Crispr-cas9-based hybridization method for saccharomyces cerevisiae

Abstract

The present invention belongs to the technical field of gene editing. Disclosed is a CRISPR-Cas9-based hybridization method for Saccharomyces cerevisiae. According to the hybridization method, the MAT gene of Saccharomyces cerevisiae is engineered by means of gene editing to realize efficient mating type switching of Saccharomyces cerevisiae strains with different genetic backgrounds, thereby realizing the hybridization of Saccharomyces cerevisiae strains with different brewing properties.

Description

CRISPR-Cas9-based hybridization method for Saccharomyces cerevisiae

[0001] This application claims priority to a Chinese patent application filed with the Patent Office of China on December 11, 2023, with application number 2023116911920 and invention name “A method for intraspecific hybridization of brewer's yeast based on CRISPR-Cas9”, the entire contents of which are incorporated by reference into this application. Technical Field

[0002] The present application belongs to the field of gene editing technology, and in particular relates to a hybridization method of brewer's yeast based on CRISPR-Cas9. Background Art

[0003] Hybrid breeding refers to the process of connecting the sexual spores or asexual spores and their cells of two strains with different genotypes, fusing the cell nuclei, and then undergoing meiosis or mitosis of the cell nuclei, causing the separation and recombination of genetic traits, and producing recombinants with various new traits. These are then separated and screened to obtain production strains that meet the requirements.

[0004] The alleles (MATa and MATα) at ​​the MAT locus on yeast chromosome 3 determine the yeast's mating type. Haploid yeast cells are divided into a-type and α-type. In homothallic yeast strains, yeast frequently switch mating types, and cells of the same mating type cannot mate. Because most industrial Saccharomyces cerevisiae strains that do not reproduce sexually are MATa / MATα, hybridization is difficult, making it difficult to promote and apply mutation breeding as widely as it is.

[0005] Although some superior bacterial strains are primarily selected through mutation breeding, long-term treatment with mutagens generally leads to a gradual decline in the viability of a strain, manifested by symptoms such as prolonged growth cycles, decreased spore production, slower metabolism, and slower yield increases. Hybrid breeding, on the other hand, utilizes donor and recipient strains with known traits as parents. Therefore, it represents a significant advancement over mutagenesis in both direction and conscious effort, making it another important approach to microbial strain selection. However, due to its complex methods and slow progress, hybrid breeding has yet to achieve the widespread adoption and application of mutagenesis. Summary of the Invention

[0006] In order to overcome some problems existing in the prior art, the present application provides a hybridization method of brewer's yeast based on CRISPR-Cas9, which transforms the MAT gene of brewer's yeast through gene editing, completes the mating type conversion of brewer's yeast strains with different genetic backgrounds, and realizes the hybridization of brewer's yeast strains with different brewing characteristics.

[0007] In one embodiment, the saccharomyces cerevisiae is industrial saccharomyces cerevisiae. Alternatively, the saccharomyces cerevisiae is brewer's yeast.

[0008] In one embodiment, the MAT gene includes MATa and MATα genes.

[0009] In one embodiment, the modification of the MAT gene of Saccharomyces cerevisiae by gene editing specifically includes: constructing a pRCC-K recombinant plasmid for MATa and a pUDP004 recombinant plasmid for MATα, respectively, to obtain a MATa-pRCC-K plasmid and a MATα-pUDP004 plasmid, respectively, and transforming them into competent cells of different Saccharomyces cerevisiae, respectively, based on screening on resistance plates and selective culture media, to quickly achieve hybridization of yeast strains. It is understandable that the pRCC-K and pUDP004 plasmids are known plasmids, and their sequences can be obtained from https: / / www.addgene.org / (Addgene is a non-profit global plasmid sharing platform).

[0010] More specifically, after obtaining the MATa-pRCC-K plasmid and the MATα-pUDP004 plasmid, the hybridization method

[0011] The MATa-pRCC-K plasmid is transformed into competent cells of the first Saccharomyces cerevisiae (the first parent). MATα in a portion of the first Saccharomyces cerevisiae is replaced by MATa, resulting in yeast with the same MAT genotype (MATa). Successful transformations are then screened using resistance plates (i.e., the first parent with successful gene editing is obtained through screening based on the resistance plate).

