Adjuvant composition for vaccine, comprising galectin-4 as active ingredient

Abstract

The present invention relates to: an adjuvant composition for vaccine, comprising galectin-4 as an active ingredient, which, when administered together with an antigen, can improve antibody titer and enhance cellular immunity and humoral immunity; a vaccine composition comprising galectin-4 and an antigen; a method for promoting immune responses, comprising a step of administering the adjuvant composition for a vaccine to a subject together with the vaccine composition or before and after the administration of the vaccine composition; and a vaccine adjuvant composition for promoting immune responses, comprising galectin-4. The adjuvant composition for a vaccine, of the present invention, can increase antibody titer produced by an antigen and can increase both humoral and cellular immune responses, and thus can increase vaccine efficacy, can reduce the production cost of a vaccine by reducing the usage amount of antigen, and is expected to be applicable to cancer treatment vaccines.

Description

Immunoadjuvant composition for vaccine containing galectin-4 as an active ingredient

[0001] Cross-reference to related applications

[0002] This disclosure claims priority to Patent Application No. 10-2023-0141446, filed October 20, 2023, and Patent Application No. 10-2024-0142468, filed October 17, 2024, the entire contents of which are incorporated herein by reference.

[0003] Statement on the Sequence List

[0004] The sequence listing associated with this application is provided in XML format instead of a paper copy and is incorporated herein by reference. The XML file containing the sequence listing is named AN ADJUVANT COMPOSITION FOR VACCINE COMPRISING GALECTIN-4 AS AN ACTIVE INGRIDIENT.xml. The XML file is 6,649 bytes in size, was created on October 11, 2024, and was submitted electronically via PatentCenter.

[0005] The present invention relates to a vaccine adjuvant composition comprising galectin-4 protein as a novel adjuvant.

[0006] As the importance of immunoadjuvants or immune boosters that enhance immunogenicity in vaccine development becomes more prominent, research is actively being conducted.

[0007] Among the vaccines sold worldwide, only about 20 formulations contain adjuvants, and only 6 types of adjuvants are used (Alum, MF59, AS01, AS03, AS04, Virosome).

[0008] Alum was first approved as an adjuvant in 1932 and remains the most widely used vaccine. A subsequent oil-in-water emulsion, MF59, has been approved for use in influenza and seasonal influenza vaccines. Many more formulations are currently under development, encompassing a wide variety of formulations.

[0009] As stimulation of PRRs such as TLR, NOD, and STING has been shown to enhance adaptive immune responses, research is underway to use PRR agonists as strong candidates for new vaccine adjuvants.

[0010] Active research is underway using immunoadjuvants to provide sufficient vaccine efficacy in infants and the elderly, who do not show normal vaccine efficacy.

[0011] Although numerous studies are being conducted to develop immunoadjuvants that can complement the shortcomings of currently used immunoadjuvants, the number of immunoadjuvants that have actually been developed and commercialized is very limited.

[0012] The immune response induced by vaccination can be broadly divided into antibody and cellular immune responses. Antibodies provide the primary defense against most pathogenic bacterial or viral infections, so antibody alone is sufficient for prevention. However, vaccines against bacteria or viruses that cause intracellular infections often rely on cellular immune responses. Therefore, the need for vaccine development using adjuvants that induce cellular immune responses is growing.

[0013] Effective vaccines against HIV, tuberculosis, and malaria remain challenging to develop. Most existing vaccines induce effective antibody immune responses, protecting against various infectious diseases. However, for the aforementioned diseases, antibody immune responses are difficult to elicit, resulting in a growing need for adjuvants to enhance vaccine efficacy.

[0014] Galectins are lectin proteins that share a carbohydrate recognition domain that binds strongly to beta-galactoside residues. Due to their sugar-binding properties, galectins can mediate a significant number of responses in the body, and are known to play a role in cell proliferation, differentiation, activation, and apoptosis. To date, a total of 15 types of galectins have been discovered in mammals, and 12 in humans.

[0015] Galectin-4, a galectin highly expressed in the digestive tract, possesses a tandem repeat structure with two carbohydrate recognition domains. Due to its lectin nature, galectin-4 mediates cell-cell or cell-matrix interactions. Specifically, it binds to lipid rafts in the cell membrane, inducing protein transport and lipid raft stabilization, and is known to be involved in the transport of substances out of the cell. Furthermore, it exhibits antibacterial effects by binding to bacterial blood group antigens, promotes intestinal wound healing, and promotes axonal growth and myelination in nerve cells.

[0016] Pathological studies of galectin-4 have been conducted in various cancer types. For example, the expression level of galectin-4 in colon cancer tissue is known to be significantly lower than in normal colon tissue, and low galectin-4 expression has been reported to be associated with the proliferation, metastasis, and migration of colon cancer cells. In colon cancer cells, galectin-4 is known to suppress tumorigenesis by regulating the Wnt / β-catenin, interleukin-6, NF-kB, and STAT3 signaling pathways. Galectin-4's function is also known to be associated with pancreatic cancer and hepatocellular carcinoma.

[0017] Galectin-4 is also known to play a crucial role in colonic inflammatory responses. Galectin-4 is known to promote colitis by binding to CD4 T cells in mice with T cell receptor mutant colitis, inducing the production of interleukin-6. This promotes colitis and sustains the inflammatory response in the colon, leading to chronic colonic disease. Conversely, in wild-type mice with colitis, galectin-4 has been reported to induce CD4 T cell apoptosis, alleviating the inflammatory response in the colon.

[0018] Compared to cancer-related research, little research has been done on immune cells affected by galectin-4 other than CD4 T cells. It is known that galectin-4 binds to human blood monocytes, inducing their differentiation into macrophages, and binds to mouse M2 macrophages, inducing a strong inflammatory response.

[0019] However, no studies have demonstrated that galectin-4 can increase immune responses as an immunoadjuvant for vaccines.

[0020] Against this backdrop, the inventors of the present invention have conducted continuous research to develop an immunoadjuvant that can be applied to various vaccines, including inactivated vaccines and protein vaccines, and as a result, have confirmed that galectin-4 can be used as an effective ingredient of an immunoadjuvant for vaccines, thereby completing the present invention.

[0021] [Prior Art Literature]

[0022] [Patent Document]

[0023] (Patent Document 1) Republic of Korea Patent Publication No. 10-2016-0087244 (July 21, 2016)

[0024] (Patent Document 2) Republic of Korea Publication No. 10-2021-0056927 (May 20, 2021)

[0025] The main purpose of the present invention is to provide an immunoadjuvant composition for a vaccine containing galectin-4 as an active ingredient.

[0026] Another object of the present invention is to provide a vaccine composition comprising an antigen and galectin-4.

[0027] Another object of the present invention is to provide a use of an immunoadjuvant composition comprising galectin-4 as an active ingredient for enhancing an immune response of an individual to whom the vaccine composition is administered.

[0028] Another object of the present invention is to provide a method for promoting an immune response, comprising the step of administering to a subject a pharmaceutically effective amount of an immunoadjuvant composition for a vaccine comprising galectin-4 as an active ingredient.

