bp, 30 bp, or 20 bp of the genomic coordinate chr6:135,181,308. In some embodiments, the target site is located within approximately 80 bp of the genomic coordinate chr6:135,181,308. In some embodiments, the target site is in the -40 to +40 region of the genomic coordinate 135,181,308. In some embodiments, the target site is located within 20 bp of the genomic coordinate chr6:135,181,308. In some embodiments, the gRNA targets a target site in the -10 to +10 region of the genomic coordinate chr6:135,181,308. In some embodiments, any such target site contains or spans the genomic coordinate chr6:135,181,308, which is the MYB transcription start site (TSS). In some embodiments, the target site contains the sequence shown in SEQ ID NO:18 or a continuous portion of at least 14 nucleotides thereof, or the complementary sequence of any of the foregoing. In some embodiments, the target site is a continuous portion of SEQ ID NO:18 that is 15, 16, 17, 18, or 19 nucleotides in length, or the complementary sequence of any of the foregoing. In some embodiments, the target site is a sequence having or at least having 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to all or a continuous portion of the target site sequence described above.In some embodiments, the target site is the sequence shown in SEQ ID NO:18.

[0237] In some embodiments, the DNA targeting system targets a target site of RASA2. In some embodiments, the target site for regulating the transcription of RASA2 is within the coordinates chr3:141,487,065-141,487,084. In some embodiments, the target site is within the coordinates chr3:141,486,965-141,487,184. In some embodiments, the target site is within the coordinates chr3:141,487,015-141,487,134. In some embodiments, the target site is within the coordinates chr3:141,487,045-141,487,104. In some embodiments, the target site is at or includes the coordinates chr3:141,487,065-141,487,084. In some embodiments, the target site of RASA2 is within 500 bp of the genomic coordinate chr3:141,487,027 of the human genome assembly GRCh38 (hg38) (e.g., +500 of 141,487,027 or -500 of 141,487,027 or a position between the foregoing). In some embodiments, the target site is within 400 bp, 300 bp, 200 bp, 100 bp, 80 bp, 60 bp, 50 bp, 40 bp, 30 bp, or 20 bp of the genomic coordinate chr3:141,487,027. In some embodiments, the target site is located within approximately 80 bp of the genomic coordinate chr3:141,487,027. In some embodiments, the target site is in the -40 to +40 region of the genomic coordinate 141,487,027. In some embodiments, the target site is located within 20 bp of the genomic coordinate chr3:141,487,027. In some embodiments, the gRNA targets a target site in the -10 to +10 region of the genomic coordinate chr3:141,487,027. In some embodiments, any such target site contains or spans the genomic coordinate chr3:141,487,027, which is the transcription start site (TSS) of RASA2. In some embodiments, the target site contains the sequence shown in SEQ ID NO:19 or a continuous portion of at least 14 nucleotides thereof, or the complementary sequence of any of the foregoing. In some embodiments, the target site is a continuous portion of SEQ ID NO:19 that is 15, 16, 17, 18, or 19 nucleotides in length, or the complementary sequence of any of the foregoing. In some embodiments, the target site is a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to all or a continuous portion of the target site sequence described above.In some embodiments, the target site is the sequence shown in SEQ ID NO: 19.

[0238] In some embodiments, the DNA targeting system targets a target site of PRDM1. In some embodiments, the target site for modulating the transcription of PRDM1 is within the coordinates chr6:106,086,371-106,086,390. In some embodiments, the target site is within the coordinates chr6:106,086,271-106,086,490. In some embodiments, the target site is within the coordinates chr6:106,086,321-106,086,440. In some embodiments, the target site is within the coordinates chr6:106,086,351-106,086,410. In some embodiments, the target site is at or includes the coordinates chr6:106,086,371-106,086,390. In some embodiments, the target site of PRDM1 is within 500 bp of the genomic coordinate chr6:106,086,336 of the human genome assembly GRCh38 (hg38) (e.g., +500 of 106,086,336 or -500 of 106,086,336 or a position between the foregoing). In some embodiments, the target site is within 400 bp, 300 bp, 200 bp, 100 bp, 80 bp, 60 bp, 50 bp, 40 bp, 30 bp, or 20 bp of the genomic coordinate chr6:106,086,336. In some embodiments, the target site is within approximately 80 bp of the genomic coordinate chr6:106,086,336. In some embodiments, the target site is in the -40 to +40 region of the genomic coordinate 106,086,336. In some embodiments, the target site is within 20 bp of the genomic coordinate chr6:106,086,336. In some embodiments, the gRNA targets a target site in the -10 to +10 region of the genomic coordinate chr6:106,086,336. In some embodiments, any such target site contains or spans the genomic coordinate chr6:106,086,336, which is the transcription start site (TSS) of PRDM1. In some embodiments, the target site contains the sequence shown in SEQ ID NO:33 or a continuous portion of at least 14 nucleotides thereof, or the complementary sequence of any of the foregoing. In some embodiments, the target site is a continuous portion of SEQ ID NO:33 that is 15, 16, 17, 18, or 19 nucleotides in length, or the complementary sequence of any of the foregoing. In some embodiments, the target site is a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to all or a continuous portion of the target site sequence described above.In some embodiments, the target site is the sequence shown in SEQ ID NO: 33.

[0239] In some embodiments, the DNA targeting system targets a combination of genes, any combination shown in Table 1. In some embodiments, the DNA targeting system targets a combination of genes selected from: CBLB and CCNC; CBLB and CD5; CBLB and CISH; CBLB and DGKZ; CBLB and ELOB; CBLB and FAS; CBLB and Fli1; CBLB and GATA3; CBLB and KDM1A; CBLB and MED12; CBLB and MYB; CBLB and PRDM1; CBLB and RASA2; CD5 and CISH; CD5 and MYB; CISH and DGKZ; CISH and MYB; CISH and RASA2; GATA3 and CD5; GATA3 and CISH; GATA3 and MYB; MED12 and CBLB; MED12 and CD5; MED12 and CISH; MED12 and DGKZ; MED12 and ELOB; MED12 and GATA3; MED12 and MYB; MED12 and PRDM1; MED12 and RASA2; MYB and RASA2; PRDM1 and CISH; PRDM1 and GATA3; PRDM1 and MYB; PRDM1 and RASA2; CD5, CISH and MYB; GATA3, CBLB and MYB; GATA3, CD5 and MYB; PRDM1, GATA3 and CISH, TGFBR2 and MED12; and TGFBR2, MED12 and CISH.

[0240] In some embodiments, the DNA targeting system targets CBLB and MYB. In some embodiments, the target site targeting CBLB can be any of the foregoing, and the target site targeting MYB can be any of the foregoing. In some embodiments, the DNA targeting system targets the target site of CBLB comprising the sequence shown in SEQ ID NO: 11, and the target site of MYB comprising the sequence shown in SEQ ID NO: 18.

[0241] In some embodiments, the DNA targeting system targets CBLB and MED12. In some embodiments, the target site targeting CBLB can be any of the foregoing, and the target site targeting MED12 can be any of the foregoing. In some embodiments, the DNA targeting system targets the target site of CBLB comprising the sequence shown in SEQ ID NO: 11, and the target site of MED12 comprising the sequence shown in SEQ ID NO: 81.

[0242] In some embodiments, the DNA targeting system targets CBLB and CCNC. In some embodiments, the target site for targeting CBLB can be any of the foregoing, and the target site for targeting CCNC can be any of the foregoing. In some embodiments, the DNA targeting system targets the target site of CBLB comprising the sequence shown in SEQ ID NO: 11, and the target site of CCNC comprising the sequence shown in SEQ ID NO: 104.

[0243] In some embodiments, the DNA targeting system targets MED12 and CISH. In some embodiments, the target site for targeting MED12 can be any of the foregoing, and the target site for targeting CISH can be any of the foregoing. In some embodiments, the DNA targeting system targets the target site of MED12 comprising the sequence shown in SEQ ID NO: 81, and the target site of CISH comprising the sequence shown in SEQ ID NO: 28.

[0244] In some embodiments, the DNA targeting system targets MED12, CBLB and CISH. In some embodiments, the target site for targeting MED12 can be any of the foregoing, the target site for targeting CBLB can be any of the foregoing, and the target site for targeting CISH can be any of the foregoing. In some embodiments, the DNA targeting system targets the target site of MED12 comprising the sequence shown in SEQ ID NO: 81, the target site of CBLB comprising the sequence shown in SEQ ID NO: 11, and the target site of CISH comprising the sequence shown in SEQ ID NO: 28.

[0245] In some embodiments, the DNA targeting system targets MED12 and RASA2. In some embodiments, the target site for targeting MED12 can be any of the foregoing, and the target site for targeting RASA2 can be any of the foregoing. In some embodiments, the DNA targeting system targets the target site of MED12 comprising the sequence shown in SEQ ID NO: 81, and the target site of RASA2 comprising the sequence shown in SEQ ID NO: 19.

[0246] In some embodiments, the DNA targeting system targets TGFBR2 and MED12. In some embodiments, the DNA targeting system targets the target site of TGBR2 comprising the sequence shown in SEQ ID NO: 301, and the target site of MED12 comprising the sequence shown in SEQ ID NO: 82.

[0247] In some embodiments, the DNA targeting system targets TGFBR2, CBLB, and CISH. In some embodiments, the DNA targeting system targets the target site of TGBR2 comprising the sequence shown in SEQ ID NO: 301, the target site of MED12 comprising the sequence shown in SEQ ID NO: 82, and the target site of CISH comprising the sequence shown in SEQ ID NO: 28.

[0248] In some embodiments, the DNA targeting system targets the target sites of a combination of genes for transcriptional repression, as shown in Table 2. Table 2. Combinations of genes and target sites for transcriptional repression

[0249] In some embodiments, the DNA targeting system targets the target site of CBLB containing the sequence shown in SEQ ID NO:11, and the target site of CCNC containing the sequence shown in SEQ ID NO:104. In some embodiments, the DNA targeting system targets the target site of CBLB containing the sequence shown in SEQ ID NO:11, and the target site of CD5 containing the sequence shown in SEQ ID NO:3. In some embodiments, the DNA targeting system targets the target site of CBLB containing the sequence shown in SEQ ID NO:11, and the target site of CISH containing the sequence shown in SEQ ID NO:30. In some embodiments, the DNA targeting system targets the target site of CBLB containing the sequence shown in SEQ ID NO:11, and the target site of DGKZ containing the sequence shown in SEQ ID NO:13. In some embodiments, the DNA targeting system targets the target site of CBLB containing the sequence shown in SEQ ID NO:11, and the target site of ELOB containing the sequence shown in SEQ ID NO:24. In some embodiments, the DNA targeting system targets the target site of CBLB containing the sequence shown in SEQ ID NO:11, and the target site of FAS containing the sequence shown in SEQ ID NO:204. In some embodiments, the DNA targeting system targets the target site of CBLB containing the sequence shown in SEQ ID NO:11, and the target site of Fli1 containing the sequence shown in SEQ ID NO:208. In some embodiments, the DNA targeting system targets the target site of CBLB containing the sequence shown in SEQ ID NO:11, and the target site of GATA3 containing the sequence shown in SEQ ID NO:26. In some embodiments, the DNA targeting system targets the target site of CBLB containing the sequence shown in SEQ ID NO:11, and the target site of KDM1A containing the sequence shown in SEQ ID NO:4. In some embodiments, the DNA targeting system targets the target site of CBLB containing the sequence shown in SEQ ID NO:11, and the target site of MED12 containing the sequence shown in SEQ ID NO:81. In some embodiments, the DNA targeting system targets the target site of CBLB containing the sequence shown in SEQ ID NO:11, and the target site of MYB containing the sequence shown in SEQ ID NO:18. In some embodiments, the DNA targeting system targets the target site of CBLB containing the sequence shown in SEQ ID NO:11, and the target site of PRDM1 containing the sequence shown in SEQ ID NO:32.In some embodiments, the DNA targeting system targets the target site of CBLB containing the sequence shown in SEQ ID NO: 11, and the target site of RASA2 containing the sequence shown in SEQ ID NO: 19. In some embodiments, the DNA targeting system targets the target site of CD5 containing the sequence shown in SEQ ID NO: 3, and the target site of CISH containing the sequence shown in SEQ ID NO: 30. In some embodiments, the DNA targeting system targets the target site of CD5 containing the sequence shown in SEQ ID NO: 3, and the target site of MYB containing the sequence shown in SEQ ID NO: 18. In some embodiments, the DNA targeting system targets the target site of CISH containing the sequence shown in SEQ ID NO: 30, and the target site of DGKZ containing the sequence shown in SEQ ID NO: 13. In some embodiments, the DNA targeting system targets the target site of CISH containing the sequence shown in SEQ ID NO: 30, and the target site of MYB containing the sequence shown in SEQ ID NO: 18. In some embodiments, the DNA targeting system targets the target site of CISH containing the sequence shown in SEQ ID NO: 30, and the target site of RASA2 containing the sequence shown in SEQ ID NO: 19. In some embodiments, the DNA targeting system targets the target site of GATA3 containing the sequence shown in SEQ ID NO: 26, and the target site of CD5 containing the sequence shown in SEQ ID NO: 3. In some embodiments, the DNA targeting system targets the target site of GATA3 containing the sequence shown in SEQ ID NO: 26, and the target site of CISH containing the sequence shown in SEQ ID NO: 30. In some embodiments, the DNA targeting system targets the target site of GATA3 containing the sequence shown in SEQ ID NO: 26, and the target site of MYB containing the sequence shown in SEQ ID NO: 18. In some embodiments, the DNA targeting system targets the target site of MED12 containing the sequence shown in SEQ ID NO: 81, and the target site of CBLB containing the sequence shown in SEQ ID NO: 11. In some embodiments, the DNA targeting system targets the target site of MED12 containing the sequence shown in SEQ ID NO: 81, and the target site of CD5 containing the sequence shown in SEQ ID NO: 3. In some embodiments, the DNA targeting system targets the target site of MED12 containing the sequence shown in SEQ ID NO: 81, and the target site of CISH containing the sequence shown in SEQ ID NO: 30.In some embodiments, the DNA targeting system targets a target site of MED12 comprising the sequence shown in SEQ ID NO:81, and a target site of DGKZ comprising the sequence shown in SEQ ID NO:13. In some embodiments, the DNA targeting system targets a target site of MED12 comprising the sequence shown in SEQ ID NO:81, and a target site of ELOB comprising the sequence shown in SEQ ID NO:24. In some embodiments, the DNA targeting system targets a target site of MED12 comprising the sequence shown in SEQ ID NO:81, and a target site of GATA3 comprising the sequence shown in SEQ ID NO:26. In some embodiments, the DNA targeting system targets a target site of MED12 comprising the sequence shown in SEQ ID NO:81, and a target site of MYB comprising the sequence shown in SEQ ID NO:18. In some embodiments, the DNA targeting system targets a target site of MED12 comprising the sequence shown in SEQ ID NO:81, and a target site of PRDM1 comprising the sequence shown in SEQ ID NO:32. In some embodiments, the DNA targeting system targets a target site of MED12 comprising the sequence shown in SEQ ID NO:81, and a target site of RASA2 comprising the sequence shown in SEQ ID NO:19. In some embodiments, the DNA targeting system targets a target site of MYB comprising the sequence shown in SEQ ID NO:18, and a target site of RASA2 comprising the sequence shown in SEQ ID NO:19. In some embodiments, the DNA targeting system targets a target site of PRDM1 comprising the sequence shown in SEQ ID NO:32, and a target site of CISH comprising the sequence shown in SEQ ID NO:30. In some embodiments, the DNA targeting system targets a target site of PRDM1 comprising the sequence shown in SEQ ID NO:32, and a target site of GATA3 comprising the sequence shown in SEQ ID NO:26. In some embodiments, the DNA targeting system targets a target site of PRDM1 comprising the sequence shown in SEQ ID NO:32, and a target site of MYB comprising the sequence shown in SEQ ID NO:18. In some embodiments, the DNA targeting system targets a target site of PRDM1 comprising the sequence shown in SEQ ID NO:32, and a target site of RASA2 comprising the sequence shown in SEQ ID NO:19.In some embodiments, the DNA targeting system targets the target site of CD5 comprising the sequence shown in SEQ ID NO:3, the target site of CISH comprising the sequence shown in SEQ ID NO:30, and the target site of MYB comprising the sequence shown in SEQ ID NO:18. In some embodiments, the DNA targeting system targets the target site of GATA3 comprising the sequence shown in SEQ ID NO:26, the target site of CBLB comprising the sequence shown in SEQ ID NO:11, and the target site of MYB comprising the sequence shown in SEQ ID NO:18. In some embodiments, the DNA targeting system targets the target site of GATA3 comprising the sequence shown in SEQ ID NO:26, the target site of CD5 comprising the sequence shown in SEQ ID NO:3, and the target site of MYB comprising the sequence shown in SEQ ID NO:18. In some embodiments, the DNA targeting system targets the target site of PRDM1 comprising the sequence shown in SEQ ID NO:32, the target site of GATA3 comprising the sequence shown in SEQ ID NO:26, and the target site of CISH comprising the sequence shown in SEQ ID NO:30.

[0250] In some embodiments, delivery of the DNA targeting system reduces (such as reduces or represses) transcription of one or more genes. In some embodiments, the reduction of gene expression in a cell (such as a T cell) is a log2 fold change of less than about -1.0. For example, compared to the level of the gene in control cells, the log2 fold change is less than or about -1.5, less than or about -2.0, less than or about -2.5, less than or about -3.0, less than or about -4.0, less than or about -5.0, less than or about -6.0, less than or about -7.0, less than or about -8.0, less than or about -9.0, less than or about -10.0, or any value between any of the foregoing. 3. Genes and target sites for increasing transcription

[0251] In some embodiments, delivery of the DNA targeting system increases transcription of one or more genes selected from the group consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1. In some embodiments, provided herein are target sites for one or more genes, an increase in transcription of which promotes a phenotype in a cell. In some embodiments, provided herein are target sites for one or more genes, an increase in transcription of which promotes an increase in T cell effector function. In some embodiments, the increase in transcription promotes enhanced T cell effector function upon T cell stimulation. In some embodiments, the one or more genes are selected from the group consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1. In some embodiments, the one or more genes are selected from EOMES, IL-2, LCP2, and TBX21.

[0252] In some embodiments, the DNA targeting system comprises a plurality of DNA targeting modules. In some embodiments, each DNA targeting module targets a target site. In some embodiments, the plurality of DNA targeting modules target at least a first gene and a second gene, wherein the first and second genes are independently selected from the group consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1. In some embodiments, the plurality of DNA targeting modules target a first gene and a second gene, wherein the first and second genes are independently selected from the group consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1. In some embodiments, the plurality of DNA targeting modules target a first gene and a second gene, wherein the first and second genes are independently selected from the group consisting of EOMES, IL-2, LCP2, and TBX21.

[0253] In some embodiments, the plurality of DNA targeting modules target at least a first gene, a second gene, and a third gene, wherein the first, second, and third genes are independently selected from the group consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1. In some embodiments, the plurality of DNA targeting modules target a first gene, a second gene, and a third gene, wherein the first, second, and third genes are independently selected from the group consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1.

[0254] In some embodiments, the DNA targeting system targets a combination of genes shown in Table 3. In some embodiments, the plurality of DNA targeting modules target a combination of genes shown in Table 3. In some embodiments, the transcription of each gene in the combination of genes is increased by the DNA targeting system. Table 3. Combinations of genes targeted by a multiplex epigenetic modification DNA targeting system for increasing transcription of target genes

[0255] In some embodiments, the DNA targeting system targets target sites of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and / or VAV1. In some embodiments, the target site comprises a sequence selected from any one of the sequences of SEQ ID NO: 7-9, 78, 144-156, 170, 172-177, and 184-191, or a continuous portion of at least 14 nucleotides thereof, or a complementary sequence of any of the foregoing sequences. In some embodiments, the target site is a continuous portion of 15, 16, 17, 18, or 19 nucleotides of any one of SEQ ID NO: 7-9, 78, 144-156, 170, 172-177, and 184-191, or a complementary sequence of any of the foregoing sequences. In some embodiments, the target site is a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to all or a continuous portion of the target site sequence described above. In some embodiments, the target site is the sequence shown in any one of SEQ ID NO: 7-9, 78, 144-156, 170, 172-177, and 184-191. In some embodiments, the target site is the sequence shown in Table 6.

[0256] In some embodiments, the DNA targeting system targets target sites of IL-2, EOMES, LCP2, and / or TBX21.

