Improved tyrosine hydroxylase promoters and nucleic acid compositions and uses thereof

Abstract

The present disclosure provides, in part, engineered tyrosine hydroxylase (TH) promoters, vectors (e.g., viral vectors) comprising the engineered TH promoters, and uses thereof for improving neuronal-type specific epigenome editing of neurodegenerative disease relevant genes (e.g., SNCA).

Description

IMPROVED TYROSINE HYDROXYLASE PROMOTERS AND NUCLEIC ACID COMPOSITIONS AND USES THEREOFFEDERAL SUPPORT STATEMENT

[0001] This invention was made with Government support under Federal Grant No. R01 NS113548-01 Al awarded by the National Institutes of Health / National Institute of Neurological Disorders and Stroke (NIH / NINDS). The Federal Government has certain rights to this invention.CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 545,007 filed October 20, 2023, which is incorporated by reference herein in its entirety.REFERENCE TO THE SEQUENCE LISTING

[0003] The Sequence Listing submitted October 21, 2024, as an XML file named “23_2099_WO_Sequence_Listing”, created on October 21, 2024, and having a filesize of 407,096 bytes, is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5).FIELD OF THE INVENTION

[0004] The present invention relates to engineering of tyrosine hydroxylase (TH) promoters, and the use of these promoters for neuronal-type specific epigenome editing using viral vectors (e.g., AAV vectors) to effect neurodegenerative disease (NDD) -relevant genes for the treatment of neurodeg enerative diseases or disorders.BACKGROUND

[0005] Compositions for cell specific A U -targeted gene therapy have been demonstrated for full length tyrosine hydroxylase (TH) promoters using viral vectors (see WO / 2024 / 196752). However, with payloads of larger sizes (e.g., certain fusion proteins) there remains an unmet problem when delivering to dopaminergic neurons with AAV vectors using a full-length TH promoter, due to the nucleotide length of promoter and payload size limitations inherent to AAV vectors (e.g., ~4.7 kb). To address this problem, provided herein are engineered TH promoters having a reduced size, but which still maintain TH promoter functional targeting todopaminergic neurons, which enables the delivery of larger payloads using AAV vectors to dopaminergic neurons.SUMMARY OF THE INVENTION

[0006] The present disclosure provides, in part, therapeutic product for Parkinson’s Disease (PD) based on a novel epigenome-editing approach to precisely reduce the expression of the SNCA specifically in dopaminergic neurons that are the primary affected neuronal type in PD.

[0007] The present disclosure provides, in part, engineered tyrosine hydroxylase (TH) promoters for neuron specific (e.g., dopaminergic neuron) targeting of nucleic acid molecules, vectors, and viral vectors. The engineered TH promoters may be incorporated into therapeutic products for effecting neurodegenerative dis ease -related genes (e.g., SNCA gene) for treatment of neurodegenerative diseases and disorders and synucleinopathies (e.g., Parkinson’s Disease (PD))

[0008] In an aspect, provided herein is an engineered TH promoter, comprising the nucleic acid sequence of SEQ ID NO: 131; SEQ ID NO: 132; SEQ ID NO: 133; SEQ ID NO: 134;SEQ ID NO: 135; or SEQ ID NO: 136, or nucleic acid sequences having reverse complementarity thereto or fragments thereof, or a nucleic acid sequence comprising a combination of two or more of the nucleic acid sequences set forth in any one of SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, or SEQ ID NO: 135, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof., in any order. The engineered TH promoter may comprise a nucleic acid sequence comprising a combination of SEQ ID NO: 132 or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof, and SEQ ID NO: 133 or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof. The engineered TH promoter may comprise a fragment of SEQ ID NO: 132 or a nucleic acid sequence having reverse complementarity thereto comprises or consists of the nucleic acid sequence of SEQ ID NO:83 or SEQ ID NO:82, and the fragment of SEQ ID NO: 133 or a nucleic acid sequence having reverse complementary comprises or consists of the nucleic acid sequence of SEQ ID NO:79 or SEQ ID NO:78. The engineered TH promoter may comprise or consist of nucleic acid sequence of SEQ ID NO:87 or SEQ ID NO:88.

[0009] In an aspect, provided herein is an engineered TH promoter, comprising the nucleic acid sequence of SEQ ID NO:91; SEQ ID NO:92; SEQ ID NO:93; SEQ ID NO:94; orSEQ ID NO:95 or nucleic acid sequences having reverse complementarity thereto or fragments thereof, or a combination of two or more of the nucleic acid sequences set forth in any one of SEQ ID NOS:91-95 or nucleic acid sequences having reverse complementarity thereto each orfragments thereof, in any order, and optionally a nucleic acid sequence of a 5’UTR. The engineered TH promoter may comprise a nucleic acid sequence of SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO: 140, SEQ ID NO: 139, SEQ ID NO: 141 or nucleic acid sequences having reverse complementarity thereto or fragments thereof.

[0010] In an aspect, an engineered TH promoter may comprise a combination of the nucleic acids of any one of SEQ ID NO : 131 , SEQ ID NO : 132, SEQ ID NO : 133 , or SEQ ID NO : 135 (e.g., the PEAK sequences exemplified herein), and any one of SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, or SEQ ID NO:95 (the CR1-CR5 or CI-CV as exemplified herein), or nucleic acid sequences having reverse complementarity thereto each, or fragments thereof.

[0011] In an aspect, provided herein is a nucleic acid molecule comprising: (a) a nucleic acid sequence encoding a CRISPR-based endonuclease; (b) a nucleic acid sequence encoding one or more polypeptide having an enzymatic activity; (c) a nucleic acid sequence of one or more guide RNA targeting (i) a neurodegenerative disease (NDD)-relevant gene; (ii) a promoter region of the NDD-relevant gene; (iii) an intron of the NDD-relevant gene or flanking sequence thereof; (iv) an untranslated region (UTR) of the NDD-relevant gene; or (v) any combination thereof, and one or more neuron specific regulatory element operably linked to the CRISPR-based endonuclease and / or the one or more polypeptide having an enzymatic activity, wherein the one or more neuron specific regulatory element comprises the engineered TH promoter as described herein.

[0012] In an aspect, the CRISPR-based endonuclease and the one or more polypeptide having the enzymatic activity may be encoded as a fusion protein, optionally wherein the CRISPR- based endonuclease and the one or more polypeptide having the enzymatic activity are linked by at least one linker. The CRISPR-based endonuclease may be deactivated. The CRISPR-based endonuclease may a deactivated Cas9 (dCas9). The dCas9 may be a Staphylococcus aureus Cas9 (dSaCas9), deactivated Streptococcus pyogenes Cas9 (dSpCas9), deactivated Campylobacter jejuni Cas9 (dCjCas9), or variant dCas9 endonuclease. The dSaCas9 may comprise the amino acid sequence of SEQ ID NO:9 or SEQ ID NO: 11, or an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 9 or SEQ ID NO: 11 or a fragment thereof either. The dCjCas9 may comprise the amino acid sequence of SEQ ID NO: 7, or an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%,at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 7 or a fragment thereof.

[0013] In an aspect, the enzymatic activity of the one or more polypeptides may comprise transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, or any combination thereof. In some embodiments, the enzymatic activity of the one or more polypeptides may comprise transcription repression activity. In some embodiments, the one or more encoded polypeptide having enzymatic activity may be selected from heterochromatin protein la (HP la), heterochromatin protein lb (HP lb), methyl-CpG-binding domain protein 1 (MBD1), methyl-CpG-binding domain protein 2, Krupp el -Associated Box (KRAB), nuclear inhibitor of protein phosphatase-1 (NIPP1), methyl-CpG binding protein 2 (MeCP2), DNA (cytosine-5)-methyltransferase 3 A (DNMT3 A), any combination thereof, or any fusion thereof. In some embodiments, the one or more polypeptide having the enzymatic activity may comprise KRAB and MeCP2, optionally wherein the KRAB and MeCP2 are encoded as a KRAB-MeCP2 fusion protein (KRAB-MeCP2), further optionally wherein the KRAB and MeCP2 are linked by at least one linker. The nucleic acid molecule of claim 22, wherein the KRAB-MeCP2 comprises the amino acid sequence of SEQ ID NO: 17 or SEQ ID NO: 18, or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18 or a fragment thereof either.

[0014] Another aspect of the present disclosure provides a viral vector system for epigenome modification of an SNCA gene, the viral vector system comprising, consisting of, or consisting essentially of (i) CRISPR / deactivated(d)SaCas9; and (ii) selected gRNA targeted at SNCA- intron 1 regulatory region fused with a synthetic repressor molecule of KRAB / MeCp2(TRD) and driven by dopaminergic neuron specific promoter engineered from Tyrosine Hydroxylase (TH) transcriptional sequences.

[0015] In an aspect, the NDD-relevant gene of the nucleic acid molecule is selected from APOE, APP, ATXN2, CHMP2B, DCTN1, FIG4, FUS, GBA, GRN, HNRNPA1, HTT, LRRK2, MATR3, OPEN, PARK7, PFNl, PRPH, PSEN1, SETX, SIGMAR1, SNCA, SOD1, SPG11, SQSIM1, TARDBP, TBK1, TBP, TRPM7, TUBA4A, UBQLN2, UCHL1, VAPB, VCP, VPS35, a fragment thereof, a variant thereof, or a chimera thereof. In some embodiments, the NDD-relevant gene may be a synuclein alpha (SNCA) gene. The least one gRNA may target an intron of the SNCA gene or flanking sequence thereof, optionally targets intron 1 of the SNCA gene.

[0016] In an aspect, the nucleic acid molecule comprises at least one gRNA, wherein the at least one gRNA comprises the nucleic acid sequence set forth in any one of SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, or any of the sequences shown in TABLE 1, or a sequence at least 90% identical thereto, or a complement thereof.

[0017] In an aspect, a nucleic acid molecule as described herein may further comprise one or more additional regulatory elements. The one or more additional regulatory elements may be selected from one or more primer binding sites (PBS), one or more splice donor (SD) sites, one or more splice acceptor (SA) sites, one or more central polypurine tracts (cPPT), one or more polypurine tracts (PPT), one or more Rev Response elements (RRE), one or more Woodchuck Hepatitis Virus Posttranscriptional Regulatory Elements (WPRE), one or more retroviral vector packaging elements, or any combination thereof.

[0018] In an aspect, provided herein is a vector, comprising an engineered TH promoter as described herein, or a nucleic acid molecule comprising an engineered TH promoter as described herein. The vector may be a viral vector. The viral vector may be selected from an adeno-associated virus-derived viral vector (AAV vector), adenovirus-derived viral vector (AV vector), lentivirus-derived viral vector (LV vector), Moloney murine leukemia virus-derived viral vector (MMLV vector), murine stem cell virus-derived viral vector (MSCV vector), baculovirus-derived viral vector (BV vector), vesicular stomatitis virus-derived viral vector (VSV vector), herpes simplex virus-derived viral vector (HSV vector), vaccinia virus-derived viral vector (VV vector), or a retrovirus-derived viral vector (RV vector). In some embodiments, the viral vector may be an AAV vector or LV vector. The viral vector may comprise a nucleic acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 77; SEQ ID NO: 112; SEQ ID NO: 116; SEQ ID NO: 117; SEQ ID NO: 118; SEQ ID NO: 121; SEQ ID NO: 122; SEQ ID NO: 123; SEQ ID NO: 124;SEQ ID NO: 125, or a sequence set forth in TABLE 2, or a nucleic acid sequence having reverse complementarity to thereto, or functional fragments thereof.

[0019] In an aspect, provided herein is a host cell, comprising an engineered TH promoter as described herein, a nucleic acid molecule comprising an engineered TH promoter as described herein, a vector comprising an engineered TH promoter as described herein, a viral vector comprising an engineered TH promoter as described herein.

[0020] In an aspect, provided herein is a composition comprising a recombinant CRISPR-based endonuclease; one or more recombinant polypeptide having an enzymatic activity, wherein the CRISPR-based endonuclease and the one or more polypeptides are recombinantly expressed using an engineered TH promoter as described herein, and optionally one or more guide RNA targeting (i) a neurodegenerative disease (NDD) -relevant gene; (ii) a promoter region of the NDD-relevant gene; (iii) an intron of the NDD-relevant gene or flanking sequence thereof; (iv) an untranslated region (UTR) of the NDD-relevant gene; or (v) or any combination thereof.

[0021] In an aspect, provided herein is a pharmaceutical composition comprising (a) an engineered TH promoter as described herein; (b) a nucleic acid molecule comprising an engineered TH promoter as described herein; (c) a vector comprising an engineered TH promoter as described herein; (d) a viral vector comprising an engineered TH promoter as described herein; (e) a host cell comprising an engineered TH promoter as described herein; or (f) a composition comprising an engineered TH promoter as described herein, and a pharmaceutically acceptable carrier, diluent and / or excipient.

[0022] In an aspect, provided herein is a means for modulating a dopaminergic neuron, comprising (a) an engineered TH promoter as described herein; (b) a nucleic acid molecule comprising an engineered TH promoter as described herein; (c) a vector comprising an engineered TH promoter as described herein; (d) a viral vector comprising an engineered TH promoter as described herein; (e) a host cell comprising an engineered TH promoter as described herein; (f) a composition comprising an engineered TH promoter as described herein; or (g) a pharmaceutical composition comprising an engineered TH promoter as described herein.

[0023] In an aspect, provided herein is a kit, comprising (a) an engineered TH promoter as described herein; (b) a nucleic acid molecule comprising an engineered TH promoter as described herein; (c) a vector comprising an engineered TH promoter as described herein; (d) a viral vector comprising an engineered TH promoter as described herein; (e) a host cell comprising an engineered TH promoter as described herein; (f) a composition comprising an engineered TH promoter as described herein; or (g) a pharmaceutical composition comprising an engineered TH promoter as described herein, and instructions for use.

[0024] In an aspect, provided herein is a method of effecting genetic or epigenetic modulation in a dopaminergic neuron, the method comprising contacting the dopaminergic neuron with (a) an engineered TH promoter as described herein; (b) a nucleic acid molecule comprising an engineered TH promoter as described herein; (c) a vector comprising an engineered TH promoter as described herein; (d) a viral vector comprising an engineered TH promoter asdescribed herein; (e) a host cell comprising an engineered TH promoter as described herein; (f) a composition comprising an engineered TH promoter as described herein; (g) a pharmaceutical composition comprising an engineered TH promoter as described herein; or (h) a means for modulating a dopaminergic neuron comprising an engineered TH promoter as described herein.

[0025] In an aspect, provided herein is a method of in vivo modulation of expression of a neurodegenerative disease (NDD)-relevant gene in a dopaminergic neuron-specific manner in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of (a) an engineered TH promoter as described herein; (b) a nucleic acid molecule comprising an engineered TH promoter as described herein; (c) a vector comprising an engineered TH promoter as described herein; (d) a viral vector comprising an engineered TH promoter as described herein; (e) a host cell comprising an engineered TH promoter as described herein; (f) a composition comprising an engineered TH promoter as described herein; (g) a pharmaceutical composition comprising an engineered TH promoter as described herein; or (h) a means for modulating a dopaminergic neuron comprising an engineered TH promoter as described herein, wherein the therapeutically effective amount is an amount sufficient to modulate expression of the NDD-relevant gene in the subject. The NDD-relevant gene may be SNCA.

[0026] In an aspect, provided herein is a method of treating, preventing, or ameliorating one or more symptom of a neurodegenerative disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of (a) an engineered TH promoter as described herein; (b) a nucleic acid molecule comprising an engineered TH promoter as described herein; (c) a vector comprising an engineered TH promoter as described herein; (d) a viral vector comprising an engineered TH promoter as described herein; (e) a host cell comprising an engineered TH promoter as described herein; (f) a composition comprising an engineered TH promoter as described herein; (g) a pharmaceutical composition comprising an engineered TH promoter as described herein; or (h) a means for modulating a dopaminergic neuron comprising an engineered TH promoter as described herein, wherein the therapeutically effective amount is an amount sufficient to reduce one or more pathological phenotype associated with the neurodegenerative disease or disorder. The NDD- relevant gene may be SNCA.