[0029] Another object of the present invention is to provide a method for preventing or treating a disease comprising administering to a subject a pharmaceutically effective amount of an immunoadjuvant composition comprising galectin-4 simultaneously or simultaneously with the vaccine composition.

[0030] Another object of the present invention is to provide a vaccine adjuvant composition for promoting an immune response, comprising galectin-4.

[0031] The problems to be solved by the present invention are not limited to the problems described above, and other problems not described will be clearly understood by those skilled in the art from the description below.

[0032] One embodiment of the present invention to achieve the above-described purpose provides an immunoadjuvant composition for a vaccine comprising galectin-4 as an active ingredient.

[0033] The term "galectin-4" in this specification refers to a protein belonging to the galectin family, which is encoded by the LGALS4 gene in humans.

[0034] There is no limitation on the origin of galectin-4, and either naturally derived or recombinant proteins can be used.

[0035] For example, galectin-4 derived from mouse or human can be used.

[0036] Mouse Gal-4 amino acid sequence (SEQ ID NO: 1)

[0037] mayvpapgyq ptynptlpyk rpipgglsvg msvyiqgmak enmrrfhvnf avgqddgadv afhfnprfdg wdkvvfntmq sgqwgkeekk ksmpfqkgkh felvfmvmpe hykvvvngns fyeyghrlpv qmvthlqvdg dlelqsinfl ggqpaaapyp gamtipaypa gspgynppqm ntlpvmtgpp vfnprvpyvg alqggltvrr tiiikgyvlp tarnfvinfk vgssgdialh lnprigdsvv rnsfmngswg aeerkvaynp fgpgqffdls ircgmdrfkv fangqhlfdf shrfqafqmv dtleingdit lsyvqi

[0038] Mouse gal-4 nucleotide sequence (SEQ ID NO: 2)

[0039] atggcctatg ttccagcacc gggctaccag cccacctaca atccgactct gccctacaag agacccatcc caggtggcct cagtgtcggg atgtccgttt acatccaagg aatggccaaa gagaacatga gacggttcca cgtgaacttc gctgtggggc aggatgatgg ggcttgtt gctccctcctcgc tgggacaagg tggtcttcaa cacgatgcaa agtggacaat ggggcaagga agagaagaag aagagcatgc ctttccagaa gggcaagcac ttcgagctgg tgttcatggt catgcctgag cactacaagg tcgtggtgaa cggaaattcc ttctatgaat acggggcacct gccttagcatgc agtggatggg gacctggaac ttcagtccat caacttcctc ggaggccaac cagctgcagc cccatatccg ggagccatga ctattccagc ttaccctgct gggagtcctg ggtacaaccc tccacagatg aacaccttgc ctgtcatgac aggacccca gtcttcagcgtcgtcgtc ggggccttac agtccgaaga accatcataa tcaagggata tgtacttcct acagccagga actttgtcat caacttcaag gtgggatcgt ccggagacat agctttacac ctaaaccccc gcataggtga cagtgtggtt cgcaacagct ttatgaatgg ctcttggggc gctgaagaga gggtacggccgc ggcagttctt tgatctgtca atccgctgcg gcatggatcg attcaaggtg tttgccaatg gccagcacct ttcgacttc tcccatcggttccaagcatt ccaaatggta gacacgctgg agatcaatgg tgacatcacc ttgtcctacg tccagatctg a

[0040] Human Gal-4 amino acid sequence (SEQ ID NO: 3)

[0041] mayvpapgyq ptynptlpyy qpipgglnvg msvyiqgvas ehmkrffvnf vvgqdpgsdv afhfnprfdg wdkvvfntlq ggkwgseerk rsmpfkkgaa felvfivlae hykvvvngnp fyeyghrlpl qmvthlqvdg dlqlqsinfi ggqplrpqgp pmmppypgpg hchqqlnslp tmegpptfnp pvpyfgrlqg gltarrtiii kgyvpptgks fainfkvgss gdialhinpr mgngtvvrns llngswgsee kkithnpfgp gqffdlsirc gldrfkvyan gqhlfdfahr lsafqrvdtl eiqgdvtlsy vqil

[0042] Human Gal-4 nucleotide sequence (SEQ ID NO: 4)

[0043] atggcctatg tcccagcacc gggctaccag cccacctaca acccgacgct gccttactac cagcccatcc cgggcgggct caacgtggga atgtctgttt acatccaagg agtggccagc gagcacatga agcggttctt cgtgaacttt gtggttgggc aggatccggg ctcattcgcctccgc gtttgacggc tgggacaagg tggtcttcaa cacgttgcag ggcgggaagt ggggcagcga ggagaggaag aggagcatgc ccttcaaaaa gggtgccgcc tttgagctgg tcttcatagt cctggctgag cactacaagg tggtggctaa acggacctcgtcgtc gcttccccta cagatggtca cccacctgca agtggatggg gatctgcaac ttcaatcaat caacttcatc ggaggccagc ccctccggcc ccagggaccc ccgatgatgc caccttaccc tggtcccgga cattgccatc aacagctgaa cagcctgcccag accatggaccccct cgccccgc atttcgggag gctgcaagga gggctcacag ctcgaagaac catcatcatc aagggctatg tgcctcccac aggcaagagc tttgctatca acttcaaggt gggctcctca ggggacatag ctctgcacat taatccccgc atgggcaacg gtaccgtggt cttcggacgcgc aagaagatca cccacaaccc atttggtccc ggacagttct ttgatctgtc cattcgctgt ggcttggatc gcttcaaggt ttacgccaat ggccagcacc tctttgactt tgcccatcgc ctctcggccttccagagggt ggacacattg gaaatccagg gtgatgtcac cttgtcctat gtccagatct tg

[0044] Galectin-4 may have at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the amino acid sequence represented by SEQ ID NO: 1 or 3, and preferably may be 100% identical.

[0045] Galectin-4 may have a nucleotide sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the nucleotide sequence represented by SEQ ID NO: 2 or 4, and preferably may be 100% identical.

[0046] In this specification, the term "vaccine adjuvant" means a pharmaceutical or immunological agent administered for the purpose of enhancing the immune response to a vaccine.

[0047] The vaccine adjuvant composition according to the present invention, when administered together with an antigen, can enhance antibody titer and simultaneously enhance cellular immunity and humoral immunity.

[0048] Galectin-4 is particularly useful as an immunoadjuvant because it can specifically stimulate antigen-presenting cells, such as macrophages and dendritic cells, thereby enhancing vaccine activity. The immunoadjuvant composition for a vaccine according to the present invention can increase the production of IgG1 and / or IgG2a.

[0049] Galectin-4 is a gene that increases the expression of H-2K, a gene that increases the expression of Major Histocompatibility Complex (MHC)-Ⅰ. bBy increasing the expression of β2m, Lmp2, or Tap1, MHC-I expression on the surface of dendritic cells can be increased, thereby enhancing the antigen presentation ability of dendritic cells.