[0012] The MATα-pUDP004 plasmid is transformed into competent cells of a second Saccharomyces cerevisiae strain (the second parent). A portion of the second Saccharomyces cerevisiae strain replaces MATa with MATα, yielding yeast with the same MAT genotype (MATα). Successful transformation is then screened using a selective medium (i.e., the second parent strain with successful gene editing is obtained).

[0013] Finally, the first parent that was successfully transformed and the second parent that were screened were hybridized to obtain a hybridized Saccharomyces cerevisiae strain, thereby achieving the hybridization of different yeast strains.

[0014] In one embodiment, the nucleotide sequences of the MATa-pRCC-K plasmid and the MATα-pUDP004 plasmid are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively;

[0015] By respectively transforming the MATa-pRCC-K plasmid and the MATα-pUDP004 plasmid into different Saccharomyces cerevisiae parents, replacing one of the mating type MATs, yeast with the same MAT genotype is obtained, and then hybridization is performed, thereby achieving hybridization of Saccharomyces cerevisiae strains with different genetic backgrounds and different brewing characteristics. It is understandable that Saccharomyces cerevisiae (parents) can include Saccharomyces cerevisiae and Saccharomyces cerevisiae var. Diastaticus. Those skilled in the art can select specific parents according to different goals (highlighted expected performance) and achieve a combination of excellent traits of both parents through hybridization. That is, those skilled in the art can select strains with different characteristics within the scope of the above species for hybridization to obtain hybrid yeast with expected performance. This scheme does not specifically limit the species within the above species range, as long as the conditions can be met within the above species range.

[0016] In one embodiment, the specific method for constructing the pRCC-K recombinant plasmid for MATa is:

[0017] Design the gene editing sgRNA primer sequence for the MAT gene;

[0018] The MAT gene is amplified by a first PCR, and the resulting PCR product is recovered by gel cutting to obtain an amplified PCR product;

[0019] The gap of the amplified PCR product was ligated and transformed using the pEASY-Basic Seamless Cloning and Assembly Kit to obtain a positive clone of the recombinant plasmid of the MAT gene. After verification, the recombinant MATa-pRCC-K plasmid was obtained.

[0020] It is understood that the above method more specifically includes the following steps:

[0021] 1) Gene-specific sgRNA and primer design

[0022] The gene editing sgRNA primer sequences include MATa-sgRNA-FW and MATa-sgRNA-RV, and their nucleotide sequences are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

[0023] 2) First PCR amplification

[0024] The MAT gene was amplified by the first PCR;

[0025] The PCR amplification reaction system was as follows: 5X Phusion Buffer 10 μl, 2 mM dNTPs 5 μl, MATa-sgRNA-FW 1 μl, MATa-sgRNA-RV 1 μl, Plasmid 2 μl, Phusion polymerase 0.5 μl, H O 30.5 μl, a total of 50 μl;

[0026] The PCR amplification reaction conditions were as follows: 98°C for 30 s; 98°C for 10 s, 62°C for 30 s, 72°C for 5 min, 30 cycles; 72°C for 10 min, and storage at 4°C.

[0027] 3) PCR product gel excision and recovery

[0028] The PCR product was excised and recovered using the GeneJET Gel Extraction Kit to obtain the amplified recombinant linear plasmid.

[0029] 4) One-step cloning of recombinant linear plasmid

[0030] 4-1) Ligation: The gaps in the amplified PCR product (i.e., recombinant linear plasmid) were ligated using the pEASY-Basic Seamless Cloning and Assembly Kit to obtain a recombinant circular plasmid.

[0031] The ligation reaction system of MATa-pRCC-K is: 2X Basic Assembly Mix 5μl, Linearized vector (5-100ng) 2μl, H2O 3μl.