[0027] In an aspect, provided herein is a method of treating, preventing, or ameliorating one or more symptom of a synucleinopathy in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of (a) an engineered TH promoter as described herein; (b) a nucleic acid molecule comprising an engineered TH promoter asdescribed herein; (c) a vector comprising an engineered TH promoter as described herein; (d) a viral vector comprising an engineered TH promoter as described herein; (e) a host cell comprising an engineered TH promoter as described herein; (f) a composition comprising an engineered TH promoter as described herein; (g) a pharmaceutical composition comprising an engineered TH promoter as described herein; or (h) a means for modulating a dopaminergic neuron comprising an engineered TH promoter as described herein, wherein the therapeutically effective amount is an amount sufficient to reduce one or more pathological phenotype associated with the synucleinopathy. The NDD-relevant gene may be SNCA. The synucleinopathy may be selected from Parkinson’s disease (PD) or dementia with Lewy bodies (DLB).

[0028] In an aspect, the methods provide for the modulation of SNCA levels in dopaminergic neurons.

[0029] Another aspect of the present disclosure provides a method of treating a disease or disorder associated with elevated SNCA expression levels in a subject the method comprising, consisting of, or consisting essentially of administering to the subject, or a cell in the subject, at least one composition, an nucleic acid molecule, a vector, a host cell, a pharmaceutical composition as provided herein, or combinations thereof such that the disease or disorder associated with elevated SNCA expression is treated.

[0030] Another aspect of the present disclosure provides method of in vivo modulating expression of a SNCA gene in a cell or a subject, the method comprising, consisting of, or consisting essentially of administering to the subject, or contacting the cell, at least one composition, an nucleic acid molecule, a vector, a host cell, a pharmaceutical composition as provided herein, or combinations thereof such that the expression of SNCA gene in the subj ect of the cell is modulated.

[0031] In an aspect, for any of the methods as described herein having administration to a subject, the administration to the subject may comprise intravenous administration, intracerebral administration, intra-CSF administration, intracerebroventricular (ICV) administration, intraventricular administration, intra-cistema magna (ICM) administration, intrapar enchym al administration, intrathecal (lumbar, cisternal, or both) administration, or any combination thereof. In an aspect, for any of the methods as described herein having administration to a subject, the method may further comprise administering to the subject a therapeutically effective amount of one or more additional therapeutic agent. The one or more additional therapeutic agent may be an immune modulator. The immune modulator may be selected frommethotrexate, rituximab, intravenous gamma globulin, Tacrolimus, SVP-Rapamycin, bortezomib, or a combination thereof.

[0032] Another aspect of the present disclosure provides all that is disclosed and illustrated herein.BRIEF DESCRIPTION OF THE DRAWINGS

[0033] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0034] The accompanying Figures and Examples are provided by way of illustration and not by way of limitation. The foregoing aspects and other features of the disclosure are explained in the following description, taken in connection with the accompanying example figures (also “FIG ”) relating to one or more embodiments, in which:

[0035] FIG. 1 provides a summary table of all peaks identified in neuronal sub-populations across the human Tyrosine hydroxylase (TH) locus using single nucleus (sn)ATAC-seq analysis. The genome coordinates of the identified PEAKS 1-6 and a differentially accessible peak (DAP) are listed. For each peak, the neuronal subtype in which it was identified (e.g., excitatory (EXC) and inhibitory (INH)) are listed.

[0036] FIG. 2A depicts a genome browser view of the human TH gene locus in chromosome 11 with the chromosomal position and coordinates (hg38). The TH gene structure is annotated for three transcript isoforms (e.g., transcription start site, exons, introns, etc). Also depicted in FIG. 2A are the positions of each of PEAK1, PEAK2, PEAK3, PEAK4, PEAK5, PEAK6 and DAP.

[0037] FIG. 2B depicts the genome browser view of FIG. 2A, with additional annotations including the positions of CI, CII, CIII, CIV, and CV promoter fragments overlayed with the full length TH promoter.

[0038] FIG. 3 depicts the reporter system used to evaluate the transcriptional repression effect on the SNCA gene. The system comprises an assembled CAG promoter fused to SNCA regulatory region across intron 1. The expressed transgene contains Human Alpha-Syn ORF, destabilized GFP (dGFP) and nano-Luciferase (nLuc) separated by p2A cleavage peptide. Two gRNAs targeting SNCA Intron 1 were designed (gRNAl and gRNA2) for each Cas9 variant. Those gRNAs targeted two different regions of the within SNCA intron 1. gRNA labelled in red represents guide sequence targeted by CjCas9, while that is labelled in green- by SaCas9.

[0039] FIG. 4 depicts the sequences of CjCas9 gRNAl, CjCas9 gRNA2, SaCas9 gRNAl, and SaCas9 gRNA2 . The two different PAM motifs recognized by each of CjCas9 and SaCas9 are depicted (see underline).

[0040] FIGS. 5A-5C depict screening assays of the efficiency of dCas9 paired with different effector repressors. Viral titers of the produced vectors were measured by real-time PCR. Physical viral titters were ~lxl013vg / ml. HEK293T cells-stably transduced with the reporter lentiviral vector carrying SNCA, GFP and Luc ORFs(FIG. 3) were used and denoted HEK293T-r eporter cell line. The HEK293T-reporter cell lines were transduced with the SNCA intron 1 -targeted repressor vectors denoted on X-axes of FIG 5 A-B. Western blotting was performed using alpha-Syn Ab and the ratio was determined for the presentation of the results. The dCas9's were derived from Campylobacter jejuni (dCjCas9) and Staphylococcus aureus (dSaCas9). FIG. 5A-B show that each dCas9 was fused to either HP la (without hinge), HP la (with hinge); HP lb (with hinge); HP lb (without hinge); NIPP1; KRAB; MeCP2, or a fusion of KRAB-MeCP2 (FIGS. 5A and 5B), for both gRNAl and gRNA2. FIG. 5C shows results for cells were harvested on day 14 and 21 post-transduction (d.p.t). The Western blotting results were analysed using Imaged software as a ratio of a-syn / GAPDH signal. Two-way ANOVA was used to analyze the results. The AAV / dSaCas9-KRAB-MeCP2-gRNAl resulted in the most robust and sustainable reduction of a-Syn expression. The results of the screening showed that (Sa)dCas9-KRAB / MeCP2(TDR)-gRNAl (gRNAl, ACCTCCCAGAGACCTGGCCCAG (SEQ ID NO:68) resulted in the most robust significant sustainable reduction of alpha-Syn expression. Thus, this construct comprising of gRNAl and dSaCas9 -KRAB / MeCP2(TDR) was selected as the lead and used for the AAV-vector

[0041] FIG. 6 shows results from characterizing AAV serotypes in CNS using GFP expression in Human induced pluripotent stem cell (hiPSC)-derived cerebral organoids. . GFP-reporter vector (313) delivered by various AAV serotypes 2, 5, 9 and PHPeB were tested, and GFP expression was evaluated at day 1, 4, 5, 9, and 12 post-transduction. The most efficient expression was achieved for the vector packaged into AAV-PHPeB capsid followed by AAV9. Transduced organoids were spun down for 45 minutes at 300 g, and the media was changed the next day. GFP fluorescence was monitored daily.

[0042] FIG. 7 depicts a schematic of a bilateral injection model as described herein. Vectors capsid are AAV9. Key: AAV / A53T-human SNCA (ID# 1838): AAV inducer of overexpression of human A53T-a-synuclein. AAV / dCas-no repressor (ID# 1290): AAV / dSaCas9 construct with no repressor and no-gRNA. AAV / dCas-TH repressor (ID# 2115): AAV / TH-dSaCas9-KRAB-MECP2(TRD) / gRNAl . AAV / A53T-human SNCA titer was IxlO14vg / ml. The control AAV / dCas-no repressor titer was 8xl012vg / ml.

[0043] FIGS. 8A-8E depict results from in-vivo testing of the engineered TH promoter based on PEAKS 2sl and 3 s 1 from the snATAC-seq analysis, driving the expression of the Cas9- repressor system using a bilateral injection delivery using PD mouse model. FIG. 8A shows representative images (2X magnification) of brain slices 2 weeks post-injection, showing expression of total human SNCA, SNCA pS129, aggregated SNCA (Agg), mouse tyrosine hydroxylase (TH) and DAPI staining in the substantia nigra. FIG. 8B shows quantification of total human SNCA, SNCA pS129, aggregated SNCA, indicating that the AAV-repressor construct driven by the engineered TH promoter significantly reduced expression of total human SNCA, and aggregated SNCA in the right SN. Expression of TH was not significantly different in right SN compared to the left SN (FIG. 8C). FIG. 8D shows representative images (2X magnification) showing expression of mouse TH and DAPI staining in the striatum. FIG. 8E shows that expression of TH was higher in the right striatum, suggesting a greater retention of dopaminergic neuron projections. N = 3 (females). Values represent mean ± SEM. * p < 0.05 ** p< 0.01 Paired t-test.

[0044] FIG. 9 depicts results from in-vitro testing of an engineered TH promoter-driven GFP constructs based on CI-V. pBK313-2 and pBK313-2 represent naive GFP vectors ; pBK1989 represents an engineered TH-promoter (CI-CII-CIII-CIV-CV-5'UTR); pBK1990 represents a full version of the TH promoter; and pBK2095 represents an engineered TH promoter based on snATAC-seq results.DETAILED DESCRIPTION OF THE INVENTION

[0045] Described herein is a system that comprises of an all-in-one viral vector system (e.g., an AAV, lentiviral vector, etc.) for the targeted epigenomic editing of the SNCA gene. The disclosed epigenome modifier compositions can be used to modify any regulatory target in a SNCA gene, such as the promoter region, intron 1 and exon 4. The system is based on CRISPR / deactivated-Cas9 nuclease (dCas9) fused with CRISPR / deactivated(d)SaCas9, selected gRNA targeted at SNCA-intron 1 regulatory region fused with a synthetic repressor molecule of KRAB / MeCp2(TRD) and driven by dopaminergic neuron specific promoter engineered from Tyrosine Hydroxylase (TH) transcriptional sequences. The present disclosure provides proof of concept that manipulation of gene expression, e.g. reversing overexpression, by epigenomeediting is a valuable therapeutic strategy for synucleinopathies that involve dysregulation of gene expression.

[0046] The CRISPR / Cas9 system provided herein provides a unique opportunity to modulate gene expression in a precise fashion that is cell-type specific. The use of epigenome-editing is an approach for gene therapy and represents new smart drugs since it is designed to target specific genes and specific cell types (e.g., dopaminergic neurons). Herein, the development and implementation of an innovative epigenome editing approach to manipulate the endogenous SNCA levels for rescuing disease related phenotypes is described.

[0047] Section headings as used in this section and the entire disclosure herein are merely for organizational purposes and are not intended to be limiting.1. Definitions

[0048] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document, including definitions, will control. Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present disclosure. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting.

[0049] The terms "comprise(s)," "include(s)," "having," "has," "can," "contain(s)," and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. The singular forms "a," "an" and "the" include plural references unless the context clearly dictates otherwise. The present disclosure also contemplates other embodiments "comprising," "consisting of and "consisting essentially of," the embodiments or elements presented herein, whether explicitly set forth or not

[0050] For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6. I, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.

[0051] As used herein, the term "about" or "approximately" means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can mean within 3 or more than 3 standard deviations, per the practice in the art. Alternatively, "about1can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1% of a given value. Alternatively,particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value.

[0052] " Adeno-associated virus" or "AAV as used interchangeably herein refers to a small virus belonging to the genus Dependovirus of the Parvoviridae family that infects humans and some other primate species. AAV is not currently known to cause disease and consequently the virus causes a very mild immune response.

[0053] As used herein, "chimeric" can refer to a nucleic acid molecule and / or a polypeptide in which at least two components are derived from different sources (e.g., different organisms, different coding regions). Also as used herein, chimeric refers to a construct comprising a polypeptide linked to a nucleic acid.

[0054] " Clustered Regularly interspaced Short Palindromic Repeats" and "CRISPRs", as used interchangeably herein, refers to loci containing multiple short direct repeats that are found in the genomes of approximately 40% of sequenced bacteria and 90% of sequenced archaea.

[0055] "Coding sequence" or "encoding nucleic acid" as used herein means the nucleic acids (RNA or DNA molecule) that comprise a nucleotide sequence which encodes a protein. The coding sequence can further include initiation and termination signals operably linked to regulatory elements including a promoter and polyadenylation signal capable of directing expression in the cells of an individual or mammal to which the nucleic acid is administered. The coding sequence may be codon optimize.

[0056] "Complement" or "complementary" as used herein means a nucleic acid can mean Watson-Crick (e.g., A-T / U and C-G) or Hoogsteen base pairing between nucleotides or nucleotide analogs of nucleic acid molecules.

[0057] "Complementarity" refers to a properly shared between two nucleic acid sequences, such that when they are aligned antiparallel to each other, the nucleotide bases at each position will be complementary.

[0058] "Complement" as used herein can mean 100% complementarity (fully complementary) with the comparator nucleotide sequence or it can mean less than 100% complementarity (e.g., substantial complementarity) (e.g., about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and the like, complementarity). Complement can also be used in terms of a "complement" to or "complementing" a mutation.

[0059] "Epigenome modification" as used herein refers to a modification or change in one or more chromosomes that affect gene activity and expression that does not derive from amodification of the genome. An epigenome modification relates to a functionally relevant change to the genome that does not involve a change in the nucleotide sequence. Epigenome modifications may include a modification to a hi stone, such as acetylation, methylation, phosphorylation, ubiquitination, and / or SUMOyation. Epigenome modifications may include a modification to DNA, such as methylation.

[0060] " Functional" and "full -functional" as used herein describes protein that has biological activity. A "functional gene" refers to a gene transcribed to mRNA, which is translated to a functional protein.

[0061] " Fusion protein" as used herein refers to a chimeric protein created through the joining of two or more genes that originally coded for separate proteins. The translation of the fusion gene results in a single polypeptide with functional properties derived from each of the original proteins.

[0062] As used herein, the term "gene" refers to a nucleic acid molecule capable of being used to produce mRNA, tRNA, rRNA, miRNA, anti-microRNA, regulatory RNA, and the like. Genes may or may not be capable of being used to produce a functional protein or gene product. Genes can include both coding and non-coding regions (e.g., introns, regulatory elements, promoters, enhancers, termination sequences and / or 5' and 3' untranslated regions). A gene can be "isolated" by which is meant a nucleic acid that is substantially or essentially free from components normally found in association with the nucleic acid in its natural state. Such components include other cellular material, culture medium from recombinant production, and / or various chemicals used in chemically synthesizing the nucleic acid.

[0063] " Genetic construct" as used herein refers to the DNA or RNA molecules that comprise a nucleotide sequence that encodes a protein. The coding sequence includes initiation and termination signals operably linked to regulatory elements including a promoter and polyadenylation signal capable of directing expression in the cells of the individual to whom the nucleic acid molecule is administered As used herein, the term "expressible form" refers to gene constructs that contain the necessary regulatory elements operable linked to a coding sequence that encodes a protein such that ,when present in the cell of the individual, the coding sequence will be expressed.

[0064] The term "genome" as used herein includes an organism's chromosomal / nuclear genome as well as any mitochondrial, and / or plasmid genome.