[0050] The vaccine immunoadjuvant composition according to the present invention can increase the interferon-gamma production amount of CD8 T cells.

[0051] The vaccine adjuvant composition of the present invention may additionally contain, in addition to the galectin-4, a pharmaceutically acceptable carrier, adjuvant, excipient, diluent, or mixture thereof.

[0052] The term "pharmaceutically acceptable" of the present invention refers to a composition that is physiologically acceptable and does not typically cause allergic reactions such as gastrointestinal upset or dizziness or similar reactions when administered to humans. Examples of such carriers, excipients, and diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition, fillers, anticoagulants, lubricants, wetting agents, fragrances, emulsifiers, and preservatives may be additionally included.

[0053] The immunoadjuvant composition of the present invention may further include, in addition to the above immunoadjuvant, a commonly used vaccine immunoadjuvant, and such vaccine immunoadjuvant may include aluminum hydroxide, aluminum phosphate, alum (potassium aluminum sulfate), MF59, virosome, AS04 [a mixture of aluminum hydroxide and monophosphoryl lipid A (MPL)], AS03 (a mixture of DLα-tocopherol, squalene, and polysorbate 80, an emulsifier), CpG, Flagellin, Poly I:C, AS01, AS02, ISCOMs, ISCOMMATRIX, etc.

[0054] Additionally, the above-described vaccine adjuvant composition may be formulated using methods known in the art to enable rapid, sustained, or delayed release of the active ingredient upon administration to a mammal. Formulations include powders, granules, tablets, emulsions, syrups, aerosols, soft or hard gelatin capsules, sterile injectable solutions, and sterile powder forms.

[0055] The vaccine adjuvant composition of the present invention can be administered via various routes, including oral, parenteral, e.g., suppository, transdermal, intravenous, intraperitoneal, intramuscular, intralesional, nasal, and intrathecal administration. It can also be administered using an implantable device for sustained release, continuous, or repeated release. The frequency of administration can be once a day or divided into several doses within a desired range, and the duration of administration is not particularly limited.

[0056] The vaccine adjuvant composition of the present invention can be administered by general systemic administration or local administration, for example, intramuscular injection or intravenous injection.

[0057] The vaccine adjuvant composition of the present invention may be administered via any conventional route as long as it can reach the target tissue. Such routes of administration include, but are not limited to, parenteral administration, such as intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, and intrasynovial administration.

[0058] The vaccine adjuvant composition of the present invention can be formulated into a suitable form with a commonly used pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers include, for example, parenteral carriers such as water, suitable oils, saline solutions, aqueous glucose, and glycols, and may further include stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite, or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben, and chlorobutanol.

[0059] The vaccine adjuvant composition of the present invention may appropriately include suspending agents, solubilizers, stabilizers, isotonic agents, preservatives, anti-adsorption agents, surfactants, diluents, excipients, pH adjusters, analgesics, buffers, antioxidants, and the like, if necessary, depending on the administration method or formulation. Pharmaceutically acceptable carriers and formulations suitable for the present invention, including those exemplified above, are described in detail in the literature [Remington's Pharmaceutical Sciences, latest edition].

[0060] When administering the vaccine adjuvant composition of the present invention to a subject, the dosage may vary depending on many factors, including the subject's height, body surface area, age, specific compound administered, sex, time and route of administration, general health, and other drugs administered simultaneously. As an example, the dosage may be administered in an amount of 100 ng / kg of body weight to 10 mg / kg of body weight, as another example, 1 to 500 μg / kg of body weight, and as yet another example, 5 to 50 μg / kg of body weight.

[0061] The vaccine composition and the immunoadjuvant composition for the vaccine of the present invention are administered in a pharmaceutically effective amount.

[0062] The term "pharmaceutically effective amount" of the present invention means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment and / or an amount sufficient to exhibit a vaccine effect and an amount that does not cause side effects or serious or excessive immune responses, and the effective dosage level can be determined according to factors including the type and severity of the individual, age, sex, activity of the drug, sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field. As an example, it can be administered at a dosage of 0.1 mg / kg to 1 g / kg, and as another example, it can be administered at a dosage of 1 mg / kg to 500 mg / kg, and the dosage can be appropriately adjusted according to the age, sex, and condition of the patient. Various general considerations in determining a "therapeutically effective amount (or dose)" are known to those skilled in the art and are described, for example, in Gilman et al., eds., Goodman And Gilman's: The Pharmacological Bases of Therapeutics, 8th ed., Pergamon Press, 1990, and Remington's Pharmaceutical Sciences, 17th ed., Mack PublishingCo., Easton, Pa., 1990.

[0063] According to another embodiment of the present invention, the present invention provides a vaccine composition comprising an antigen as an active ingredient and galectin-4 as an immunoadjuvant component.

[0064] According to another embodiment of the present invention, the present invention provides the use of an immunoadjuvant composition comprising galectin-4 as an active ingredient for enhancing an immune response of an individual to whom the vaccine composition is administered.

[0065] As used herein, “enhancing an immune response” means inducing or stimulating an immune response in a subject and / or promoting, strengthening, or augmenting an immune response to achieve a desired physiological, immunological, or pharmacological effect, such as alleviating, alleviating, delaying, treating, or curing a disease or its associated symptoms, as well as reducing tumor size and / or inhibiting tumor metastasis. Furthermore, enhancing an immune response should be understood to include completely or partially preventing the development and / or metastasis of cancer, including viral proliferation.

[0066] As used herein, the term "subject" includes, but is not limited to, mammals, including humans. The term "subject" includes individuals (patients) diagnosed with a disease caused by a viral antigen or cancer antigen used herein. It also includes individuals who have not yet been diagnosed with a disease, such as individuals with a family history and suspected genetic predisposition to the disease, even though the disease or related symptoms have not yet been demonstrated. Therefore, in the broadest sense, the term "subject" encompasses individuals who are currently in need of treatment, as well as individuals at risk for developing a disease associated with a viral antigen or cancer antigen.

[0067] As used herein, the term "antigen" refers to a substance that induces an immune response in a recipient. Therefore, the present invention may use any substance that exhibits such immune response-inducing activity without limitation.

[0068] An antigen can be a peptide, protein, nucleic acid, sugar, pathogen, attenuated pathogen, inactivated pathogen, virus, virus-like particle (VLP), cell, or cell fragment.

[0069] The antigen is not particularly limited to, but may be a viral antigen, a cancer antigen, or a combination thereof, as long as it can induce an immune response in vivo.

[0070] Viral antigens include Epstein-Barr virus (EBV), hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis D virus (HDV), hepatitis E virus (HEV), Hantaan virus, cytomegalovirus (CMV), human immunodeficiency virus (HIV), influenza virus including HIV (HIV), human papilloma virus (HPV), poliovirus, Ebola virus, rotavirus, dengue virus, West Nile virus, yellow fever virus, adenovirus, Japanese encephalitis virus, BK virus, smallpox virus, Zika virus, severe fever with thrombocytopenia syndrome virus (SFTS virus), Examples include viral antigens derived from various viruses, such as herpes simplex virus (HSV) and lymphocytic choriomeningitis virus (LCMV).