[0032] 4-2) Conversion:

[0033] a. Thaw Trans1-T1 competent cells on ice;

[0034] b. Add 2 μl of the recombinant product (i.e., the recombinant circular plasmid) to 50 μl of Trans1-T1 competent cells, gently flick the tube wall to mix, and place on ice for 30 minutes;

[0035] c. Heat shock in a 42°C water bath for 30 seconds, then immediately cool on ice for 2 minutes;

[0036] d. Add 450 μl of room temperature LB medium and then incubate at 37°C in a shaker at 250 rpm for 1 hour;

[0037] e. Preheat the LB plate with appropriate resistance (ampicillin resistance can be selected) at 37°C;

[0038] f. Take 100 μl of the cells cultured in step d and evenly spread them on the plate, then culture them upside down in a 37°C incubator overnight;

[0039] 4-3) Positive clone detection:

[0040] a. Use a sterile pipette tip to select a single clone, add 10 μl of the optimal partner (the optimal partner can be directly amplified using M5Hiper Ultralight Mix purchased from Beijing Polymer Biotechnology Co., Ltd.), pipette to mix, incubate at 95°C or in boiling water for 5 minutes, and centrifuge at 12,000 rpm for 1-2 minutes.

[0041] b. Take 2 μl of cell wall disruption solution and mix it with 25 μl of PCR verification system to identify positive clones;

[0042] The primer sequences for the positive clone PCR verification system include:

[0043] pBR322ori-F(3'-5'):

[0044] GGGAAACGCCTGGTATCTTT

[0045] MATa-sgRNA-RV(3'-5'):

[0046] AGCACGGGCATTTTTAGAACGATCATTTATCTTTCACTGCGGAG

[0047] The above sequences are shown in SEQ ID NO: 8 and SEQ ID NO: 9, respectively.

[0048] c. PCR positive clone sequencing verification

[0049] Primer sequences for sequencing verification of positive clones include:

[0050] pRCC-K-SEQ(3'-5'):

[0051] TTTTGGTCAAACGCTGTA; as shown in SEQ ID NO: 10.

[0052] After sequencing verification, it was found that the MATa-pRCC-K plasmid had been constructed.

[0053] In one embodiment, the specific method for constructing the pUDP004 recombinant plasmid for MATα is:

[0054] Design and synthesize a MAT gene-specific crRNA-tracerRNA chimera sequence as shown in SEQ ID NO: 5;

[0055] The synthesized sequence was connected to the pUC57 vector to obtain the pUC57-MATα-sgRNA plasmid; the E. coli containing the pUC57-MATα-sgRNA plasmid was preserved, and the plasmid pUC57-MATα-sgRNA was extracted using a plasmid extraction kit;

[0056] Design primer sequences for obtaining MATα-crRNA-tracerRNA chimera amplification products, perform secondary PCR amplification of the target fragment (MATα-sgRNA) on the extracted pUC57-MATα-sgRNA plasmid, and recover the resulting MATα-crRNA-tracerRNA chimera PCR products by gel excision.

[0057] Plasmid pUDP004 was extracted, and plasmid pUDP004 and MATα-crRNA-tracerRNA chimera PCR product were digested with BsaI respectively. The digested products of the two were mixed and then T4 ligated. The ligated products were transferred into DH5α competent cells to obtain positive clones of recombinant plasmid MATα-pUDP004. After verification, the final recombinant MATα-pUDP004 plasmid was obtained.

[0058] It is understood that the above method more specifically includes the following steps:

[0059] 1) Design and synthesis of MATα gene-specific crRNA-tracerRNA chimera sequences:

[0060] A synthetic sequence crRNA-tracerRNA chimera was designed, and its nucleotide sequence is shown in SEQ ID NO: 5.

[0061] 2) Connect the above synthetic fragment into the pUC57 vector:

[0062] The crRNA-tracerRNA chimera fragment was connected to the pUC57 vector to obtain the pUC57-MATα-sgRNA plasmid; the E. coli containing the pUC57-MATα-sgRNA plasmid was preserved and the plasmid was extracted using a plasmid extraction kit.

[0063] 3) Design primers and perform a second PCR amplification of the target fragment on the extracted plasmid (pUC57-MATα-sgRNA):

[0064] In order to obtain a complete MATα-crRNA-tracerRNA chimera, primers for obtaining amplified products of MATα-crRNA-tracerRNA chimera (ie, primers for the second PCR amplification) were synthesized, and protective bases TT were added to the 5' ends of the upstream and downstream primers.

[0065] The primer sequences used to obtain the MATα-crRNA-tracerRNA chimera amplification product include pUDP004-MATα-FW and pUDP004-MATα-RV, whose nucleotide sequences are shown in SEQ ID NO: 6 and SEQ ID NO: 7, respectively.