[0065] " Identical" or "identity" as used herein in the context of one or more nucleic acids or polypeptide sequences means that the sequences have a specified percentage of residues that arethe same over a specified region. The percentage may be calculated by optimally aligning the two sequences, comparing the two sequences over the specified region, determining the number of positions at which the identical residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the specified region, and multiplying the result by 1 00 to yield the percentage of sequence identity. In cases where the two sequences are of different lengths or the alignment produces one or more staggered ends and the specified region of comparison includes only a single sequence, the residues of single sequence are included in the denominator but not the numerator of the calculation. When comparing DNA and RNA, thymine (T) and uracil CU) may be considered equivalent. Identity may be performed manually or by using a computer sequence algorithm such as BLAST or BLAST 2.0.

[0066] As used herein, the terms "increase," "increasing," "increased," "enhance," "enhanced," "enhancing," and "enhancement" (and grammatical variations thereof) describe an elevation of at least about 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400%, 500% or more as compared to a control.

[0067] An "isolated" nucleic acid molecule or polynucleotide or an "isolated" polypeptide is a nucleotide sequence or polypeptide sequence that, by the hand of man, exists apart from its native environment and is therefore not a product of nature. In some embodiments, the polynucleotides and polypeptides of the disclosure are "isolated." A nucleic acid molecule or polypeptide can exist in a purified form that is at least partially separated from at least some of the other components of the naturally occurring organism or vims, for example, the eel 1 or viral structural components or other polypeptides or polynucleotides commonly found associated with the polypeptide or polynucleotide. In representative embodiments, the nucleic acid molecule and / or the isolated polypeptide is at least about 1%, 5%, 1 0%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%; 95%, or purer. Any nucleic acid sequence or amino acid sequence as described herein may be isolated.

[0068] In other embodiments, a nucleic acid molecule or polypeptide can exist in a nonnative environment such as, for example, a recombinant host cell. Thus, for example, with respect to nucleotide sequences, the term "isolated" means that it is separated from the chromosome and / or cell in which it naturally occurs. A polynucleotide is also isolated if it is separated from the chromosome and / or cell in which it naturally occurs in and is then inserted into a genetic context, a chromosome and / or a cell in , which it does not naturally occur (e.g., a different host cell, different regulatory sequences, and / or different position in the genome than as found in nature). Accordingly, the polynucleotides and their encoded polypeptides are "isolated" in that,by the hand of man, they exist apart from their native environment and therefore are not products of nature, however, in some embodiments, they can be introduced into and exist in a recombinant host cell.

[0069] " Multi ci stronic" or "polycistronic" as used interchangeable herein refers to a polynucleotide possessing more than one coding region to produce more than one protein from the same polynucleotide. The polycistronic polynucleotide sequence can include (internal ribosome- entry site (IRES), cleavage peptides (p2A, t2A and others), utilization of different promoters, etc.

[0070] " Mutant gene" or "mutated gene" as used interchangeably herein refers to a gene that has undergone a detectable mutation. A mutant gene has undergone a change, such as the loss, gain, or exchange of genetic material, which affects the normal transmission and expression of the gene.

[0071] A "native" or "wild type" nucleic acid, nucleotide sequence, polypeptide or amino acid sequence refers to a naturally occurring or endogenous nucleic acid, nucleotide sequence, polypeptide or amino acid sequence. Thus, for example, a "wild type mRNA" is an mRNA that is naturally occurring in or endogenous to the organism. A "homologous" nucleic acid is a nucleotide sequence naturally associated with a host cell into which it is introduced.

[0072] "Neurodegenerative diseases" are disorders characterized by, resulting from, or resulting in the progressive loss of structure or function of neurons, including death of neurons. Neurodegenerative diseases include, for example, Synucleinopathies, Alzheimer's Disease (AD), amyloidosis, amyotrophic lateral sclerosis (ALS), Parkinson's Disease (PD), Huntington's Disease, prion disease, motor neuron disease, spinocerebellar ataxia, spinal muscular atrophy, neuronal loss, cognitive defect, primary age-related tauopathy (PART) / Neurofibrillary tangle- predominant senile dementia, chronic traumatic encephalopathy including dementia pugilistica, dementia with Lewy bodies (Lewy body dementia} neuroaxonal dystrophies, and multiple system atrophy, progressive supranuclear palsy, Pick's Disease, corticobasal degeneration, some forms of frontotemporal lobar degeneration, frontotemporal dementia and parkinsonism linked to chromosome 17, Lytico-Bodig disease (Parkinson-dementia complex of Guam), ganglioglioma, gangliocytoma, meningioangiomatosis, postencephalitic parkinsonism, subacute sclerosing panencephalitis, lead encephalopathy, tuberous sclerosis, Hallervorden-Spatz disease, and lipofuscinosis.

[0073] As used herein, the term “Synucleinopathies” refers to those diverse group of neurodegenerative disorders that share a common pathologic legion composed of aggregates ofinsoluble a-synuclein protein in selectively vulnerable populations of neurons and glia. Pathologically, synucleinopathies are divided into two categories: Lewy body diseases and multiple system atrophy (MSA). Common clinical presentations of Lewy body disease include, but are not limited to, Parkinson’s disease (PD), PD with dementia, and dementia with Lewy Body (DLB) and the like. Common clinical presentations for MSA include, but are not limited to, MDA with predominant cerebellar ataxia, MSA with predominant parkinsonism, and the like.

[0074] "Normal gene" as used herein refers to a gene that has not undergone a change, such as a loss, gain, or exchange of genetic material. The normal gene undergoes normal gene transmission and gene expression.

[0075] "Nucleic acid" or "oligonucleotide" or "polynucleotide" as used herein means at least two nucleotides covalently linked together. The depiction of a single strand also defines the sequence of the complementary strand. Thus, a nucleic acid also encompasses the complementary strand of a depicted single strand. Many variants of a nucleic acid may be used for the same purpose as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and complements thereof. A single strand provides a probe that may hybridize to a target sequence under stringent hybridization conditions. Thus, a nucleic acid also encompasses a probe that hybridizes under stringent hybridization conditions. Nucleic acids may be single stranded or double stranded, or may contain portions of both double stranded and single stranded sequence.

[0076] The nucleic acid may be DNA, both genomic and cDNA, RNA, or a hybrid, where the nucleic acid may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine and isoguanine. Nucleic acids may be obtained by chemical synthesis methods or by recombinant methods.

[0077] A "nuclear localization signal," "nuclear localization sequence," or "NLS" as used interchangeably herein refers to an amino acid sequence that "tags" a protein for import into the cell nucleus by nuclear transport. Typically, this signal consists of one or more short sequences of positively charged lysines or arginines exposed on the protein surface. Different nuclear localized proteins can share the same NLS. An NLS has the opposite function of a nuclear export signal, which targets proteins out of the nucleus.

[0078] "Operably linked" as used herein means that expression of a gene is under the control of a promoter with which it is spatially connected. A promoter may be positioned 5' (upstream) or3' (downstream) of a gene under its control. The distance between the promoter and a gene may be approximately the same as the distance between that promoter and the gene it controls in the gene from which the promoter is derived. As is known in the art, variation in this distance may be accommodated without loss of promoter function.

[0079] As used herein, the term "percent sequence identity" or "percent identity" refers to the percentage of identical nucleotides in a linear polynucleotide of a reference ("query") polynucleotide molecule (or its complementary strand) as compared to a test ("subject') polynucleotide molecule (or its complementary strand), when the two sequences are optimally aligned. In some embodiments, "percent identity" can refer to the percentage of identical amino acids in an amino acid sequence.

[0080] As used herein, the term "polynucleotide" refers to a heteropolymer of nucleotides or the sequence of these nucleotides from the 5' to 3' end of a nucleic acid molecule and includes DNA or RNA molecules, including cDNA, a DNA fragment or portion, genomic DNA, synthetic (chemically synthesized) DNA, plasmid DNA, mRNA, and anti-sense RNA, any of which can be single stranded or double stranded.

[0081] The terms "polynucleotide," "nucleotide sequence" "nucleic acid," "nucleic acid molecule," and "oligonucleotide" are also used interchangeably herein to refer to a heteropolymer of nucleotides. Except as otherwise indicated, nucleic acid molecules and / or polynucleotides provided herein are presented herein in the 5' to 3' direction, from left to right and are represented using the standard code for representing the nucleotide characters as set forth in the U.S. sequence rules, 37 CFR §§1.821 - 1.825 and the World Intellectual Property Organization (WIPO) Standard ST.26.

[0082] The term "prevent," "preventing," and "prevention" (and grammatical variations thereof) refer to prevention and / or delay of the onset of an infection, disease, condition and / or a clinical symptom(s) in a subject and / or a reduction in the severity of the onset of the infection, disease, condition and / or clinical symptom(s) relative to what would occur in the absence of carrying out the methods of the disclosure prior to the onset of the disease, disorder and / or clinical symptom(s).

[0083] " Promoter" as used herein means a synthetic or naturally derived molecule which is capable of conferring, activating or enhancing expression of a nucleic acid in a cell. A promoter may comprise one or more specific transcriptional regulatory sequences to further enhance expression and / or to alter the spatial expression and / or temporal expression of same. A promoter may also comprise distal enhancer or repressor elements, which may be located asmuch as several thousand base pairs from the start site of transcription. A. promoter may be derived from sources including viral, bacterial, fungal, plants, insects, and animals. A promoter may regulate the expression of a gene component constitutively, or differentially with respect to cell, the tissue or organ in which expression occurs or, with respect to the developmental stage at which expression occurs, or in response to external stimuli such as physiological stresses, pathogens, metal ions, or inducing agents. Representative examples of promoters include the EFS promoter, bacteriophage T7 promoter, bacteriophage T3 promoter, SP6 promoter, lac operator-promoter, tac promoter, SV40 late promoter, SV40 early promoter, RSV-LTR promoter, CNIV IE promoter, SV40 early promoter or SV40 late promoter, human U6 (hU6) promoter, and CrvfV IE promoter.

[0084] A "protospacer sequence" refers to the target double stranded DNA and specifically to the portion of the target DNA (e.g., or target region in the genome) that is fully or substantially complementary (and hybridizes) to the spacer sequence of the CRISPR arrays. The protospacer sequence in a Type I system is directly flanked at the 3' end by a PAM. A spacer is designed to be complementary to the protospacer.

[0085] A "protospacer adjacent motif (PAM)" is a short motif of 2 - 4 base pairs present immediately 3' or 5' to the protospacer.

[0086] As used herein, the terms "reduce," "reduced," "reducing," "reduction," "diminish," "suppress," and "decrease" (and grammatical variations thereof} describe, for example, a decrease of at least about 5%, 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% as compared to a control. For some embodiments, the reduction results in no or essentially no (i.e., an insignificant amount, e.g., less than about 10% or even less than about 5% detectable activity or amount.

[0087] As used herein "sequence identity" refers to the extent to which two optimally aligned polynucleotide or peptide sequences are invariant throughout a window of alignment of components, e.g., nucleotides or amino acids. "Identity" can be readily calculated by known methods including, but not limited to, those described in: Computational Molecular Biology (Lesk, A. M, ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, D. W, ed.) Academic Press, New York (i 993); Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., eds.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G, ed.) Academic Press (i 987); and Sequence Analysis Primer (Gribskov, M. and Devereux, 1, eds.) Stockton Press, New York

[0088] "Subject" and "patient" as used herein interchangeably refers to any vertebrate, including, but not limited to, a mammal (e.g., cow, pig, camel, llama, horse, goat, rabbit, sheep, hamsters, guinea pig, cat, dog, rat, and mouse, a non-human primate (for example, a monkey, such as a cynomolgous or rhesus monkey, chimpanzee, etc.) and a human). In some embodiments, the subject may be a human or a non-human. The subject or patient may be undergoing other forms of treatment.

[0089] "Target gene" as used herein refers to any nucleotide sequence encoding a known or putative gene product. The target gene may be a mutated gene involved in a genetic disease or disorder. The target gene may be APOE.

[0090] "Target region" as used herein refers to the region of the target gene and / or chromosome to which the composition for epigenome modification of the target gene is designed to bind and modify.

[0091] The terms "transformation," "transfection," and "transduction" as used interchangeably herein refer to the introduction of a heterologous nucleic acid molecule into a cell. Such introduction into a cell can be stable or transient. Thus, in some embodiments, a host cell or host organism is stably transformed with a polynucleotide of the disclosure. In other embodiments, a host cell or host organism is transiently transformed with a polynucleotide of the disclosure. "Transient transformation" in the context of a polynucleotide means that a polynucleotide is introduced into the cell and does not integrate into the genome of the cell. By "stably introducing" or "stably introduced" in the context of a polynucleotide introduced into a cell is intended that the introduced polynucleotide is stably incorporated into the genome of the cell, and thus the cell is stably transformed with the polynucleotide. "Stable transformation" or "stably transformed" as used herein means that a nucleic acid molecule is introduced into a cell and integrates into the genome of the cell. As such, the integrated nucleic acid molecule is capable of being inherited by the progeny thereof, more particularly, by the progeny of multiple successive generations.

[0092] " Genome" as used herein also includes the nuclear, the plasmid and the plastid genome, and therefore includes integration of the nucleic acid construct into, for example, the chloroplast or mitochondrial genome. Stable transformation as used herein can also refer to a transgene that is maintained extrachromasomally, for example, as a minichromosome or a plasmid. In some embodiments, the nucleotide sequences, constructs, expression cassettes can be expressed transiently and / or they can be stably incorporated into the genome of the host organism.

[0093] "Transgene" as used herein refers to a gene or genetic material containing a gene sequence that has been isolated from one organism and is introduced into a different organism. This non-native segment of DNA may retain the ability to produce RNA. or protein in the transgenic organism, or it may alter the normal function of the transgenic organism's genetic code. The introduction of a transgene has the potential to change the phenotype of an organism.

[0094] By the terms "treat," "treating," or "treatment," it is intended that the severity of the subject's disease or disorder is reduced or at least partially improved or modified and that some alleviation, mitigation or decrease in at least one clinical symptom is achieved, and / or there is a delay in the progression of the disease or disorder, and / or delay of the onset of a disease or disorder. In some embodiments, the term refers to, e.g., a decrease in the symptoms or other manifestations of the disease or disorder. In some embodiments, treatment provides a reduction in symptoms or other manifestations of the disease or disorder by at least about 5 'o, e.g., about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, 90%, 95%, or more.

[0095] " Variant" used herein with respect to a nucleic acid means (i) a portion or fragment of a referenced nucleotide sequence; (ii) the complement of a referenced nucleotide sequence or portion thereof; (iii) a nucleic acid that is substantially identical to a referenced nucleic acid or the complement thereof or (iv) a nucleic acid that hybridizes under stringent conditions to the referenced nucleic acid, complement thereof, or a sequences substantially identical thereto. "Variant" with respect to a peptide or polypeptide that differs in amino acid sequence by the insertion, deletion, or conservative substitution of amino acids, but retain at least one biological activity Variant may also mean a protein with an amino acid sequence that is substantially identical to a referenced protein with an amino acid sequence that retains at least one biological activity. A conservative substitution of an amino acid, i.e., replacing an amino acid with a different amino acid of similar properties (e.g., hydrophilicity, degree and distribution of charged regions) is recognized in the art as typically involving a minor change. These minor changes may be identified, in part, by considering the hydropathic index of amino acids, as understood in the art. Kyte et al., .J Afol. Biol. 157: 105-132 (1982). The hydropathic index of an amino acid is based on a consideration of its hydrophobicity and charge. It is known in the art that amino acids of similar hydropathic indexes may be substituted and still retain protein function. In one aspect, amino acids having hydropathic indexes of± 2 are substituted. The hydrophilicity of amino acids may also be used to reveal substitutions that would result in proteins retaining biological function. A consideration of the hydrophilicity of amino acids in the context of a peptide permits calculation of the greatest local average hydrophilicity of thatpeptide. Substitutions may be performed with amino acids having hydrophilicity values within ± 2 of each other. Both the hydrophobicity index and the hydrophilicity value of amino acids are influenced by the particular side chain of that amino acid. Consistent with that observation, amino acid substitutions that are compatible with biological function are understood to depend on the relative similarity of the amino acids, and particularly the side chains of those amino acids, as revealed by the hydrophobicity, hydrophilicity, charge, size, and other properties.