[0071] Examples of cancer antigens include human papillomavirus (HPV)-derived antigens, carcinoembryonic antigen, prostate-specific antigen (PSA), prostate-specific membrane antigen (PSMA), Her2 / neu, MUC-1, BCR / ABL, alpha-fetoprotein (AFP), Epstein-Barr virus (EBV)-derived antigens, human hepatitis virus B (HBV)-derived antigens, human hepatitis virus C (HCV)-derived antigens, carcinoma-125 (CA-125), carcinoma-72-4 (CA-72-4), carcinoma-15-3 (CA-15-3), and carcinoma-19-9 (CA-19-9).

[0072] The vaccine composition of the present invention can induce a sufficient immune response with its basic composition, i.e., the antigen and galectin-4 alone, thereby demonstrating preventive efficacy against a specific disease. Optionally, the vaccine composition of the present invention may further include the additional immunoadjuvant component mentioned above.

[0073] The vaccine composition may be a salmonella vaccine, a cancer vaccine, a flu vaccine, a tuberculosis vaccine, anthrax vaccine, HAV vaccine, HBV vaccine, HCV vaccine, HIV vaccine, herpes simplex vaccine, meningitis vaccine, diphtheria vaccine, pertussis vaccine, tetanus vaccine, or varicella vaccine.

[0074] The vaccine composition of the present invention can be administered as a vaccine to induce immunity against a disease caused by infection with a pathogenic bacterium, and the vaccine composition can be appropriately formulated with a pharmaceutically acceptable carrier.

[0075] Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, coloring agents, and flavoring agents for oral administration, and injectables may include aqueous solvents such as saline solution and Ringer's solution, non-aqueous solvents such as vegetable oils, higher fatty acid esters (e.g., ethyl oleate, etc.), and alcohols (e.g., ethanol, benzyl alcohol, propylene glycol, glycerin, etc.), and may be mixed and used with buffers, preservatives, analgesics, solubilizers, isotonic agents, and stabilizers. In the case of propellants, suitable propellants such as compressed air, nitrogen, carbon dioxide, or hydrocarbon-based low-boiling-point solvents may be used to conveniently deliver the composition in the form of an aerosol spray presentation from a pressurized pack or nebulizer.

[0076] The vaccine composition of the present invention can be prepared in various forms by mixing it with a pharmaceutically acceptable carrier as described above. For example, for oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and for injections, it can be prepared in the form of unit dose ampoules or multiple doses.

[0077] The route of administration of the vaccine composition is not limited as long as it can reach the target tissue, and can be administered through a commonly used route.

[0078] As used herein, the term "administration" means introducing a given substance into a human or animal by any appropriate method, and is formulated for human or veterinary use and administered via various routes. The vaccine composition of the present invention may be administered via a parenteral route, such as intravascular, intravenous, intraarterial, intramuscular, or subcutaneous, and may be administered via oral, nasal, rectal, transdermal, or aerosol inhalation routes, and may be administered as a bolus or slowly injected, but may be specifically administered via the sublingual, intramuscular, or intranasal route, and more specifically via the nasal route, but is not limited thereto.

[0079] The vaccine composition of the present invention comprising an antigen and galectin-4 as an adjuvant component can be administered in a pharmaceutically effective amount.

[0080] According to one embodiment of the present invention, the present invention provides a method for promoting an immune response, comprising administering to a subject a pharmaceutically effective amount of an immunoadjuvant composition for a vaccine comprising galectin-4 as an active ingredient.

[0081] In the method of the present invention, the vaccine adjuvant composition may be administered simultaneously or at different times with the antigen.

[0082] In the method for promoting an immune response according to the present invention, the immune response includes a humoral immune response, a cellular immune response, or both.

[0083] According to another embodiment of the present invention, the present invention,

[0084] As a method for preventing or treating a disease,

[0085] A method is provided comprising administering to a subject a pharmaceutically effective amount of an immunoadjuvant composition comprising galectin-4 concurrently or concurrently with a vaccine composition.

[0086] As used herein, the term “simultaneous or sequential” administration means that administration can be performed simultaneously or sequentially. That is, it can be understood that the vaccine composition and the immunoadjuvant composition can be administered simultaneously or as a mixture thereof, or the vaccine composition can be administered first and then the immunoadjuvant composition, and it will be understood that the antigen according to the present invention and the immunoadjuvant composition for a vaccine can be administered simultaneously or as a mixture thereof, or the antigen can be administered first and then the immunoadjuvant composition for a vaccine can be administered.

[0087] The immunoadjuvant composition according to the present invention may preferably be administered multiple times or in multiple doses. For example, the immunoadjuvant composition may be administered 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more times over a set period of time. The dosing interval may range from about 1 day to about 5 weeks. Periodic re-administration may be necessary to achieve desired therapeutic outcomes, such as a reduction in tumor size and / or a reduction in the incidence of metastasis. Furthermore, it will be apparent to those skilled in the art that the optimal route of administration can be determined using conventional treatment procedures or efficacy or immune status assessment tests. The route of administration and the dosage regimen may vary depending on the stage or severity of the disease being treated and can be determined by a skilled medical practitioner.

[0088] The above vaccine composition may be, but is not limited to, an antigen that induces an immune response or a vaccine composition containing the antigen, and the disease may be, but is not limited to, a viral disease, a cancerous disease, or both.

[0089] Another embodiment of the present invention provides a vaccine adjuvant composition for stimulating an immune response, comprising galectin-4.

[0090] As described above, when administered together with an antigen, galectin-4 can enhance antibody titer and enhance cellular immune response and / or humoral immune response, and therefore, a composition containing galectin-4 can be used as a vaccine adjuvant for promoting immune response.

[0091] Galectin-4 according to the present invention can enhance both cellular and humoral immune responses, thereby improving the efficiency of various vaccines, including killed vaccines and protein vaccines, and thus has the advantage of reducing the amount of antigen used, thereby lowering the production cost of the vaccine.

[0092] The immunoadjuvant of the present invention can enhance the cellular and humoral immune responses of various viral vaccines, thereby increasing the efficacy of the vaccine.

[0093] The immunoadjuvant of the present invention can enhance the immune response of various vaccines, including inactivated vaccines and protein vaccines, and consequently reduce the production cost of the vaccine through an antigen reduction effect.

[0094] The immunoadjuvant of the present invention can also enhance the cancer treatment effect when applied to a cancer treatment vaccine through the effect of enhancing cellular and humoral immune responses.

[0095] Figure 1 shows the results of measuring the concentration of immunoglobulins specific to the influenza vaccine in the serum of mice 7 days after vaccination with or without the indicated concentration of galectin-4 (mouse origin) in wild-type Balb / c mice using enzyme-linked immunosorbent assay: (a) IgG, (b) IgG1, (c) IgG2a.