[0257] In some embodiments, the DNA targeting system targets the target site of IL-2. In some embodiments, the target site for regulating the transcription of IL-2 is within the coordinates chr4:122,456,711-122,456,729. In some embodiments, the target site is within the coordinates chr4:122,456,611-122,456,829. In some embodiments, the target site is within the coordinates chr4:122,456,661-122,456,779. In some embodiments, the target site is within the coordinates chr4:122,456,691-122,456,749. In some embodiments, the target site is or includes the coordinates chr4:122,456,711-122,456,729. In some embodiments, the target site of IL-2 is within 500 bp of the genomic coordinate chr4:122,451,470 of the human genome assembly GRCh38 (hg38) (e.g., +500 of 122,451,470 or -500 of 122,451,470 or a position between the foregoing). In some embodiments, the target site is within 400 bp, 300 bp, 200 bp, 100 bp, 80 bp, 60 bp, 50 bp, 40 bp, 30 bp, or 20 bp of the genomic coordinate chr4:122,451,470. In some embodiments, the target site is within approximately 80 bp of the genomic coordinate chr4:122,451,470. In some embodiments, the target site is in the -40 to +40 region of the genomic coordinate 122,451,470. In some embodiments, the target site is within 20 bp of the genomic coordinate chr4:122,451,470. In some embodiments, the gRNA targets the target site in the -10 to +10 region of the genomic coordinate chr4:122,451,470. In some embodiments, any such target site contains or spans the genomic coordinate chr4:122,451,470, which is the transcription start site (TSS) of IL-2. In some embodiments, the target site contains the sequence shown in SEQ ID NO:78 or a continuous portion of at least 14 nucleotides thereof, or the complementary sequence of any of the foregoing. In some embodiments, the target site is a continuous portion of SEQ ID NO:78 that is 15, 16, 17, 18, or 19 nucleotides in length, or the complementary sequence of any of the foregoing. In some embodiments, the target site is a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to all or a continuous portion of the target site sequence described above.In some embodiments, the target site is the sequence shown in SEQ ID NO: 78.

[0258] In some embodiments, the DNA targeting system targets a target site of EOMES. In some embodiments, the target site for regulating the transcription of EOMES is within the coordinates chr3:27,722,421-27,722,440. In some embodiments, the target site is within the coordinates chr3:27,722,321-27,722,540. In some embodiments, the target site is within the coordinates chr3:27,722,371-27,722,490. In some embodiments, the target site is within the coordinates chr3:27,722,401-27,722,460. In some embodiments, the target site is or comprises the coordinates chr3:27,722,421-27,722,440. In some embodiments, the target site of EOMES is within 500 bp of the genomic coordinate chr3:27,715,953 of the human genome assembly GRCh38 (hg38) (e.g., +500 of 27,715,953 or -500 of 27,715,953 or a position between the foregoing). In some embodiments, the target site is within 400 bp, 300 bp, 200 bp, 100 bp, 80 bp, 60 bp, 50 bp, 40 bp, 30 bp, or 20 bp of the genomic coordinate chr3:27,715,953. In some embodiments, the target site is within approximately 80 bp of the genomic coordinate chr3:27,715,953. In some embodiments, the target site is in the -40 to +40 region of the genomic coordinate 27,715,953. In some embodiments, the target site is within 20 bp of the genomic coordinate chr3:27,715,953. In some embodiments, the gRNA targets a target site in the -10 to +10 region of the genomic coordinate chr3:27,715,953. In some embodiments, any such target site contains or spans the genomic coordinate chr3:27,715,953, which is the transcription start site (TSS) of EOMES. In some embodiments, the target site contains the sequence shown in SEQ ID NO:149 or a contiguous portion of at least 14 nucleotides thereof, or the complementary sequence of any of the foregoing. In some embodiments, the target site is a contiguous portion of SEQ ID NO:149 that is 15, 16, 17, 18, or 19 nucleotides in length, or the complementary sequence of any of the foregoing. In some embodiments, the target site is a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to all or a contiguous portion of the target site sequence described above. In some embodiments, the target site is the sequence shown in SEQ ID NO:149.

[0259] In some embodiments, the DNA targeting system targets a target site of LCP2. In some embodiments, the target site for regulating the transcription of LCP2 is within the coordinates chr5:170,298,278-170,298,297. In some embodiments, the target site is within the coordinates chr5:170,298,178-170,298,397. In some embodiments, the target site is within the coordinates chr5:170,298,228-170,298,347. In some embodiments, the target site is within the coordinates chr5:170,298,258-170,298,317. In some embodiments, the target site is or comprises the coordinates chr5:170,298,278-170,298,297. In some embodiments, the target site of LCP2 is within 500 bp of the genomic coordinate chr5:170,246,233 of the human genome assembly GRCh38 (hg38) (e.g., +500 of 170,246,233 or -500 of 170,246,233 or a position between the foregoing). In some embodiments, the target site is within 400 bp, 300 bp, 200 bp, 100 bp, 80 bp, 60 bp, 50 bp, 40 bp, 30 bp, or 20 bp of the genomic coordinate chr5:170,246,233. In some embodiments, the target site is within approximately 80 bp of the genomic coordinate chr5:170,246,233. In some embodiments, the target site is in the -40 to +40 region of the genomic coordinate 170,246,233. In some embodiments, the target site is within 20 bp of the genomic coordinate chr5:170,246,233. In some embodiments, the gRNA targets a target site in the -10 to +10 region of the genomic coordinate chr5:170,246,233. In some embodiments, any such target site contains or spans the genomic coordinate chr5:170,246,233, which is the transcription start site (TSS) of LCP2. In some embodiments, the target site comprises the following sequence, which is selected from SEQ ID NO:151 or a continuous portion of at least 14 nucleotides thereof, or the complementary sequence of any of the foregoing. In some embodiments, the target site is a continuous portion of SEQ ID NO:151 that is 15, 16, 17, 18, or 19 nucleotides in length, or the complementary sequence of any of the foregoing. In some embodiments, the target site is a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to all or a continuous portion of the target site sequence described above.In some embodiments, the target site is the sequence shown in SEQ ID NO: 151.

[0260] In some embodiments, the DNA targeting system targets a target site of TBX21. In some embodiments, the target site for regulating the transcription of TBX21 is within the coordinates chr17:47,733,109-47,733,128. In some embodiments, the target site is within the coordinates chr17:47,733,009-47,733,228. In some embodiments, the target site is within the coordinates chr17:47,733,059-47,733,178. In some embodiments, the target site is within the coordinates chr17:47,733,089-47,733,148. In some embodiments, the target site is or comprises the coordinates chr17:47,733,109-47,733,128. In some embodiments, the target site of TBX21 is within 500 bp of the human genome assembly GRCh38 (hg38) genomic coordinate chr17:41,733,236 (e.g., +500 of 41,733,236 or -500 of 41,733,236 or a position therebetween). In some embodiments, the target site is within 400 bp, 300 bp, 200 bp, 100 bp, 80 bp, 60 bp, 50 bp, 40 bp, 30 bp, or 20 bp of the genomic coordinate chr17:41,733,236. In some embodiments, the target site is within approximately 80 bp of the genomic coordinate chr17:41,733,236. In some embodiments, the target site is in the -40 to +40 region of the genomic coordinate 41,733,236. In some embodiments, the target site is located within 20 bp of the genomic coordinate chr17:41,733,236. In some embodiments, the gRNA targets a target site in the -10 to +10 region of the genomic coordinate chr17:41,733,236. In some embodiments, any such target site contains or spans the genomic coordinate chr17:41,733,236, which is the transcription start site (TSS) of TBX21. In some embodiments, the target site comprises a sequence selected from SEQ ID NO:155 or a continuous portion of at least 14 nucleotides thereof, or the complementary sequence of any of the foregoing. In some embodiments, the target site is a continuous portion of SEQ ID NO:155 that is 15, 16, 17, 18, or 19 nucleotides in length, or the complementary sequence of any of the foregoing. In some embodiments, the target site is a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to all or a continuous portion of the target site sequence described above.In some embodiments, the target site is the sequence shown in SEQ ID NO: 155.

[0261] In some embodiments, the DNA targeting system targets a combination of genes, any combination as shown in Table 1. In some embodiments, the DNA targeting system targets a combination of genes selected from: BATF and IL-2; BATF and VAV1; CD28 and BATF; CD28 and EOMES; CD28 and IL-2; CD28 and LCP2; CD28 and TBX21; CD28 and VAV1; EOMES and BATF; EOMES and LCP2; EOMES and TBX21; EOMES and VAV1; LCP2 and BATF; LCP2 and IL-2; LCP2 and TBX21; LCP2 and VAV1; TBX21 and BATF; TBX21 and IL-2; TBX21 and TBX21; TBX21 and VAV1; and VAV1 and IL-2.

[0262] In some embodiments, the DNA targeting system targets IL-2 and VAV1. In some embodiments, the target site targeting IL-2 can be any of the foregoing, and the target site targeting VAV1 can be any of the foregoing. In some embodiments, the DNA targeting system targets the target site of IL-2 comprising the sequence shown in SEQ ID NO: 78, and the target site of VAV1 comprising the sequence shown in SEQ ID NO: 170.

[0263] In some embodiments, the DNA targeting system targets IL-2 and LCP2. In some embodiments, the target site targeting IL-2 can be any of the foregoing, and the target site targeting LCP2 can be any of the foregoing. In some embodiments, the DNA targeting system targets the target site of IL-2 comprising the sequence shown in SEQ ID NO: 78, and the target site of LCP2 comprising the sequence shown in SEQ ID NO: 151.

[0264] In some embodiments, the DNA targeting system targets IL-2 and TBX21. In some embodiments, the target site targeting IL-2 can be any of the foregoing, and the target site targeting TBX21 can be any of the foregoing. In some embodiments, the DNA targeting system targets the target site of IL-2 comprising the sequence shown in SEQ ID NO: 78, and the target site of TBX21 comprising the sequence shown in SEQ ID NO: 155.

[0265] In some embodiments, the DNA targeting system targets IL-2 and EOMES. In some embodiments, the target site for targeting IL-2 can be any of the foregoing, and the target site for targeting EOMES can be any of the foregoing. In some embodiments, the DNA targeting system targets the target site of IL-2 comprising the sequence shown in SEQ ID NO:78, and the target site of EOMES comprising the sequence shown in SEQ ID NO:149.

[0266] In some embodiments, the DNA targeting system targets IL2RB and VAV1.

[0267] In some embodiments, the DNA targeting system targets a combination of target sites of a combination of genes for transcriptional activation, as shown in Table 4. Table 4. Combinations of genes and target sites for transcriptional activation

[0268] In some embodiments, the DNA targeting system targets the target site of BATF comprising the sequence shown in SEQ ID NO: 172, and the target site of IL-2 comprising the sequence shown in SEQ ID NO: 78. In some embodiments, the DNA targeting system targets the target site of BATF comprising the sequence shown in SEQ ID NO: 172, and the target site of VAV1 comprising the sequence shown in SEQ ID NO: 170. In some embodiments, the DNA targeting system targets the target site of CD28 comprising the sequence shown in SEQ ID NO: 144, and the target site of BATF comprising the sequence shown in SEQ ID NO: 172. In some embodiments, the DNA targeting system targets the target site of CD28 comprising the sequence shown in SEQ ID NO: 144, and the target site of EOMES comprising the sequence shown in SEQ ID NO: 149. In some embodiments, the DNA targeting system targets the target site of CD28 comprising the sequence shown in SEQ ID NO: 144, and the target site of IL-2 comprising the sequence shown in SEQ ID NO: 78. In some embodiments, the DNA targeting system targets the target site of CD28 comprising the sequence shown in SEQ ID NO: 144, and the target site of LCP2 comprising the sequence shown in SEQ ID NO: 151. In some embodiments, the DNA targeting system targets the target site of CD28 comprising the sequence shown in SEQ ID NO: 144, and the target site of TBX21 comprising the sequence shown in SEQ ID NO: 155. In some embodiments, the DNA targeting system targets the target site of CD28 comprising the sequence shown in SEQ ID NO: 144, and the target site of VAV1 comprising the sequence shown in SEQ ID NO: 170. In some embodiments, the DNA targeting system targets the target site of EOMES comprising the sequence shown in SEQ ID NO: 149, and the target site of BATF comprising the sequence shown in SEQ ID NO: 172. In some embodiments, the DNA targeting system targets the target site of EOMES comprising the sequence shown in SEQ ID NO: 149, and the target site of LCP2 comprising the sequence shown in SEQ ID NO: 151. In some embodiments, the DNA targeting system targets the target site of EOMES comprising the sequence shown in SEQ ID NO: 149, and the target site of TBX21 comprising the sequence shown in SEQ ID NO: 155.In some embodiments, the DNA targeting system targets a target site of EOMES comprising the sequence shown in SEQ ID NO: 149, and a target site of VAV1 comprising the sequence shown in SEQ ID NO: 170. In some embodiments, the DNA targeting system targets a target site of LCP2 comprising the sequence shown in SEQ ID NO: 151, and a target site of BATF comprising the sequence shown in SEQ ID NO: 172. In some embodiments, the DNA targeting system targets a target site of LCP2 comprising the sequence shown in SEQ ID NO: 151, and a target site of IL-2 comprising the sequence shown in SEQ ID NO: 78. In some embodiments, the DNA targeting system targets a target site of LCP2 comprising the sequence shown in SEQ ID NO: 151, and a target site of TBX21 comprising the sequence shown in SEQ ID NO: 155. In some embodiments, the DNA targeting system targets a target site of LCP2 comprising the sequence shown in SEQ ID NO: 151, and a target site of VAV1 comprising the sequence shown in SEQ ID NO: 170. In some embodiments, the DNA targeting system targets a target site of TBX21 comprising the sequence shown in SEQ ID NO: 155, and a target site of BATF comprising the sequence shown in SEQ ID NO: 172. In some embodiments, the DNA targeting system targets a target site of TBX21 comprising the sequence shown in SEQ ID NO: 155, and a target site of IL-2 comprising the sequence shown in SEQ ID NO: 78. In some embodiments, the DNA targeting system targets a target site of TBX21 comprising the sequence shown in SEQ ID NO: 155, and a target site of TBX21 comprising the sequence shown in SEQ ID NO: 155. In some embodiments, the DNA targeting system targets a target site of TBX21 comprising the sequence shown in SEQ ID NO: 155, and a target site of VAV1 comprising the sequence shown in SEQ ID NO: 170. In some embodiments, the DNA targeting system targets a target site of VAV1 comprising the sequence shown in SEQ ID NO: 170, and a target site of IL-2 comprising the sequence shown in SEQ ID NO: 78.

[0269] In some embodiments, delivery of the DNA targeting system increases the expression (such as transcription) of one or more genes. In some embodiments, the increase in gene expression in a cell (such as a T cell) is a log2 fold change of greater than about 1.0. For example, compared to the level of the gene in control cells, the log2 fold change is greater than or about 1.5, greater than or about 2.0, greater than or about 2.5, greater than or about 3.0, greater than or about 4.0, greater than or about 5.0, greater than or about 6.0, greater than or about 7.0, greater than or about 8.0, greater than or about 9.0, greater than or about 10.0, or any value between any of the foregoing. C. CRISPR / Cas-Based DNA Targeting Systems and DNA Binding Domains

[0270] Provided herein are multiplex epigenetic targeting DNA targeting systems based on the CRISPR / Cas system, i.e., CRISPR / Cas-based DNA targeting systems, which are capable of binding to target sites of target genes, or combinations of target sites, such as combinations of target genes. In some embodiments, the CRISPR / Cas DNA binding domain is nuclease-inactivated, such as comprising dCas (such as dCas9), so that the system binds to the target sites of target genes without mediating nucleic acid cleavage at the target sites. The CRISPR / Cas-based DNA targeting systems can be used to modulate the expression of target genes in cells (such as T cells). In some embodiments, the target genes can include any of the genes described herein, including any of those described in Section I.B above. In some embodiments, the target sites of the target genes can include any of the genes described herein, including any of those described in Section I.B above. In some embodiments, the CRISPR / Cas-based DNA targeting system can comprise any known Cas enzyme and is generally nuclease-inactivated or dCas. In some embodiments, the CRISPR / Cas-based DNA targeting system comprises a fusion protein of a nuclease-inactivated Cas protein or a variant thereof and an effector domain, and at least one gRNA. In some embodiments, the effector domain decreases the transcription of one or more genes (such as the effector domain is a transcriptional repressor, such as any of those described in Section I.E.1). In some embodiments, the effector domain increases the transcription of one or more genes (such as the effector domain is a transcriptional activator, such as any of those described in Section I.E.2).

[0271] The CRISPR system (also known as the CRISPR / Cas system or CRISPR-Cas system) refers to a conserved microbial nuclease system present in the genomes of bacteria and archaea, which provides a form of acquired immunity against invading bacteriophages and plasmids. Clustered regularly interspaced short palindromic repeats (CRISPR) refer to loci containing multiple repetitive DNA elements separated by non-repetitive DNA sequences called spacers. Spacers are short sequences of foreign DNA that are incorporated into the genome between CRISPR repeats as a "memory" of past exposure. Spacers encode the DNA-targeting portions of RNA molecules, thereby conferring specificity for nucleic acid cleavage by the CRISPR system. The CRISPR locus contains or is adjacent to one or more CRISPR-associated (Cas) genes, which can act as RNA-guided nucleases for mediating cleavage; and non-protein-coding DNA elements encoding RNA molecules capable of programming the specificity of CRISPR-mediated nucleic acid cleavage.

[0272] In type II CRISPR / Cas systems with the Cas protein Cas9, two RNA molecules and the Cas9 protein form a ribonucleoprotein (RNP) complex to direct Cas9 nuclease activity. CRISPR RNA (crRNA) contains a spacer sequence complementary to the target nucleic acid sequence (target site) and encodes the sequence specificity of the complex. Trans-activating crRNA (tracrRNA) base pairs with a portion of the crRNA and forms a structure complexed with the Cas9 protein, thereby forming the Cas / RNA RNP complex. In class 2 CRISPR / Cas systems with the Cas protein Cas9, two RNA molecules and the Cas9 protein form a ribonucleoprotein (RNP) complex to direct Cas9 nuclease activity. CRISPR RNA (crRNA) contains a spacer sequence complementary to the target nucleic acid sequence (target site), and it encodes the sequence specificity of the complex. Trans-activated crRNA (tracrRNA) base pairs with a portion of the crRNA and forms a structure complexed with the Cas9 protein, forming the Cas / RNA RNP complex.

[0273] Naturally occurring CRISPR / Cas systems (such as those with Cas9) have been engineered to allow for the efficient programming of Cas / RNA RNPs to target desired sequences in cells of interest, thereby enabling gene editing and regulation of gene expression. The tracrRNA and crRNA have been engineered to form a single chimeric guide RNA molecule, commonly referred to as guide RNA (gRNA), for example, as described in WO 2013 / 176772, WO 2014 / 093661, WO 2014 / 093655, Jinek, M. et al. Science 337(6096):816-21(2012) or Cong, L. et al. Science 339(6121):819-23(2013). The spacer sequence of the gRNA can be selected by the user to target the Cas / gRNA RNP complex to a desired locus, such as a desired target site in a target gene.

[0274] Cas proteins have also been engineered to be catalytically inactive or nuclease - inactive to allow targeting of the Cas / gRNA RNP without inducing cleavage at the target site. Mutations in the Cas protein can reduce or eliminate the nuclease activity of the Cas protein, rendering the Cas protein catalytically inactive. Cas proteins with reduced or eliminated nuclease activity are referred to as dead Cas (dCas) or nuclease - inactive Cas (iCas) proteins and can be used interchangeably herein. Exemplary dead Cas9 (dCas9) derived from Streptococcus pyogenes contains silent mutations (D10A and H840A) in the RuvC and HNH nuclease domains, for example, as described in WO 2013 / 176772, WO2014 / 093661, Jinek, M. et al. Science 337(6096):816-21(2012) and Qi, L. et al. Cell 152(5):1173-83(2013). Exemplary dCas variants derived from the Cas12 system (i.e., Cpf1) are described in, for example, WO2017 / 189308 and Zetsche, B. et al. Cell163(3):759-71(2015). Conserved domains that mediate nucleic acid cleavage (such as the RuvC and HNH endonuclease domains) can be readily identified in Cas orthologs and can be mutated to generate inactive variants, for example, as described in Zetsche, B. et al. Cell163(3):759-71(2015).