[0066] The PCR amplification reaction system was as follows: 5X Phusion Buffer 10 μl, 2 mM dNTPs 5 μl, pUDP004-MATα-FW 1 μl, pUDP004-MATα-RV 1 μl, Plasmid 1 μl, Phusion polymerase 0.5 μl, H O 31.5 μl, a total of 50 μl;

[0067] The PCR amplification reaction conditions were as follows: 98°C for 30 s; 98°C for 10 s, 65°C for 30 s, 72°C for 15 s, 30 cycles; 72°C for 10 min, and storage at 4°C.

[0068] 4) MATα-crRNA-tracerRNA chimera PCR product was excised and recovered from the gel and concentration was determined:

[0069] The PCR products were recovered from the gel using GeneJET Gel Extraction Kit.

[0070] 5) Extract plasmid pUDP004

[0071] E. coli containing pUDP004 was inoculated into LB medium containing ampicillin (Amp) resistance, cultured at 37°C for 16 hours, and plasmid pUDP004 was extracted.

[0072] 6) BsaI digestion of MATα-crRNA-tracerRNA chimera fragment and plasmid pUDP004

[0073] The obtained MATα-crRNA-tracerRNA chimera and plasmid pUDP004 were digested with BsaI using the following system:

[0074] The enzyme digestion reaction system includes: 10x FastDigest 5μl, PCR product or plasmid 1μg, FastDigest enzyme 5μl, total volume 50μl.

[0075] The enzyme digestion reaction procedure was as follows: 37°C for 5 h, followed by treatment at 65°C for 5 min to inactivate the enzyme.

[0076] 7) T4 ligation of the MATα-crRNA-tracerRNA chimera fragment and the plasmid pUDP004 digestion product:

[0077] The digested MATα-crRNA-tracerRNA chimera fragment and plasmid pUDP004 were mixed, and then T4 ligated to obtain a ligation product;

[0078] The T4 ligation reaction system includes: pUDP004-BsaI (enzyme digestion product of pUDP004) 50 ng (0.2 μl), PCR-BsaI (enzyme digestion product of MATα-crRNA-tracerRNA chimera fragment) 100 ng (3 μl), Buffer 2 μl, T4 0.2 μl, H2O 14.7 μl;

[0079] The ligation reaction procedure was: 22°C for 1 h, 65°C for 10 min.

[0080] 8) DH5α transformation of ligation product:

[0081] The ligation product was transformed into DH5α competent cells.

[0082] 9) PCR verification and sequencing verification of recombinant plasmid pUDP004-MATα

[0083] Amplification primers were designed outside the BsaI restriction site of the vector (pUDP004), and positive clones were verified by colony PCR and sequencing.

[0084] PCR amplification reaction primers include:

[0085] pUDP004-BsaI-Test-FW(3'-5'):

[0086] AAAAGAATCCCAGCACCA

[0087] pUDP004-BsaI-Test-RV(3'-5'):

[0088] TCCTTTTCGGTTAGAGCG

[0089] The above sequences are shown in SEQ ID NO: 11 and SEQ ID NO: 12, respectively.

[0090] The PCR amplification reaction system includes:

[0091] 2X DreamTaq Buffer 25μl, pUDP004-BsaI-Test-FW 2μl, Plasmid 1μl, pUDP004-BsaI-Test-RV 2μl, H2O 20μl;

[0092] The PCR amplification reaction conditions were as follows: 95°C for 3 min; 95°C for 30 s, 54°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 10 min, and storage at 4°C.

[0093] The positive clones were further sequenced to verify the accuracy of their sequences. The sequencing primer sequence of the recombinant plasmid MATα-pUDP004 was AACCATCAGTTCATAGGTCCAT; as shown in SEQ ID NO: 13.

[0094] After sequencing verification, it was found that the MATα-pUDP004 plasmid had been constructed.