[0096] Figure 2 shows the results of comparing the number of GP33-recognizing CD8 T cells (B), the number of GP33-recognizing activated CD8 T cells producing TNF-α and IFN-γ (C), the number of NP396-recognizing activated CD8 T cells producing TNF-α and IFN-γ (D), the number of GP66-recognizing CD4 T cells (E), the number of GP61-recognizing activated CD4 T cells producing TNF-α and IFN-γ (F), and the change in the degree of proliferation of P14 T cells (H) 8 days after infection with lymphocytic choriomeningitis virus in wild-type C57BL / 6 mice and galectin-4-deficient C57BL / 6 mice.

[0097] Figure 3 shows the results of measuring the concentrations of OVA-specific immunoglobulins (A) IgG, (B) IgG1 in the serum of mice 14 days after the first vaccination using enzyme-linked immunosorbent assay, and the concentrations of OVA-specific immunoglobulins (C) IgG, (D) IgG1, (E) IgG2c in the serum of mice 7 days after the second vaccination, after inoculating wild-type C57BL / 6 mice with or without protein (OVA, Ovalbumin), an immunoadjuvant (addavax), and the indicated concentrations of galectin-4 (mouse origin), and the results of measuring the concentrations of OVA-specific immunoglobulins (A) IgG, (B) IgG1, (C) IgG2c in the serum of mice 7 days after the second vaccination using enzyme-linked immunosorbent assay.

[0098] Figure 4 shows the results of inoculating wild-type C57BL / 6 mice with or without protein (OVA, Ovalbumin), an immune adjuvant (addavax) and the indicated concentrations of galectin-4 (mouse origin). Seven days after the second inoculation, spleen cells were isolated from the mice and analyzed for OVA peptide. 257-264 Stimulate at 37°C for 12 hours and analyze OVA peptide using flow cytometry. 257-264 Shows the results of measuring the proportion of CD8 T lymphocytes that produce IFN-γ specific to .

[0099] Figure 5 shows the average tumor volume and mouse survival rate measured after inoculation of wild-type C57BL / 6 mice with a melanoma cell line (B16 / OVA), and 7 days later, with or without protein (OVA, Ovalbumin), an immunoadjuvant (addavax), and the indicated concentrations of galectin-4 (mouse origin) (Figure 5a): (b) the average tumor volume of each experimental group; (c) the mouse survival rate.

[0100] Figures 6a and 6b show the results of comparing the tumor volume (Figure 6a) and survival rate (Figure 6b) when a non-small cell lung cancer (NSCLC) (purchased from American Type Culture Collection, ATCC) model cell line (TC1) was subcutaneously transplanted into wild-type C57BL / 6 mice and galectin-4 deficient C57BL / 6 mice.

[0101] Figure 6c shows the results of comparing the survival rates of wild-type C57BL / 6 mice and galectin-4 deficient C57BL / 6 mice with CD8 T cells removed by subcutaneously transplanting a non-small cell lung cancer (NSCLC) model cell line (TC1).

[0102] Figures 6d and 6e show the results comparing the survival rates of mice transplanted with a melanoma cell line (B16 / OVA) into wild-type C57BL / 6 mice, administered protein (OVA) and an immune adjuvant (addavax) and galectin-4 at the indicated concentrations, followed by three doses of anti-PD-1 antibody.

[0103] Figure 7 shows the results of comparing the expression levels of MHC-I in dendritic cells differentiated from the bone marrow of wild-type C57BL / 6 mice or galectin-4-deficient C57BL / 6 mice after inducing immune activity by treating dendritic cells with Toll-like receptor (TLR) and IFN-α (Figures 7a to 7e), and the ratio of differentiated P14 CD8 T cells when co-cultured with GP33-recognizing P14 CD8 T cells (Figures 7f and 7g).

[0104] Figure 7h shows the results comparing the degree of proliferation of P14 CD8 T cells when wild-type C57BL / 6 mouse bone marrow-derived dendritic cells were co-cultured with P14 CD8 T cells after treatment with or without galectin-4.

[0105] Figures 8a to 8d show the results of comparing the expression levels of MHC-related genes in dendritic cells differentiated from the bone marrow of wild-type C57BL / 6 mice or galectin-4 deficient C57BL / 6 mice by RT-qPCR: (a) H-2K b , (b) β2m, (c) Lmp2, (d) Tap1.

[0106] Figure 8e shows the results of comparing the MHC-I expression levels on the surface of dendritic cells when wild-type C57BL / 6 mouse bone marrow-derived dendritic cells were treated with or without galectin-4.

[0107] Hereinafter, the present invention will be described in more detail through examples. These examples are intended merely to illustrate the present invention, and therefore, the scope of the present invention is not to be construed as being limited by these examples.

[0108] Materials and Methods

[0109] This section provides a description of experimental materials and experimental methods commonly applied to each embodiment according to the present invention.

[0110] 1. Animal model

[0111] The animal models used in this experiment were 6-8 week-old wild-type C57BL / 6 or Balb / c wild-type mice purchased from Daehan Biolink Co., Ltd. or galectin-4 deficient C57BL / 6 mice produced by Gemcro Co., Ltd.

[0112] 2. Reagents and antibodies

[0113] The influenza vaccine used in this experiment was purchased from Green Cross. OVA, used as an antigen, was purchased from Sigma-Aldrich, and distilled water was used as a solvent. Addavax, used as an immunoadjuvant, was purchased from Invivogen. Peroxidase-conjugated secondary antibodies (anti-mouse IgG, anti-mouse IgG1, anti-mouse IgG2a, and anti-mouse IgG2c) for antibody measurement were purchased from Invitrogen or Southerbiotech. TMB substrate and sulfuric acid, used to catalyze and halt the peroxidase reaction, respectively, were purchased from Biolegend and Sigma-Aldrich. OVA peptide (257-264) for detecting CD8 T cell responses was purchased from GenScript. Mouse marker protein CD8, cytokine IFN-γ, and antibodies for measuring cell activity were purchased from Biolegend.

[0114] 3. Cell culture

[0115] B16 / OVA (Murnie B16 melanoma expressing ovalbumin) cells used in this experiment were cultured in a 5% CO2 incubator at 37°C. The cell line was cultured in DMEM (Dulbecco's modified essential medium, GenDepot) medium supplemented with 10% fetal bovine serum (Fetal Bovine Serum, GenDepot) and 1% penicillin / streptomycin (PS, Welgene). When culturing the B16 / OVA cell line, 0.8% G418 solution (Roche) was additionally added.

[0116] 4. Vaccination

[0117] Influenza vaccine (inactivated vaccine, Green Cross GC Flu) was diluted in saline and administered intramuscularly at a dose of 0.6 μg per subject. Protein (OVA, ovalbumin) was diluted in saline and administered intramuscularly at a dose of 10 μg per subject. Vaccine adjuvant (addavax, a preclinical investigational substance similar to MF59) was diluted 1:1 and administered together with the vaccine to the respective experimental groups. Galectin-4 (mouse derived; protein with amino acid sequence number 1) was diluted to the concentration specified in the vaccine injection mixture and administered together with the vaccine.