[0275] dCas fusion proteins with transcriptional and / or epigenetic regulators have been used as a versatile platform for ectopically regulating gene expression in target cells. These include fusions of Cas with effector domains such as transcriptional activators or transcriptional repressors. For example, fusing dCas9 with a transcriptional activator such as VP64 (a polypeptide consisting of four tandem copies of VP16, the 16-amino acid transcriptional activation domain of herpes simplex virus) can result in strong induction of gene expression. Alternatively, fusing dCas9 with a transcriptional repressor such as KRAB (Krüppel-associated box) can result in strong repression of gene expression. A variety of dCas fusion proteins with effector domains can be engineered to regulate gene expression, as described, for example, in WO2014 / 197748, WO2016 / 130600, WO2017 / 180915, WO2021 / 226555, WO2013 / 176772, WO2014 / 152432, WO2014 / 093661, WO2021 / 247570, Adli, M. Nat. Commun. 9, 1911 (2018), Perez-Pinera, P. et al., Nat. Methods 10, 973-976 (2013), Mali, P. et al., Nat. Biotechnol. 31, 833-838 (2013), Maeder, M. L. et al., Nat. Methods 10, 977-979 (2013), Gilbert, l. a. et al., Cell 154(2):442-451(2013), and j. et al., Cell 184(9):2503-2519(2021).

[0276] In some aspects, a DNA targeting system is provided that includes a fusion protein comprising a DNA binding domain and at least one effector domain, the DNA binding domain comprising a nuclease-inactivated Cas protein or variant thereof, and the effector domain being used to reduce transcription or induce transcriptional repression (i.e., a transcriptional repressor) when targeted to a target gene in a cell (such as a T cell). In some embodiments, the dCas protein is any suitable dCas protein, such as any of those described in Section I.C. In some embodiments, the dCas protein is a dCas9 protein, such as dSpCas9 or dSaCas9. In some embodiments, the at least one effector domain is any suitable transcriptional repressor effector domain, such as any of those described in Section I.E.1, such as KRAB and / or DNMT3A / L. In some embodiments, the at least one effector domain is KRAB. In some embodiments, the fusion protein is a dCas9-KRAB or dCas9-KRAB-DNMT3A / L fusion protein, such as those described in Section I.F. In such embodiments, the DNA targeting system further includes one or more gRNAs (such as those described in Section I.C.2.a), provided in combination with or as a complex with the dCas protein or variant thereof, for targeting the DNA targeting system to a target site of a target gene. In some embodiments, the fusion protein is guided by a guide RNA to a specific target site sequence of a target gene, wherein the effector domain mediates targeted epigenetic modification to reduce or repress transcription of the target gene. In some embodiments, a combination of gRNAs guides the fusion protein to a combination of target site sequences in a combination of genes, wherein the effector domain mediates targeted epigenetic modification to reduce or repress transcription of the combination of target genes. As described below, various effector domains for reducing or repressing transcription can be used.

[0277] In some aspects, a DNA targeting system is provided that includes a fusion protein comprising a DNA binding domain and an effector domain, where the DNA binding domain comprises a nuclease-inactivated Cas protein or variant thereof, and where the effector domain is used to increase transcription or induce transcriptional activation (i.e., a transcriptional activator) when targeted to a target gene in a cell (such as a T cell). In some embodiments, the dCas protein is any suitable dCas protein, such as any of those described in Section I.C. In some embodiments, the dCas protein is a dCas9 protein, such as dSpCas9 or dSaCas9. In some embodiments, the at least one effector domain is any suitable transcriptional activator effector domain, such as any of those described in Section I.E.2, such as VP64. In some embodiments, the at least one effector domain is VP64. In some embodiments, the fusion protein is a dCas9-VP64 fusion protein, such as described in Section I.F. In such embodiments, the DNA targeting system further includes one or more gRNAs (such as those described in Section I.C.2.b), provided in combination with or as a complex with the dCas protein or variant thereof, for targeting the DNA targeting system to a target site of a target gene. In some embodiments, the fusion protein is guided by a guide RNA to a specific target site sequence of a target gene, where the effector domain mediates a targeted epigenetic modification to increase or activate transcription of the target gene. In some embodiments, a combination of gRNAs guides the fusion protein to a combination of target site sequences in a combination of genes, where the effector domain mediates a targeted epigenetic modification to increase or activate transcription of the combination of target genes. As described below, various effector domains for increasing or activating transcription can be used. 1. CRISPR / Cas-based DNA binding domain

[0278] In some aspects, the DNA binding domain comprises a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated (Cas) protein or variant thereof, or is derived from a Cas protein or variant thereof. In certain embodiments herein, the Cas protein is nuclease-inactivated (i.e., is a dCas protein).

[0279] In some embodiments, the Cas protein is derived from a type I CRISPR system (i.e., a multi-Cas protein system), such as a type I, type III, or type IV CRISPR system. In some embodiments, the Cas protein is derived from a type II CRISPR system (i.e., a single Cas protein system), such as a type II, type V, or type VI CRISPR system. In some embodiments, the Cas nuclease is from a type V CRISPR system. In some embodiments, the Cas protein is derived from a Cas12 protein (i.e., Cpf1) or a variant thereof, such as those described in WO2017 / 189308 and Zetsche, B. et al., Cell. 163(3):759-71(2015). In some embodiments, the Cas protein is derived from a type II CRISPR system. In some embodiments, the Cas protein is derived from a Cas9 protein or a variant thereof, such as those described in WO2013 / 176772, WO2014 / 152432, WO2014 / 093661, WO2014 / 093655, Jinek, M. et al., Science 337(6096):816-21(2012), Mali, P. et al., Science 339(6121):823-6(2013), Cong, L. et al., Science 339(6121):819-23(2013), Perez-Pinera, P. et al., Nat. Methods 10,973-976(2013) or Mali, P. et al., Nat. Biotechnol. 31,833-838(2013). Various CRISPR / Cas systems and related Cas proteins for gene editing and regulation have been described, for example, in Moon, S.B. et al Exp. Mol. Med. 51,1-11(2019), Zhang, F.Q. Rev. Biophys. 52,E6(2019) and Makarova K.S. et al Methods Mol. Biol. 1311:47-75(2015).

[0280] In some embodiments, the dCas9 protein may comprise a sequence derived from a naturally occurring Cas9 molecule, or a variant thereof. In some embodiments, the dCas9 protein may comprise a sequence derived from a naturally occurring Cas9 molecule of Streptococcus pyogenes, Streptococcus thermophilus, Staphylococcus aureus, Campylobacter jejuni, Neisseria meningitidis, Francisella novicida, Streptococcus canis, Staphylococcus auricularis, or a variant thereof. In some embodiments, the dCas9 protein comprises a sequence derived from a naturally occurring Cas9 molecule of Staphylococcus aureus. In some embodiments, the dCas9 protein comprises a sequence derived from a naturally occurring Cas9 molecule of Streptococcus pyogenes.

[0281] Non-limiting examples of Cas9 orthologs from other bacterial strains include, but are not limited to: Cas proteins identified in the following: the marine unicellular cyanobacterium Acaryochloris marina MBIC11017; Acetohalobium arabaticum DSM 5501; Acidithiobacillus caldus; Acidithiobacillus ferrooxidans ATCC 23270; Alicyclobacillus acidocaldarius LAA1; Alicyclobacillus acidocaldarius subsp.Acidocaldarius) DSM 446; Allochromatium vinosum DSM 180; Ammonifex degensii KC4; Anabaena variabilis ATCC 29413; Arthrospira maxima CS-328; Arthrospira platensis strain Paraca; Arthrospira sp. PCC 8005; Bacillus pseudomycoides DSM 12442; Bacillus selenitireducens MLS10; Burkholderiales bacterium 1_1_47; Caldicelulosiruptor becscii DSM 6725; Candidatus Desulforudis audaxviator MP104C; Caldicellulosiruptor hydrothermalis 108; Clostridium phage c-st; Clostridium botulinum A3 strain Loch Maree; Clostridium botulinum Ba4 strain 657; Clostridium difficile QCD-63q42; Crocosphaera watsonii WH 8501; Cyanothece sp. ATCC 51142; Cyanothece sp. CCY0110; Cyanothece sp. PCC 7424; Cyanothece sp. PCC 7822; Exiguobacterium sibiricum 255-15; Finegoldia magna ATCC 29328; Ktedonobacter racemifer DSM 44963; Lactobacillus delbrueckii subsp.Lactobacillus delbrueckii subsp. bulgaricus) PB2003 / 044-T3-4; Lactobacillus salivarius ATCC 11741; Listeria innocua; Lyngbya species PCC 8106; Marinobacter species ELB17; Methanohalobium evestigatum Z-7303; Microcystis phage Ma-LMM01; Microcystis aeruginosa NIES-843; Microscilla marina ATCC23134; Microcoleus chthonoplastes PCC 7420; Neisseria meningitidis; Nitrosococcus halophilus Nc4; Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111; Nodularia spumigena CCY9414; Nostoc species PCC 7120; Oscillatoria species PCC 6506; Pelotomaculum thermopropionicum SI; Petrotoga mobilis SJ95; Polaromonas naphthalenivorans CJ2; Polaromonas species JS666; Pseudoalteromonas haloplanktis TAC125; Streptomyces pristinaespiralis ATCC 25486; Streptomyces pristinaespiralis ATCC 25486; Streptococcus thermophilus; Streptomyces viridochromogenes DSM 40736; Streptosporangium roseum DSM 43021; Synechococcus species PCC 7335; and Thermosipho africanus TCF52B (Chylinski et al., RNA Biol., 2013; 10(5): 726-737).

[0282] In some aspects, the Cas protein is a variant lacking nuclease activity (i.e., is a dCas protein). In some embodiments, the Cas protein is mutated such that nuclease activity is reduced or eliminated. Such Cas proteins are referred to as inactivated Cas or dead Cas (dCas) or nuclease - inactive Cas (iCas) proteins and may be referred to interchangeably herein. In some embodiments, the variant Cas protein is a variant Cas9 protein lacking nuclease activity or is an inactivated Cas9 (dCas9 or iCas9) protein.

[0283] In some embodiments, the Cas9 protein or its variant is derived from the Staphylococcus aureus Cas9 (SaCas9) protein or its variant. In some embodiments, the variant Cas9 is the Staphylococcus aureus dCas9 protein (dSaCas9), which contains at least one amino acid mutation selected from D10A and N580A, with reference to the position numbering of SEQ ID NO:124. In some embodiments, the variant Cas9 protein contains the sequence shown in SEQ ID NO:125, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0284] In some embodiments, the Cas9 protein or its variant is derived from the Streptococcus pyogenes Cas9 (SpCas9) protein or its variant. In some embodiments, the variant Cas9 is the Streptococcus pyogenes dCas9 (dSpCas9) protein, which contains at least one amino acid mutation selected from D10A and H840A, with reference to the position numbering of SEQ ID NO:126. In some embodiments, the variant Cas9 protein contains the sequence shown in SEQ ID NO:127, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. 2. Guide RNA (gRNA)

[0285] In some embodiments, the Cas protein (such as dCas9) is provided in combination with one or more guide RNAs (gRNAs) or as a complex. In some aspects, the gRNA is a nucleic acid that promotes the specific targeting or homing of the gRNA / CasRNP complex to the target site of the target gene, as described in any of the above Section I.B. In some embodiments, the target site of the gRNA may be referred to as a protospacer.

[0286] The present disclosure provides gRNAs, such as gRNAs that target or bind to a target site of a gene, such as a gRNA in a target gene or its regulatory DNA element, such as any of those described herein, such as any of those described in Section I.B. In some embodiments, the gRNA is capable of complexing with the Cas protein or a variant thereof. In some embodiments, the gRNA comprises a gRNA spacer sequence (i.e., spacer sequence or guide sequence) that hybridizes to or is complementary to the target site, such as any target site described herein. In some embodiments, the gRNA comprises a scaffold sequence that complexes with or binds to the Cas protein.

[0287] In some embodiments, the gRNAs provided herein are chimeric gRNAs. Generally, a gRNA can be single-molecule (i.e., composed of a single RNA molecule) or modular (comprising more than one and typically two separate RNA molecules). Modular gRNAs can be engineered into single-molecule gRNAs, where sequences from separate modular RNA molecules are included in a single gRNA molecule, sometimes referred to as a chimeric gRNA, synthetic gRNA, or single gRNA. In some embodiments, the chimeric gRNA is a fusion of two non-coding RNA sequences: a crRNA sequence and a tracrRNA sequence, such as those described in WO2013 / 176772 or Jinek, M. et al., Science 337(6096):816-21 (2012). In some embodiments, the chimeric gRNA mimics the naturally occurring crRNA:tracrRNA duplex that is involved in the type II effector system, where the naturally occurring crRNA:tracrRNA duplex serves as a guide for the Cas9 protein.

[0288] In some aspects, the spacer sequence of the gRNA is a polynucleotide sequence that comprises at least a portion that has sufficient complementarity to the target site to hybridize to the target site in the target gene and direct sequence-specific binding of the Cas / gRNA complex to the sequence of the target site. In some embodiments, the gRNA comprises a spacer sequence that is complementary (such as at least 80%, 85%, 90%, 95%, 98%, 99%, or 100% (such as fully complementary)) to the target site. The target nucleic acid strand that contains the target site sequence can be referred to as the "complementary strand" of the target nucleic acid.

[0289] In some aspects, the gRNA targets a target site in double-stranded DNA. Thus, in some aspects, the sequence of the target site can be defined by the sequence that hybridizes to the gRNA spacer or the sequence that is complementary to the sequence that hybridizes to the gRNA spacer. In some aspects, the sequence of the target site can be defined by the sequence that the gRNA spacer displaces in order to hybridize to the DNA. In some embodiments, the sequence of the target site is the sequence to which the gRNA hybridizes.

[0290] In some embodiments, the length of the gRNA spacer sequence is between about 14 nucleotides (nt) and about 26 nt, or between 16 nt and 22 nt. In some embodiments, the length of the gRNA spacer sequence is 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 21 nt or 22 nt, 23 nt, 24 nt, 25 nt or 26 nt. In some embodiments, the length of the gRNA spacer sequence is 18 nt, 19 nt, 20 nt, 21 nt or 22 nt. In some embodiments, the length of the gRNA spacer sequence is 20 nt.

[0291] The target site of the gRNA can be referred to as the protospacer. In some aspects, the gRNA spacer is designed to target a protospacer with a specific protospacer adjacent motif (PAM), which is the sequence immediately adjacent to the protospacer and promotes and / or is required for Cas binding specificity. Different CRISPR / Cas systems have different PAM requirements for targeting. For example, in some embodiments, Streptococcus pyogenes Cas9 uses the PAM 5'-NGG-3' (SEQ ID NO:224), where N is any nucleotide. In some embodiments, Staphylococcus aureus Cas9 uses the PAM 5'-NNGRRT-3' (SEQ ID NO:225), where N is any nucleotide and R is G or A. In some embodiments, Neisseria meningitidis Cas9 uses the PAM 5'-NNNNGATT-3' (SEQ ID NO:226), where N is any nucleotide. In some embodiments, Campylobacter jejuni Cas9 uses the PAM 5'-NNNNRYAC-3' (SEQ ID NO:227), where N is any nucleotide, R is G or A, and Y is C or T. In some embodiments, Streptococcus thermophilus uses the PAM 5'-NNAGAAW-3' (SEQ ID NO:228), where N is any nucleotide and W is A or T. In some embodiments, Francisella novicida Cas9 uses the PAM 5'-NGG-3' (SEQ ID NO:224), where N is any nucleotide. In some embodiments, Treponema denticola (T. denticola) Cas9 uses the PAM 5'-NAAAAC-3' (SEQ ID NO:229), where N is any nucleotide. In some embodiments, Cas12a (also known as Cpf1) from various species uses the PAM 5'-TTTV-3' (SEQ ID NO:230). In some embodiments, the Cas protein can use or be engineered to use a PAM different from those listed above. For example, the mutant SpCas9 protein can use the PAM 5'-NGG-3' (SEQ ID NO:224), 5'-NGAN-3' (SEQ ID NO:231), 5'-NGNG-3' (SEQ ID NO:232), 5'-NGAG-3' (SEQ ID NO:233), or 5'-NGCG-3' (SEQ ID NO:234). In some embodiments, the protospacer adjacent motif (PAM) of the gRNA used in combination with Streptococcus pyogenes Cas9 or its variants is NGG, as shown in SEQ ID NO:224.In some embodiments, the PAM sequence for a gRNA that complexes with Staphylococcus aureus Cas9 or a variant thereof is NNGRRT, as shown in SEQ ID NO:225.

[0292] The spacer sequence can be selected to reduce the degree of secondary structure within the spacer sequence. The secondary structure can be determined by any suitable polynucleotide folding algorithm.

[0293] In some embodiments, the gRNA (including the guide sequence) will contain the base uracil (U), while the DNA encoding the gRNA molecule will contain the base thymine (T). Without wishing to be bound by theory, in some embodiments, it is believed that the complementarity of the guide sequence to the target sequence contributes to the specificity of the interaction of the gRNA molecule / Cas molecule complex with the target nucleic acid. It should be understood that in a guide sequence and target sequence pair, a uracil base in the guide sequence will pair with an adenine base in the target sequence.

[0294] In some embodiments, one, more than one, or all of the nucleotides of the gRNA can have modifications, such as to make the gRNA less prone to degradation and / or improve biocompatibility. By way of a non-limiting example, the backbone of the gRNA can be modified with phosphorothioates or other modifications. In some cases, the nucleotides of the gRNA can comprise 2'-modifications, such as 2'-acetylation, such as 2'-methylation or other modifications.

[0295] Methods for designing gRNAs and exemplary targeting domains can include those described in International PCT Publication Nos. WO2014 / 197748, WO2016 / 130600, WO2017 / 180915, WO2021 / 226555, WO2013 / 176772, WO2014 / 152432, WO2014 / 093661, WO2014 / 093655, WO2015 / 089427, WO2016 / 049258, WO2016 / 123578, WO2021 / 076744, WO2014 / 191128, WO2015 / 161276, WO2017 / 193107, and WO2017 / 093969. a. gRNAs for transcriptional repression

[0296] In some embodiments, the gRNAs provided herein target target sites of genes for transcriptional repression, such as any target site or target gene described in Section I.B.2. In some embodiments, the gRNAs provided herein target target sites of genes (such as genes in T cells), where the genes are selected from the list consisting of: CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2. In some embodiments, the gRNA targets a gene for transcriptional repression.

[0297] In some embodiments, the gRNA targets a target site that comprises a sequence selected from any one of SEQ ID NO: 1-6, 10-33, 80-90, 102-112, 200-211, 292-295, 300-302, and 306-308 (as shown in Table 5), a continuous portion of at least 14 nucleotides thereof, a complementary sequence of any of the foregoing, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the target site is a continuous portion of 15, 16, 17, 18, or 19 nucleotides of any one of SEQ ID NO: 1-6, 10-33, 80-90, and 200-211. In some embodiments, the target site is as shown in any one of SEQ ID NO: 1-6, 10-33, 80-90, 102-112, 200-211, 292-295, 300-302, and 306-308.

[0298] In some embodiments, the target site targeted by the gRNA comprises a sequence selected from any one of SEQ ID NOs: 35-40, 44-67, 91-101, 113-123, 212-223, 296-299, 303-305, and 309-311 (as shown in Table 5), a continuous portion of at least 14 nucleotides thereof, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity with any of the foregoing. In some embodiments, the spacer sequence of the gRNA is a continuous portion of 14, 15, 16, 17, 18, or 19 nucleotides in any one of SEQ ID NOs: 35-40, 44-67, 91-101, 113-123, 212-223, 296-299, 303-305, and 309-311. In some embodiments, the spacer sequence of the gRNA is as shown in any one of SEQ ID NOs: 35-40, 44-67, 91-101, 113-123, 212-223, 296-299, 303-305, and 309-311.

[0299] In some embodiments, the target site targeted by the gRNA is the CBLB target site. In some embodiments, the gRNA targets the following target site, which comprises SEQ ID NO: 11, a continuous portion of at least 14 nucleotides thereof, any complementary sequence of the foregoing, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity with any of the foregoing. In some embodiments, the target site is a continuous portion of 14, 15, 16, 17, 18, or 19 nucleotides in SEQ ID NO: 11. In some embodiments, the target site is as shown in SEQ ID NO: 11. In some embodiments, the gRNA comprises a spacer sequence that comprises SEQ ID NO: 45 or a continuous portion of at least 14 nt thereof, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity with any of the foregoing. In some embodiments, the spacer sequence of the gRNA is a continuous portion of 14, 15, 16, 17, 18, or 19 nucleotides in SEQ ID NO: 45. In some embodiments, the spacer sequence of the gRNA is as shown in SEQ ID NO: 45.