[0095] Compared with the prior art, the advantages and positive effects of this application are:

[0096] At least one embodiment of the present application provides a CRISPR-Cas9-based hybridization method for brewer's yeast, which transforms the MAT gene of brewer's yeast through gene editing, completes efficient mating type conversion of brewer's yeast strains with different genetic backgrounds, and realizes the hybridization of brewer's yeast strains with different brewing characteristics. BRIEF DESCRIPTION OF THE DRAWINGS

[0097] FIG1 is a yeast fingerprint provided in one embodiment of the present application;

[0098] Figure 2 is a schematic diagram of yeast cell diameter;

[0099] Figure 3 is a schematic diagram of yeast count during the fermentation process;

[0100] Figure 4 shows the utilization of maltotetraose and above sugars;

[0101] Figure 5 shows the utilization of maltotriose;

[0102] Figure 6 shows the utilization of maltose + sucrose;

[0103] Figure 7 is a schematic diagram of the fermentation degree of cold-stored wine;

[0104] Figure 8 is a schematic diagram of the alcohol content of cold-stored wine;

[0105] Figure 9 is a schematic diagram of diacetyl content in cold-stored wine;

[0106] Figure 10 is a schematic diagram of acetaldehyde content in cold-stored wine;

[0107] Figure 11 is a schematic diagram of the total alcohol content of cold-stored wine;

[0108] Figure 12 is a schematic diagram of the total ester content of cold-stored wine;

[0109] Figure 13 is a schematic diagram of the alcohol-ester ratio of cold-stored wine;

[0110] FIG14 is a schematic diagram of the 4-vinylguaiacol content in cold-stored wine;

[0111] FIG15 is a schematic diagram showing the 4-ethylphenol content in cold-stored wine. DETAILED DESCRIPTION

[0112] The following is a clear and complete description of the technical solutions in the embodiments of this application. Obviously, the embodiments described are only part of the embodiments of this application, not all of them. Based on the embodiments of this application, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of this application.

[0113] Example 1

[0114] Saccharomyces cerevisiae var. diastaticus BE-13 (TTA-35) was selected as the first parent for hybridization. It is characterized by high sugar utilization ability and fermentation degree, and is rich in phenolic substances (4-VG); Saccharomyces cerevisiae Voss Kveik Ale (TTA-36) was selected as the second parent for hybridization. It is characterized by medium fermentation degree and no phenolic substances. Both are commercially available yeasts.

[0115] The following operations were performed on TTA-35 and TTA-36 yeasts: the yeast was inoculated into 50 mL YPD medium and cultured at 30°C overnight; the yeast culture was transferred to 100 mL YPD medium and the OD 600 The yeast was placed in a 30°C incubator and continued to be cultured until the OD 600 ≈0.7-0.8 (approximately 2h); collect the yeast cells into a 50mL centrifuge tube, centrifuge and wash once with sterile water.

[0116] The following procedures were performed on the collected TTA-35 and TTA-36 yeast cells: the yeast cells were resuspended in 25 mL of 0.1 M lithium acetate / 10 mM dithiothreitol / 10 mM TE solution and allowed to stand at room temperature for 1 hour. After centrifugation, the 25 mL aliquot was washed twice with ice-cold sterile water and once with 10 mL of ice-cold 1 M sorbitol. After centrifugation, the yeast cells were dissolved in 600 μL of sorbitol. 100 μL of TTA-35 and TTA-36 yeast cells were electroporated. The recombinant MATa-pRCC-K plasmid (500 ng) was added to TTA-35, and the recombinant MATα-pUDP004 plasmid (500 ng) was added to TTA-36. After standing on ice for 5 minutes, the cells were electroporated at 1.8 kV. After electroporation, 1 mL of ice-cold sorbitol solution was quickly poured over the cells, and the cells were then transferred to 300 μL of YPD medium.

[0117] The TTA-35 yeast culture transformed with MATa-pRCC-K was cultured in a 30°C incubator for 3 hours, and then a certain amount of yeast (200-300 μL) was spread on a G418 plate (i.e., the resistance plate) to obtain TTA-35 containing MATa-pRCC-K. The TTA-36 yeast culture transformed with MATα-pUDP004 was cultured in a 30°C incubator for 3 hours, and then a certain amount of yeast (200-300 μL) was spread on a selective medium (acetamide) plate to obtain TTA-36 containing MATα-pUDP004.

[0118] Mix TTA-35 and TTA-36 containing the recombinant plasmid to be hybridized (5 μl + 5 μl) and plate onto a YPD plate. After 12-36 hours, transfer the cells to acetamide selective medium + G418 plates (i.e., acetamide selective medium containing the antibiotic G418) to screen for hybrid yeast. Select four single colonies from the acetamide selective medium + G418 plates.