[0096] " Vector" as used herein means a nucleic acid sequence containing an origin of replication. A vector can be a viral vector, bacteriophage, bacterial artificial chromosome or yeast artificial chromosome. A vector can be a DNA or RNA vector. A vector can be a selfreplicating extrachromosomal vector, and preferably, is a DNA plasmid.

[0097] Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. For example, any nomenclatures used in connection with and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those that are well known and commonly used in the art. The meaning and scope of the terms should be clear; in the event however of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.2. Tyrosine hydroxylase (TH) promoters and engineered TH Promoters

[0098] Provided herein are tyrosine hydroxylase (TH) promoters (e.g., nucleic acid sequences), which are involved in the regulation of the TH gene. The TH gene encodes the enzyme tyrosine hydroxylase, which is the rate limiting enzyme in the catecholamine synthesis pathway.Tyrosine hydroxylase converts L-tyrosine to L-DOPA, the first step in the biosynthesis of catecholamines like dopamine, noradrenaline, and adrenaline. Tyrosine hydroxylase is the rate limiting enzyme in the catecholamine synthesis pathway. Antibodies that detect tyrosine hydroxylase may be used to identify dopaminergic neurons in the central nervous system. As such, the TH promoter is a DNA region that can be used for identifying dopaminergic neurons.

[0099] In some embodiments, a TH promoter comprises or consists of a nucleic acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 138, or a fragment thereof.

[0100] A TH promoter may be an engineered TH promotor. Such engineered TH promoters may be a fragment of a TH promoter (e.g., a fragment that retains TH promoter activity). Engineering a TH promoter may comprise modifying the promoter to have different strengths or functional activity. An engineered TH promoter may have a minimized size, for example, truncations of the promoter to reduce its overall size while also maintaining TH promoter functional activity. An engineered TH promoter may comprise replacement substitutions, nucleotide insertions, or nucleotide deletions of the full-length promoter sequence. An engineered TH promoter may also comprise multiple fragments of the TH promoter, which are connected in an orientation that deviates from the location of those fragments in the full-length TH promoter. For instance, critical portions of the full-length promoter may be combined and reoriented. In certain embodiments, an engineered TH promoter comprises one or more fragments of a full-length TH promoter. The one or more fragments may be selected so that the engineered TH promoter maintains functional activity, but is smaller in size or has other advantageous properties. Such engineered promoters that are smaller in size may be advantageous because they can fit inside of vector or promoter carrier that may have payload size limitations (e.g., an AAV vector). Reducing the size of the TH promoter may allow for larger payloads to be incorporated into vector or promoter carrier.

[0101] In some embodiments, an engineered promoter is single stranded or double stranded. When a nucleic acid sequence is described herein as being an engineered promoter, it is contemplated that a nucleic acid having reverse complementarity thereto the each or fragments thereof

[0102] An engineered TH promoter may comprise a TH promoter or engineered TH promoter as described herein. An engineered TH promoter may comprise or consist of the nucleic acid sequence of SEQ ID NO: 138 or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either. An engineered TH promoter may comprise or consist of the nucleic acid sequence of SEQ ID NO: 130 or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either. An engineered TH promoter may comprise or consist of the nucleic acid sequence of SEQ ID NO: 131 or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either. An engineered TH promoter may comprise or consist of the nucleic acid sequence of SEQ ID NO: 132 or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either. An engineered TH promoter may comprise or consist of the nucleic acid sequence of SEQ ID NO: 133 or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either. An engineered TH promoter may comprise or consist of the nucleic acid sequence ofSEQ ID NO: 134 or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either. An engineered TH promoter may comprise or consist of the nucleic acid sequence of SEQ ID NO: 135 or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either. An engineered TH promoter may comprise or consist of the nucleic acid sequence of SEQ ID NO: 136 or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either.

[0103] An engineered TH promoter may comprise a combination of two or more of the nucleic acid sequences set forth in any one of SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, or SEQ ID NO: 135. An engineered TH promoter may comprise a combination ofSEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, and SEQ ID NO: 135, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof.

[0104] An engineered TH promoter may comprise a combination of SEQ ID NO: 131, SEQ ID NO: 132, and SEQ ID NO: 133, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of SEQ ID NO: 131, SEQ ID NO: 132, and SEQ ID NO: 135 , or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of SEQ ID NO: 131, SEQ ID NO: 133, andSEQ ID NO: 135, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination ofSEQ ID NO: 132, SEQ ID NO: 133, and SEQ ID NO: 135 , or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of SEQ ID NO: 131 and SEQ ID NO: 132, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of SEQ ID NO: 131 and SEQ ID NO: 133, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of SEQ ID NO: 131 and SEQ ID NO: 135, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of SEQ ID NO: 132 and SEQ ID NO: 133, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of SEQ ID NO: 132 andSEQ ID NO: 135, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of SEQ ID NO: 133 and SEQ ID NO: 135, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprisea nucleic acid sequence comprising a combination of SEQ ID NO: 132 or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof, and SEQ ID NO: 133 or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof. An engineered TH promoter may comprise a fragment of SEQ ID NO: 132 or a nucleic acid sequence having reverse complementarity thereto, and comprise or consist of the nucleic acid sequence of SEQ ID NO:82 or SEQ ID NO:83 or SEQ ID NO:84. An engineered TH promoter may comprise a fragment of SEQ ID NO: 133 or a nucleic acid sequence having reverse complementary thereto, which may comprise or consist of the nucleic acid sequence of SEQ ID NO:78 or SEQ ID NO:79 or SEQ ID NO:80.

[0105] An engineered TH promoter may comprise or consist of the nucleic acid sequence of SEQ ID NO:86, SEQ ID NO:87, SEQ ID NO:88, or SEQ ID NO:89 or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either.

[0106] An engineered TH promoter may comprise or consist of the nucleic acid sequence of SEQ ID NO:91 or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either. An engineered TH promoter may comprise or consist of the nucleic acid sequence of SEQ ID NO:92 or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either. An engineered TH promoter may comprise or consist of the nucleic acid sequence of SEQ ID NO:93 or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either. An engineered TH promoter may comprise or consist of the nucleic acid sequence of SEQ ID NO:94 or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either. An engineered TH promoter may comprise or consist of the nucleic acid sequence of SEQ ID NO:95 or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either. An engineered TH promoter may comprise or consist of the nucleic acid sequence of SEQ ID NO: 133 or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either. An engineered TH promoter may comprise or consist of a nucleic acid sequence comprising a combination of two or more of the nucleic acid sequences set forth in any one ofSEQ ID NOS:91-95 or nucleic acid sequences having reverse complementarity thereto each or fragments thereof, in any order. An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof.

[0107] An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, and SEQ ID NO:95, ornucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences ofSEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, and SEQ ID NO:94, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:94, andSEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO:91, SEQ ID NO:93, SEQ ID NO:94, and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences ofSEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof.

[0108] An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO:91, SEQ ID NO:92, and SEQ ID NO:93, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO:91, SEQ ID NO:92, and SEQ ID NO: 94, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO:91, SEQ ID NO:92, and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO:91, SEQ ID NO:93, and SEQ ID NO: 94, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO:91, SEQ ID NO:93, and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO:91, SEQ ID NO:94, and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO:92, SEQ ID NO:93, and SEQ ID NO:94, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO:92, SEQ ID NO:93,and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO:92, SEQ ID NO:94, and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO:93, SEQ ID NO:94, and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof.

[0109] An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO:91 and SEQ ID NO:92, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO:91 and SEQ ID NO:93, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences ofSEQ ID NO:91 and SEQ ID NO:94, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO:91 and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO:92 and SEQ ID NO: 93, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO: 92 and SEQ ID NO: 94, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO:92 and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences ofSEQ ID NO:93 and SEQ ID NO:94, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO:93 and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise a combination of the nucleic acid sequences of SEQ ID NO:94 and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof. An engineered TH promoter may comprise or consist of the nucleic acid sequence of SEQ ID NO:96 or SEQ ID NO:97 or 108.

[0110] In an aspect, a TH promoter as described herein further comprise one or more nucleic acid moieties. In some embodiments, a TH promoter further comprises 5’UTR sequence. The 5’UTR sequence may be from any species, and may be modified (e.g., nucleic acid substitutions) wherein the modified 5’UTR retains its functional activity. In some embodiments, the 5’UTR sequence comprises or consists of the nucleic acid sequence of SEQ ID NO: 140, or a nucleic acid sequence having reverse complementarity thereto each or a fragment thereof either.[oni] An engineered TH promoter may comprise or consist of the nucleic acid sequence of SEQ ID NO: 139 or SEQ ID NO: 141.

[0112] An engineered TH promoter may comprise a combination of the nucleic acids of any one of SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, or SEQ ID NO: 135 (e g., the PEAK sequences exemplified herein), and any one of SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, or SEQ ID NO:95 (the CR1-CR5 or CI-CV as exemplified herein), or nucleic acid sequences having reverse complementarity thereto each, or fragments thereof.

[0113] An engineered TH promoter may comprise a nucleic acid sequence extracted from any one of the sequences provided in TABLE 2 or TABLE 3.3. Nucleic Acid Molecules and Constructs Driven by TH Promoters

[0114] The present disclosure is directed to nucleic acid molecule (e.g., a nucleic acid molecules) as described herein, comprising any composition of the components as described here (e.g., an engineered TH promoter, a vector, a CRISPR-based endonuclease, one or more polypeptides having enzymatic activity, and / or gRNA).

[0115] Provided herein are nucleic acid molecules comprising the TH promoter (e.g., an engineered TH promoter) as described herein. The nucleic acid molecule may be a vector. The nucleic acid molecule may be a cloning vector. The nucleic acid molecule may be an expression vector. The nucleic acid molecule may be a viral vector. When a nucleic acid molecule as described herein comprises inclusion of a TH promoter, it may localize the nucleic acid molecule or drive expression at dopaminergic neurons.

[0116] In an aspect a nucleic acid molecule as described herein comprises (a) a nucleic acid sequence encoding a CRISPR-based endonuclease; (b) a nucleic acid sequence encoding one or more polypeptide having an enzymatic activity; (c) a nucleic acid sequence of one or more guide RNA targeting (i) a neurodegenerative disease (NDD)-r elevant gene; (ii) a promoter region of the NDD-relevant gene; (iii) an intron of the NDD-relevant gene or flanking sequence thereof; (iv) an untranslated region (UTR) of the NDD-relevant gene; (v) or any combination thereof, and (d) one or more neuron specific regulatory element operably linked to the CRISPR-basedendonuclease and / or the one or more polypeptide having an enzymatic activity, wherein the one or more neuron specific regulatory element comprises an engineered TH promoter as described herein. a. Additional Neuron Specific Regulatory Elements

[0117] Nucleic acid constructs as described herein may comprise a TH promoter (e.g., engineered TH promoter) as described herein, and optionally additional neuron specific regulatory sequences (e.g., more than a TH promoter). A TH promoter is a neuron specific regulatory element that may be specific for a dopaminergic neuron. The neuron specific regulatory sequences (e.g., the TH promoter and / or one or more neuron specific regulatory sequences) may comprise a wild-type promoter, a neuron specific enhancer, a synthetic promoter, a synthetic enhancer, a transcriptional or translational regulatory sequence or any combination thereof.

[0118] A neuron specific promoter can drive enhanced expression of the gene-of-interest to which it is operably linked, in the neuron compared to other brain cells, for example, glia. In an aspect, the neuron specific promoter may be functional in enhancing expression in the neuron, of gene-of-interest to which it is operably linked, by about 1.1-fold to about 100-fold or more. In an aspect, the neuron specific promoter may be functional in enhancing expression in the neuron, of gene-of-interest to which it is operably linked, by about 1.1-fold to about 2-fold, about 2-fold to about 10-fold, about 10-fold to about 20-fold, about 20-fold to about 30-fold, about 30-fold to about 40-fold, about 40-fold to about 50-fold, about 50-fold to about 60-fold, about 60-fold to about 70-fold, about 70-fold to about 80-fold, about 80-fold to about 90-fold, about 90-fold to about 100-fold or more compared to other brain cells. In an aspect, the one or more neuron specific regulatory elements comprise at least one neuron specific promoter (e.g., a neuron specific wild-type promoter or a neuron specific synthetic promoter). Non-limiting examples of neuron specific promoters include a TH promoter, a FOXA2 promoter, a ChAT promoter, a Nkx2.1 promoter or a derivative thereof.

[0119] In an aspect, the neuron specific regulatory element (e.g., promoter) may be specific for a certain type of neuron (e.g., a dopaminergic or a cholinergic neuron). In these instances, the neuron specific regulatory element may include a dopaminergic specific regulatory element (i.e., a dopaminergic promoter) and / or a cholinergic neuron specific regulatory element (i.e., a cholinergic promoter). In an aspect, the neuron specific regulatory element may comprise a neuron specific promoter. Additional neuron specific promoters that may be incorporated into a nucleic acid molecule (e.g., a construct) as described herein may comprise a FOXA2 promoter,ChAT promoter, Nkx2.1 promoter, a fragment, or any combination thereof. TH promoter, FOXA2 promoter, ChAT promoter, and / or Nkx2.1 promoter may be the dopaminergic promoter.

[0120] In an aspect, the neuron specific promoter is a TH promoter, or a derivative thereof. In an aspect, a disclosed TH promoter can comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in any one of SEQ ID NO: 138, SEQ ID NOS:78-89, 91-109, 130-139, 141, or SEQ ID NOS:71-77, 90, 116-118, 120-125, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof.

[0121] In an aspect, the neuron specific promoter is a FOXA2 promoter, or a derivative thereof. In an aspect, a disclosed FOXA2 promoter can comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO:53, or a fragment, or a derivative thereof. In an aspect, a disclosed FOXA2 promoter can comprise a sequence as set forth in SEQ ID NO:53.

[0122] In an aspect, the neuron specific promoter is a ChAT promoter, or a derivative thereof. In an aspect, a disclosed ChAT promoter can comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO:51, or a fragment, or a derivative thereof. In an aspect, a disclosed ChAT promoter can comprise a sequence as set forth in SEQ ID NO:51.

[0123] In an aspect, the neuron specific promoter is a Nkx2.1 promoter, or a derivative thereof. In an aspect, a disclosed Nkx2.1 promoter can comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 52, or a fragment, or a derivative thereof. In an aspect, a disclosed Nkx2.1 promoter can comprise a sequence as set forth in SEQ ID NO: 52.

[0124] In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) can be operably linked to a Cas endonuclease (e.g., a dCas endonuclease) as described herein.

[0125] In an aspect, a disclosed neuron specific regulatory element (i.e., a neuron specific promoter) operably linked to the Cas endonuclease (e.g., dCas endonuclease) can be operably linked to the at least one polypeptide having enzymatic activity. For example, a fusion proteinof the Cas endonuclease (e.g., dCas endonuclease) and the at least one polypeptide having enzymatic activity.