[0300] In some embodiments, the gRNA targets a target site of MYB. In some embodiments, the gRNA targets a target site that comprises SEQ ID NO:18, a continuous portion of at least 14 nucleotides thereof, a complementary sequence of any of the foregoing, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the target site is a continuous portion of SEQ ID NO:18 that is 14, 15, 16, 17, 18, or 19 nucleotides in length. In some embodiments, the target site is as set forth in SEQ ID NO:18. In some embodiments, the gRNA comprises a spacer sequence that comprises SEQ ID NO:52 or a continuous portion of at least 14 nt thereof, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the spacer sequence of the gRNA is a continuous portion of SEQ ID NO:52 that is 14, 15, 16, 17, 18, or 19 nucleotides in length. In some embodiments, the spacer sequence of the gRNA is as set forth in SEQ ID NO:52.

[0301] In some embodiments, the gRNA targets a target site of RASA2. In some embodiments, the gRNA targets the following target site, which comprises SEQ ID NO:19, a continuous portion of at least 14 nucleotides thereof, a complementary sequence of any of the foregoing, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity with any of the foregoing. In some embodiments, the target site is a continuous portion of SEQ ID NO:19 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the target site is as set forth in SEQ ID NO:19. In some embodiments, the gRNA comprises a spacer sequence that comprises SEQ ID NO:53 or a continuous portion of at least 14 nt thereof, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity with any of the foregoing. In some embodiments, the spacer sequence of the gRNA is a continuous portion of SEQ ID NO:53 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the spacer sequence of the gRNA is as set forth in SEQ ID NO:53.

[0302] In some embodiments, the gRNA targets a target site of CISH. In some embodiments, the gRNA targets a target site comprising SEQ ID NO:28, a continuous portion of at least 14 nucleotides thereof, a complementary sequence of any of the foregoing, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity to any of the foregoing. In some embodiments, the target site is a continuous portion of SEQ ID NO:28 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the target site is as shown in SEQ ID NO:28. In some embodiments, the gRNA comprises a spacer sequence comprising SEQ ID NO:62 or a continuous portion of at least 14 nt thereof, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity to any of the foregoing. In some embodiments, the spacer sequence of the gRNA is a continuous portion of SEQ ID NO:62 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the spacer sequence of the gRNA is as shown in SEQ ID NO:62.

[0303] In some embodiments, the gRNA targets a target site of PRDM1. In some embodiments, the gRNA targets the following target site, which comprises SEQ ID NO: 33, a continuous portion of at least 14 nucleotides thereof, a complementary sequence of any of the foregoing, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity to any of the foregoing. In some embodiments, the target site is a continuous portion of SEQ ID NO: 33 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the target site is as shown in SEQ ID NO: 33. In some embodiments, the gRNA comprises a spacer sequence that comprises SEQ ID NO: 67 or a continuous portion of at least 14 nt thereof, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity to any of the foregoing. In some embodiments, the spacer sequence of the gRNA is a continuous portion of SEQ ID NO: 67 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the spacer sequence of the gRNA is as shown in SEQ ID NO: 67.

[0304] In some embodiments, the gRNA targets a target site of MED12. In some embodiments, the gRNA targets the following target site, which comprises SEQ ID NO:81, a continuous portion of at least 14 nucleotides thereof, a complementary sequence of any of the foregoing, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity to any of the foregoing. In some embodiments, the target site is a continuous portion of SEQ ID NO:81 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the target site is as shown in SEQ ID NO:81. In some embodiments, the gRNA comprises a spacer sequence, which comprises SEQ ID NO:92 or a continuous portion of at least 14 nt thereof, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity to any of the foregoing. In some embodiments, the spacer sequence of the gRNA is a continuous portion of SEQ ID NO:92 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the spacer sequence of the gRNA is as shown in SEQ ID NO:92.

[0305] In some embodiments, the gRNA further comprises a scaffold sequence. In some embodiments, the scaffold sequence comprises the sequence shown in SEQ ID NO:69 (GUUUAAGCUAUGCUGGAAACCAUAGCAAGUUUAAAUAAGGCUAGUCCUGUUAUCAACU GAUAAAAGUGCACCGAGUCGGUGC), or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity to all or part thereof. In some embodiments, the scaffold sequence is as shown in SEQ ID NO:69.

[0306] In some embodiments, any provided gRNA sequence is provided in complex or combination with a fusion protein comprising Cas9. In some embodiments, the Cas9 is dCas9. In some embodiments, the dCas9 is dSpCas9, such as dSpCas9 as shown in SEQ ID NO:127.

[0307] In some embodiments, provided herein are combinations of gRNAs, each of which targets a target site of a gene for transcriptional repression. In some embodiments, provided herein is a multiplex epigenetic modification DNA targeting system comprising a combination of gRNAs.

[0308] In some embodiments, the combination of gRNAs comprises at least two gRNAs that target at least two different genes for transcriptional repression. In some embodiments, the gRNAs target a combination of genes selected from the combinations of genes listed in Table 1. In some embodiments, each gRNA in the combination of gRNAs is selected from any of the gRNAs for targeting transcriptional repression described herein.

[0309] In some embodiments, the combination of gRNAs comprises a first gRNA targeting a first gene and a second gRNA targeting a second gene. In some embodiments, the first gRNA targets a gene selected from the list consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2, the second gRNA targets a gene selected from the list consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2, and the first and second gRNAs target different genes.

[0310] In some embodiments, the first gRNA targets CBLB, and the second gRNA targets a gene selected from the list consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2. In some embodiments, the first gRNA targets CCNC, and the second gRNA targets a gene selected from the list consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2. In some embodiments, the first gRNA targets MED12, and the second gRNA targets a gene selected from the list consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2. In some embodiments, the first gRNA targets MYB, and the second gRNA targets a gene selected from the list consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2.

[0311] In some embodiments, the first gRNA targets CBLB, and the second gRNA targets MYB. In some embodiments, the gRNA targeting CBLB can be any of the foregoing, and the gRNA targeting MYB can be any of the foregoing. In some embodiments, the first gRNA targets the target site of CBLB having the sequence shown in SEQ ID NO: 11, and the second gRNA targets the target site of MYB having the sequence shown in SEQ ID NO: 18.

[0312] In some embodiments, the first gRNA targets CBLB, and the second gRNA targets CCNC. In some embodiments, the gRNA targeting CBLB can be any of the foregoing, and the gRNA targeting CCNC can be any of the foregoing. In some embodiments, the first gRNA targets the target site of CBLB having the sequence shown in SEQ ID NO: 11, and the second gRNA targets the target site of CCNC having the sequence shown in SEQ ID NO: 104.

[0313] In some embodiments, the first gRNA targets CBLB, and the second gRNA targets MED12. In some embodiments, the gRNA targeting CBLB can be any of the foregoing, and the gRNA targeting MED12 can be any of the foregoing. In some embodiments, the first gRNA targets the target site of CBLB having the sequence shown in SEQ ID NO: 11, and the second gRNA targets the target site of MED12 having the sequence shown in SEQ ID NO: 81.

[0314] In some embodiments, the first gRNA targets CBLB, and the second gRNA targets RASA2. In some embodiments, the gRNA targeting CBLB can be any of the foregoing, and the gRNA targeting RASA2 can be any of the foregoing. In some embodiments, the first gRNA targets the target site of CBLB having the sequence shown in SEQ ID NO: 11, and the second gRNA targets the target site of RASA2 having the sequence shown in SEQ ID NO: 19.

[0315] In some embodiments, the first gRNA targets CISH, and the second gRNA targets MED12. In some embodiments, the gRNA targeting CISH can be any of the foregoing, and the gRNA targeting MED12 can be any of the foregoing. In some embodiments, the first gRNA targets the target site of CISH having the sequence shown in SEQ ID NO: 28, and the second gRNA targets the target site of MED12 having the sequence shown in SEQ ID NO: 81.

[0316] In some embodiments, the combination of gRNAs comprises at least three gRNAs targeting at least three different genes. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a first gene, a second gRNA targeting a second gene, and a third gRNA targeting a third gene. In some embodiments, the first gRNA targets a gene selected from the list consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2, the second gRNA targets a gene selected from the list consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2, the third gRNA targets a gene selected from the list consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2, and the first, second, and third gRNAs each target a different gene.

[0317] In some embodiments, the combination of gRNAs targets target sites of gene combinations for transcriptional repression, as shown in Table 2 and described in Section I.B.2.

[0318] In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CBLB and a second gRNA targeting a target site of CCNC, wherein the target site of CBLB comprises the sequence shown in SEQ ID NO:11 and the target site of CCNC comprises the sequence shown in SEQ ID NO:104. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CBLB and a second gRNA targeting a target site of CD5, wherein the target site of CBLB comprises the sequence shown in SEQ ID NO:11 and the target site of CD5 comprises the sequence shown in SEQ ID NO:3. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CBLB and a second gRNA targeting a target site of CISH, wherein the target site of CBLB comprises the sequence shown in SEQ ID NO:11 and the target site of CISH comprises the sequence shown in SEQ ID NO:30. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CBLB and a second gRNA targeting a target site of DGKZ, wherein the target site of CBLB comprises the sequence shown in SEQ ID NO:11 and the target site of DGKZ comprises the sequence shown in SEQ ID NO:13. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CBLB and a second gRNA targeting a target site of ELOB, wherein the first gRNA targeting the target site of CBLB comprises the sequence shown in SEQ ID NO:11 and the target site of ELOB comprises the sequence shown in SEQ ID NO:24. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CBLB and a second gRNA targeting a target site of FAS, wherein the target site of CBLB comprises the sequence shown in SEQ ID NO:11 and the target site of FAS comprises the sequence shown in SEQ ID NO:204. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CBLB and a second gRNA targeting a target site of Fli1, wherein the target site of CBLB comprises the sequence shown in SEQ ID NO:11 and the target site of Fli1 comprises the sequence shown in SEQ ID NO:208. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CBLB and a second gRNA targeting a target site of GATA3, wherein the target site of CBLB comprises the sequence shown in SEQ ID NO:11 and the target site of GATA3 comprises the sequence shown in SEQ ID NO:26.In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CBLB and a second gRNA targeting a target site of KDM1A, wherein the target site of CBLB comprises the sequence shown in SEQ ID NO:11 and the target site of KDM1A comprises the sequence shown in SEQ ID NO:4. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CBLB and a second gRNA targeting a target site of MED12, wherein the target site of CBLB comprises the sequence shown in SEQ ID NO:11 and the target site of MED12 comprises the sequence shown in SEQ ID NO:81. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CBLB and a second gRNA targeting a target site of MYB, wherein the first gRNA targeting the target site of CBLB comprises the sequence shown in SEQ ID NO:11 and the target site of MYB comprises the sequence shown in SEQ ID NO:18. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CBLB and a second gRNA targeting a target site of PRDM1, wherein the target site of CBLB comprises the sequence shown in SEQ ID NO:11 and the target site of PRDM1 comprises the sequence shown in SEQ ID NO:32. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CBLB and a second gRNA targeting a target site of RASA2, wherein the target site of CBLB comprises the sequence shown in SEQ ID NO:11 and the target site of RASA2 comprises the sequence shown in SEQ ID NO:19. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CD5 and a second gRNA targeting a target site of CISH, wherein the target site of CD5 comprises the sequence shown in SEQ ID NO:3 and the target site of CISH comprises the sequence shown in SEQ ID NO:30. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CD5 and a second gRNA targeting a target site of MYB, wherein the target site of CD5 comprises the sequence shown in SEQ ID NO:3 and the target site of MYB comprises the sequence shown in SEQ ID NO:18. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CISH and a second gRNA targeting a target site of DGKZ, wherein the target site of CISH comprises the sequence shown in SEQ ID NO:30 and the target site of DGKZ comprises the sequence shown in SEQ ID NO:13.In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CISH and a second gRNA targeting a target site of MYB. The target site of CISH comprises the sequence shown in SEQ ID NO:30, and the target site of MYB comprises the sequence shown in SEQ ID NO:18. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CISH and a second gRNA targeting a target site of RASA2. The target site of CISH comprises the sequence shown in SEQ ID NO:30, and the target site of RASA2 comprises the sequence shown in SEQ ID NO:19. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of GATA3 and a second gRNA targeting a target site of CD5. The target site of GATA3 comprises the sequence shown in SEQ ID NO:26, and the target site of CD5 comprises the sequence shown in SEQ ID NO:3. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of GATA3 and a second gRNA targeting a target site of CISH. The target site of GATA3 comprises the sequence shown in SEQ ID NO:26, and the target site of CISH comprises the sequence shown in SEQ ID NO:30. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of GATA3 and a second gRNA targeting a target site of MYB. The target site of GATA3 comprises the sequence shown in SEQ ID NO:26, and the target site of MYB comprises the sequence shown in SEQ ID NO:18. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of MED12 and a second gRNA targeting a target site of CBLB. The target site of MED12 comprises the sequence shown in SEQ ID NO:81, and the target site of CBLB comprises the sequence shown in SEQ ID NO:11. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of MED12 and a second gRNA targeting a target site of CD5. The target site of MED12 comprises the sequence shown in SEQ ID NO:81, and the target site of CD5 comprises the sequence shown in SEQ ID NO:3. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of MED12 and a second gRNA targeting a target site of CISH. The target site of MED12 comprises the sequence shown in SEQ ID NO:81, and the target site of CISH comprises the sequence shown in SEQ ID NO:30.In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of MED12 and a second gRNA targeting a target site of DGKZ, wherein the target site of MED12 comprises the sequence shown in SEQ ID NO:81, and the target site of DGKZ comprises the sequence shown in SEQ ID NO:13. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of MED12 and a second gRNA targeting a target site of ELOB, wherein the first gRNA targeting the target site of MED12 comprises the sequence shown in SEQ ID NO:81, and the target site of ELOB comprises the sequence shown in SEQ ID NO:24. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of MED12 and a second gRNA targeting a target site of GATA3, wherein the target site of MED12 comprises the sequence shown in SEQ ID NO:81, and the target site of GATA3 comprises the sequence shown in SEQ ID NO:26. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of MED12 and a second gRNA targeting a target site of MYB, wherein the target site of MED12 comprises the sequence shown in SEQ ID NO:81, and the target site of MYB comprises the sequence shown in SEQ ID NO:18. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of MED12 and a second gRNA targeting a target site of PRDM1, wherein the target site of MED12 comprises the sequence shown in SEQ ID NO:81, and the target site of PRDM1 comprises the sequence shown in SEQ ID NO:32. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of MED12 and a second gRNA targeting a target site of RASA2, wherein the target site of MED12 comprises the sequence shown in SEQ ID NO:81, and the target site of RASA2 comprises the sequence shown in SEQ ID NO:19. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of MYB and a second gRNA targeting a target site of RASA2, wherein the first gRNA targeting the target site of MYB comprises the sequence shown in SEQ ID NO:18, and the second gRNA targeting the target site of RASA2 comprises the sequence shown in SEQ ID NO:19. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of PRDM1 and a second gRNA targeting a target site of CISH, wherein the target site of PRDM1 comprises the sequence shown in SEQ ID NO:32, and the target site of CISH comprises the sequence shown in SEQ ID NO:30.In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of PRDM1 and a second gRNA targeting a target site of GATA3, wherein the target site of PRDM1 comprises the sequence shown in SEQ ID NO:32, and the target site of GATA3 comprises the sequence shown in SEQ ID NO:26. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of PRDM1 and a second gRNA targeting a target site of MYB, wherein the target site of PRDM1 comprises the sequence shown in SEQ ID NO:32, and the target site of MYB comprises the sequence shown in SEQ ID NO:18. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of PRDM1 and a second gRNA targeting a target site of RASA2, wherein the target site of PRDM1 comprises the sequence shown in SEQ ID NO:32, and the target site of RASA2 comprises the sequence shown in SEQ ID NO:19. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CD5, a second gRNA targeting a target site of CISH, and a third gRNA targeting a target site of MYB, wherein the target site of CD5 comprises the sequence shown in SEQ ID NO:3, the target site of CISH comprises the sequence shown in SEQ ID NO:30, and the target site of MYB comprises the sequence shown in SEQ ID NO:18. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of GATA3, a second gRNA targeting a target site of CBLB, and a third gRNA targeting a target site of MYB, wherein the target site of GATA3 comprises the sequence shown in SEQ ID NO:26, the target site of CBLB comprises the sequence shown in SEQ ID NO:11, and the target site of MYB comprises the sequence shown in SEQ ID NO:18. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of GATA3, a second gRNA targeting a target site of CD5, and a third gRNA targeting a target site of MYB, wherein the target site of GATA3 comprises the sequence shown in SEQ ID NO:26, the target site of CD5 comprises the sequence shown in SEQ ID NO:3, and the target site of MYB comprises the sequence shown in SEQ ID NO:18.In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of PRDM1, a second gRNA targeting a target site of GATA3, and a third gRNA targeting a target site of CISH, wherein the target site of PRDM1 comprises the sequence shown in SEQ ID NO:32, the target site of GATA3 comprises the sequence shown in SEQ ID NO:26, and the target site of CISH comprises the sequence shown in SEQ ID NO:30. Table 5. Genes, target sites, and gRNAs for transcriptional repression b. gRNAs for transcriptional activation

[0319] In some embodiments, the gRNAs provided herein target target sites of genes for transcriptional activation, such as any of the target sites or target genes described in Section I.B.3. In some embodiments, the gRNAs provided herein target target sites of genes for transcriptional activation. In some embodiments, the gRNAs provided herein target target sites of genes, such as genes in T cells, wherein the genes are selected from the list shown in Table 6, which consists of: BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1.

[0320] In some embodiments, the gRNA targets a target site that comprises a sequence selected from any of SEQ ID NO:7-9, 78, 144-156, 170, 172-177, and 184-191 (as shown in Table 6), a continuous portion of at least 14 nucleotides thereof, a complementary sequence of any of the foregoing, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the target site is a continuous portion of 14, 15, 16, 17, 18, or 19 nucleotides in any of SEQ ID NO:7-9, 78, 144-156, 170, 172-177, and 184-191. In some embodiments, the target site is as shown in any of SEQ ID NO:7-9, 78, 144-156, 170, 172-177, and 184-191.

[0321] In some embodiments, the gRNA targets the following target sites, which contain a sequence selected from any of SEQ ID NOs: 41-43, 79, 157-169, 171, 178-183, and 192-199 (as shown in Table 6), a continuous portion of at least 14 nucleotides thereof, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the spacer sequence of the gRNA is a continuous portion of 14, 15, 16, 17, 18, or 19 nucleotides in any of SEQ ID NOs: 41-43, 79, 157-169, 171, 178-183, and 192. In some embodiments, the spacer sequence of the gRNA is as shown in any of SEQ ID NOs: 41-43, 79, 157-169, 171, 178-183, and 192.

[0322] In some embodiments, the gRNA targets the target site of IL-2. In some embodiments, the gRNA targets the following target sites, which contain SEQ ID NO: 78, a continuous portion of at least 14 nucleotides thereof, the complementary sequence of any of the foregoing, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the target site is a continuous portion of 14, 15, 16, 17, 18, or 19 nucleotides in SEQ ID NO: 78. In some embodiments, the target site is as shown in SEQ ID NO: 78. In some embodiments, the gRNA contains a spacer sequence, which contains SEQ ID NO: 79 or a continuous portion of at least 14 nt thereof, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the spacer sequence of the gRNA is a continuous portion of 14, 15, 16, 17, 18, or 19 nucleotides in SEQ ID NO: 79. In some embodiments, the spacer sequence of the gRNA is as shown in SEQ ID NO: 79.

[0323] In some embodiments, the gRNA targets a target site of EOMES. In some embodiments, the gRNA targets a target site comprising SEQ ID NO: 149, a contiguous portion of at least 14 nucleotides thereof, a complementary sequence of any of the foregoing, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the target site is any contiguous portion of SEQ ID NO: 149 that is 14, 15, 16, 17, 18, or 19 nucleotides in length. In some embodiments, the target site is as shown in any of SEQ ID NO: 149. In some embodiments, the gRNA comprises a spacer sequence comprising SEQ ID NO: 162 or a contiguous portion of at least 14 nt thereof, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the spacer sequence of the gRNA is a contiguous portion of SEQ ID NO: 162 that is 14, 15, 16, 17, 18, or 19 nucleotides in length. In some embodiments, the spacer sequence of the gRNA is as shown in SEQ ID NO: 162.

[0324] In some embodiments, the gRNA targets a target site of LCP2. In some embodiments, the gRNA targets a target site comprising SEQ ID NO: 151, a contiguous portion of at least 14 nucleotides thereof, a complementary sequence of any of the foregoing, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the target site is any contiguous portion of SEQ ID NO: 151 that is 14, 15, 16, 17, 18, or 19 nucleotides in length. In some embodiments, the target site is as shown in any of SEQ ID NO: 151. In some embodiments, the gRNA comprises a spacer sequence comprising SEQ ID NO: 164 or a contiguous portion of at least 14 nt thereof, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 100% sequence identity to any of the foregoing. In some embodiments, the spacer sequence of the gRNA is a contiguous portion of SEQ ID NO: 164 that is 14, 15, 16, 17, 18, or 19 nucleotides in length. In some embodiments, the spacer sequence of the gRNA is as shown in SEQ ID NO: 164.