[0119] To ensure traceless editing by discarding the gene-editing plasmids (i.e., pRCC-K and pUDP004 plasmids), four selected single clones were inoculated into YPD medium and passaged two to three times. After that, they were plated onto YPD medium and single colonies were selected for verification on acetamide selective medium plus G418 medium. Finally, hybrid strains HA1, HA2, HA3, and HA4 were obtained, which grew on YPD medium but not on acetamide medium plus G418 medium.

[0120] Hybrid yeast fingerprint verification

[0121] Yeast fingerprint PCR amplification of HA1, HA2, HA3, and HA4 was performed using primers Delta12 (5P-TCAACAATGGAATCCCAAC-3P) and Delta21 (5P-CATCTTAACACCGTATATGA-3P). The sequences of Delta12 and Delta21 are shown in SEQ ID NO: 14 and SEQ ID NO: 15, respectively.

[0122] The PCR amplification reaction strip system includes:

[0123] 2X DreamTaq Buffer 25μl, Delta12 2μl, Delta21 2μl, DNA 1μl, H2O20μl;

[0124] The PCR amplification reaction conditions were as follows: 95°C for 3 min; 30 cycles of 95°C for 30 s, 46°C for 30 s, and 72°C for 90 s; 72°C for 10 min, and storage at 4°C.

[0125] From the yeast fingerprint results in Figure 1, we can see that the four hybrid yeast strains (HA1-HA4) obtained all combined the fingerprint bands of the two parents (TTA35 and TTA36).

[0126] Verification of EBC tube fermentation performance of yeast strains (hybrid parents and hybrid strains)

[0127] The following operations were performed on two parental strains (TTA-35, TTA-36) and four hybrid strains (HA1-HA4), and three biological replicates were performed for each sample.

[0128] (1) Retrieve the yeast using a 50 mL sterile centrifuge tube and spin at 4000 r / min after balancing. -1 Centrifuge for 10 min and discard the supernatant and surface yeast layer.

[0129] (2) Weigh 0.5g yeast (2×10 7 The culture medium was taken from each of the two samples and mixed evenly.

[0130] (3) Add the yeast in the centrifuge tube to a Scott bottle containing 220 mL of wort (or culture medium), mix well, and add 1 drop of defoamer.

[0131] (4) Oxygenation of Scott bottle: Shake left and right 20 times to release the air; repeat 2 times.

[0132] (5) The culture medium and yeast in the Scott bottle were transferred to the EBC tube and fermentation was started (18°C).

[0133] (6) After ten days, when the fermentation is finished, the flavor substances and fermentation degree of the cold-stored wine are tested.

[0134] The analysis results are as follows:

[0135] FIG2 shows the diameter of yeast cells. As can be seen from FIG2 , the cell diameters of hybrid yeasts HA1, HA2, HA3, and HA4 are larger than those of hybrid parents TTA-35 and TTA-36.

[0136] Figure 3 shows the yeast proliferation during the fermentation process. From the perspective of yeast count, the yeast counts of the hybrid parents TTA-35 and TTA-36 are significantly higher than those of the four hybrid yeast strains HA1, HA2, HA3, and HA4, and the yeast peaks of the four hybrid strains are significantly lower than those of the two starting yeast strains (i.e., parent yeasts).

[0137] Figure 4 shows the utilization of maltotetraose and higher sugars by yeast during the fermentation process (measured after fermentation). The data in Figure 4 show that TTA-36 yeast utilizes almost no maltotetraose and higher sugars, while TTA-35 utilizes approximately 27% of maltotetraose and higher sugars. The sugar utilization rates of the four hybrid yeast strains HA1, HA2, HA3, and HA4 are around 8%, which is between the sugar utilization rates of the two hybrid parents, TTA-35 and TTA-36. Figure 5 shows the utilization of maltotriose by yeast during the fermentation process. The data in Figure 5 show that TTA-35 yeast utilizes approximately 86% of maltotriose, while TTA-36 utilizes approximately 50%. The maltotriose utilization rates of the four hybrid yeast strains HA1, HA2, HA3, and HA4 are around 80-84%, which is between the maltotriose utilization rates of the two starting yeast strains, TTA-35 and TTA-36, and closer to TTA-35. Figure 6 shows the utilization of maltose and sucrose by yeast during fermentation. The data in Figure 6 show that TTA-36 yeast has a 100% maltotriose utilization rate, TTA-35 has a utilization rate of approximately 97.7%, and the four hybrid yeast strains have a maltotriose utilization rate of approximately 98%, which is between the sugar utilization rates of the two starting yeast strains. The utilization rates of maltose, maltotriose, maltotetraose, and other sugars in the hybrid yeasts are between the sugar utilization rates of the two starting yeast strains.