[0126] A neuron specific promoter may comprise a nucleic acid sequence extracted from any one of the sequences provided in TABLE 2 or TABLE 3. b. Encoded Cas Endonucleases i. CRISPR Systems

[0127] As used herein, clustered regularly interspaced short palindromic repeats (CRISPR) may be the loci containing multiple short direct repeats that are found in the genomes of approximately 40% of sequenced bacteria and 90% of sequenced archaea. The CRISPR system is a microbial nuclease system involved in defence against invading phages and plasmids that provides a form of acquired immunity. The CRISPR loci in microbial hosts contain a combination of CRISPR-associated (Cas) genes as well as non-coding RNA elements capable of programming the specificity of the CRISPR-mediated nucleic acid cleavage by a CRISPR-based endonuclease, as recited herein. Short segments of foreign DNA, called spacers, are incorporated into the genome between CRISPR repeats, and serve as a 'memory' of past exposures. Cas9 is a CRISPR-based endonuclease that forms a complex with the 3' end of the sgRNA (also referred interchangeably herein as "gRNA"), and the protein-RNA pair recognizes its genomic target by complementary base pairing between the 5' end of the sgRNA sequence and a predefined 20 bp DNA sequence, known as the protospacer. This complex is directed to homologous loci of pathogen DNA via regions encoded within the crRNA, i.e., the protospacers, and protospacer-adjacent motifs (PAMs) within the pathogen genome. The non-coding CRISPR array is transcribed and cleaved within direct repeats into short crRNAs containing individual spacer sequences, which direct Cas nucleases to the target site (protospacer). By simply exchanging the 20 hp recognition sequence of the expressed sgRNA, the Cas9 nuclease can be directed to new genomic targets. CRISPR spacers are used to recognize and silence exogenous genetic elements in a manner analogous to RNAi in eukaryotic organisms.

[0128] Three classes of CRISPR systems (Types I, U and III effector systems) are known, which have functional CRISPR-based endonuclease. The Type II effector system carries out targeted DNA double-strand break in four sequential steps, using a single effector enzyme, Cas9, to cleave dsDNA Compared to the Type I and Type II effector systems, which require multiple distinct effectors acting as a complex, the Type II effector system may function in alternative contexts such as eukaryotic cells. The Type II effector system consists of a long pre- crRNA, which is transcribed from the spacer-containing CRISPR locus, the Cas9 protein, and atracrRNA, which is involved in pre-crRNA processing. The tracrRNAs hybridize to the repeat regions separating the spacers of the pre-crRNA, thus initiating dsRNA cleavage by endogenous RNase HI. This cleavage is followed by a second cleavage event within each spacer by Cas9, producing mature crRNAs that remain associated with the tracrRNA and Cas9, forming a Cas9:crRNA-tracrRNA complex.

[0129] The Cas9:crRNA-tracrRNA complex unwinds the DNA duplex and searches for sequences matching the crRNA to cleave. Target recognition occurs upon detection of complementarity between a "protospacer" sequence in the target DNA and the remaining spacer sequence in the crRNA. Cas9 mediates cleavage of target DNA if a correct protospacer-adjacent motif (PAM) is also present at the 3' end of the protospacer. For protospacer targeting, the sequence must be immediately followed by the protospacer-adjacent motif (PAM), a short sequence recognized by the Cas9 nuclease that is required for DNA cleavage. Different Type II systems have differing PAM requirements. The S. pyogenes CRISPR system may have the PAM sequence for this Cas9 (SpCas9) as 5'-NRG-3 ', where R is either A or G, and characterized the specificity of this system in human cells. A unique capability of the CRISPR / Cas9-based epigenome modifier and modifying system is the straightforward ability to simultaneously target multiple distinct genomic loci by co-expressing a single Cas9 protein with two or more sgRNAs. For example, the Streptococcuspyogenes Type II system naturally prefers to use an "NGG" sequence, where "N" can be any nucleotide, but also accepts other PAM sequences, such as "NAG" in engineered systems (Hsu et al., Nature Biotechnology (2013) doi: HU 038 / nbt2647), Similarly, the Cas9 derived from Neisseria meningitidis (NmCas9) normally has a native PAM of NNNNGATT, but has activity across a variety of PAMs, including a highly degenerate NNNNGNNN PAM (Esvelt et al., Nature Methods (2013) doi:1038 / nmeth2681 } Similarly, the VRER-Cas9 derived from Streptococcuspyogenes Type II system is designed to target NGCG PAM.

[0130] An engineered form of the Type II effector system of Streptococcus pyogenes was shown to function in human cells for genome engineering. In this system, CRISPR-based endonuclease (e.g., Cas9) protein was directed to genomic target sites by a synthetically reconstituted "guide RNA" ("gRNA", also used interchangeably herein as a chimeric single guide RNA ("sgRNA")), which is a crRNA-tracrRNA fusion that obviates the need for RNAase III and crRNA processing in general.

[0131] A CRISPR-based endonuclease may may comprise an amino acid sequence of, is encoded by a nucleic acid sequence of, or comprises a sequence extracted from any one of the sequences provided in TABLE 2 or TABLE 3, or a fragment thereof.ii. Cas Endonucleases

[0132] The epigenome modification of a neurodegenerative disease (NDD) -relevant gene (e.g., SNCA gene) may comprise Cas9 protein is mutated so that the nuclease activity is inactivated, i.e., a Cas9 variant. Cas9 protein is an endonuclease that cleaves nucleic acid and is encoded by the CRISPR loci and is involved in the Type II CRISPR system. The Cas9 protein may be from any bacterial or archaea species, such as Streptococcus pyogenes, Streptococcus thermophiles, or Neisseria meningitides. An inactivated Cas9 protein ("iCas9", also referred to as "dCas9") with no endonuclease activity has been recently targeted to genes in bacteria, yeast, and human cells by gRNAs to silence gene expression through steric hindrance. As used herein, "iCas9" and "dCas9" both refer to a Cas9 protein that has the amino acid substitutions D10A and H840A and has its nuclease activity inactivated. In an aspect, a CRISPR-based endonuclease as described herein may be a deactivated Cas9 (dCas9) nuclease.

[0133] The Cas9 protein may be from any bacterial or archaea species, such as Streptococcuspyogenes, that was modified to carry four mutations, namely VRER. The VRER protein may be linked (fused or separated by p2 or rRES sequence, or any other method supporting the expression of bicistronic or polycistronic proteins) with / to catalytic domain of KRAB and / or any other repressor / activator (e.g. DNMT3 A), chromatin modifier, chromatin modulator etc., to target SNCA. The VRER protein may be encoded by a nucleic acid sequence comprising the nucleic acid sequence of SEQ ID NO:39.

[0134] In an aspect, a disclosed dCas9 endonuclease can comprise a deactivated Staphylococcus aureus Cas9 (dSaCas9), a deactivated Streptococcus pyogenes Cas9 (dSpCas9), a deactivated Campylobacter jejuni Cas9 (dCjCas9), or a variant dCas9 endonuclease. In an aspect, a disclosed variant dCas9 can comprise a variant dSaCas9, a variant dSpCas9, or a variant dCjCas9. In an aspect, a disclosed variant dSpCas9 can comprise dVQR, dEQR, or dVRER.

[0135] In an aspect, a nucleic acid sequence encoding the disclosed dSpCas9 may comprise a sequence as set forth in SEQ ID NO:4 or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed dSpCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO:5, or a fragment thereof. In an aspect, a disclosed dSpCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO:5, or a fragment, or a derivative thereof. In an aspect, a disclosed dSpCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%,at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 5, or a fragment thereof.

[0136] In an aspect, a nucleic acid sequence encoding the disclosed dSaCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 8 or SEQ ID NO: 10, or a fragment, or a derivative there-of. In an aspect, the sequence encoding the disclosed dSaCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequences set forth SEQ ID NO:8 or SEQ ID NO: 10, or a fragment thereof. In an aspect, a disclosed dSaCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO:9 or SEQ ID NO: 11, or a fragment, or a derivative thereof. In an aspect, a disclosed dSaCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 9 or SEQ ID NO: 11, or a fragment thereof.

[0137] In an aspect, a nucleic acid sequence encoding the disclosed dCjCas9 may comprise a sequence as set forth in any one of SEQ ID NO: 6, or a fragment, or a derivative there-of. In an aspect, the sequence encoding the disclosed dCjCas9 endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO: 6, or a fragment thereof. In an aspect, a disclosed dCjCas9 endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO:7, or a fragment, or a derivative thereof. In an aspect, a disclosed dCjCas9 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 7, or a fragment thereof. iii. Cas Fusion Protein

[0138] In some embodiments, the composition includes a Cas fusion protein. The fusion protein can include two heterologous polypeptide domains, wherein the first polypeptide domain includes a Clustered Regularly Interspaced Short Palindromic Repeats associated (Cas) protein and the second polypeptide domain includes a peptide having an activity selected from the group consisting of transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methyltransferase activity, demethylase activity, acetyltransferase activity, and deacetylaseactivity In some embodiments, the second polypeptide domain is fused to the C-terminus, N- terminus, or both, of the first polypeptide domain. In some embodiments, the fusion protein further comprises a nuclear localization sequence. In some embodiments, the fusion protein further comprises a linker connecting the first polypeptide domain to the second polypeptide domain. In some embodiments, the fusion protein represses transcription of the SNCA gene. c. Encoded Polypeptides Having Enzymatic Activity

[0139] In an aspect, a nucleic acid molecule as described herein (e.g., nucleic acid constructs) may comprise a nucleic acid sequence encoding one or more polypeptide having an enzymatic activity. The enzymatic activity of the one or more polypeptides may comprise transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methyltransferase activity, demethylase activity, acetyl-transferase activity, deacetylase activity, or any combination thereof.

[0140] In an aspect, a disclosed encoded polypeptide having an enzymatic activity can comprise heterochromatin protein la (HP la), heterochromatin protein lb (HP lb), methyl-CpG-binding domain protein 1 (MBD1), optionally the Transcription Repression Domain (TRD) of MBD1, methyl-CpG-binding domain protein 2 (MBD2), optionally the Transcription Repression Domain (TRD) of MBD1, Kriippel-Associated Box (KRAB), nuclear inhibitor of protein phosphatase-1 (NIPP1), methyl-CpG binding protein 2 (MeCP2), optionally the Transcription Repression Domain (TRD) of MeCP2, DNA (cytosine-5)-methyltransferase 3 A (DNMT3 A), any combination thereof, or any fusion thereof.

[0141] In an aspect, a disclosed fusion can comprise HP la-HP la, HPla-HPlb, HPla-MBDl, HPla-MBD2, HPla-KRAB, HPla-NIPPl, HPla-MeCP2, HPla-DNMT3A, HPlb-HPlb, HPlb- HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb- DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1- NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB- KRAB, KRAB-HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB- MeCP2, KRAB-DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NIPP1- MBD2, NIPPl-KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2-MeCP2, MeCP2-HPla, MeCP2-HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2- DNMT3A, DNMT3A-DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A-MBD2, DNMT3A-KRAB, DNMT3A-NLPP1, or DNMT3 A-MeCP2. Any of these fusions may be in turn fused to a CRISPR-based endonuclease, as described herein.

[0142] In an aspect, a nucleic acid sequence encoding the disclosed HPla may comprise a sequence as set forth in any one of SEQ ID NO:21, or a fragment, or a derivative thereof. In an aspect, the sequence encoding the disclosed HPla endonuclease may comprise a nucleic acid sequence having at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to any one of the sequences set forth in SEQ ID NO:21, or a fragment thereof. In an aspect, a disclosed HPla endonuclease can comprise the amino acid sequence as set forth in SEQ ID NO:22, or a fragment, or a derivative thereof. In an aspect, a disclosed HPla can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 22, or a fragment thereof.

[0143] In an aspect, a nucleic acid sequence encoding the disclosed HP lb can comprise the sequence set forth in SEQ ID NO: 23, or a fragment thereof, or a derivative thereof. In an aspect, the sequence encoding the disclosed HP lb can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO:23, or a fragment thereof. In an aspect, a disclosed encoded HP lb can comprise an amino acid sequence as set forth in SEQ ID NO:24, or a fragment thereof. In an aspect, a disclosed encoded HP lb can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO:24, or a fragment thereof.

[0144] In an aspect, a nucleic acid sequence encoding the disclosed MBD1 or the Transcription Repression Domain (TRD) of MBD1 can comprise the sequence set forth in SEQ ID NO:27, or a fragment thereof. In an aspect, the sequence encoding the disclosed MBD1 or the Transcription Repression Domain (TRD) of MBD1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO:27, or a fragment thereof. In an aspect, a disclosed encoded MBD1 or the Transcription Repression Domain (TRD) of MBD1 can comprise an amino acid sequence set forth in SEQ ID NO:28, or a fragment thereof. In an aspect, a disclosed encoded MBD1 or the Transcription Repression Domain (TRD) of MBD1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO:28, or a fragment thereof.

[0145] In an aspect, a nucleic acid sequence encoding the disclosed MBD2 or the Transcription Repression Domain (TRD) of MBD2 can comprise the sequence set forth in SEQ ID NO:29, ora fragment thereof. In an aspect, the sequence encoding the disclosed MBD2 or the Transcription Repression Domain (TRD) of MBD1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO:29, or a fragment thereof. In an aspect, a disclosed encoded MBD2 or the Transcription Repression Domain (TRD) of MBD2 can comprise an amino acid sequence set forth SEQ ID NO:30, or a fragment thereof. In an aspect, a disclosed encoded MBD2 or the Transcription Repression Domain (TRD) of MBD2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 30, or a fragment thereof.

[0146] In an aspect, a nucleic acid sequence encoding the disclosed NIPP1 can comprise the sequence set forth in SEQ ID NO:25, or a fragment thereof. In an aspect, the sequence encoding the disclosed NIPP1 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO:25, or a fragment thereof. In an aspect, a disclosed encoded NIPP1 can comprise an amino acid sequence set forth in SEQ ID NO:26, or a fragment thereof. In an aspect, a disclosed encoded NIPP1 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO:26 or a fragment thereof.

[0147] In an aspect, a nucleic acid sequence encoding the disclosed KRAB can comprise the sequence set forth in SEQ ID NO: 12, or a fragment thereof. In an aspect, the sequence encoding the disclosed KRAB can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 12, or a fragment thereof. In an aspect, a disclosed encoded KRAB can comprise an amino acid sequence set forth in SEQ ID NO: 13 or a fragment thereof. In an aspect, a disclosed encoded KRAB can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 13, or a fragment thereof.

[0148] In an aspect, a nucleic acid sequence encoding the disclosed MeCP2 can comprise the sequence set forth in SEQ ID NO: 14, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 14, or a fragment thereof. In an aspect, a disclosed encoded MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 15, or afragment thereof. In an aspect, a disclosed encoded MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 15, or a fragment thereof.

[0149] In an aspect, a nucleic acid sequence encoding the disclosed KRAB-MeCP2 can comprise the sequence set forth in SEQ ID NO: 16 or a fragment thereof In an aspect, the nucleic acid sequence encoding the disclosed KRAB-MeCP2 can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 16, or a fragment thereof. In an aspect, a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18, or a fragment thereof. In an aspect, a disclosed encoded KRAB-MeCP2 can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18, or a fragment thereof.

[0150] In an aspect, a nucleic acid sequence encoding the disclosed DNMT3A can comprise the sequence set forth in SEQ ID NO: 19, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed DNMT3 A can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO: 19, or a fragment thereof. In an aspect, a disclosed encoded DNMT3A can comprise an amino acid sequence set forth in SEQ ID NO:20, or a fragment thereof. In an aspect, a disclosed encoded DNMT3 A can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO:20, or a fragment thereof.

[0151] In an aspect, the one or more polypeptide having enzymatic activity may comprise a VRER-DNMT3A. A nucleic acid sequence encoding the disclosed VRER-DNMT3A can comprise the sequence set forth in SEQ ID NO:40, or a fragment thereof. In an aspect, the nucleic acid sequence encoding the disclosed VRER-DNMT3A can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO:40, or a fragment thereof. In an aspect, a disclosed encoded VRER-DNMT3 A can comprise an amino acid sequence set forth in SEQ ID NO:41, or a fragment thereof. In an aspect, a disclosed encoded VRER-DNMT3 A can comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%,at least 80%, at least 85%, at least 90%, or at least 95% identity to the sequence set forth in SEQ ID NO:41, or a fragment thereof.