[0325] In some embodiments, the gRNA targets a target site of TBX21. In some embodiments, the gRNA targets the following target site, which comprises SEQ ID NO:155, a continuous portion of at least 14 nucleotides thereof, a complementary sequence of any of the foregoing, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity with any of the foregoing. In some embodiments, the target site is any continuous portion of SEQ ID NO:155 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the target site is as shown in any of SEQ ID NO:155. In some embodiments, the gRNA comprises a spacer sequence, which comprises SEQ ID NO:168 or a continuous portion of at least 14 nt thereof, or a sequence having or having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% or 100% sequence identity with any of the foregoing. In some embodiments, the spacer sequence of the gRNA is a continuous portion of SEQ ID NO:168 that is 14, 15, 16, 17, 18 or 19 nucleotides in length. In some embodiments, the spacer sequence of the gRNA is as shown in SEQ ID NO:168.

[0326] In some embodiments, provided herein is a combination of gRNAs, each of which targets a target site of a gene for transcriptional activation. In some embodiments, provided herein is a multiplex epigenetic modification DNA targeting system comprising a combination of gRNAs.

[0327] In some embodiments, the combination of gRNAs comprises at least two gRNAs that target at least two different genes for transcriptional activation. In some embodiments, the gRNAs target a combination of genes selected from the combination of genes listed in Table 3. In some embodiments, each gRNA in the combination of gRNAs is selected from any of the gRNAs described herein for targeting transcriptional activation.

[0328] In some embodiments, the combination of gRNAs comprises a first gRNA targeting a first gene and a second gRNA targeting a second gene. In some embodiments, the first gRNA targets a gene selected from the list consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1, the second gRNA targets a gene selected from the list consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1, and the first and second gRNAs target different genes. In some embodiments, the first gRNA targets IL-2, and the second gRNA targets a gene selected from the list consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1. In some embodiments, the first gRNA targets VAV1, and the second gRNA targets a gene selected from the list consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1.

[0329] In some embodiments, the first gRNA targets IL-2, and the second gRNA targets VAV1. In some embodiments, the gRNA targeting the target site of IL-2 can be any of the foregoing, and the gRNA targeting the target site of VAV1 can be any of the foregoing. In some embodiments, the first gRNA targets the target site of IL-2 having the sequence shown in SEQ ID NO:78, and the second gRNA targets the target site of VAV1 having the sequence shown in SEQ ID NO:170.

[0330] In some embodiments, the first gRNA targets IL-2, and the second gRNA targets LCP2. In some embodiments, the gRNA targeting the target site of IL-2 can be any of the foregoing, and the gRNA targeting the target site of LCP2 can be any of the foregoing. In some embodiments, the first gRNA targets the target site of IL-2 having the sequence shown in SEQ ID NO:78, and the second gRNA targets the target site of VAV1 having the sequence shown in SEQ ID NO:151.

[0331] In some embodiments, the first gRNA targets IL-2, and the second gRNA targets TBX21. In some embodiments, the gRNA targeting the target site of IL-2 can be any of the foregoing, and the gRNA targeting the target site of TBX21 can be any of the foregoing. In some embodiments, the first gRNA targets the target site of IL-2 having the sequence shown in SEQ ID NO:78, and the second gRNA targets the target site of TBX21 having the sequence shown in SEQ ID NO:155.

[0332] In some embodiments, the first gRNA targets IL-2, and the second gRNA targets EOMES. In some embodiments, the gRNA targeting the target site of IL-2 can be any of the foregoing, and the gRNA targeting the target site of EOMES can be any of the foregoing. In some embodiments, the first gRNA targets the target site of IL-2 having the sequence shown in SEQ ID NO:78, and the second gRNA targets the target site of EOMES having the sequence shown in SEQ ID NO:149.

[0333] In some embodiments, the combination of gRNAs comprises at least three gRNAs targeting at least three different genes. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a first gene, a second gRNA targeting a second gene, and a third gRNA targeting a third gene. In some embodiments, the first gRNA targets a gene selected from the list consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1, the second gRNA targets a gene selected from the list consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1, the third gRNA targets a gene selected from the list consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1, and the first, second, and third gRNAs each target a different gene.

[0334] In some embodiments, the combination of gRNAs targets the target sites of a combination of genes for transcriptional activation, as shown in Table 4 and described in Section I.B.3.

[0335] In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of BATF comprising the sequence shown in SEQ ID NO: 172, and a second gRNA targeting a target site of IL-2 comprising the sequence shown in SEQ ID NO: 78. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of BATF comprising the sequence shown in SEQ ID NO: 172, and a second gRNA targeting a target site of VAV1 comprising the sequence shown in SEQ ID NO: 170. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CD28 comprising the sequence shown in SEQ ID NO: 144, and a second gRNA targeting a target site of BATF comprising the sequence shown in SEQ ID NO: 172. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CD28 comprising the sequence shown in SEQ ID NO: 144, and a second gRNA targeting a target site of EOMES comprising the sequence shown in SEQ ID NO: 149. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CD28 comprising the sequence shown in SEQ ID NO: 144, and a second gRNA targeting a target site of IL-2 comprising the sequence shown in SEQ ID NO: 78. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CD28 comprising the sequence shown in SEQ ID NO: 144, and a second gRNA targeting a target site of LCP2 comprising the sequence shown in SEQ ID NO: 151. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CD28 comprising the sequence shown in SEQ ID NO: 144, and a second gRNA targeting a target site of TBX21 comprising the sequence shown in SEQ ID NO: 155. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of CD28 comprising the sequence shown in SEQ ID NO: 144, and a second gRNA targeting a target site of VAV1 comprising the sequence shown in SEQ ID NO: 170. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of EOMES comprising the sequence shown in SEQ ID NO: 149, and a second gRNA targeting a target site of BATF comprising the sequence shown in SEQ ID NO: 172.In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of EOMES comprising the sequence shown in SEQ ID NO: 149, and a second gRNA targeting a target site of LCP2 comprising the sequence shown in SEQ ID NO: 151. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of EOMES comprising the sequence shown in SEQ ID NO: 149, and a second gRNA targeting a target site of TBX21 comprising the sequence shown in SEQ ID NO: 155. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of EOMES comprising the sequence shown in SEQ ID NO: 149, and a second gRNA targeting a target site of VAV1 comprising the sequence shown in SEQ ID NO: 170. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of LCP2 comprising the sequence shown in SEQ ID NO: 151, and a second gRNA targeting a target site of BATF comprising the sequence shown in SEQ ID NO: 172. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of LCP2 comprising the sequence shown in SEQ ID NO: 151, and a second gRNA targeting a target site of IL-2 comprising the sequence shown in SEQ ID NO: 78. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of LCP2 comprising the sequence shown in SEQ ID NO: 151, and a second gRNA targeting a target site of TBX21 comprising the sequence shown in SEQ ID NO: 155. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of LCP2 comprising the sequence shown in SEQ ID NO: 151, and a second gRNA targeting a target site of VAV1 comprising the sequence shown in SEQ ID NO: 170. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of TBX21 comprising the sequence shown in SEQ ID NO: 155, and a second gRNA targeting a target site of BATF comprising the sequence shown in SEQ ID NO: 172. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of TBX21 comprising the sequence shown in SEQ ID NO: 155, and a second gRNA targeting a target site of IL-2 comprising the sequence shown in SEQ ID NO: 78.In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of TBX21 encompassing the sequence shown in SEQ ID NO: 155, and a second gRNA targeting a target site of TBX21 encompassing the sequence shown in SEQ ID NO: 155. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of TBX21 encompassing the sequence shown in SEQ ID NO: 155, and a second gRNA targeting a target site of VAV1 encompassing the sequence shown in SEQ ID NO: 170. In some embodiments, the combination of gRNAs comprises a first gRNA targeting a target site of VAV1 encompassing the sequence shown in SEQ ID NO: 170, and a second gRNA targeting a target site of IL-2 encompassing the sequence shown in SEQ ID NO: 78.

[0336] Table 6. Genes, target sites, and gRNAs for transcriptional activation D. Other DNA-binding domains and DNA targeting systems

[0337] In some of any of the provided embodiments, the DNA-binding domain comprises a zinc finger protein (ZFP); a transcription activator-like effector (TALE); a meganuclease; a homing nuclease; or an I-SceI enzyme or variant thereof. In some embodiments, the DNA-binding domain comprises a catalytically inactive variant of any of the foregoing. In some embodiments, the fusion protein of the DNA targeting system or one or more of its DNA targeting modules comprises a DNA-binding domain described herein, such as the DNA-binding domain of an engineered zinc finger protein (eZFP) or TALE.

[0338] In some embodiments, a ZFP, zinc finger DNA-binding protein or zinc finger DNA-binding domain is a protein or a domain within a larger protein that binds DNA in a sequence-specific manner through one or more zinc fingers, which are regions of amino acid sequence within the binding domain whose structure is stabilized by coordination of zinc ions. The term zinc finger DNA-binding protein is often abbreviated to zinc finger protein or ZFP. ZFPs include artificial or engineered ZFPs (eZFPs) that contain a ZFP domain targeting a specific DNA sequence, typically 9-18 nucleotides in length, generated by assembly of individual fingers. ZFPs include those in which the individual finger domain is approximately 30 amino acids in length and contains an α helix that contains two invariant histidine residues coordinated by zinc to two cysteines of a single β turn, and has two, three, four, five or six fingers. Typically, the sequence specificity of a ZFP can be altered by making amino acid substitutions at four helical positions (-1, 2, 3 and 6) on the zinc finger recognition helix. Thus, for example, a ZFP or a molecule containing a ZFP is non-naturally occurring, e.g., an eZFP engineered to bind to a selected target site.

[0339] In some embodiments, the zinc fingers are custom-designed (i.e., designed by the user) or obtained from commercial sources. A variety of methods for designing zinc finger proteins are available. For example, methods for designing zinc finger proteins to bind to a target DNA sequence of interest are described in, e.g., Liu, Q. et al., PNAS, 94(11):5525-30 (1997); Wright, D.A. et al., Nat. Protoc., 1(3):1637-52 (2006); Gersbach, C.A. et al., Acc. Chem. Res., 47(8):2309-18 (2014); Bhakta M.S. et al., Methods Mol. Biol., 649:3-30 (2010); and Gaj et al., Trends Biotechnol, 31(7):397-405 (2013). In addition, a variety of web-based tools for designing zinc finger proteins to bind to a DNA target sequence of interest are publicly available. See, e.g., the Zinc Finger Tool...

Claims

1. An epigenetically modified DNA targeting system comprising at least one DNA targeting module for repressing the transcription of one or more genes in T cells, wherein each of the at least one DNA targeting modules comprises a fusion protein comprising: (a) a DNA binding domain capable of being targeted to a target site of one of the one or more genes, wherein the one or more genes are selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2; and (b) at least one transcriptional repressor effector domain for repressing the transcription of the one or more genes in T cells.

2. An epigenetically modified DNA targeting system comprising at least one DNA targeting module for increasing the transcription of one or more genes in T cells, wherein each of the at least one DNA targeting modules comprises a fusion protein comprising: (a) a DNA binding domain capable of being targeted to a target site of one of the one or more genes, wherein the one or more genes are selected from the group consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1; and (b) at least one transcriptional activator effector domain for increasing the transcription of the one or more genes in T cells.

3. The epigenetically modified DNA targeting system according to claim 1 or claim 2, wherein transient delivery of the epigenetically modified DNA targeting system to the T cells promotes enhanced T cell effector function upon T cell stimulation, optionally enhanced as compared to T cells not delivered with the epigenetically modified DNA targeting system.

4. The epigenetically modified DNA targeting system according to any one of claims 1-3, wherein the T cell effector function is characterized by an activity selected from the group consisting of IL-2 production, IFN-γ production, TNF-α production, T cell proliferation, or any combination of the foregoing.

5. The epigenetically modified DNA targeting system according to any one of claims 1-4, wherein the T cell effector function is characterized by IL-2 production.

6. The epigenetically modified DNA targeting system according to any one of claims 1-4, wherein the T cell effector function is characterized by IFN-γ production.

7. The epigenetically modified DNA targeting system according to any one of claims 1-4, wherein the T cell effector function is characterized by IL-2 production and IFN-γ production.

8. The epigenetically modified DNA targeting system according to any one of claims 1-4, wherein the T cell effector function is characterized by the production of the multifunctionality of IL-2, IFN-γ, and TNF-α.

9. The epigenetically modified DNA targeting system according to any one of claims 4-8, wherein the T cell effector function is further characterized by the activity of T cell proliferation.

10. The epigenetically modified DNA targeting system according to any one of claims 4-9, wherein the T cell effector function is further characterized by the activity of killing target cells.

11. The epigenetically modified DNA targeting system according to any one of claims 4-10, wherein the T cell effector function is further characterized by the activity of T cell persistence.

12. The epigenetically modified DNA targeting system according to any one of claims 3-11, wherein the enhanced T cell effector function occurs 48 hours or more after the transient delivery of the epigenetically modified DNA targeting system to the T cells.

13. The epigenetically modified DNA targeting system according to any one of claims 3-12, wherein the enhanced T cell effector function occurs at most 6 days, at most 9 days, at most 12 days, at most 15 days, at most 21 days, at most 28 days, at most 35 days, at most 42 days, at most 49 days, at most 56 days, at most 63 days, at most 71 days or more after the transient delivery of the epigenetically modified DNA targeting system to the T cells.

14. The epigenetically modified DNA targeting system according to any one of claims 3-13, wherein the T cell stimulation is with anti-CD3 and anti-CD28 activating reagents.

15. The epigenetically modified DNA targeting system according to any one of claims 3-14, wherein the T cells express an engineered antigen receptor, optionally a chimeric antigen receptor or a T cell receptor (eTCR).

16. The epigenetically modified DNA targeting system according to claim 15, wherein the engineered antigen receptor is a chimeric antigen receptor (CAR) or an engineered T cell receptor (eTCR) specific for an antigen, and the T cell stimulation is antigen-specific stimulation of the CAR or eTCR, optionally wherein the T cell stimulation is with antigen-expressing target cells.

17. The epigenetically modified DNA targeting system according to any one of claims 3-16, wherein the T cells express a chimeric antigen receptor (CAR) specific for an antigen, and the T cell stimulation is antigen-specific stimulation of the CAR, optionally wherein the T cell stimulation is with antigen-expressing target cells.

18. The epigenetically modified DNA targeting system according to any one of claims 3-17, wherein the T cell stimulation is restimulation after at least one previous T cell stimulation of the T cells.

19. The epigenetically modified DNA targeting system according to any one of claims 1-18, wherein the DNA targeting system does not introduce gene disruption or DNA breaks.

20. The epigenetically modified DNA targeting system according to any one of claims 1-19, wherein the fusion protein of each DNA targeting module comprises a DNA binding domain selected from the group consisting of: clustered regularly interspaced short palindromic repeat (Cas) proteins or variants thereof; zinc finger proteins (ZFPs); transcription activator-like effectors (TALEs); meganucleases; homing nucleases; or I-SceI enzymes or variants thereof, optionally wherein the DNA binding domain comprises any of the foregoing catalytically inactive variants.

21. The epigenetically modified DNA targeting system according to any one of claims 1-20, wherein the at least one DNA targeting module is a single DNA targeting module targeting a target site of one of the one or more genes.

22. The epigenetically modified DNA targeting system according to any one of claims 1-20, wherein: the at least one DNA targeting module is a plurality of DNA targeting modules for repressing the transcription of one or more genes in T cells, wherein each DNA targeting module targets a target site of one of the one or more genes; or the at least one DNA targeting module is a plurality of DNA targeting modules for increasing the transcription of one or more genes in T cells, wherein each DNA targeting module targets a target site of one of the one or more genes.

23. The epigenetically modified DNA targeting system according to claim 22, wherein the plurality of DNA targeting modules are 2, 3, 4, 5, or 6 DNA targeting modules.

24. The epigenetically modified DNA targeting system according to claim 22 or 23, wherein the plurality of DNA targeting modules are 2 DNA targeting modules.

25. The epigenetically modified DNA targeting system according to any one of claims 22-24, wherein the plurality of DNA targeting modules for repressing the transcription of one or more genes in T cells target at least a first gene and a second gene, wherein the first and second genes are independently selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2.

26. The epigenetically modified DNA targeting system according to any one of claims 22-25, wherein the plurality of DNA targeting modules for repressing the transcription of one or more genes in T cells target at least a first gene and a second gene, wherein the first and second genes are independently selected from the group consisting of CBLB, CISH, MED12, MYB, PRDM1, and RASA2.

27. The epigenetically modified DNA targeting system according to claim 22 or 23, wherein the plurality of DNA targeting modules for repressing the transcription of one or more genes in T cells target at least a first gene, a second gene, and a third gene, wherein the first, second, and third genes are independently selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2.

28. The epigenetically modified DNA targeting system according to claim 22-23 or 27, wherein the plurality of DNA targeting modules for repressing the transcription of one or more genes in T cells target at least a first gene, a second gene, and a third gene, wherein the first, second, and third genes are independently selected from the group consisting of CBLB, CISH, MED12, MYB, PRDM1, and RASA2.

29. The epigenetically modified DNA targeting system according to any one of claims 22-24, wherein the plurality of DNA targeting modules for increasing the transcription of one or more genes in T cells target at least a first gene and a second gene, wherein the first and second genes are independently selected from the group consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1.

30. The epigenetically modified DNA targeting system according to any one of claims 22-24 or 29, wherein the plurality of DNA targeting modules for increasing the transcription of one or more genes in T cells target at least a first gene and a second gene, wherein the first and second genes are independently selected from the group consisting of EOMES, IL-2, LCP2, and TBX21.

31. The epigenetically modified DNA targeting system according to any one of claims 22, 23, and 29, wherein the plurality of DNA targeting modules for increasing the transcription of one or more genes in T cells target at least a first gene, a second gene, and a third gene, wherein the first, second, and third genes are independently selected from the group consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1.

32. The epigenetically modified DNA targeting system according to any one of claims 22, 23, 29, or 31, wherein the plurality of DNA targeting modules for increasing the transcription of one or more genes in T cells target at least a first gene, a second gene, and a third gene, wherein the first, second, and third genes are independently selected from the group consisting of EOMES, IL-2, LCP2, and TBX21.

33. The epigenetically modified DNA targeting system according to claim 25 or 27, wherein the plurality of DNA targeting modules target a combination of genes selected from the following: CBLB and CCNC; CBLB and CD5; CBLB and CISH; CBLB and DGKZ; CBLB and ELOB; CBLB and FAS; CBLB and Fli1; CBLB and GATA3; CBLB and KDM1A; CBLB and MED12; CBLB and MYB; CBLB and PRDM1; CBLB and RASA2; CD5 and CISH; CD5 and MYB; CISH and DGKZ; CISH and MYB; CISH and RASA2; GATA3 and CD5; GATA3 and CISH; GATA3 and MYB; MED12 and CBLB; MED12 and CD5; MED12 and CISH; MED12 and DGKZ; MED12 and ELOB; MED12 and GATA3; MED12 and MYB; MED12 and PRDM1; MED12 and RASA2; MYB and RASA2; PRDM1 and CISH; PRDM1 and GATA3; PRDM1 and MYB; PRDM1 and RASA2; CD5, CISH and MYB; GATA3, CBLB and MYB; GATA3, CD5 and MYB; PRDM1, GATA3 and CISH; TGFBR2 and MED12; and TGFBR2, MED12 and CISH.

34. The epigenetically modified DNA targeting system according to claim 25 - 27 or 33, wherein the plurality of DNA targeting modules target a combination of genes selected from the following: MED12 and CBLB; MED12 and CISH; CBLB and MYB; and CBLB and RASA2.

35. The epigenetically modified DNA targeting system according to claim 25 or 27, wherein the first and second genes are CBLB and MYB.

36. The epigenetically modified DNA targeting system according to claim 25 or 27, wherein the first and second genes are CBLB and MED12.

37. The epigenetically modified DNA targeting system according to claim 25 or 27, wherein the first and second genes are CBLB and CCNC.