[0118] 5. Enzyme-Linked Immunosorbent Assay (ELISA)

[0119] SPL 96-well immunoplates (Flat, Maxibinding) were coated with influenza vaccine (GC Green Cross) or OVA (Sigma-Aldrich) at a concentration of 1 μg / mL each at 4°C overnight. The plates were washed the next day and blocked with 1% BSA solution for 2 hours at room temperature. After washing again, serum samples were added and incubated for 2 hours at room temperature. The washed plates were then treated with HRP-conjugated goat anti-mouse IgG, IgG1, IgG2a, and IgG2c (Invitrogen or SoutherBiotech) and incubated for 2 hours at room temperature. After washing, color development was performed using TMB substrate (Biolegend), and the reaction was stopped with 2 N sulfuric acid. The absorbance was measured using an ELISA reader to determine the antibody concentration in the serum.

[0120] 6. Flow cytometry

[0121] To detect T lymphocyte activity in vaccinated mice, fluorescently labeled antibodies were used. To measure cell activity, antibodies (Zombie NIR™ Fixable Viability Kit, Biolegend) were applied and stained at room temperature for 30 minutes. Antibodies specific for cell marker proteins, anti-mouse CD8 and anti-mouse CD3 (Biolegend), were diluted 1 / 200 and applied to the cells, followed by staining at 4°C for 20 minutes. For cytokine staining within T lymphocytes, cells were fixed and permeabilized with Cyto-Fast Fix / Perm Solution (Biolegend) for 20 minutes at room temperature. Then, cells were applied with anti-mouse IFN-γ (Biolegend) antibody diluted 1 / 100 and stained for 20 minutes at room temperature. Results were analyzed using a flow cytometer (Attune NxT Acoustic Focusing Cytometer, Thermo Scientific).

[0122] 7. Tumor growth and observation

[0123] 4*10 B16 / OVA cells, a melanoma cell line 5 Dogs were injected subcutaneously into wild-type C57BL / 6 mice. After 7 days, the tumor volume was 0 mm 3 Excess, 75mm 3 Only individuals with a tumor volume less than 2000 mm were selected and vaccinated. From that point on, the tumor volume was measured using an electronic caliper (SAHHE) every two days, and the tumor volume of the individual was 2000 mm 3 At the point where the time point exceeded , mice were euthanized using CO2.

[0124] [Example 1] Effect of galectin-4 as an immunoadjuvant for influenza vaccines

[0125] As confirmed from Figure 1, when galectin-4 was mixed with an influenza vaccine (inactivated vaccine, Green Cross GC Flu) and injected into mice, the production of antibodies against the influenza virus was found to significantly increase. Compared to when the influenza vaccine alone was injected, when the influenza vaccine and galectin-4 were mixed and injected into mice, the production of influenza virus-specific antibodies (total IgG, IgG1, IgG2) was found to increase by approximately 2-6 times (based on OD). These results demonstrate that when galectin-4 is mixed with an inactivated vaccine and administered, a higher humoral immune response can be induced than when the inactivated vaccine is administered alone.

[0126] [Example 2] Effect of Galectin-4 as an Immunoadjuvant for LCMV Vaccines

[0127] 1. Experimental method

[0128] Lymphocytic choriomeningitis virus (LCMV) Armstrong subspecies was challenged into wild-type and galectin-4-deficient mice at a dose of 2 × 10 5 Mice were injected intraperitoneally at a concentration of 10 PFU. Eight days after infection, the mice were euthanized with CO2 gas, and the spleens were isolated to measure the immune response (Fig. 2).

[0129] For transplantation of P14 CD8 T cells, CD8 T cells were isolated from the spleen of P14 transgenic mice and 2×10 were injected one day before infection. 5 It was injected intravenously at a PFU concentration.

[0130] Proliferation of CD8 T cells is regulated by LCMV glycoproteins. 33-41 (GP33) After antigen treatment, activated dendritic cells and GP33 peptide-specific T lymphocytes stained with CFSE (Invitrogen) were mixed and cultured for 2 days, and the proliferation of T lymphocytes was analyzed using a flow cytometer.

[0131] To verify whether the reduced virus-specific immune response in galectin-4-deficient mice was due to the intrinsic effects of galectin-4-deficient T cells, CD8 T cells were isolated from transgenic mice (P14) harboring T cells specifically recognizing glycoprotein 33-41 (GP33), transplanted into wild-type and galectin-4-deficient mice, and infected with LCMV. The proportion of virus-specific P14 T cells in the blood was then analyzed.

[0132] 2. Experimental Results

[0133] As shown in Figure 2, in mice lacking galectin-4, glycoprotein 33-41 The proportion and number of CD8 T cells recognizing (GP33) were significantly lower than those in wild-type mice.

[0134] viral antigen glycoprotein 33-41 The proportion of activated T cells that specifically respond to (GP33) and nucleoprotein 396-404 (NP396) and secrete the cytokines TNF-α and IFN-γ was significantly lower in galectin-4-deficient mice. Similarly, the number of virus-specific CD4 T cells and activated CD4 T cells were reduced in galectin-4-deficient mice compared to wild-type mice.

[0135] These results demonstrate that galectin-4 plays an important role in viral immune activity, as virus-specific T cell immune activity is reduced in galectin-4-deficient mice.

[0136] Compared with wild-type mice, proliferation of transplanted P14 T cells was significantly reduced in galectin-4-deficient mice on days 15, 22, and 29 post-infection, demonstrating that galectin-4 enhances T cell immune activity against viral infection.

[0137] [Example 3] Effect of Galectin-4 as a Protein Subunit Vaccine Adjuvant

[0138] Since Example 1 demonstrated that galectin-4 enhances the antibody production efficiency of an inactivated vaccine, we analyzed whether other types of vaccines exhibited similar effects. As shown in Figure 3, when galectin-4 was mixed with a protein (OVA, ovalbumin) and a vaccine adjuvant (addavax, a preclinical trial substance similar to MF59) and injected into mice, the humoral immune response (antibody) was confirmed to increase. These results demonstrate that galectin-4 can significantly induce an immune response to a protein subunit vaccine by enhancing the efficiency of existing adjuvants.

[0139] [Example 4] Effect of galectin-4 on cytotoxic T lymphocyte activity

[0140] We analyzed whether the vaccine-enhanced effect of galectin-4 also manifested in cellular immunity. As shown in Figure 4, when galectin-4 was mixed with protein (OVA, ovalbumin) and a vaccine adjuvant (addavax, a preclinical trial substance similar to MF59) and injected into mice, the proportion of IFN-γ-producing T lymphocytes among antigen-specific T lymphocytes increased. These results demonstrate that galectin-4 can significantly enhance the cellular immune response efficiency of existing adjuvants.