[0138] Figures 7 and 8 show the fermentation and alcohol content data for cold-stored wines. The data in these figures show that, compared to the original strains TTA-35 and TTA-36, the fermentation and alcohol content of the hybrid strains HA1, HA2, HA3, and HA4 are between those of the two original strains. Figures 9 and 10 show the diacetyl and acetaldehyde contents of cold-stored wines. The data in these figures show that, compared to the original strains TTA-35 and TTA-36, the diacetyl and acetaldehyde contents of the hybrid strains HA1, HA2, HA3, and HA4 are between those of the two original strains, indicating acceptable maturity. Among the hybrid strains, strain HA3 has relatively low diacetyl and acetaldehyde contents, indicating good maturity indicators. Figures 11-13 show the total alcohol, total ester, and alcohol-ester ratio of cold-stored wines, respectively. The data in these figures show that compared with the original strains TTA-35 and TTA-36, the total alcohol content of the hybrid strains HA1, HA2, and HA3 was higher than that of the two original strains, while the total alcohol content of HA4 was comparable to that of TTA-35. Among the hybrid strains, HA2 had a lower total ester content, while HA4 had a higher total ester content. The total ester content of HA1 and HA3 was comparable to that of the two original strains. Regarding the alcohol-ester ratio, HA4 had the lowest content, while HA2 had the highest. Figures 14 and 15 show the 4-vinylguaiacol and 4-ethylphenol content of cold-stored wines, respectively. The data in these figures show that, compared with the original strains TTA-35 and TTA-36, the 4-vinylguaiacol content of the hybrid strains HA1, HA2, HA3, and HA4 was between that of the two original strains, with the data closer to that of the original strain TTA-35. The 4-ethylphenol content of the hybrid strains HA1, HA2, HA3, and HA4 was comparable to that of TTA-35.

[0139] In summary, starting from TTA-35 and TTA-36 yeasts, the hybrid strains HA1, HA2, HA3, and HA4 obtained have differences in various indicators from the starting strains. The cell diameter of the hybrid yeast is significantly larger than that of the starting yeast, the yeast proliferation during the fermentation process is slower, and the peak yeast count is lower; the fermentation degree, alcohol content, diacetyl, and acetaldehyde content of the hybrid yeast are all between the two starting yeast strains. Among the hybrid strains, the diacetyl and acetaldehyde content of the HA3 strain is relatively low, and the maturity index is better; the total alcohol production of the hybrid yeast is slightly higher than that of the starting strain; the 4-VG content of the hybrid yeast is between the two starting strains, closer to TTA-35, and the 4-VP content is the same as TTA-35. It can be seen that the fermentation performance of the obtained hybrid strains is different due to different genetic recombination produced during hybridization, which creates unlimited possibilities for the acquisition of new flavor strains and the development of new flavor products. In addition, the hybridization method provided in the present application significantly improves the feasibility of hybridization of brewer's yeast.

Claims

1. A hybridization method of Saccharomyces cerevisiae based on CRISPR-Cas9, wherein: The MAT gene of Saccharomyces cerevisiae is modified through gene editing to complete the conversion of the mating type of Saccharomyces cerevisiae and achieve the hybridization of Saccharomyces cerevisiae.

2. The hybridization method according to claim 1, wherein The MAT genes include MATa and MATα genes.

3. The hybridization method according to claim 2, wherein The modification of the MAT gene of Saccharomyces cerevisiae through gene editing specifically includes: The pRCC-K recombinant plasmid for MATa and the pUDP004 recombinant plasmid for MATα were constructed respectively, namely the MATa-pRCC-K plasmid and the MATα-pUDP004 plasmid were obtained, which were transformed into different competent cells of Saccharomyces cerevisiae for use in the hybridization of Saccharomyces cerevisiae.