38. The epigenetically modified DNA targeting system according to claim 29 or 31, wherein the plurality of DNA targeting modules target a combination of genes selected from: BATF and IL-2; BATF and VAV1; CD28 and BATF; CD28 and EOMES; CD28 and IL-2; CD28 and LCP2; CD28 and TBX21; CD28 and VAV1; EOMES and BATF; EOMES and LCP2; EOMES and TBX21; EOMES and VAV1; EOMES and IL-2; LCP2 and BATF; LCP2 and IL-2; LCP2 and TBX21; LCP2 and VAV1; TBX21 and BATF; TBX21 and IL-2; TBX21 and TBX21; TBX21 and VAV1; and VAV1 and IL-2.

39. The epigenetically modified DNA targeting system according to claim 29 or 31, wherein the first and second genes are IL2RB and VAV1.

40. The epigenetically modified DNA targeting system according to claim 29 or 31, wherein the first and second genes are IL2 and VAV1.

41. The epigenetically modified DNA targeting system according to claim 29 or 31, wherein the first and second genes are IL2 and LCP2.

42. The epigenetically modified DNA targeting system according to claim 29 or 31, wherein the first and second genes are IL2 and TBX21.

43. The epigenetically modified DNA targeting system according to claim 29 or 31, wherein the first and second genes are IL2 and EOMES.

44. The epigenetically modified DNA targeting system according to any one of claims 1-43, wherein the target site of each gene of the gene or the one or more genes is in the gene and / or its regulatory DNA element.

45. The epigenetically modified DNA targeting system according to claim 44, wherein the regulatory DNA element is an enhancer or promoter of the gene.

46. The epigenetically modified DNA targeting system according to any one of claims 1-45, wherein the target site is within 1000 base pairs (bp) of the transcription start site of the gene.

47. The epigenetically modified DNA targeting system according to any one of claims 1-46, wherein the target site is within 500 base pairs (bp) of the transcription start site of the gene.

48. The epigenetically modified DNA targeting system according to any one of claims 1, 3-27, 33-37 and 44-47, wherein the target site is selected from: (a) The target site of CD5, which has the sequence shown in any one of SEQ ID NO: 1-3, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing. (b) Target sites of KDM1A, having the sequences shown in any one of SEQ ID NO:4-6, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing; (c) Target sites of CBLB, having the sequences shown in any one of SEQ ID NO:10-12, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing; (d) Target sites of DGKZ, having the sequences shown in any one of SEQ ID NO:13-15, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing; (e) Target sites of MYB, having the sequences shown in any one of SEQ ID NO:16-18, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing; (f) Target sites of RASA2, having the sequences shown in any one of SEQ ID NO:19-21, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing; (g) Target sites of ELOB, having the sequences shown in any one of SEQ ID NO:22-24, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing; (h) Target sites of GATA3, having the sequences shown in any one of SEQ ID NO:25-27, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing; (i) Target sites of CISH, having the sequences shown in any one of SEQ ID NO:28-30, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing; (j) Target sites of PRDM1, having the sequences shown in any one of SEQ ID NO:31-33, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing; (k) Target sites of MED12, having the sequences shown in any one of SEQ ID NO:80-90, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing; (l) Target sites of CCNC, having the sequences shown in any one of SEQ ID NO:102-112, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing; (m) Target sites of FAS, having the sequences shown in any one of SEQ ID NO:200-205 and 292-295, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing; (n) Target sites of Fli1, having the sequences shown in any one of SEQ ID NO:206-211, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing; and (o)Target sites of TGFBR2, having the sequences shown in any of SEQ ID NO: 300 - 302 and 306 - 308, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing.

49. The epigenetically modified DNA targeting system according to any one of claims 1, 3 - 27, 33 - 37, and 44 - 47, wherein the target sites are selected from: (a) Target sites of CD5, having the sequences shown in any of SEQ ID NO: 1 - 3 or complementary sequences thereof; (b) Target sites of KDM1A, having the sequences shown in any of SEQ ID NO: 4 - 6 or complementary sequences thereof; (c) Target sites of CBLB, having the sequences shown in any of SEQ ID NO: 10 - 12 or complementary sequences thereof; (d) Target sites of DGKZ, having the sequences shown in any of SEQ ID NO: 13 - 15 or complementary sequences of any of the foregoing; (e) Target sites of MYB, having the sequences shown in any of SEQ ID NO: 16 - 18 or complementary sequences of any of the foregoing; (f) Target sites of RASA2, having the sequences shown in any of SEQ ID NO: 19 - 21 or complementary sequences of any of the foregoing; (g) Target sites of ELOB, having the sequences shown in any of SEQ ID NO: 22 - 24 or complementary sequences of any of the foregoing; (h) Target sites of GATA3, having the sequences shown in any of SEQ ID NO: 25 - 27 or complementary sequences of any of the foregoing; (i) Target sites of CISH, having the sequences shown in any of SEQ ID NO: 28 - 30 or complementary sequences of any of the foregoing; (j) Target sites of PRDM1, having the sequences shown in any of SEQ ID NO: 31 - 33 or complementary sequences of any of the foregoing; (k) Target sites of MED12, having the sequences shown in any of SEQ ID NO: 80 - 90 or complementary sequences of any of the foregoing; (l) Target sites of CCNC, having the sequences shown in any of SEQ ID NO: 102 - 112 or complementary sequences of any of the foregoing; (m) Target sites of FAS, having the sequences shown in any of SEQ ID NO: 200 - 205 and 292 - 295 or complementary sequences of any of the foregoing; (n) Target sites of Fli1, having the sequences shown in any of SEQ ID NO: 206 - 211 or complementary sequences of any of the foregoing; and (o) Target sites of TGFBR2, having the sequences shown in any of SEQ ID NO: 300 - 302 and 306 - 308 or complementary sequences of any of the foregoing.

50. The epigenetically modified DNA targeting system according to any one of claims 1, 3 - 27, 33 - 37, and 44 - 47, (a) wherein the target site is selected from the target sites of CBLB, which has the sequence shown in SEQ ID NO: 11 or its complementary sequence; (b) wherein the target site is selected from the target sites of MYB, which has the sequence shown in SEQ ID NO: 18 or its complementary sequence; (c) wherein the target site is selected from the target sites of RASA2, which has the sequence shown in SEQ ID NO: 19 or its complementary sequence; (d) wherein the target site is selected from the target sites of CISH, which has the sequence shown in SEQ ID NO: 28 or its complementary sequence; (e) wherein the target site is selected from the target sites of PRDM1, which has the sequence shown in SEQ ID NO: 33 or its complementary sequence; and (f) wherein the target site is selected from the target sites of MED12, which has the sequence shown in SEQ ID NO: 81 or its complementary sequence.

51. The epigenetically modified DNA targeting system according to any one of claims 2-24, 29, 31 and 38-47, wherein the target site is selected from: (a) the target site of VAV1, which has the sequence shown in any one of SEQ ID NOs: 7-9, 156 and 170, a continuous portion of at least 14 nucleotides (nt) thereof or the complementary sequence of any of the foregoing; (b) the target site of IL2, which has the sequence shown in SEQ ID NO: 78, a continuous portion of at least 14 nucleotides (nt) thereof or the complementary sequence of any of the foregoing; (c) the target site of BATF, which has the sequence shown in any one of SEQ ID NOs: 172-174, a continuous portion of at least 14 nucleotides (nt) thereof or the complementary sequence of any of the foregoing; (d) the target site of CD28, which has the sequence shown in any one of SEQ ID NOs: 144-146 and 189-191, a continuous portion of at least 14 nucleotides (nt) thereof or the complementary sequence of any of the foregoing; (e) the target site of EOMES, which has the sequence shown in any one of SEQ ID NOs: 147-149, a continuous portion of at least 14 nucleotides (nt) thereof or the complementary sequence of any of the foregoing; (f) the target site of IRF4, which has the sequence shown in any one of SEQ ID NOs: 175-177, a continuous portion of at least 14 nucleotides (nt) thereof or the complementary sequence of any of the foregoing; (g) the target site of LAT, which has the sequence shown in any one of SEQ ID NOs: 184-186, a continuous portion of at least 14 nucleotides (nt) thereof or the complementary sequence of any of the foregoing; (h) the target site of LCP2, which has the sequence shown in any one of SEQ ID NOs: 150-152 and 187-188, a continuous portion of at least 14 nucleotides (nt) thereof or the complementary sequence of any of the foregoing; and (i) Target sites of TBX21, having a sequence shown in any of SEQ ID NO: 153 - 155, a continuous portion of at least 14 nucleotides (nt) thereof, or a complementary sequence of any of the foregoing.

52. The epigenetically modified DNA targeting system according to any one of claims 2 - 24, 29, 31, 38 - 47, and 51, wherein the target site is selected from: (a) Target sites of VAV1, having a sequence shown in any of SEQ ID NO: 7 - 9, 156, and 170, or a complementary sequence of any of the foregoing; (b) Target sites of IL2, having a sequence shown in SEQ ID NO: 78, or any complementary sequence of the foregoing; (c) Target sites of BATF, having a sequence shown in any of SEQ ID NO: 172 - 174, or a complementary sequence of any of the foregoing; (d) Target sites of CD28, having a sequence shown in any of SEQ ID NO: 144 - 146 and 189 - 191, or a complementary sequence of any of the foregoing; (e) Target sites of EOMES, having a sequence shown in any of SEQ ID NO: 147 - 149, or a complementary sequence of any of the foregoing; (f) Target sites of IRF4, having a sequence shown in any of SEQ ID NO: 175 - 177, or a complementary sequence of any of the foregoing; (g) Target sites of LAT, having a sequence shown in any of SEQ ID NO: 184 - 186, or a complementary sequence of any of the foregoing; (h) Target sites of LCP2, having a sequence shown in any of SEQ ID NO: 150 - 152 and 187 - 188, or a complementary sequence of any of the foregoing; and (i) Target sites of TBX21, having a sequence shown in any of SEQ ID NO: 153 - 155, or a complementary sequence of any of the foregoing.

53. The epigenetically modified DNA targeting system according to any one of claims 2 - 24, 29, 31, 38 - 47, and 52, wherein the target site is selected from: (a) Target sites of IL - 2, having a sequence shown in SEQ ID NO: 78, or a complementary sequence of any of the foregoing; (b) Target sites of EOMES, having a sequence shown in SEQ ID NO: 149, or a complementary sequence of any of the foregoing; (c) Target sites of LCP2, having a sequence shown in SEQ ID NO: 151, or a complementary sequence of any of the foregoing; and (d) Target sites of TBX21, having a sequence shown in SEQ ID NO: 155, or a complementary sequence of any of the foregoing.

54. The epigenetically modified DNA targeting system according to any one of claims 1-53, wherein the DNA binding domain of each of the at least one DNA targeting module is a clustered regularly interspaced short palindromic repeat (Cas) protein or a variant thereof, and each of the at least one DNA targeting module further comprises at least one guide RNA (gRNA) for targeting the DNA binding domain to a target site of the one or more genes.

55. The epigenetically modified DNA targeting system according to any one of claims 20-54, wherein the Cas protein or a variant thereof is a deactivated (dCas) protein.

56. The epigenetically modified DNA targeting system according to claim 55, wherein the dCas protein lacks nuclease activity.

57. The epigenetically modified DNA targeting system according to claim 55 or 56, wherein the dCas protein is a dCas9 protein.

58. The epigenetically modified DNA targeting system according to claim 55 or 56, wherein the dCas protein is a dCas12 protein.

59. The epigenetically modified DNA targeting system according to claim 57, wherein the dCas9 protein is a Staphylococcus aureus dCas9 (dSaCas9) protein.

60. The epigenetically modified DNA targeting system according to claim 59, wherein the dSaCas9 comprises at least one amino acid mutation selected from D10A and N580A, with reference to the position numbering of SEQ ID NO:

124.

61. The epigenetically modified DNA targeting system according to claim 59 or 60, wherein the dSaCas9 protein comprises the sequence shown in SEQ ID NO:125, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

62. The epigenetically modified DNA targeting system according to any one of claims 59-61, wherein the dSaCas9 is as shown in SEQ ID NO:

125.

63. The epigenetically modified DNA targeting system according to claim 57, wherein the dCas9 protein is a Streptococcus pyogenes dCas9 (dSpCas9) protein.

64. The epigenetically modified DNA targeting system according to claim 63, wherein the dSpCas9 comprises at least one amino acid mutation selected from D10A and H840A, with reference to the position numbering of SEQ ID NO:

126.

65. The epigenetically modified DNA targeting system according to claim 63 or 64, wherein the dSpCas9 protein comprises the sequence shown in SEQ ID NO: 127, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

66. The epigenetically modified DNA targeting system according to any one of claims 63-65, wherein the dSpCas9 is as shown in SEQ ID NO:

127.

67. The epigenetically modified DNA targeting system according to any one of claims 54-66, wherein the gRNA comprises a gRNA spacer complementary to the target site of the gene.

68. The epigenetically modified DNA targeting system according to any one of claims 54-67, wherein the DNA targeting module is for repressing the transcription of the one or more genes, and the gRNA is selected from: (a) a gRNA targeting the target site of CD5 and comprising a gRNA spacer sequence containing the sequence shown in any one of SEQ ID NOs: 35-37 or at least 14 consecutive nucleotides thereof; (b) a gRNA targeting the target site of KDM1A and comprising a gRNA spacer sequence containing the sequence shown in any one of SEQ ID NOs: 38-40 or at least 14 consecutive nucleotides thereof; (c) a gRNA targeting the target site of CBLB and comprising a gRNA spacer sequence containing the sequence shown in any one of SEQ ID NOs: 44-46 or at least 14 consecutive nucleotides thereof; (d) a gRNA targeting the target site of DGKZ and comprising a gRNA spacer sequence containing the sequence shown in any one of SEQ ID NOs: 47-49 or at least 14 consecutive nucleotides thereof; (e) a gRNA targeting the target site of MYB and comprising a gRNA spacer sequence containing the sequence shown in any one of SEQ ID NOs: 50-52 or at least 14 consecutive nucleotides thereof; (f) a gRNA targeting the target site of RASA2 and comprising a gRNA spacer sequence containing the sequence shown in any one of SEQ ID NOs: 53-55 or at least 14 consecutive nucleotides thereof; (g) a gRNA targeting the target site of ELOB and comprising a gRNA spacer sequence containing the sequence shown in any one of SEQ ID NOs: 56-58 or at least 14 consecutive nucleotides thereof; (h) a gRNA targeting the target site of GATA3 and comprising a gRNA spacer sequence containing the sequence shown in any one of SEQ ID NOs: 59-61 or at least 14 consecutive nucleotides thereof; (i) a gRNA targeting the target site of CISH and comprising a gRNA spacer sequence containing the sequence shown in any one of SEQ ID NOs: 62-64 or at least 14 consecutive nucleotides thereof; (j) A gRNA that targets the target site of PRDM1 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 65 - 67 or a continuous portion of at least 14 nt thereof; (k) A gRNA that targets the target site of MED12 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 91 - 101 or a continuous portion of at least 14 nt thereof; (l) A gRNA that targets the target site of CCNC and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 113 - 123 or a continuous portion of at least 14 nt thereof; (m) A gRNA that targets the target site of FAS and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 212 - 217 and 296 - 299 or a continuous portion of at least 14 nt thereof; (n) A gRNA that targets the target site of Fli1 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 218 - 223 or a continuous portion of at least 14 nt thereof; and (o) A gRNA that targets the target site of TGFBR2 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 303 - 305 and 309 - 311 or a continuous portion of at least 14 nt thereof.

69. The epigenetically modified DNA targeting system according to any one of claims 54 - 68, wherein the DNA targeting module is for repressing the transcription of the one or more genes, and the gRNA is selected from: (a) A gRNA that targets the target site of CD5 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 35 - 37; (b) A gRNA that targets the target site of KDM1A and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 38 - 40; (c) A gRNA that targets the target site of CBLB and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 44 - 46; (d) A gRNA that targets the target site of DGKZ and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 47 - 49; (e) A gRNA that targets the target site of MYB and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 50 - 52; (f) A gRNA that targets the target site of RASA2 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 53 - 55; (g) A gRNA that targets the target site of ELOB and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 56 - 58; (h) A gRNA that targets the target site of GATA3 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 59 - 61; (i) A gRNA that targets the target site of CISH and contains the gRNA spacer sequence shown in any one of SEQ ID NOs: 62 - 64; (j) A gRNA that targets the target site of PRDM1 and contains the gRNA spacer sequence shown in any one of SEQ ID NOs: 65 - 67; (k) A gRNA that targets the target site of MED12 and contains the gRNA spacer sequence shown in any one of SEQ ID NOs: 91 - 101; (l) A gRNA that targets the target site of CCNC and contains the gRNA spacer sequence shown in any one of SEQ ID NOs: 113 - 123; (m) A gRNA that targets the target site of FAS and contains the gRNA spacer sequence shown in any one of SEQ ID NOs: 212 - 217 and 296 - 299; (n) A gRNA that targets the target site of Fli1 and contains the gRNA spacer sequence shown in any one of SEQ ID NOs: 218 - 223; and (o) A gRNA that targets the target site of TGFBR2 and contains the gRNA spacer sequence shown in any one of SEQ ID NOs: 303 - 305 and 309 - 311.

70. The epigenetically modified DNA targeting system according to any one of claims 54 - 68, wherein the DNA targeting module is for repressing the transcription of the one or more genes, and the gRNA is selected from: (a) A gRNA that targets the target site of CBLB and contains the gRNA spacer sequence shown in SEQ ID NO: 45; (b) A gRNA that targets the target site of MYB and contains the gRNA spacer sequence shown in SEQ ID NO: 52; (c) A gRNA that targets the target site of RASA2 and contains the gRNA spacer sequence shown in SEQ ID NO: 53; (d) A gRNA that targets the target site of CISH and contains the gRNA spacer sequence shown in SEQ ID NO: 62; (e) A gRNA that targets the target site of PRDM1 and contains the gRNA spacer sequence shown in SEQ ID NO: 67; and (f) A gRNA that targets the target site of MED12 and contains the gRNA spacer sequence shown in SEQ ID NO:

92.

71. The epigenetically modified DNA targeting system according to any one of claims 54 - 67, wherein the DNA targeting module is for increasing the transcription of the one or more genes, and the gRNA is selected from: (a) A gRNA that targets the target site of VAV1 and contains a gRNA spacer sequence containing the sequence shown in any one of SEQ ID NOs: 41 - 43, 169, and 171 or at least 14 consecutive nucleotides thereof; (b) A gRNA that targets the target site of IL2 and contains a gRNA spacer sequence containing the sequence shown in SEQ ID NO: 79 or at least 14 consecutive nucleotides thereof; (c) A gRNA that targets the target site of BATF and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 178 - 180 or a continuous portion of at least 14 nt thereof; (d) A gRNA that targets the target site of CD28 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 157 - 159 and 197 - 199 or a continuous portion of at least 14 nt thereof; (e) A gRNA that targets the target site of EOMES and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 160 - 162 or a continuous portion of at least 14 nt thereof; (f) A gRNA that targets the target site of IRF4 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 181 - 183 or a continuous portion of at least 14 nt thereof; (g) A gRNA that targets the target site of LAT and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 192 - 194 or a continuous portion of at least 14 nt thereof; (h) A gRNA that targets the target site of LCP2 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 163 - 165 and 195 - 196 or a continuous portion of at least 14 nt thereof; and (i) A gRNA that targets the target site of TBX21 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 166 - 168 or a continuous portion of at least 14 nt thereof.

72. The epigenetically modified DNA targeting system according to any one of claims 54 - 67 and 71, wherein the DNA targeting module is for increasing the transcription of the one or more genes, and the gRNA is selected from: (a) A gRNA that targets the target site of VAV1 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 41 - 43, 169, and 171; (b) A gRNA that targets the target site of IL2 and contains a gRNA spacer sequence shown in SEQ ID NO: 79; (c) A gRNA that targets the target site of BATF and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 178 - 180; (d) A gRNA that targets the target site of CD28 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 157 - 159 and 197 - 199; (e) A gRNA that targets the target site of EOMES and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 160 - 162; (f) A gRNA that targets the target site of IRF4 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 181 - 183; (g) A gRNA that targets the target site of LAT and contains the gRNA spacer sequence shown in any of SEQ ID NOs: 192 - 194; (h) A gRNA that targets the target site of LCP2 and contains the gRNA spacer sequence shown in any of SEQ ID NOs: 163 - 165 and 195 - 196; and (i) A gRNA that targets the target site of TBX21 and contains the gRNA spacer sequence shown in any of SEQ ID NOs: 166 - 168.