[0141] [Example 5] Effect of Galectin-4 as an Immunoadjuvant for Cancer Treatment Vaccines

[0142] Since Examples 3 and 4 confirmed that galectin-4 can increase the adjuvant efficacy of protein subunit vaccines, we further examined whether the same effect was observed in an actual disease model. Tumors were formed in wild-type C57BL / 6 mice by injecting a melanoma cell line (B16 / OVA) expressing a protein (OVA, ovalbumin). As shown in Fig. 5, when the tumor-forming mice were injected with a mixture of protein and vaccine adjuvant (addavax, a preclinical test substance similar to MF59) and additionally galectin-4, the tumor size was approximately twice as small as that of the tumors in uninjected mice. In addition, when the survival rate of the mice was analyzed, it was confirmed that the survival rate of the mice was significantly increased when the adjuvant (addavax, a preclinical test substance similar to MF59) and galectin-4 were mixed and injected into the mice.

[0143] Additionally, tumor volume growth was observed by subcutaneously transplanting a non-small-cell lung cancer (NSCLC) model cell line (TC1). As shown in Figure 6a, similar to the melanoma cell line, tumor volume increased more rapidly in galectin-4-deficient mice, resulting in a decreased survival rate.

[0144] To verify whether this phenomenon was driven by CD8 T cells, anti-CD8 antibodies were administered to wild-type and galectin-4-deficient mice to eliminate CD8 T cells. Tumors were then transplanted in the same manner, and survival rates of the mice were observed. No significant difference in survival rates was observed when CD8 T cells were removed (see Figure 6c). This demonstrates that galectin-4 can suppress tumor growth through the anti-tumor immune activity of CD8 T cells.

[0145] Based on this, to verify whether the anti-cancer immune activation effect of galectin-4 can increase the efficiency of anti-PD-1 antibody treatment, 200 μg of anti-PD-1 antibody (BioXcell) was intraperitoneally injected on days 7, 9, and 11 after tumor transplantation in the above melanoma model (Fig. 6d).

[0146] As a result, as shown in Fig. 6e, when anti-PD-1 antibody treatment was administered in combination with a combination of ovalbumin (OVA), an immune booster (Addavax), and galectin-4, the survival rate of mice was significantly increased compared to the anti-PD-1 antibody treatment group alone. This indicates that galectin-4 can activate anticancer immunity and increase the efficiency of immune checkpoint inhibitor treatment through its CD8 T cell activation effect, and that the immune boosting effect of galectin-4 can be implemented in an actual cancer treatment vaccine.

[0147] [Example 6] Effect of galectin-4 on dendritic cell activity

[0148] 1. Preparation of dendritic cells

[0149] Bone marrow cells were isolated from the leg bones of mice and differentiated into dendritic cells in RPMI-1640 with L-glutamine (GenDEPOT) medium containing granulocyte-macrophage colony-stimulating factor (GM-CSF, PEPROTECH) at a concentration of 20 ng / mL. The cells were cultured for a total of 6 to 8 days, and 10 mL of the above medium was added on day 3 or day 6, respectively. The differentiated dendritic cells were washed with PBS and activated by treating them with 5 μg / mL of Poly I:C, 100 ng / mL of LPS, and 1 μg / mL of R848 for 24 h to stimulate TLR3, TLR4, or TLR7, respectively.

[0150] 2. Flow cytometry

[0151] To determine the antigen expression rate of dendritic cells and the proliferation and activity of T lymphocytes, fluorescently labeled antibodies were used. Antibodies specific to the cell marker protein were treated and stained for 20 minutes at 4°C. To determine the activity of T lymphocytes in virus-infected mice, fluorescently labeled antibodies were used. To measure the activity of cells, antibodies (Zomgbie NIR) were used. TM The cells were treated with Cyto-Fast Fix / Perm Solution (Biolegend) for 20 minutes at room temperature, and stained for 30 minutes at room temperature. Antibodies specific for cell marker proteins, anti-mouse CD8 and anti-mouse CD3 (Biolegend), were diluted 1 / 200 and treated with the cells, and stained for 20 minutes at 4°C. To fix and permeabilize the cells for cytokine staining in T lymphocytes, the cells were treated with Cyto-Fast Fix / Perm Solution (Biolegend) for 20 minutes at room temperature, and then treated with anti-mouse IFN-γ (Biolegend) antibody diluted 1 / 100 and stained for 20 minutes at room temperature. The results were analyzed using a flow cytometer (Attune NxT Acoustic Focusing Cytometer, Thermo Scientific).

[0152] 3. Changes in antigen presentation ability according to changes in MHC-I expression

[0153] In Example 5, it was confirmed that galectin-4 can regulate the immune activity of CD8 T cells. Since the activity of CD8 T cells is significantly regulated by antigen-presenting cells, the effect of galectin-4 on the antigen-presenting ability of dendritic cells, a representative antigen-presenting cell, was investigated.

[0154] Dendritic cells were differentiated from the bone marrow of wild-type and galectin-4-deficient mice, and immune activation was induced by treating the differentiated dendritic cells with toll-like receptor (TLR) agonists and interferon-α. As a result, it was confirmed that in galectin-4-deficient dendritic cells, the expression of major histocompatibility complex-I (MHC-I) was significantly reduced compared to normal dendritic cells when treated with TLR3 (Poly I:C), TLR4 (LPS), TLR7 (R848) agonists, and IFN-α, including in the absence of stimulation (Figures 7a to 7e).

[0155] To verify whether this phenomenon actually affects the antigen-presenting ability of dendritic cells, glycoproteins were injected into dendritic cells that stimulated differentiation and immune activity. 33-41 (GP33) and co-cultured with P14 CD8 T cells that specifically recognize it.

[0156] As a result, as shown in Fig. 7, the proportion of differentiated P14 CD8 T cells was significantly reduced when co-cultured with galectin-4-deficient dendritic cells (Fig. 7f) compared to when co-cultured with normal dendritic cells (Fig. 7g). In addition, when galectin-4-treated dendritic cells were co-cultured with P14 CD8 T cells, the proliferation of CD8 T cells was significantly increased compared to when co-cultured with dendritic cells not treated with galectin-4 (see Fig. 7h). This demonstrates that galectin-4 can regulate the antigen-presenting activity of dendritic cells.

[0157] 4. Analysis of the effect of galectin-4 on MHC expression in dendritic cells

[0158] To investigate the factors responsible for the decreased MHC-I expression in galectin-4-deficient dendritic cells compared to normal dendritic cells, the genomes of normal and galectin-4-deficient dendritic cells were analyzed by RNA-sequencing. The genome analysis results showed that the expression levels of 2,315 genes were significantly increased and the expression levels of 2,249 genes were significantly decreased in galectin-4-deficient dendritic cells. These gene expression patterns were analyzed using KEGG pathway gene set enrichment analysis (GSEA), and it was found that pathways related to the immune response were negatively regulated in galectin-4-deficient dendritic cells compared to normal dendritic cells. The association of negatively regulated immune responses in galectin-4 deficient dendritic cells was observed through the formation of a gene network, and four pathways, including 'allograft rejection', 'graft-versus host disease', 'autoimmune thyroid disease (AITD)', and 'antigen processing and presentation', were confirmed to be closely related to each other.