4. The hybridization method according to claim 3, wherein The nucleotide sequences of the MATa-pRCC-K plasmid and the MATα-pUDP004 plasmid are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively; The MATa-pRCC-K plasmid and the MATα-pUDP004 plasmid were transformed into competent cells of different Saccharomyces cerevisiae, respectively, and screened on resistance plates and selective media, and then hybridized to achieve hybridization of Saccharomyces cerevisiae with different genetic backgrounds and different brewing characteristics; The brewer's yeast is beer yeast, including Saccharomyces cerevisiae and Saccharomyces cerevisiae var. Diastaticus.

5. The hybridization method according to claim 3 or 4, wherein The specific method for constructing the pRCC-K recombinant plasmid for MATa is: Design the gene editing sgRNA primer sequence of the MAT gene; Performing a first PCR amplification on the MAT gene, and after amplification, performing gel excision and recovery on the obtained PCR product to obtain an amplified PCR product; The gap of the amplified PCR product was connected and transformed using the pEASY-Basic Seamless Cloning and Assembly Kit to obtain a positive clone of the recombinant plasmid of the MAT gene. After verification, the recombinant MATa-pRCC-K plasmid was obtained.

6. The hybridization method according to claim 5, wherein The gene editing sgRNA primer sequences include MATa-sgRNA-FW and MATa-sgRNA-RV, and their nucleotide sequences are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

7. The hybridization method according to claim 5, wherein The reaction system of the first PCR amplification is: 5X Phusion Buffer 10μl, 2mM dNTPs 5μl, MATa-sgRNA-FW 1μl, MATa-sgRNA-RV 1μl, Plasmid 2μl, Phusion polymerase 0.5μl, H2O 30.5μl, a total of 50μl; the reaction conditions of the first PCR amplification are: 98℃ 30s; 98℃ 10s, 62℃ 30s, 72℃ 5min, 30 cycles; 72℃ 10min, and storage at 4℃.

8. The hybridization method according to claim 3 or 4, wherein The specific method for constructing the pUDP004 recombinant plasmid targeting MATα is as follows: Design and synthesize a crRNA-tracerRNA chimera sequence specific to the MATα gene, as shown in SEQ ID NO: 5; The synthesized sequence was connected to the pUC57 vector to obtain the pUC57-MATα-sgRNA plasmid; the E. coli containing the pUC57-MATα-sgRNA plasmid was preserved, and the plasmid pUC57-MATα-sgRNA was extracted using a plasmid extraction kit; Design primer sequences for obtaining MATα-crRNA-tracerRNA chimera amplification products, perform a second PCR amplification of the target fragment on the extracted pUC57-MATα-sgRNA plasmid, and perform gel excision and recovery on the obtained MATα-crRNA-tracerRNA chimera PCR products after amplification; Plasmid pUDP004 was extracted, and plasmid pUDP004 and MATα-crRNA-tracerRNA chimera PCR product were digested with BsaI respectively, and then T4 ligated. The ligated product was transferred to DH5α competent cells to obtain a positive clone of the recombinant plasmid MATα-pUDP004. After verification, the recombinant MATα-pUDP004 plasmid was obtained.

9. The hybridization method according to claim 8, wherein The primer sequences for obtaining the MATα-crRNA-tracerRNA chimera amplification product include pUDP004-MATα-FW and pUDP004-MATα-RV, and their nucleotide sequences are shown in SEQ ID NO: 6 and SEQ ID NO: 7, respectively.

10. The hybridization method according to claim 9, wherein The reaction system of the second PCR amplification is: 5X Phusion Buffer 10μl, 2mM dNTPs 5μl, pUDP004-MATα-FW 1μl, pUDP004-MATα-RV 1μl, Plasmid 1μl, Phusion polymerase 0.5μl, H2O 31.5μl, totaling 50μl; the reaction conditions of the second PCR amplification are: 98℃ 30s; 98℃ 10s, 65℃ 30s, 72℃ 15s, 30 cycles; 72℃ 10min, stored at 4℃.

Images