73. The epigenetically modified DNA targeting system according to any one of claims 54 - 67 and 71, wherein the DNA targeting module is for increasing the transcription of the one or more genes, and the gRNA is selected from: (a) A gRNA that targets the target site of IL - 2 and contains the gRNA spacer sequence shown in SEQ ID NO: 79; (a) A gRNA that targets the target site of EOMES and contains the gRNA spacer sequence shown in SEQ ID NO: 162; (a) A gRNA that targets the target site of LCP2 and contains the gRNA spacer sequence shown in SEQ ID NO: 164; and (a) A gRNA that targets the target site of TBX21 and contains the gRNA spacer sequence shown in SEQ ID NO:

168.

74. The epigenetically modified DNA targeting system according to any one of claims 54 - 72, wherein the gRNA contains a spacer sequence having a length between 14 nt and 24 nt or between 16 nt and 22 nt.

75. The epigenetically modified DNA targeting system according to any one of claims 54 - 74, wherein the gRNA contains a spacer sequence having a length of 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt.

76. The epigenetically modified DNA targeting system according to any one of claims 54 - 75, wherein the gRNA further contains the scaffold sequence shown in SEQ ID NO:

69.

77. The epigenetically modified DNA targeting system according to any one of claims 1, 3 - 27, 33 - 37, 36 - 41, 54 - 69, and 74 - 76, wherein the at least one transcriptional repressor effector domain is capable of reducing the transcription of the one or more genes.

78. An epigenetically modified DNA targeting system according to any one of claims 1, 3-27, 33-37, 44-49, 54-69, and 74-77, wherein the transcriptional repressor effector domain is selected from the group consisting of a KRAB domain, a DNMT3A domain, a DNMT3L domain, a DNMT3B domain, a DNMT3A-DNMT3L fusion protein domain, an ERF repressor domain, an Mxi1 repressor domain, a SID4X repressor domain, a Mad-SID repressor domain, an LSD1 repressor domain, an EZH2 repressor domain, a SunTag domain, or a variant or portion of any of the foregoing domains, or a combination of any of the foregoing domains.

79. An epigenetically modified DNA targeting system according to any one of claims 1, 3-27, 33-37, 44-49, 54-69, and 74-78, wherein the transcriptional repressor effector domain is a KRAB domain, a DNMT3A domain, or a DNMT3L domain, or a combination of any of the foregoing domains.

80. An epigenetically modified DNA targeting system according to any one of claims 1, 3-27, 33-37, 44-49, 54-69, and 74-79, wherein the at least one transcriptional repressor effector domain comprises a KRAB domain or a variant or portion thereof that exhibits transcriptional repressor activity.

81. An epigenetically modified DNA targeting system according to any one of claims 1, 3-27, 33-37, 44-49, 54-69, and 74-80, wherein the at least one transcriptional repressor effector domain comprises the sequence shown in any one of SEQ ID NO:70, 235, and 355-358, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

82. An epigenetically modified DNA targeting system according to any one of claims 1, 3-27, 33-37, 44-49, 54-69, and 74-79, wherein the at least one transcriptional repressor effector domain comprises a DNMT3A domain or a variant or portion thereof that exhibits transcriptional repressor activity.

83. An epigenetically modified DNA targeting system according to any one of claims 1, 3-27, 33-37, 44-49, 54-69, 74-79, and 82, wherein the at least one transcriptional repressor domain comprises the sequence shown in SEQ ID NO:131 or 238, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

84. An epigenetically modified DNA targeting system according to any one of claims 1, 3-27, 33-37, 44-49, 54-69, and 74-79, wherein the at least one transcriptional repressor effector domain comprises a DNMT3L domain or a variant or portion thereof that exhibits transcriptional repressor activity.

85. An epigenetically modified DNA targeting system according to any one of claims 1, 3-27, 33-37, 44-49, 54-69, 74-79, and 84, wherein the at least one transcriptional repressor domain comprises a sequence shown in any one of SEQ ID NO: 133 and 240-242, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with any of the foregoing.

86. An epigenetically modified DNA targeting system according to any one of claims 1, 3-27, 33-37, 44-49, 54-69, and 74-79, wherein the at least one transcriptional repressor domain is a DNMT3A-DNMT3L fusion protein domain, a DNMT3B-DNMT3L fusion protein domain, or a variant thereof that exhibits transcriptional repressor activity.

87. An epigenetically modified DNA targeting system according to any one of claims 1, 3-27, 33-37, 44-49, 54-69, 74-79, and 86, wherein the at least one transcriptional repressor domain comprises a sequence shown in any one of SEQ ID NO: 135, 137, or 363, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with any of the foregoing.

88. An epigenetically modified DNA targeting system according to any one of claims 1, 3-27, 33-37, 44-49, 54-69, 74-87, wherein the fusion protein comprises a sequence shown in any one of SEQ ID NO: 138-141, 332-351, and 365-384, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity therewith.

89. A DNA targeting system according to any one of claims 2-24, 29, 31, 38-47, 51-67, and 71-76, wherein the at least one transcriptional activator effector domain is capable of increasing the transcription of the one or more genes.

90. A DNA targeting system according to any one of claims 2-24, 29, 31, 38-47, 51-67, 71-76, and 89, wherein the at least one transcriptional activator effector domain is selected from the group consisting of: VP64 domain, p65 activation domain, p300 domain, Rta domain, CBP domain, VPR domain, VPH domain, HSF1 domain, TET protein domain, optionally wherein the TET protein is TET1, SunTag domain, or a domain, portion, variant, or truncation of any of the foregoing.

91. A DNA targeting system according to any one of claims 2-24, 29, 31, 38-47, 51-67, 71-76, 89, and 90, wherein the at least one transcriptional activator effector domain comprises at least one VP16 domain and / or a VP16 tetramer ("VP64") or a variant thereof.

92. A DNA targeting system according to any one of claims 2-24, 29, 31, 38-47, 51-67, 71-76, and 89-91, wherein the at least one transcriptional activator effector domain comprises a VP64 domain or a variant or portion thereof that exhibits transcriptional activation activity.

93. A DNA targeting system according to any one of claims 2-24, 29, 31, 38-47, 51-67, 71-76, and 89-92, wherein the at least one transcriptional activator effector domain is VP64.

94. A DNA targeting system according to any one of claims 2-24, 29, 31, 38-47, 51-67, 71-76, and 89-93, wherein the at least one transcriptional activation domain comprises the sequence shown in SEQ ID NO: 142, a portion thereof, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of the foregoing.

95. A DNA targeting system according to any one of claims 2-24, 29, 31, 38-47, 51-67, 71-76, and 89-94, wherein the fusion protein comprises the sequence shown in SEQ ID NO: 77, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

96. A combination of epigenetically modified DNA targeting systems, comprising at least two DNA targeting systems according to any one of claims 1, 3-27, 33-37, 44-49, 54-69, and 74-88, wherein each DNA targeting system represses the transcription of a different gene among the one or more genes.

97. A combination of epigenetically modified DNA targeting systems, comprising at least two of the DNA targeting systems according to any one of claims 2-24, 29, 31, 38-47, 51-67, 71-76, and 89-95, wherein each DNA targeting system increases the transcription of a different gene among the one or more genes.

98. A guide RNA (gRNA) that targets a target site of a gene selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2.

99. The gRNA according to claim 98, wherein the target site of the gene is in the gene or its regulatory DNA element.

100. The gRNA according to claim 99, wherein the regulatory DNA element is an enhancer or a promoter.

101. The gRNA according to any one of claims 98-100, wherein the target site is within 1000 base pairs (bp) of the transcription start site of the gene.

102. The gRNA according to any one of claims 98-101, wherein the target site is within 500 base pairs (bp) of the transcription start site of the gene.

103. The gRNA according to any one of claims 98-102, wherein the target site is selected from: (a) The target site of CD5, which has the sequence shown in any one of SEQ ID NO: 1-3, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (b) The target site of KDM1A, which has the sequence shown in any one of SEQ ID NO: 4-6, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (c) The target site of CBLB, which has the sequence shown in any one of SEQ ID NO: 10-12, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (d) The target site of DGKZ, which has the sequence shown in any one of SEQ ID NO: 13-15, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (e) The target site of MYB, which has the sequence shown in any one of SEQ ID NO: 16-18, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (f) The target site of RASA2, which has the sequence shown in any one of SEQ ID NO: 19-21, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (g) The target site of ELOB, which has the sequence shown in any one of SEQ ID NO: 22-24, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (h)Target sites of GATA3, having the sequences shown in any of SEQ ID NOs: 25 - 27, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing; (i)Target sites of CISH, having the sequences shown in any of SEQ ID NOs: 28 - 30, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing; (j)Target sites of PRDM1, having the sequences shown in any of SEQ ID NOs: 31 - 33, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing; (k)Target sites of MED12, having the sequences shown in any of SEQ ID NOs: 80 - 90, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing; (l)Target sites of CCNC, having the sequences shown in any of SEQ ID NOs: 102 - 112, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing; (m)Target sites of FAS, having the sequences shown in any of SEQ ID NOs: 200 - 205 and 292 - 295, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing; (n)Target sites of Fli1, having the sequences shown in any of SEQ ID NOs: 206 - 211, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing; and (o)Target sites of TGFBR2, having the sequences shown in any of SEQ ID NOs: 300 - 302 and 306 - 308, continuous portions of at least 14 nucleotides (nt) thereof, or complementary sequences of any of the foregoing.

104. The gRNA according to any one of claims 98 - 103, wherein the target site is selected from: (a)Target sites of CD5, having the sequences shown in any of SEQ ID NOs: 1 - 3 or complementary sequences thereof; (b)Target sites of KDM1A, having the sequences shown in any of SEQ ID NOs: 4 - 6 or complementary sequences thereof; (c)Target sites of CBLB, having the sequences shown in any of SEQ ID NOs: 10 - 12 or complementary sequences thereof; (d)Target sites of DGKZ, having the sequences shown in any of SEQ ID NOs: 13 - 15 or complementary sequences of any of the foregoing; (e)Target sites of MYB, having the sequences shown in any of SEQ ID NOs: 16 - 18 or complementary sequences of any of the foregoing; (f)Target sites of RASA2, having the sequences shown in any of SEQ ID NOs: 19 - 21 or complementary sequences of any of the foregoing; (g)Target sites of ELOB, having the sequences shown in any of SEQ ID NOs: 22 - 24 or complementary sequences of any of the foregoing; (h)Target sites of GATA3, having the sequences shown in any one of SEQ ID NOs: 25 - 27 or the complementary sequences of any of the foregoing; (i)Target sites of CISH, having the sequences shown in any one of SEQ ID NOs: 28 - 30 or the complementary sequences of any of the foregoing; (j)Target sites of PRDM1, having the sequences shown in any one of SEQ ID NOs: 31 - 33 or the complementary sequences of any of the foregoing; (k)Target sites of MED12, having the sequences shown in any one of SEQ ID NOs: 80 - 90 or the complementary sequences of any of the foregoing; (l)Target sites of CCNC, having the sequences shown in any one of SEQ ID NOs: 102 - 112 or the complementary sequences of any of the foregoing; (m)Target sites of FAS, having the sequences shown in any one of SEQ ID NOs: 200 - 205 and 292 - 295 or the complementary sequences of any of the foregoing; (n)Target sites of Fli1, having the sequences shown in any one of SEQ ID NOs: 206 - 211 or the complementary sequences of any of the foregoing; and (o)Target sites of TGFBR2, having the sequences shown in any one of SEQ ID NOs: 300 - 302 and 306 - 308 or the complementary sequences of any of the foregoing.

105. The gRNA according to any one of claims 98 - 104, wherein the target site is selected from: (a)Target sites of CBLB, having the sequence shown in SEQ ID NO: 11 or the complementary sequence of any of the foregoing; (b)Target sites of MYB, having the sequence shown in SEQ ID NO: 18 or the complementary sequence of any of the foregoing; (c)Target sites of RASA2, having the sequence shown in SEQ ID NO: 19 or the complementary sequence of any of the foregoing; (d)Target sites of CISH, having the sequence shown in SEQ ID NO: 28 or the complementary sequence of any of the foregoing; (e)Target sites of PRDM1, having the sequence shown in SEQ ID NO: 33 or the complementary sequence of any of the foregoing; and (f)Target sites of MED12, having the sequence shown in SEQ ID NO: 81 or the complementary sequence of any of the foregoing.

106. The gRNA according to any one of claims 98 - 105, wherein the gRNA is selected from: (a)A gRNA targeting the target site of CD5 and comprising a gRNA spacer sequence containing the sequence shown in any one of SEQ ID NOs: 35 - 37 or at least 14 consecutive nucleotides thereof; (b)A gRNA targeting the target site of KDM1A and comprising a gRNA spacer sequence containing the sequence shown in any one of SEQ ID NOs: 38 - 40 or at least 14 consecutive nucleotides thereof; (c) A gRNA that targets the target site of CBLB and contains a gRNA spacer sequence that contains the sequence shown in any one of SEQ ID NOs: 44 - 46 or at least 14 consecutive nucleotides thereof; (d) A gRNA that targets the target site of DGKZ and contains a gRNA spacer sequence that contains the sequence shown in any one of SEQ ID NOs: 47 - 49 or at least 14 consecutive nucleotides thereof; (e) A gRNA that targets the target site of MYB and contains a gRNA spacer sequence that contains the sequence shown in any one of SEQ ID NOs: 50 - 52 or at least 14 consecutive nucleotides thereof; (f) A gRNA that targets the target site of RASA2 and contains a gRNA spacer sequence that contains the sequence shown in any one of SEQ ID NOs: 53 - 55 or at least 14 consecutive nucleotides thereof; (g) A gRNA that targets the target site of ELOB and contains a gRNA spacer sequence that contains the sequence shown in any one of SEQ ID NOs: 56 - 58 or at least 14 consecutive nucleotides thereof; (h) A gRNA that targets the target site of GATA3 and contains a gRNA spacer sequence that contains the sequence shown in any one of SEQ ID NOs: 59 - 61 or at least 14 consecutive nucleotides thereof; (i) A gRNA that targets the target site of CISH and contains a gRNA spacer sequence that contains the sequence shown in any one of SEQ ID NOs: 62 - 64 or at least 14 consecutive nucleotides thereof; (j) A gRNA that targets the target site of PRDM1 and contains a gRNA spacer sequence that contains the sequence shown in any one of SEQ ID NOs: 65 - 67 or at least 14 consecutive nucleotides thereof; (k) A gRNA that targets the target site of MED12 and contains a gRNA spacer sequence that contains the sequence shown in any one of SEQ ID NOs: 91 - 101 or at least 14 consecutive nucleotides thereof; (l) A gRNA that targets the target site of CCNC and contains a gRNA spacer sequence that contains the sequence shown in any one of SEQ ID NOs: 113 - 123 or at least 14 consecutive nucleotides thereof; (m) A gRNA that targets the target site of FAS and contains a gRNA spacer sequence that contains the sequence shown in any one of SEQ ID NOs: 212 - 217 and 296 - 299 or at least 14 consecutive nucleotides thereof; (n) A gRNA that targets the target site of Fli1 and contains a gRNA spacer sequence that contains the sequence shown in any one of SEQ ID NOs: 218 - 223 or at least 14 consecutive nucleotides thereof; and (o) A gRNA that targets the target site of TGFBR2 and contains a gRNA spacer sequence that contains the sequence shown in any one of SEQ ID NOs: 303 - 305 and 309 - 311 or at least 14 consecutive nucleotides thereof.

107. The gRNA according to any one of claims 98-106, wherein the gRNA is selected from: (a) A gRNA that targets the target site of CD5 and contains the gRNA spacer sequence shown in any one of SEQ ID NOs: 35-37; (b) A gRNA that targets the target site of KDM1A and contains the gRNA spacer sequence shown in any one of SEQ ID NOs: 38-40; (c) A gRNA that targets the target site of CBLB and contains the gRNA spacer sequence shown in any one of SEQ ID NOs: 44-46; (d) A gRNA that targets the target site of DGKZ and contains the gRNA spacer sequence shown in any one of SEQ ID NOs: 47-49; (e) A gRNA that targets the target site of MYB and contains the gRNA spacer sequence shown in any one of SEQ ID NOs: 50-52; (f) A gRNA that targets the target site of RASA2 and contains the gRNA spacer sequence shown in any one of SEQ ID NOs: 53-55; (g) A gRNA that targets the target site of ELOB and contains the gRNA spacer sequence shown in any one of SEQ ID NOs: 56-58; (h) A gRNA that targets the target site of GATA3 and contains the gRNA spacer sequence shown in any one of SEQ ID NOs: 59-61; (i) A gRNA that targets the target site of CISH and contains the gRNA spacer sequence shown in any one of SEQ ID NOs: 62-64; (j) A gRNA that targets the target site of PRDM1 and contains the gRNA spacer sequence shown in any one of SEQ ID NOs: 65-67; (k) A gRNA that targets the target site of MED12 and contains the gRNA spacer sequence shown in any one of SEQ ID NOs: 91-101; (l) A gRNA that targets the target site of CCNC and contains the gRNA spacer sequence shown in any one of SEQ ID NOs: 113-123; (m) A gRNA that targets the target site of FAS and contains the gRNA spacer sequence shown in any one of SEQ ID NOs: 212-217 and 296-299; (n) A gRNA that targets the target site of Fli1 and contains the gRNA spacer sequence shown in any one of SEQ ID NOs: 218-223; and (o) A gRNA that targets the target site of TGFBR2 and contains the gRNA spacer sequence shown in any one of SEQ ID NOs: 303-305 and 309-311.

108. The gRNA according to any one of claims 98-107, wherein the gRNA is selected from: (a) A gRNA that targets the target site of CBLB and contains the gRNA spacer sequence shown in SEQ ID NO: 45; (b) A gRNA that targets the target site of MYB and contains the gRNA spacer sequence shown in SEQ ID NO:52; (c) A gRNA that targets the target site of RASA2 and contains the gRNA spacer sequence shown in SEQ ID NO:53; (d) A gRNA that targets the target site of CISH and contains the gRNA spacer sequence shown in SEQ ID NO:62; (e) A gRNA that targets the target site of PRDM1 and contains the gRNA spacer sequence shown in SEQ ID NO:67; and (f) A gRNA that targets the target site of MED12 and contains the gRNA spacer sequence shown in SEQ ID NO:

91.

109. The gRNA according to any one of claims 98 - 108, wherein the gRNA contains a spacer sequence having a length between 14 nt and 24 nt or between 16 nt and 22 nt.

110. The gRNA according to any one of claims 98 - 109, wherein the gRNA contains a spacer sequence having a length of 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt.

111. The gRNA according to any one of claims 98 - 110, wherein the gRNA further contains the scaffold sequence shown in SEQ ID NO:

69.

112. A guide RNA (gRNA) that targets the target site of a gene selected from the group consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1.

113. The gRNA according to claim 112, wherein the target site of the gene is in the gene or its regulatory DNA element.

114. The gRNA according to claim 113, wherein the regulatory DNA element is an enhancer or a promoter.

115. The gRNA according to any one of claims 112 - 114, wherein the target site is within 1000 base pairs (bp) of the transcription start site of the gene.

116. The gRNA according to any one of claims 112 - 115, wherein the target site is within 500 base pairs (bp) of the transcription start site of the gene.

117. The gRNA according to any one of claims 112 - 116, wherein the target site is selected from: (a) The target site of VAV1, which has the sequence shown in any one of SEQ ID NOs: 7 - 9, 156, and 170, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (b) The target site of IL2, which has the sequence shown in SEQ ID NO:78, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (c) A target site of BATF, which has the sequence shown in any one of SEQ ID NO: 172 - 174, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (d) A target site of CD28, which has the sequence shown in any one of SEQ ID NO: 144 - 146 and 189 - 191, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (e) A target site of EOMES, which has the sequence shown in any one of SEQ ID NO: 147 - 149, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (f) A target site of IRF4, which has the sequence shown in any one of SEQ ID NO: 175 - 177, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (g) A target site of LAT, which has the sequence shown in any one of SEQ ID NO: 184 - 186, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; (h) A target site of LCP2, which has the sequence shown in any one of SEQ ID NO: 150 - 152 and 187 - 188, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing; and (i) A target site of TBX21, which has the sequence shown in any one of SEQ ID NO: 153 - 155, a continuous portion of at least 14 nucleotides (nt) thereof, or the complementary sequence of any of the foregoing.