[0152] In an aspect, a disclosed encoded polypeptide can comprise transcription activation activity. In an aspect, a disclosed encoded polypeptide comprising transcription activation activity can comprise a transactivation domain. In an aspect, a disclosed transactivation domain can com-prise a VP16 protein, a series of linked VP16 proteins, a p65 domain of NFKB, or any combination thereof.

[0153] In an aspect, a disclosed encoded polypeptide can comprise transcription repression activity. In an aspect, a disclosed encoded polypeptide comprising transcription repression activity can comprise a Kriippel associated box domain, an ERF repressor domain, a MXI1 repressor domain, a SID4x repressor domain, a fused KRAB-MeCP2 domain, a MeCP2 TRD domain, a MAS-SID repressor domain, a TATA box binding protein activity, or any combination thereof. In an aspect, a disclosed encoded polypeptide comprising transcription repression activity can comprise HP1 repressor activity, MeCP2 repressor activity, MBD1 repressor activity, MBD2 repressor activity, MBD3 repressor activity, MBD4 repressor activity, KRAB repressor activity, SUV39H1 repressor activity, SUV39H2 repressor activity, CTCF insulator-repressor activity, LSD-1 histone-demethylase repressor activity, or any combination thereof.

[0154] In an aspect, a disclosed encoded polypeptide can comprise transcription release factor activity. In an aspect, a disclosed encoded polypeptide comprising transcription release factor activity can comprise Eukaryotic Release F actor 1 (ERF 1) activity or Eukaryotic Release F actor 3 (ERF 3) activity.

[0155] In an aspect, a disclosed encoded polypeptide can comprise histone modification activity. A histone modification may a covalent post-translational modification (PTM) to histone proteins which includes methylation, phosphorylation, acetylation, ubiquitylation, and SUMOyation. The PTMs made to histones can impact gene expression by altering chromatin structure or recruiting histone modifiers. Histones act to package DNA, which wraps around eight histones, into chromosomes. Histone modifications are involved in biological processes such as transcriptional activation / inactivation, chromosome packaging, and DNA damage / repair. In an aspect, a disclosed encoded polypeptide comprising histone modification activity can comprise histone acetyltransferase, histone deacetylase, histone demethylase, histone methyltransferase activity, or any combination thereof.

[0156] In an aspect, a disclosed encoded polypeptide can comprise nucleic acid association activity. In an aspect, a disclosed encoded polypeptide comprising nucleic acid association activity can comprise a helix-tum-helix region, a leucine zipper region, a winged helix region, a winged helix-tum-helix region, a helix-loop-helix region, an immunoglobulin fold, a B3 domain, a zinc finger, an HMG-box, a Wor3 domain, a TAL effector DNA-binding domain, or any combination thereof. In an aspect, a disclosed encoded polypeptide may comprise a nucleic acid binding protein- DNA-binding domain (DBD), or an independently folded protein domain that contains at least one motif that recognizes double- or single-stranded DNA. A DBD can recognize a specific DNA sequence (a recognition sequence) or have a general affinity to DNA.

[0157] In an aspect, a disclosed encoded polypeptide can comprise methyltransferase activity. In an aspect, a disclosed encoded polypeptide comprising methyltransferase activity can comprise DNA (cytosine-5)-m ethyltransferase 3a (DNMT3 A). In an aspect, a disclosed encoded polypeptide can comprise demethylase activity. In an aspect, a disclosed encoded polypeptide com-prising demethylase activity can comprise ten-eleven translocation methylcytosine dioxygenase 1 (TET1) or lysine-specific histone demethylase 1 (LSD1). In an aspect, a disclosed encoded polypeptide can comprise acetyltransferase activity. In an aspect, a disclosed encoded polypeptide comprising acetyltransferase activity can comprise histone acetyltransferase. In an aspect, a disclosed encoded polypeptide can comprise deacetylase activity. In an aspect, a disclosed encoded polypeptide comprising deacetylase activity can comprise histone deacetylase. i. Exemplary Combinations of dCas Endonucleases and Polypeptides Having Enzymatic Activity

[0158] In an aspect, a disclosed dCas endonuclease can comprise dSpCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl -CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, a disclosed dCas endonuclease can comprise dSaCas9 and a disclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination there-of, or any fusion thereof. In an aspect, a disclosed dCas endonuclease can comprise dCjCas9 and a disclosed polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NLPP1, the transcription repression domain (TRD) of Methyl- CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof. In an aspect, a disclosed dCas endonuclease can comprise dVQR, dEQR, or dVRER and adisclosed encoded polypeptide can comprise HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.

[0159] In an aspect, a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9, and a disclosed fusion can comprise HP la-HP la, HPla-HPlb, HPla-MBDl, HP la- MBD2, HPla-KRAB, HPla-NIPPl, HPla-MeCP2, HPla-DNMT3A, HPlb-HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb-MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1-KRAB, MBD1-NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2-KRAB, MBD2-NLPP1, MBD2-MeCP2, MBD2-DNMT3A, KRAB-KRAB, KRAB- HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB-NIPP1, KRAB-MeCP2, KRAB- DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1-MBD1, NLPP1-MBD2, NIPP1- KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2-MeCP2, MeCP2-HPla, MeCP2-HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2-DNMT3A, DNMT3A-DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A-MBD1, DNMT3A- MBD2, DNMT3A-KRAB, DNMT3A-NIPP1, or DNMT3A-MeCP2. In an aspect, a disclosed dCas endonuclease can comprise dSpCas9, dSaCas9, or dCjCas9 and a disclosed fusion can comprise KRAB-MeCP2. In an aspect, a disclosed dCas endonuclease can comprise dSaCas9, and a disclosed fusion can com-prise KRAB-MeCP2.

[0160] In an aspect, a nucleic acid can encode for a dCas endonuclease fused to the at least one encoded polypeptide having an enzymatic activity. In these or related aspects, the nucleic acid can encode for a “fusion protein” wherein the fusion protein comprises a first com-ponent comprising a dCas endonuclease and a second component comprising at least one polypeptide having an enzymatic activity. In an aspect, the encoded fusion protein can comprise a dSpCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel- associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof. In an aspect, the encoded fusion protein can comprise a dSaCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NLPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination thereof, or any fusion thereof. In an aspect, the encoded fusion protein can comprise a dCjCas9 and a polypeptide having enzymatic activity comprising HPla, HPlb, MBD1, MBD2, Kriippel-associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3A, any combination there-of, or anyfusion thereof. In an aspect, the encoded fusion protein can comprise dVQR, dEQR, or dVRER and a polypeptide having enzymatic activity comprising HP la, HP lb, MBD1, MBD2, Kriippel- associated box (KRAB), NIPP1, the transcription repression domain (TRD) of Methyl-CpG Binding Protein 2 (MeCP2), DNMT3 A, any combination thereof, or any fusion thereof.

[0161] In an aspect, the encoded fusion protein can comprise dSpCas9, dSaCas9, dCjCas9, or a variant dCas9 (e.g., dVQR, dEQR or dVRER) and one or more of HPla-HPla, HPla-HPlb, HPla-MBDl, HPla-MBD2, HPla-KRAB, HPla-NIPPl, HPla-MeCP2, HPla-DNMT3A, HPlb-HPlb, HPlb-HPla, HPlb-MBDl, HPlb-MBD2, HPlb-KRAB, HPlb-NIPPl, HPlb- MeCP2, HPlb-DNMT3A, MBD1-MBD1, MBDl-HPla, MBDl-HPlb, MBD1-MBD2, MBD1- KRAB, MBD1-NIPP1, MBDl-MeCP2, MBD1-DNMT3A, MBD2-MBD2, MBD2-HPla, MBD2-HPlb, MBD2-MBD1, MBD2-KRAB, MBD2-NIPP1, MBD2-MeCP2, MBD2- DNMT3A, KRAB-KRAB, KRAB-HPla, KRAB-HPlb, KRAB-MBD1, KRAB-MBD2, KRAB- NIPP1, KRAB-MeCP2, KRAB-DNMT3A, NIPPI-NIPPI, NIPPl-HPla, NIPPl-HPlb, NIPP1- MBD1, NIPP1-MBD2, NIPP1-KRAB, NIPPl-MeCP2, NIPP1-DNMT3A, MeCP2-MeCP2, MeCP2-HPla, MeCP2-HPlb, MeCP2-MBDl, MeCP2-MBD2, MeCP2-KRAB, MeCP2-NIPPl, MeCP2-DNMT3A, DNMT3A-DNMT3A, DNMT3A-HPla, DNMT3A-HPlb, DNMT3A- MBD1, DNMT3A-MBD2, DNMT3A-KRAB, DNMT3A-NIPP1, or DNMT3A-MeCP2. In an aspect, the encoded fusion protein can comprise a variant dCas9 selected from dVQR, dEQR, or dVRER and a fusion comprising KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and a fusion comprising KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dSaCas9 and KRAB-MeCP2. In an aspect, the encoded fusion protein can comprise a dCas9 selected from dSpCas9, dSaCas9, or dCjCas9 and DNMT3A. In an aspect, the encoded fusion protein can comprise a dSaCas9 and DNMT3 A. In an aspect, the encoded fusion protein can comprise a dSpCas9 and DNMT3A.

[0162] A polypeptide having enzymatic activity may comprise an amino acid sequence of, is encoded by a nucleic acid sequence of, or comprises a sequence extracted from any one of the sequences provided in TABLE 2 or TABLE 3, or a fragment thereof. d. gRNAs and Genes of Interest

[0163] In an aspect, a disclosed gene of interest or portion thereof can demonstrate a reduced expression and / or activity level when compared to wild-type or control expression level. In an aspect, a disclosed gRNA can target a gene of interest or portion thereof that demonstrates areduced expression and / or activity level when compared to wild-type or control expression level. In an aspect, a disclosed gene of interest or portion thereof can demonstrate an increased expression and / or activity level when compared to wild-type or control expression level. In an aspect, a disclosed gRNA can target a gene of interest or portion thereof that demonstrates increased expression and / or activity level when compared to wild-type or control expression level.

[0164] In an aspect, a disclosed gene of interest is a neurodegenerative disease (NDD) -relevant gene. A gene of interest (e.g., an NDD-relevant gene) can comprise a neuronal gene of interest implicated in a synucleinopathy or other neurodegenerative disease or disorder. In an aspect, a disclosed gene of interest can comprise SNCA, LRRK2, RAB8, or RAB10. In an aspect, a disclosed gene of interest can comprise SNCA. In an aspect, a disclosed gene of interest can comprise SNCA (UniProt ID: P37840), LRRK2 (UniProt ID: Q5S007), RAB8 (UniProt ID: P61026), RAB10 (UniProt ID: P61006) or any variant thereof, or any fragment thereof, or any portion thereof. In an aspect, a disclosed gene of interest can comprise SNCA (UniProt ID: P37840) or any variant thereof, or any fragment thereof, or any portion thereof.

[0165] In an aspect, the NDD-relevant gene targeted (e.g., by a gRNA) is selected from APOE, APP, ATXN2, CHMP2B, DCTN1, FIG4, FUS, GBA, GRN, HNRNPA1, HTT, LRRK2, MATR3, OPTN, PARK7, PFN1, PRPH, PSEN1, SETX, SIGMAR1, SNCA, SOD1, SPG11, SQSTM1, TARDBP, TBK1, TBP, TRPM7, TUBA4A, UBQLN2, UCHL1, VAPB, VCP, VPS35, a fragment thereof, a variant thereof, or a

[0166] In an aspect, a disclosed nucleic acid can comprise at least one gRNA that can target a gene of interest (e.g., an NDD-relevant gene) or portion thereof (e.g., a SNCA gene). In an aspect, a disclosed gRNA targeting a gene of interest or portion thereof can comprise at least two gRNAs. In an aspect, multiple gRNAs can target the same gene of interest or portion thereof. In an aspect, disclosed gRNAs can target different genes of interest or portions thereof. In an aspect, a disclosed gRNA can target a gene or portion thereof that demonstrates a loss of function. In an aspect, a disclosed gRNA can target a gene or portion thereof that demonstrates a gain of function.

[0167] In an aspect, a disclosed gRNA can target the SNCA gene. In an aspect, a disclosed gRNA can target the SNCA gene that encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:3. In an aspect, a disclosed SNCA gene can comprise the sequence set forth in SEQ ID NO:2. In an aspect, a disclosed SNCA gene can comprise the nucleic acid sequence that encodes the sequence set forth in SEQ ID NO:2. In an aspect, a disclosed gRNA can target thepromoter of the SNCA gene. In an aspect, a disclosed gRNA can target exon 1 of the SNCA gene. In an aspect, a disclosed SNCA gene can comprise the sequence set forth in SEQ ID NO: 2. In an aspect, a disclosed gRNA can target exon 1 of the SNCA gene. In an aspect, a disclosed gRNA can target intron 1 of the SNCA gene. In some embodiments, the intron 1 of the SNCA comprises the nucleic acid sequence of SEQ ID NO: 1. In an aspect, a disclosed gRNA can target intron 4 of the SNCA gene. In an aspect, a disclosed gRNA can target a CpG island region of intron 1 of the SNCA gene. The CpG island region can include CpGl, CpG2, CpG3, CpG4, CpG5, CpG6, CpG7, CpG8, CpG9, CpGlO, CpGl l, CpG12, CpG13, CpG14, CpG15, CpG16, CpG17, CpG18, CpG19, CpG20, CpG21, CpG22, CpG23, or a combination thereof. For example, the CpG island region can include CpGl, CpG3, CpG6, CpG7, CpG8, CpG9, CpG18, CpG19, CpG20, CpG21, CpG22, or a combination thereof. In an aspect, a disclosed gRNA targeting the SNCA gene can target the sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 or a sequence at least 90% identical thereto either.

[0168] In an aspect, a disclosed gRNA targeting the SNCA gene comprises any sequence set forth in any of SEQ ID NO: 64-68, or any SNCA gRNA that may be provided in any one of SEQ ID NOS: 1-141 or as referenced in TABLE 3, or a sequence at least 90% identical thereto each, or a complement thereof.

[0169] In an aspect, a disclosed gRNA can target a CMV promoter. In an aspect, a disclosed gRNA comprises any sequence set forth in any one of SEQ ID NO:31, 32, 36, 59-62.

[0170] In an aspect, a disclosed gRNA can target an open reading frame (e.g., of a GFP reporter system). In an aspect, a disclosed open reading frame can comprise the sequence set forth in SEQ ID NO: 43. In an aspect, a disclosed open reading frame can encode a polypeptide comprising the amino acid sequence of SEQ ID NO:44. In an aspect, a disclosed gRNA comprises any sequence set forth in SEQ ID NO:45 or SEQ ID NO:45.

[0171] In an aspect, a disclosed gRNA comprises any sequence set forth in any one of SEQ ID NO:55-58.

[0172] Disclosed herein is a guide RNA or gRNA comprising the sequence set forth in any one of SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, or any of the sequences shown in TABLE 1, or a sequence at least 90% identical thereto, or a complement thereof. Disclosed herein is a guide RNA or gRNA targeting a disclosed gene of interest or portion thereof. Examples of gRNAs are listed below in TABLE 1.TABLE 1: Listing of Exemplary gRNA Sequences

[0173] A PAM sequence for CjCas9 may comprise the nucleic acid sequence of NNNNRYAC wherein N = any amino acid. A PAM sequence for SaCas9 may comprise the nucleic acid sequence of NGRRT / N, wherein N = any amino acid.