[0159] To identify genes that significantly contribute to the correlation between the four pathways mentioned above, we examined the gene changes in galectin-4-deficient dendritic cells compared to normal dendritic cells, and observed a decrease in the expression of MHC-related genes in all four pathways. To verify this in vitro through genome analysis, we measured the expression of MHC-related genes using RT-qPCR, and the results showed that H-2K b, β2m, Lmp2, and Tap1 genes were all found to have a decrease in expression levels (see Figures 8a to 8d). In addition, when the bone marrow-derived dendritic cells were treated with galectin-4, the surface MHC-I expression level of the dendritic cells was confirmed to significantly increase (see Figure 8e). This demonstrates that galectin-4 can positively regulate the expression of MHC-related genes in dendritic cells.

[0160] In summary, the present inventors demonstrated that when galectin-4 was administered in combination with a previously known vaccine and vaccine adjuvant, the production of IgG1 and IgG2 antibodies, the cytokine secretion capacity of CD8 T cells, and the antigen presentation capacity of dendritic cells were enhanced. It was confirmed that this synergistic effect was not due to direct immune response induction by galectin-4 itself, but rather to its function as an immunoadjuvant for the vaccine. Therefore, the vaccine immunoadjuvant composition comprising galectin-4 as an active ingredient according to the present invention can enhance the efficiency of various vaccines such as killed vaccines and protein vaccines, and is therefore useful as an immunoadjuvant. In addition, it is expected to have the effect of reducing the amount of antigen used, thereby lowering the production cost of vaccines, and can also be applied to cancer treatment vaccines.

[0161] While specific aspects of the present invention have been described in detail above, it should be apparent to those skilled in the art that these specific descriptions are merely exemplary implementations and are not intended to limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. An adjuvant composition for a vaccine containing galectin-4 as an active ingredient.

2. In paragraph 1, An immunoadjuvant composition for a vaccine, wherein the galectin-4 has an amino acid sequence having at least 70% identity with the amino acid sequence of sequence number 1 or sequence number 3.

3. In paragraph 1, The above galectin-4 is an immunoadjuvant composition for a vaccine that simultaneously increases cellular immunity and humoral immunity.

4. In paragraph 1, An immunoadjuvant composition for a vaccine that increases the production of IgG1 and IgG2a.

5. In paragraph 1, A composition of an immunoadjuvant for a vaccine that increases the interferon-gamma production of CD8 T cells.

6. In paragraph 1, H-2K, a gene that increases MHC (Major Histocompatibility Complex)-Ⅰ expression b An immunoadjuvant composition for a vaccine, which increases the expression level of at least one gene selected from the group consisting of , β2m, Lmp2, and Tap1.

7. A vaccine composition comprising an antigen and galectin-4.

8. In paragraph 7, A vaccine composition, wherein the antigen is an antigen selected from the group consisting of viral antigens, cancer antigens, and combinations thereof.

9. In paragraph 8, The above viral antigens include Epstein-Barr virus (EBV), hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis D virus (HDV), hepatitis E virus (HEV), Hantaan virus, cytomegalovirus (CMV), human immunodeficiency virus (HIV), influenza virus, human papilloma virus (HPV), poliovirus, Ebola virus, rotavirus, dengue virus, West Nile virus, yellow fever virus, adenovirus, Japanese encephalitis virus, BK virus, smallpox virus, Zika virus, severe fever with thrombocytopenia syndrome virus (SFTS virus), herpes simplex virus (HSV), and derived from a virus selected from the group consisting of lymphocytic choriomeningitis virus (LCMV), A vaccine composition, wherein the cancer antigen is an antigen selected from the group consisting of an antigen derived from human papillomavirus (HPV), a carcinoembryonic antigen, a prostate-specific antigen (PSA), a prostate-specific membrane antigen (PSMA), Her2 / neu, MUC-1, BCR / ABL, alpha-fetoprotein (AFP), an antigen derived from Epstein-Barr virus (EBV), an antigen derived from human hepatitis virus B (HBV), an antigen derived from human hepatitis virus C (HCV), cancer antigen 125 (CA-125), cancer antigen-72-4 (CA-72-4), cancer antigen-15-3 (CA-15-3), cancer antigen-19-9 (CA-19-9), and a combination thereof.

10. In paragraph 8, A vaccine composition wherein the viral antigen is derived from an influenza virus or a lymphocytic choriomeningitis virus (LCMV).

11. A vaccine adjuvant composition for stimulating an immune response, comprising galectin-4.

12. In paragraph 11, A vaccine adjuvant composition for promoting an immune response, wherein the immune response is a humoral immune response, a cellular immune response, or both.

13. A method for promoting an immune response, comprising administering to a subject a pharmaceutically effective amount of an immunoadjuvant composition for a vaccine containing galectin-4 as an active ingredient.

14. In paragraph 13, A method for promoting an immune response, wherein the immune response is a humoral immune response, a cellular immune response, or both.

15. Use of an immunoadjuvant composition containing galectin-4 as an active ingredient to enhance the immune response of an individual to whom the vaccine composition is administered.

16. In paragraph 15, The above vaccine composition comprises an antigen, The use, wherein the antigen is selected from the group consisting of viral antigens, cancer antigens, and combinations thereof.

17. In paragraph 16, The above viral antigens include Epstein-Barr virus (EBV), hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis D virus (HDV), hepatitis E virus (HEV), Hantaan virus, cytomegalovirus (CMV), human immunodeficiency virus (HIV), influenza virus, human papilloma virus (HPV), poliovirus, Ebola virus, rotavirus, dengue virus, West Nile virus, yellow fever virus, adenovirus, Japanese encephalitis virus, BK virus, smallpox virus, Zika virus, severe fever with thrombocytopenia syndrome virus (SFTS virus), herpes simplex virus (HSV), and derived from a virus selected from the group consisting of lymphocytic choriomeningitis virus (LCMV), The use of the cancer antigen is an antigen selected from the group consisting of an antigen derived from human papillomavirus (HPV), a carcinoembryonic antigen, a prostate-specific antigen (PSA), a prostate-specific membrane antigen (PSMA), Her2 / neu, MUC-1, BCR / ABL, alpha-fetoprotein (AFP), an antigen derived from Epstein-Barr virus (EBV), an antigen derived from human hepatitis virus B (HBV), an antigen derived from human hepatitis virus C (HCV), cancer antigen 125 (CA-125), cancer antigen-72-4 (CA-72-4), cancer antigen-15-3 (CA-15-3), cancer antigen-19-9 (CA-19-9), and a combination thereof.

18. As a method for preventing or treating a disease, In an individual requiring prevention or treatment of a disease, A method comprising administering to a subject a pharmaceutically effective amount of an immunoadjuvant composition comprising galectin-4 concurrently or concurrently with a vaccine composition.

19. In paragraph 18, A method, characterized in that the disease is a viral disease, a cancerous disease, or both.

Images