118. The gRNA according to any one of claims 112 - 117, wherein the target site is selected from: (a) A target site of VAV1, which has the sequence shown in any one of SEQ ID NO: 7 - 9, 156, and 170 or the complementary sequence of any of the foregoing; (b) A target site of IL2, which has the sequence shown in SEQ ID NO: 78 or any complementary sequence of the foregoing; (c) A target site of BATF, which has the sequence shown in any one of SEQ ID NO: 172 - 174 or the complementary sequence of any of the foregoing; (d) A target site of CD28, which has the sequence shown in any one of SEQ ID NO: 144 - 146 and 189 - 191 or the complementary sequence of any of the foregoing; (e) A target site of EOMES, which has the sequence shown in any one of SEQ ID NO: 147 - 149 or the complementary sequence of any of the foregoing; (f) A target site of IRF4, which has the sequence shown in any one of SEQ ID NO: 175 - 177 or the complementary sequence of any of the foregoing; (g) A target site of LAT, which has the sequence shown in any one of SEQ ID NO: 184 - 186 or the complementary sequence of any of the foregoing; (h)Target sites of LCP2, which have the sequences shown in any one of SEQ ID NOs: 150 - 152 and 187 - 188 or the complementary sequences of any of the foregoing; and (i)Target sites of TBX21, which have the sequences shown in any one of SEQ ID NOs: 153 - 155 or the complementary sequences of any of the foregoing.

119. The gRNA according to any one of claims 112 - 118, wherein the target site is selected from: (a)Target sites of IL-2, which have the sequences shown in SEQ ID NO: 78 or the complementary sequences of any of the foregoing; (b)Target sites of EOMES, which have the sequences shown in SEQ ID NO: 149 or the complementary sequences of any of the foregoing; (c)Target sites of LCP2, which have the sequences shown in SEQ ID NO: 151 or the complementary sequences of any of the foregoing; and (d)Target sites of TBX21, which have the sequences shown in SEQ ID NO: 155 or the complementary sequences of any of the foregoing.

120. The gRNA according to any one of claims 112 - 119, wherein the gRNA is selected from: (a)A gRNA targeting the target site of VAV1 and comprising a gRNA spacer sequence containing the sequences shown in any one of SEQ ID NOs: 41 - 43, 169 and 171 or at least 14 consecutive nucleotides thereof; (b)A gRNA targeting the target site of IL2 and comprising a gRNA spacer sequence containing the sequences shown in SEQ ID NO: 79 or at least 14 consecutive nucleotides thereof; (c)A gRNA targeting the target site of BATF and comprising a gRNA spacer sequence containing the sequences shown in any one of SEQ ID NOs: 178 - 180 or at least 14 consecutive nucleotides thereof; (d)A gRNA targeting the target site of CD28 and comprising a gRNA spacer sequence containing the sequences shown in any one of SEQ ID NOs: 157 - 159 and 197 - 199 or at least 14 consecutive nucleotides thereof; (e)A gRNA targeting the target site of EOMES and comprising a gRNA spacer sequence containing the sequences shown in any one of SEQ ID NOs: 160 - 162 or at least 14 consecutive nucleotides thereof; (f)A gRNA targeting the target site of IRF4 and comprising a gRNA spacer sequence containing the sequences shown in any one of SEQ ID NOs: 181 - 183 or at least 14 consecutive nucleotides thereof; (g)A gRNA targeting the target site of LAT and comprising a gRNA spacer sequence containing the sequences shown in any one of SEQ ID NOs: 192 - 194 or at least 14 consecutive nucleotides thereof; (h)A gRNA targeting the target site of LCP2 and comprising a gRNA spacer sequence containing the sequences shown in any one of SEQ ID NOs: 163 - 165 and 195 - 196 or at least 14 consecutive nucleotides thereof; and (i) A gRNA that targets a target site of TBX21 and contains a gRNA spacer sequence that contains the sequence shown in any one of SEQ ID NOs: 166 - 168 or a continuous portion of at least 14 nt thereof.

121. The gRNA according to any one of claims 112 - 120, wherein the gRNA is selected from: (a) A gRNA that targets a target site of VAV1 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 41 - 43, 169, and 171; (b) A gRNA that targets a target site of IL2 and contains a gRNA spacer sequence shown in SEQ ID NO: 79; (c) A gRNA that targets a target site of BATF and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 178 - 180; (d) A gRNA that targets a target site of CD28 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 157 - 159 and 197 - 199; (e) A gRNA that targets a target site of EOMES and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 160 - 162; (f) A gRNA that targets a target site of IRF4 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 181 - 183; (g) A gRNA that targets a target site of LAT and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 192 - 194; (h) A gRNA that targets a target site of LCP2 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 163 - 165 and 195 - 196; and (i) A gRNA that targets a target site of TBX21 and contains a gRNA spacer sequence shown in any one of SEQ ID NOs: 166 - 168.

122. The gRNA according to any one of claims 112 - 121, wherein the gRNA is selected from: (a) A gRNA that targets a target site of IL - 2 and contains a gRNA spacer sequence shown in SEQ ID NO: 79; (b) A gRNA that targets a target site of EOMES and contains a gRNA spacer sequence shown in SEQ ID NO: 162; (c) A gRNA that targets a target site of LCP2 and contains a gRNA spacer sequence shown in SEQ ID NO: 164; and (d) A gRNA that targets a target site of TBX21 and contains a gRNA spacer sequence shown in SEQ ID NO:

168.

123. The gRNA according to any one of claims 112 - 122, wherein the gRNA contains a spacer sequence having a length between 14 nt and 24 nt or between 16 nt and 22 nt.

124. The gRNA according to any one of claims 112 - 123, wherein the gRNA comprises a spacer sequence having a length of 18 nt, 19 nt, 20 nt, 21 nt, or 22 nt.

125. The gRNA according to any one of claims 112 - 124, wherein the gRNA further comprises the scaffold sequence shown in SEQ ID NO:

69.

126. A combination of gRNAs, comprising: two or more gRNAs, each selected from the gRNAs according to any one of claims 98 - 111, or two or more gRNAs, each selected from the gRNAs according to any one of claims 112 - 125.

127. The combination of gRNAs according to claim 126, wherein the two gRNAs comprise the spacer sequences shown in SEQ ID NO: 92 and 45; SEQ ID NO: 92 and 62; SEQ ID NO: 45 and 52; and SEQ ID NO: 45 and 53; SEQ ID NO: 92 and 304; SEQ ID NO: 92, 304, or 62; or wherein the two gRNAs comprise the spacer sequences shown in SEQ ID NO: 79 and 164; SEQ ID NO: 79 and 168; SEQ ID NO: 79 and 162.

128. A Cas guide RNA (gRNA) combination, comprising: (a) a clustered regularly interspaced short palindromic repeat - associated (Cas) protein or a variant thereof; and (b) at least one gRNA according to any one of claims 98 - 111.

129. A Cas guide RNA (gRNA) combination, comprising: (a) a clustered regularly interspaced short palindromic repeat - associated (Cas) protein or a variant thereof; and (b) at least one gRNA according to any one of claims 112 - 125.

130. The Cas guide RNA (gRNA) combination according to claim 128 or 129, wherein the Cas protein or its variant is a deactivated (dCas) protein.

131. The Cas guide RNA (gRNA) combination according to claim 130, wherein the dCas protein lacks nuclease activity.

132. The Cas guide RNA (gRNA) combination according to claim 130 or 131, wherein the dCas protein is a dCas9 protein.

133. The Cas guide RNA (gRNA) combination according to claim 130 or 131, wherein the dCas protein is a dCas12 protein.

134. The Cas guide RNA (gRNA) combination according to claim 132, wherein the dCas9 protein is a Staphylococcus aureus dCas9 (dSaCas9) protein.

135. The Cas guide RNA (gRNA) combination according to claim 134, wherein the dSaCas9 comprises at least one amino acid mutation selected from D10A and N580A, with reference to the position numbering of SEQ ID NO:

124.

136. The Cas guide RNA (gRNA) combination according to claim 134 or 135, wherein the dSaCas9 protein comprises the sequence shown in SEQ ID NO: 125, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

137. The Cas guide RNA (gRNA) combination according to any one of claims 134-136, wherein the dSaCas9 is as shown in SEQ ID NO:

125.

138. The Cas guide RNA (gRNA) combination according to claim 132, wherein the dCas9 protein is a Streptococcus pyogenes dCas9 (dSpCas9) protein.

139. The Cas guide RNA (gRNA) combination according to claim 138, wherein the dSpCas9 comprises at least one amino acid mutation selected from D10A and H840A, with reference to the position numbering of SEQ ID NO:

126.

140. The Cas guide RNA (gRNA) combination according to claim 121 or 122, wherein the dSpCas9 comprises the sequence shown in SEQ ID NO: 127, or an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

141. The Cas guide RNA (gRNA) combination according to any one of claims 138-140, wherein the dSpCas9 is as shown in SEQ ID NO:

127.

142. A polynucleotide encoding an epigenetically modified DNA targeting system according to any one of claims 1-95.

143. A polynucleotide encoding at least one DNA targeting module of an epigenetically modified DNA targeting system according to any one of claims 1-95.

144. A polynucleotide encoding a fusion protein and at least one gRNA of an epigenetically modified DNA targeting system according to any one of claims 1-95.

145. A polynucleotide encoding a gRNA according to any one of claims 98-125.

146. A polynucleotide encoding a combination of gRNAs according to claim 126.

147. A polynucleotide encoding a Cas-gRNA combination according to any one of claims 128-141.

148. Two or more polynucleotides that jointly encode: an epigenetically modified DNA targeting system according to any one of claims 1-95 At least one DNA targeting module of the epigenetically modified DNA targeting system according to any one of claims 1-95 A fusion protein and at least one gRNA of the epigenetically modified DNA targeting system according to any one of claims 1-95 A combination of gRNAs according to claim 126, and / or A Cas-gRNA combination according to any one of claims 128-141 149. A polynucleotide gRNA combination, comprising: a) A polynucleotide encoding a fusion protein of at least one DNA targeting module for repressing the transcription of one or more genes of the epigenetically modified DNA targeting system according to any one of claims 1, 3-26, 33-37, 44-49, 54-69, 74-88 and 96, and one or more gRNAs selected from the gRNAs according to any one of claims 98-111; or b) A polynucleotide encoding a fusion protein of at least one DNA targeting module for increasing the transcription of one or more genes of the epigenetically modified DNA targeting system according to any one of claims 2-24, 29, 31, 38-47, 51-67, 71-76, 89-95 and 97, and one or more gRNAs selected from the gRNAs according to any one of claims 112-125 150. The polynucleotide gRNA combination according to claim 149, wherein the polynucleotide encoding the fusion protein is mRNA 151. A vector comprising the polynucleotide according to any one of claims 142-147 152. A vector comprising two or more polynucleotides according to claim 148 153. A vector comprising the polynucleotide gRNA combination according to claim 149 154. A vector comprising the polynucleotide gRNA combination according to claim 150 155. The vector according to any one of claims 151-154, wherein the vector is a viral vector 156. The vector according to claim 155, wherein the vector is an adeno-associated virus (AAV) vector 157. The vector according to claim 156, wherein the vector is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 and AAV9 158. The vector according to any one of claims 151-154, wherein the vector is a non-viral vector 159. The vector according to claim 158, wherein the non-viral vector is selected from: lipid nanoparticles, liposomes, exosomes or cell-penetrating peptides 160. The vector according to claim 158 or 159, wherein the non-viral vector is lipid nanoparticles 161. The vector according to any one of claims 151-160, wherein the vector exhibits immunocyte tropism, optionally wherein the vector exhibits T cell tropism 162. A modified T cell comprising a DNA targeting system according to any one of claims 1-95, a combination of DNA targeting systems according to claim 96 or 97, a gRNA according to any one of claims 98-125, a combination of gRNAs according to claim 126 or claim 127, a CRISPR Cas-gRNA combination according to any one of claims 128-141, a polynucleotide according to any one of claims 142-147, two or more polynucleotides according to claim 148, or a polynucleotide gRNA combination according to claim 149 or 150.

163. A modified T cell comprising an epigenetic or phenotypic modification resulting from contact with a DNA targeting system according to any one of claims 1-95, a combination of DNA targeting systems according to claim 96 or 97, a gRNA according to any one of claims 98-125, a combination of gRNAs according to claim 126 or claim 127, a CRISPR Cas-gRNA combination according to any one of claims 128-141, a polynucleotide according to any one of claims 142-147, two or more polynucleotides according to claim 148, a polynucleotide gRNA combination according to claim 149 or 150, or a vector according to any one of claims 151-161.

164. The modified T cell according to claim 162 or 163, wherein the modified T cell is derived from a cell from a subject.

165. The modified T cell according to any one of claims 162-164, wherein the modified T cell is derived from primary T cells.

166. The modified T cell according to any one of claims 162-165, wherein the modified T cell is derived from T cell progenitors, pluripotent stem cells, or induced pluripotent stem cells.

167. The modified T cell according to any one of claims 162-166, wherein the modified T cell further comprises an engineered T cell receptor (eTCR) or a chimeric antigen receptor (CAR).

168. A method for repressing the transcription of one or more genes in T cells, the method comprising introducing into the T cells a DNA targeting system according to any one of claims 1, 3 - 26, 33 - 37, 44 - 49, 54 - 69, and 74 - 88, a combination of DNA targeting systems according to claim 96, a gRNA according to any one of claims 98 - 99, a combination of gRNAs according to claim 126 or claim 127, a Cas-gRNA combination according to any one of claims 128 and 130 - 145, a polynucleotide according to any one of claims 142 - 147, two or more polynucleotides according to claim 148, a polynucleotide-gRNA combination according to claim 149 or 150, or a vector according to any one of claims 151 - 161.

169. The method according to claim 168, wherein repression of the transcription of the one or more genes promotes an increase in T cell effector function upon T cell stimulation relative to T cell effector function in the absence of T cell stimulation.

170. A method for increasing the transcription of one or more genes in T cells, the method comprising introducing into the T cells a DNA targeting system according to any one of claims 2 - 24, 29, 31, 38 - 47, 51 - 67, 71 - 76, and 89 - 95, a combination of DNA targeting systems according to claim 97, a gRNA126 according to any one of claims 112 - 125 or a combination of gRNAs of claim 127, a Cas-gRNA combination of any one of claims 129 and 130 - 141, a polynucleotide according to any one of claims 142 - 147, two or more polynucleotides according to claim 148, a polynucleotide-gRNA combination according to claim 149 or 150, or a vector according to any one of claims 151 - 161.

171. The method according to claim 170, wherein increasing the transcription of the one or more genes promotes an increase in T cell effector function upon T cell stimulation relative to T cell effector function in the absence of T cell stimulation.

172. A method of increasing T cell effector function, the method comprising introducing into T cells a DNA targeting system according to any one of claims 1-95, a combination of DNA targeting systems according to claim 96 or 97, a gRNA according to any one of claims 98-125, a combination of gRNAs according to claim 126 or claim 127, a CRISPR Cas-gRNA combination according to any one of claims 128-141, a polynucleotide according to any one of claims 142-147, two or more polynucleotides according to claim 148, a polynucleotide gRNA combination according to claim 149 or 150, or a vector according to any one of claims 151-161.

173. The method according to claim 169, 171 or 172, wherein the T cell effector function is increased compared to T cells into which a DNA targeting system according to any one of claims 1-95, a combination of DNA targeting systems according to claim 96 or 97, a gRNA according to any one of claims 98-125, a combination of gRNAs according to claim 126 or claim 127, a CRISPR Cas-gRNA combination according to any one of claims 128-141, a polynucleotide according to any one of claims 142-147, two or more polynucleotides according to claim 148, a polynucleotide gRNA combination according to claim 149 or 150, or a vector according to any one of claims 151-161 has not been introduced.

174. The method according to any one of claims 168-173, wherein the T cells are T cells in a subject, and the method is carried out in vivo.

175. The method according to any one of claims 168-173, wherein the T cells are T cells from a subject, or cells derived from the subject, and the method is carried out ex vivo.

176. The cell according to claim 175, wherein the T cells are primary T cells.

177. The method according to claim 176, wherein the T cells are derived from T cell progenitors, pluripotent stem cells or induced pluripotent stem cells.

178. The method according to any one of claims 168-177, wherein the introduction is by transient delivery into the T cells.

179. The method according to claim 178, wherein the transient delivery comprises electroporation, transfection or transduction.

180. The method according to any one of claims 168 - 179, wherein the DNA targeting system according to any one of claims 1 - 95, the combination of DNA targeting systems according to claim 96 or 97, the gRNA according to any one of claims 98 - 125, the combination of gRNAs according to claim 126 or claim 127, the CRISPR Cas - gRNA combination according to any one of claims 128 - 141, the polynucleotide according to any one of claims 142 - 147, the two or more polynucleotides according to claim 148, the polynucleotide gRNA combination according to claim 149 or 150, or the vector according to any one of claims 151 - 161 is transiently expressed and / or transiently present in T cells.

181. The method according to any one of claims 168, 169, and 272 - 180, wherein the introduction represses the transcription of one or more genes in the T cells, the genes being selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2.

182. The method according to any one of claims 170 - 180, wherein the introduction increases the transcription of one or more genes in the T cells, the genes being selected from the group consisting of BATF, CD28, EOMES, IL - 2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1.

183. A modified T cell produced by the method according to any one of claims 168 - 182.

184. A method of treating a disease or disorder in a subject, the method comprising administering to the subject a modified T cell according to any one of claims 162 - 167 and 183.

185. A method of increasing T cell persistence in T cells of a subject, the method comprising administering to the subject or its T cells the DNA targeting system according to any one of claims 1 - 95, the combination of DNA targeting systems according to claim 96 or 97, the gRNA according to any one of claims 98 - 125, the combination of gRNAs according to claim 126 or claim 127, the CRISPR Cas - gRNA combination according to any one of claims 128 - 141, the polynucleotide according to any one of claims 142 - 147, the two or more polynucleotides according to claim 148, the polynucleotide gRNA combination according to claim 149 or 150, or the vector according to any one of claims 151 - 161.

186. The method according to claim 185, wherein the T cells are from adoptive T cell therapy for treating the disease or disorder of the subject.

187. The method according to claim 186, wherein the T cell therapy comprises T cells expressing a recombinant receptor specific for a target antigen.

188. The method according to claim 186 or 187, wherein the administration is carried out before, simultaneously with, or after the administration of the adoptive T cell therapy.

189. The method according to any one of claims 186-188, wherein the administration is carried out after the administration of the adoptive T cell therapy in the subject, at a time after the number or effector function of the T cells of the adoptive T cell therapy in the subject has decreased or is suspected of decreasing.

190. A method of treating a disease or disorder in a subject, the method comprising administering to the subject: A T cell therapy comprising cells expressing a recombinant receptor specific for a target antigen associated with the disease or disorder; and A DNA targeting system according to any one of claims 1-95, a combination of DNA targeting systems according to claim 96 or 97, a gRNA according to any one of claims 98-125, a combination of gRNAs according to claim 126 or claim 127, a CRISPR Cas-gRNA combination according to any one of claims 128-141, a polynucleotide according to any one of claims 142-147, two or more polynucleotides according to claim 148, a polynucleotide gRNA combination according to claim 149 or 150, or a vector according to any one of claims 151-161.

191. The method according to any one of claims 187-190, wherein the recombinant receptor is an engineered T cell receptor (eTCR) or a chimeric antigen receptor (CAR).

192. The method according to any one of claims 187-191, wherein the target antigen is a tumor antigen.

193. The method according to any one of claims 186-192, wherein the disease or disorder is cancer.

194. The method according to claim 193, wherein the cancer is a hematological cancer or a solid tumor.

195. The method according to any one of claims 186-192, wherein the disease or disorder is an autoimmune disorder and / or an inflammatory disorder.

196. The method according to any one of claims 185-195, wherein the administration results in the transient delivery of the following into the T cells: the DNA targeting system, the combination of DNA targeting systems, the gRNA, the combination of gRNAs, the CRISPR Cas-gRNA combination, the polynucleotide, the two or more polynucleotides, the polynucleotide gRNA combination, or the vector.

197. The method according to any one of claims 185-196, wherein the administration represses the transcription of one or more genes in the T cells, and the genes are selected from the group consisting of CBLB, CCNC, CD5, CISH, DGKZ, ELOB, FAS, Fli1, GATA3, KDM1A, MED12, MYB, PRDM1, TGFBR2, and RASA2.

198. The method according to any one of claims 185-197, wherein the administration represses the transcription of one or more genes in the T cells, and the genes are selected from the group consisting of CBLB, CISH, MED12, MYB, PRDM1, and RASA2.

199. The method according to any one of claims 185-196, wherein the administration increases the transcription of one or more genes in the T cells, and the genes are selected from the group consisting of BATF, CD28, EOMES, IL-2, IL2RB, IRF4, LAT, LCP2, TBX21, and VAV1.

200. The method according to any one of claims 185-196 or 199, wherein the administration increases the transcription of one or more genes in the T cells, and the genes are selected from the group consisting of EOMES, IL-2, LCP2, and TBX21.

Images