[0174] As known to the art, a gRNA provides the targeting of a CRISPR / Cas9-based epigenome modifying system. A guide RNA is a specific RNA sequence that recognizes the target DNA region of interest (such as, for example, the SNCA gene) and directs the Cas endonuclease there for editing. The gRNA may comprise two parts: CRISPRRNA (crRNA), a 17-20 nucleotide sequence complementary to the target DNA, and a tracr RNA, which serves as a binding scaffold for the Cas nuclease. A guide RNA may target any desired DNA sequence byexchanging the sequence encoding a 20 hp protospacer which confers targeting specificity through complementary base pairing with the desired DNA target. Guide RNA mimics the naturally occurring crRNA: tracrRNA duplex involved in the Type II Effector system. This duplex, which may include, for example, a 42 -nucleotide crRNA and a 75- nucleotide tracrRNA, acts as a guide for the Cas9.

[0175] In some embodiments, the nucleic acid molecule comprises between one and ten different gRNA molecules. In some embodiments, the nucleic acid molecule comprises two or more gRNA molecules. In some embodiments, the presently disclosed epigenome modifying includes at least one gRNA, at least two different gRNAs, at least three different gRNAs, at least four different gRNAs, at least five different gRNAs, at least six different gRNAs, at least seven different gRNAs, at least eight different gRNAs, at least nine different gRNAs, or at least ten different gRNAs. In some embodiments, the composition comprises four different gRNAs.

[0176] In an aspect, a disclosed gRNA can serve to direct a disclosed CRISPR-based endonuclease (e.g., a Cas9 endonuclease or deactivated Cas9 endonuclease (e.g., dSpCas9, dSaCas9, or dCjCas9)) or a disclosed fusion product having a deactivated endonuclease to a target area of interest (such as, for example, an NDD-relevant gene, or the promoter of the SNCA gene or a targeted gene of interest as described herein). In an aspect, a disclosed gRNA can serve to direct a disclosed CRISPR-based endonuclease (e.g., a Cas9 endonuclease or deactivated Cas9 endonuclease (e.g., dSpCas9, dSaCas9, or dCjCas9)) or a disclosed fusion product having a disclosed deactivated endonuclease to a target area of interest (such as, for example, a gene having a loss of function). The gRNA may target and bind a target region of the SNCA gene. In some embodiments, the at least one gRNA targets the fusion protein to a target region within promoter of the SNCA gene.

[0177] A gRNA may comprise a nucleic acid sequence of a sequence extracted from any one of the sequences provided in TABLE 2 or TABLE 3. e. Additional Elements in Nucleic acid Molecules

[0178] In an aspect, a disclosed nucleic acid molecule can further comprise one or more regulatory elements (i.e., promoters) in addition to the neuron specific regulatory element (e.g., neuron specific promoter). In an aspect, a disclosed additional regulatory element can comprise a U6 promoter, optionally a mini U6 promoter, a chicken P-actin promoter, an EF-la, a CMV promoter, a CMV promoter / enhancer, a fragment thereof a derivative thereof, or any combination thereof.

[0179] In an aspect, a disclosed U6 promoter can comprise the sequence set forth inSEQ ID NO:49 or a fragment thereof. In an aspect, a disclosed U6 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO:49 or a fragment thereof. In an aspect, a disclosed mini U6 promoter can comprise the sequence set forth in SEQ ID NO:50 or a fragment thereof. In an aspect, a disclosed mini U6 promoter can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO:50 or a fragment thereof.

[0180] In an aspect, a disclosed additional regulatory element can comprise a Woodchuck Hepatitis Virus (WHP) Post-Transcriptional Regulatory Element (WPRE), which is a DNA sequence that when transcribed creates a tertiary structure enhancing expression. In an aspect, a disclosed WPRE can comprise the sequence set forth in SEQ ID NO:54 or a fragment thereof. In an aspect, a disclosed WPRE can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO:54 or a fragment thereof.

[0181] In an aspect, a disclosed additional regulatory element can comprise a CMV enhancer. In an aspect, a disclosed CMV enhancer can comprise the sequence set forth in SEQ ID NO:63 or a fragment thereof. In an aspect, a disclosed WPRE can comprise a sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 63 or a fragment thereof.

[0182] In an aspect, a disclosed promoter operably can be linked to the at least one guide RNA targeting a gene of interest or portion thereof. In an aspect, a disclosed promoter operably linked to the at least one guide RNA can comprise a U6 promoter, a fragment thereof, or a derivative thereof. In an aspect, a disclosed promoter operably linked to the at least one guide RNA targeting an SNCA gene can comprise a U6 promoter, a fragment thereof, or a derivative thereof.

[0183] In an aspect, a disclosed nucleic acid molecule can further two or more promoters, wherein a first promoter can be operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest or portion thereof. In an aspect, a disclosed nucleic acidmolecule can further comprise one or more promoters, wherein a first promoter com-prises a neuron specific promoter that is operably linked to the dCas endonuclease, a polypeptide having enzymatic activity, a fusion of two or more polypeptides having enzymatic activities or any combination thereof, and wherein a second promoter can be operably linked to the at least one guide RNA targeting a gene of interest thereof. In an aspect, the second promoter operably linked to the gRNA may not be a neuron specific promoter. In an aspect, the nucleic acid can comprise a first promoter selected from a TH promoter, a F0XA2 promoter, a ChAT promoter, or a Nkx2.1 promoter, a fragment thereof, or a derivative thereof and a second promoter comprising a U6 promoter, a fragment thereof, or a derivative thereof.

[0184] In an aspect, a disclosed nucleic acid molecule can further comprise one or more additional regulatory elements. In an aspect, a disclosed additional regulatory element can comprise a promoter (described supra), an enhancer, a promoter / enhancer, an internal ribosomal entry site, a transcription terminal signal, a polyadenylation signal, a Spl and / or NF -kB transcriptional factor binding site, a p2A signal, a woodchuck hepatitis virus post-transcriptional regulatory element, a Phi signal-packaging signal, a rev responsive element, a 5’-LTR, a 3’- LTR, an inverted terminal repeat, a nuclear localization signal (NLS), or any combination thereof.

[0185] In an aspect, a disclosed nucleic acid sequence can be CpG depleted and codon- optimized for expression in a human cell. In an aspect, “CpG-free” can mean completely free of CpGs or partially free of CpGs. In an aspect, “CpG-free” can mean “CpG-depleted”. In an aspect, “CpG-depleted” can mean “CpG-free”. In an aspect, “CpG-depleted” can mean completely depleted of CpGs or partially depleted of CpGs. In an aspect, “CpG-free” can mean “CpG-optimized” for a desired and / or ideal expression level. CpG depletion and / or optimization is known to the skilled person in the art. In an aspect, any disclosed Cas9 endonuclease, a disclosed polypeptide having enzymatic activities, a disclosed fusion product or a disclosed fusion protein, or any combination thereof can be codon optimized.

[0186] In an aspect, a disclosed nucleic acid molecule can comprise a sequence that is about 4.5 kilobases or less than about 4.5 kilobases.

[0187] An additional element in a nucleic acid molecule may comprise an amino acid sequence of, is encoded by a nucleic acid sequence of, or comprises a sequence extracted from any one of the sequences provided in TABLE 2 or TABLE 3, or a fragment thereof.4. Vectors

[0188] The present disclosure provides for a vector comprising a nucleic acid molecule as described herein (e.g., a TH promoter or engineered TH promoter). In an aspect a vector comprises (a) a nucleic acid sequence encoding a CRISPR-based endonuclease; (b) a nucleic acid sequence encoding one or more polypeptide having an enzymatic activity; (c) a nucleic acid sequence of one or more guide RNA targeting (i) a neurodegenerative disease (NDD)-relevant gene; (ii) a promoter region of the NDD-relevant gene; (iii) an intron of the NDD-relevant gene or flanking sequence thereof; (iv) an untranslated region (UTR) of the NDD-relevant gene; (v) or any combination thereof, and (d) one or more neuron specific regulatory element operably linked to the CRISPR-based endonuclease and / or the one or more polypeptide having an enzymatic activity, wherein the one or more neuron specific regulatory element comprises an engineered TH promoter as described herein.

[0189] In an aspect, the genetic construct is a vector (e.g., a cloning vector, expression vector, or viral vector). The vector may be a plasmid. The vectors can be used for in vivo gene therapy, for example treating a synucleinopathy or neurological disease or disorder, particularly wherein targeted therapy using a TH promoter is beneficial. The vector may be recombinant. The vector may comprise heterologous nucleic acid encoding the Cas fusion protein. The vector may be useful for transfecting cells with a nucleic acid encoding the Cas fusion protein, which the transformed host cell is cultured and maintained under conditions wherein expression of the Cas fusion protein takes place.

[0190] Coding sequences may be optimized for stability and high levels of expression. In some instances, codons are selected to reduce secondary structure formation of the RNA such as that formed due to intramolecular bonding.

[0191] The initiation and termination codon may be in frame with the coding sequence. The vector may also comprise a promoter that is operably linked to the coding sequence. The promoter that is operably linked to the coding sequence may be a promoter from simian virus 40 (S V40), a mouse mammary tumor virus (MMTV) promoter, a human immunodeficiency virus (HIV) promoter such as the bovine immunodeficiency vims (BIV) long terminal repeat (LTR) promoter, a Moloney virus promoter, an avian leukosis virus (ALV) promoter, a cytomegalovirus (CJVIV) promoter such as the CMV immediate early promoter or hCM V, Epstein Barr virus (EBV) promoter, a EFS promoter, a 1 J6 promoter, such as the human U6 promoter (smU6 or hU6), or a Rous sarcoma virus (RSV) promoter. The promoter may also be a promoter from a human gene such as human ubiquitin C (hUbC), human actin, human myosin, human haemoglobin, human muscle creatine, or human metallothionein. The promoter may also be a tissue specific promoter, such as a muscle or skin specific promoter, natural or synthetic.Examples of such promoters are described in US Patent Application Publication Nos. US20040175727 and US20040192593, the contents of which are incorporated herein in their entirety. Examples of muscle-specific promoters include a Spc5-12 promoter (described in US Patent Application Publication No. US 20040192593, which is incorporated by reference herein in its entirety; Hakim et al. Mol. Ther. Methods Clin. Dev. (2014) 1 : 14002; and Lai et al. Hum Mol Genet (2014) 23(12): 3189-3199), a rvfHCK7 promoter (described in Salva et al, Mol. Ther (2007) 15:320-329), a CK8 promoter (described in Park et al. PLoS One (2015) 10(4): e0124914), and a CKSe promoter (described in :Muir et al., Mol. Ther. Methods Clin. Dev. (2014) 1 : 14025). In some embodiments, the expression of the composition for epigenome modification of a SNCA gene is driven by tRNAs. In some embodiments, the at least one Mi crol -specific regulatory element comprises the ChAT / Nkx2.1 promoter, or a portion or fragment thereof. In another embodiment, the Mi crol -specific regulatory element comprises the TH / FOXA2 promoter, or a portion or fragment thereof.

[0192] Each of the polynucleotide sequences encoding the gRNA molecule and / or Cas fusion protein molecule may each be operably linked to a promoter. The promoters that are operably linked to the gRNA molecule and / or Cas fusion protein molecule may be the same promoter. The promoters that are operably linked to the gRNA molecule and / or Cas fusion protein molecule may be different promoters. The promoter may be a constitutive promoter, an inducible promoter, a repressible promoter, or a regulatable promoter.

[0193] The vector may also comprise a polyadenylation signal, which may be downstream of the coding sequence. The polyadenylation signal may be a SV40 polyadenylation signal, LTR polyadenylation signal, bovine growth hormone (bGH) polyadenylation signal, human growth hormone (hGH) polyadenylation signal, or human p-globin polyadenylation signal. The SV40 polyadenylation signal may be a polyadenylation signal from a pCEP4 vector (Invitrogen, San Diego, CA).

[0194] The vector may also comprise an enhancer upstream of the coding sequence. The enhancer may be necessary for DNA expression. The enhancer may be human actin, human myosin, human hemoglobin, human muscle creatine or a viral enhancer such as one from CMV, HA, RSV or EBV. Polynucleotide function enhancers are described in U.S. Patent Nos. 5,593,972, 5,962,428, and WO94 / 016737, the contents of each are fully incorporated by reference. The vector may also comprise a mammalian origin of replication in order to maintain the vector extrachromosomally and produce multiple copies of the vector in a cell. The vector may also comprise a regulatory sequence, which may be well suited for gene expression in a mammalian or human cell into which the vector is administered. The vector may also comprisea reporter gene, such as green fluorescent protein ("GFP") and / or a selectable marker, such as hygromycin ("Hygro").

[0195] The vector may be expression vectors or systems to produce protein by routine techniques and readily available starting materials including Sambrook et al., Molecular Cloning and Laboratory Manual, Second Ed., Cold Spring Harbor (1989), which is incorporated fully by reference. In some embodiments, the vector may comprise the nucleic acid sequence encoding the composition for epigenome modification of a SNCA gene, including the nucleic acid sequence encoding the Cas fusion protein as provided in Appendix B and the nucleic acid sequence encoding the at least one gRNA comprising the nucleic acid sequence of at least one of SEQ ID NOs found in TABLE 3, or complement thereof, and a microglial cell-type specific promoter as provided in at least one of SEQ ID NOs found in TABLE 3 or a complement thereof.

[0196] The nucleic acid molecule or the vector comprising the nucleic acid molecule may be introduced into a host cell. Methods of introducing a nucleic acid into a host cell are known in the art, and any known method can be used to introduce a nucleic acid (e.g., an expression construct) into a cell. Suitable methods include, include e.g., viral or bacteriophage infection, transfection, conjugation, protoplast fusion, polycation or lipidmucleic acid conjugates, lipofection, electroporation, nucleofection, immunoliposomes, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome- mediated transfection, particle gun technology, calcium phosphate precipitation, direct micro injection, nanoparticle-mediated nucleic acid delivery, and the like. In some embodiments, the composition may be introduced by mRNA delivery and ribonucleoprotein (RNP) complex delivery. a. Viral Vectors

[0197] Disclosed herein is a viral vector comprising a nucleic acid molecule as described herein. In an aspect a viral vector comprises (a) a nucleic acid sequence encoding a CRISPR-based endonuclease; (b) a nucleic acid sequence encoding one or more polypeptide having an enzymatic activity; (c) a nucleic acid sequence of one or more guide RNA targeting (i) a neurodeg enerative disease (NDD)-relevant gene; (ii) a promoter region of the NDD-relevant gene; (iii) an intron of the NDD-relevant gene or flanking sequence thereof; (iv) an untranslated region (UTR) of the NDD-relevant gene; (v) or any combination thereof, and (d) one or more neuron specific regulatory element operably linked to the CRISPR-based endonuclease and / orthe one or more polypeptide having an enzymatic activity, wherein the one or more neuron specific regulatory element comprises an engineered TH promoter as described herein.

[0198] In an aspect, a disclosed viral vector can be an adenovirus vector, an AAV vector, a herpes simplex virus vector, a retrovirus vector, a lentivirus vector, and alphavirus vector, a flavivirus vector, a rhabdovirus vector, a measles virus vector, a Newcastle disease viral vector, a poxvirus vector, or a picomavirus vector. In an aspect, a disclosed viral vector can be a lentiviral vector. In an aspect, a disclosed viral vector can be an AAV vector

[0199] In an aspect, a disclosed viral vector may be selected from an adeno-associated virus- derived viral vector (AAV vector), adenovirus-derived viral vector (AV vector), lentivirus- derived viral vector (LV vector), Moloney murine leukemia virus-derived viral vector (MMLV vector), murine stem cell virus-derived viral vector (MSCV vector), baculovirus-derived viral vector (BV vector), vesicular stomatitis virus-derived viral vector (VSV vector), herpes simplex virus-derived viral vector (HSV vector), vaccinia virus-derived viral vector (VV vector), or a retrovirus-derived viral vector (RV vector). In an aspect, a disclosed viral vector can be a lentiviral vector. In an aspect, a disclosed viral vector can be an AAV vector.

[0200] The nucleic acid construct may be a genetic construct, such as a recombinant plasmid or recombinant viral particle, and may comprise a nucleic acid that encodes a Cas fusion protein and at least one gRNA. In some embodiments, the genetic construct may comprise a nucleic acid that encodes the Cas fusion protein and at least two different gRNAs. In some embodiments, the genetic construct may comprise a nucleic acid that encodes the Cas fusion protein and more than two different gRNAs. In some embodiments, the present disclosure includes a nucleic acid molecule encoding a disclosed composition for epigenome modification of a SNCA gene. The nucleic acid molecule may encode the Cas fusion protein and at least one gRNA.

[0201] In some embodiments, the genetic construct may comprise a promoter that is operably linked to the nucleotide sequence encoding the at least one gRNA molecule and / or a Cas fusion protein molecule. In some embodiments, the promoter is operably linked to the nucleotide sequence encoding two or more gRNA molecules and / or a Cas fusion protein molecule. The genetic construct may be present in the cell as a functioning extrachromosomal molecule. The genetic construct may be a linear minichromosome including centromere, telomeres or plasmids or cosmids.

[0202] The genetic construct may also be part of a genome of a recombinant viral vector, including recombinant lentivirus, recombinant adenovirus, and recombinant adenovirusassociated virus. The genetic construct may be part of the genetic material in attenuated live microorganisms or recombinant microbial vectors which live in cells. The genetic constructs may comprise regulatory elements for gene expression of the coding sequences of the nucleic acid. The regulatory elements may be a promoter, an enhancer, an initiation codon, a stop codon, or a polyadenylation signal.

[0203] In an aspect, a disclosed viral vector or plasmid can treat and / or prevent a synucleinopathy (or progression thereof). In an aspect, a disclosed viral vector or plasmid can treat and / or prevent an SNCA associated disease or disorder (or progression thereof). In an aspect, a disclosed viral vector or disclosed plasmid can treat and / or prevent Parkinson’s disease (PD) (or progression thereof). In an aspect, a disclosed viral vector or disclosed plasmid can treat and / or prevent dementia with Lewy bodies (DLB) (or progression thereof). i. Lentiviral Vector

[0204] CRISPR-JdCas9 systems have the potential to revolutionize the field of epigenetics by enabling direct manipulation of specific regulatory sequences and epigenetic marks. The technology offers the unprecedented opportunity to fine-tune a particular epigenetic mark and correcting disease-associated expression aberrations. However, to achieve an effective epigenome directed modifications, stable transduction of the dCas9-effector tool is often necessary, in particular, when applied to primary cells or iPSCs. Delivery platform based on lentiviral vectors (1 Vs) is feasible and highly efficient for CRISPR / Cas9 components due to their ability to accommodate large DNA payloads and efficiently and stably transduce a wide range of dividing and non-dividing cells. LVs also display low cytotoxicity and immunogenicity and have a minimal impact on the life cycle of the transduced cells. Herein, an optimized all-in-one lentiviral vectors was adopted for highly efficient delivery of CRISPR / dCas9-DNMT3 A components. In some embodiments, the vector may be a lentiviral vector.

[0205] The large packaging capacity of lentiviral vectors, a commonly used method to stably deliver CRISPR / Cas9 components in vitro, can accommodate the 4.2 kb S. pyogenes Cas9, epigenetic modulator fusions, a single gRNA, and associated regulatory elements required for expression. In some embodiments, the lentiviral vector may comprise the nucleic acid sequence encoding the composition for epigenome modification of a SNCA gene, including the nucleic acid sequence encoding a dCas9-KRAB-MECP2 fusion protein and the nucleic acid sequence encoding the at least one gRNA comprising a nucleic acid sequence as shown in TABLE XX, orcomplement thereof, wherein in an aspect, the nucleic acid sequence encoding the dCas9- KRAB-MECP2 fusion protein is operably linked to a neuron specific regulatory element.

[0206] In an aspect, a disclosed lentiviral vector may be a modified lentiviral vector. For example, the lentiviral vector may be modified to increase vector titer. In an aspect, the viral vector may be an episomal integrase -deficient lentiviral vector (IDLV). The IDLV may comprise the nucleic acid sequence encoding the composition for epigenome modification of an SNCA gene, including the nucleic acid sequence encoding a dCas9-KRAB-MECP2 fusion protein and the nucleic acid sequence encoding the at least one gRNA comprising a nucleic acid sequence as shown in TABLE 1, or complement thereof, wherein in an aspect, the nucleic acid sequence encoding the dCas9-KRAB-MECP2 fusion protein is operably linked to a neuron specific regulatory element.

[0207] Episomal integrase-deficient lentiviral vectors (IDLVs) are an ideal platform for delivery of large genetic cargos where only transient expression of the transgene is desired. IDLVs retain residual (integrase-independent and illegitimate) integration rates ofA0.2%-0.5% (one integration event per 200-500 transduced cells), which could be further reduced by packaging a novel 3g polypurine tract (PPT)-deleted lentiviral vector into integrase-deficient particles. While efficacious for in vitro delivery, under certain circumstances, lentiviral delivery is typically not suitable for in vivo gene regulation due to concerns for insertional mutagenesis. In contrast, the IDLV may display lower capacity to induce off-target mutations than other lentiviral vectors.

[0208] In an aspect, a disclosed lentiviral vector may comprise an episomal integrase-competent lentiviral vector (ICLV). The ICLV may comprise the nucleic acid sequence encoding the composition for epigenome modification of a SNCA gene including the nucleic acid sequence encoding a dCas9-KRAB-MECP2 fusion protein and the nucleic acid sequence encoding the at least one gRNA comprising a nucleic acid sequence as shown in TABLE 1, or complement thereof, wherein in an aspect, the nucleic acid sequence encoding the dCas9-KRAB-MECP2 fusion protein is operably linked to a neuron specific regulatory element.

[0209] In an aspect, a disclosed lentiviral vector may include an episomal integrase-deficient lentiviral vector (IDLV). The IDLV may comprise the nucleic acid sequence encoding the composition for epigenome modification of a SNCA gene including the nucleic acid sequence encoding a dCas9-KRAB-MECP2 fusion protein and the nucleic acid sequence encoding the at least one gRNA comprising a nucleic acid sequence as shown in TABLE 1, or complement thereof, wherein in an aspect, the nucleic acid sequence encoding the dCas9-KRAB-MECP2 fusion protein is operably linked to a neuron specific regulatory element.ii. Adeno-Associated Virus Vectors

[0210] In certain embodiments, the vector is an adeno-associated virus (AAV) vector. The AAV vector is a small virus belonging to the genus Dependovirus of the Parvoviridae family that infects humans and some other primate species. AAV vectors may be used to deliver the composition for epigenome modification of a SNCA gene using various construct configurations. For example, AAV vectors may deliver Cas fusion protein and gRNA expression cassettes on separate vectors or on the same vector. Alternatively, if the small Cas9 proteins, derived from species such as Staphylococcus aureus o Neisseria meningitidis or Campylobacter jejuni are used then both the Cas fusion protein and up to two gRNA expression cassettes may be combined in a single AAV vector within the 4.7 kb packaging limit.

[0211] In certain aspects, the AAV vector is a modified AAV vector. For example, the modified AAV vector may be an AAV-SASTG vector (Piacentino et al. (2012) Human Gene Therapy 23:635-646). The modified AAV vector may deliver nucleases to skeletal and cardiac muscle in vivo. The modified AAV vector may be based on one or more of several capsid types, including AAV1, AAV2, AAV5, AAV6, AAV8, and AAV9. The modified AAV vector may be based on AAV2 pseudotype with alternative muscle-tropic AAV capsids, such as AAV2 / 1, AAV2 / 6, AAV2 / 7, AAV2 / 8, AAV2 / 9, AAV2.5 and AAV / SASTG vectors that efficiently transduce skeletal muscle or cardiac muscle by systemic and local delivery (Seto et al. Current Gene Therapy (2012) 12: 139-151). The modified AAV vector may be AAV2i8G9 (Shen et al. J. Biol. Chem. (2013) 288:28814-28823)

[0212] In an aspect, a disclosed AAV vector (e.g., a recombinant AAV vector) can include naturally isolated serotypes including, but not limited to, AAV1, AAV2, AAV3 (including 3a and 3b), AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV13, AAVrh39, AAVrh43, AAVcy.7 as well as bovine AAV, caprine AAV, canine AAV, equine AAV, ovine AAV, avian AAV, primate AAV, non-primate AAV, and any other virus classified by the International Committee on Taxonomy of Viruses (ICTV) as an AAV. In an aspect, an AAV capsid can be a chimera either created by capsid evolution or by rational capsid engineering from a naturally isolated AAV variants to capture desirable serotype features such as enhanced or specific tissue tropism and / or a host immune response escape. Naturally isolated AAV variants include, but not limited to, AAV-DJ, AAV-HAE1, AAV-HAE2, AAVM41, AAV-1829, AAV2 Y / F, AAV2 T / V, AAV2i8, AAV2.5, AAV9.45, AAV9.61, AAV- Bl, AAV-AS, AAV9.45A-String (e.g., AAV9.45-AS), AAV9.45Angiopep, AAV9.47- Angiopep, and AAV9.47-AS, AAV-PHP.B, AAV-PHP.eB, AAV-PHP.S, AAV-F, AAVcc.47, and AAVcc.81. In an aspect, a disclosed AAV vector can be AAV-Rh74 or a related variant(e.g., capsid variants like RHM4-1). In an aspect, a disclosed AAV vector can be AAV8. In an aspect, a dis-closed AAV vector (e.g., a recombinant AAV vector) can be AAVhum.8. In an aspect, a dis-closed AAV vector (e.g., a recombinant AAV vector) can be AAV9.

[0213] In an aspect, an AAV vector is a vector disclosed herein comprising a TH promoter or an engineered TH promoter. In some embodiments, an AAV vector comprises the nucleic acid sequence set forth in SEQ ID NO:77; SEQ ID NO: 112; SEQ ID NO: 116; SEQ ID NO: 117;SEQ ID NO: 118; SEQ ID NO: 121; SEQ ID NO: 122; SEQ ID NO: 123; SEQ ID NO: 124;SEQ ID NO: 125, or a sequence set forth in TABLE 2, or a nucleic acid sequence having reverse complementarity to thereto, or functional fragments thereof. In some embodiments, an AAV vector comprises a nucleic acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO: 77; SEQ ID NO: 112; SEQ ID NO: 116; SEQ ID NO: 117;SEQ ID NO: 118; SEQ ID NO: 121; SEQ ID NO: 122; SEQ ID NO: 123; SEQ ID NO: 124;SEQ ID NO: 125, or a sequence set forth in TABLE 2, or a nucleic acid sequence having reverse complementarity to thereto, or functional fragments thereof.TABLE 2: Exemplary AAV Vectors Comprising Engineered TH Promoters

[0214] TABLE 2 above shows constructed vectors having engineered TH promoters or that were used in the development thereof. It is contemplated that any aspect or feature of any of the individual vectors of TABLE 2 (or any positive or negative directional strand complementary thereto) may be used in part or totality for an aspect of the engineered TH promoter, the nucleic acid molecule, the vector, the viral vector, the host cell, the composition, the pharmaceutical composition, any of the methods, or the means for modulating a dopaminergic neuron, each of which are described herein, comprising the engineered TH promoter as described herein. In other words, the vectors shown in TABLE 2 may annotated by a skilled artisan and its features implemented into any aspect of the invention as describe herein. b. Plasmid Vectors

[0215] Disclosed herein is a plasmid comprising a disclosed nucleic acid molecule. In an aspect of a disclosed plasmid, a disclosed nucleic acid molecule comprises one or more neuron specific regulatory elements. In an aspect, the one or more neuron specific regulatory elements can comprise a neuron specific wild-type promoter, a neuron specific enhancer, a synthetic promoter, a synthetic enhancer, a transcriptional or translational regulatory sequence or any combination thereof. In an aspect, the one or more neuron specific regulatory elements comprise at least one neuron specific promoter (e.g., a neuron specific wild-type promoter or a neuron specific synthetic promoter). In an aspect, the neuron specific regulatory element (e.g., promoter) may be specific for a certain type of neuron (e.g., a dopaminergic or a cholinergic neuron). In these instances, the neuron specific regulatory element may include a dopaminergic specific regulatory element (i.e., a dopaminergic promoter) and / or a cholinergic neuron specific regulatory element (i.e., a cholinergic promoter). In an aspect, the neuron specific regulatory element can comprise a neuron specific promoter. In an aspect, a disclosed neuron specific promoter can comprise a TH promoter, a FOXA2 promoter, a ChAT promoter, a Nkx2.1 promoter, a fragment, or any combination thereof. In an aspect, a disclosed dopaminergic promoter can comprise a TH promoter, a FOXA2 promoter, a fragment, or any combination thereof. In an aspect, a disclosed cholinergic promoter can comprise a ChAT promoter, a Nkx2.1 promoter, a fragment, or any combination thereof.

[0216] In an aspect of a disclosed plasmid, a disclosed encoded polypeptide can comprise transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, or any combination thereof.

[0217] In an aspect of a disclosed plasmid, a disclosed gene of interest or portion thereof can demonstrate a reduced expression level when compared to wild-type or control expression level. In an aspect of a disclosed plasmid, a disclosed gRNA can targes a gene of interest or portion thereof that demonstrates a reduced expression level when compared to wild-type or control expression level.

[0218] In an aspect of a disclosed plasmid, a disclosed gene of interest or portion thereof can demonstrate an increased expression level when compared to wild-type or control expression level. In an aspect of a disclosed plasmid, a disclosed gRNA can target a gene of interest or portion thereof that demonstrates an increased expression level when compared to wild-type or control expression level. In an aspect of a disclosed plasmid, a disclosed gRNA targeting a gene of interest or portion thereof can comprise at least two gRNAs. In an aspect of a disclosed plasmid, disclosed gRNAs can target the same gene of interest or portion thereof. In an aspect of a disclosed plasmid, dis-closed gRNAs can target different genes of interest or portions thereof. In an aspect of a disclosed plasmid, a disclosed gRNA can target a gene or portion thereof that demonstrates a loss of function. In an aspect of a disclosed plasmid, a disclosed gRNA can tar-get a gene or portion thereof that demonstrates a gain of function. Disclosed target genes and disclosed genes of interest are discussed supra.5. Host Cells

[0219] The present disclosure provides for a host cell or a host cell line comprising a nucleic acid molecule as described herein. In an aspect a vector comprises (a) a nucleic acid sequence encoding a CRISPR-based endonuclease; (b) a nucleic acid sequence encoding one or more polypeptide having an enzymatic activity; (c) a nucleic acid sequence of one or more guide RNA targeting (i) a neurodegenerative disease (NDD) -relevant gene; (ii) a promoter region of the NDD-relevant gene; (iii) an intron of the NDD-relevant gene or flanking sequence thereof; (iv) an untranslated region (UTR) of the NDD-relevant gene; (v) or any combination thereof, and (d) one or more neuron specific regulatory element operably linked to the CRISPR-based endonuclease and / or the one or more polypeptide having an enzymatic activity, wherein the one or more neuron specific regulatory element comprises an engineered TH promoter as described herein.

[0220] The host cell may be a transfected cell (e.g., transfected with a viral vector as described herein). The host cell may be a transformed cell (e.g., transformed with a nucleic acid molecule as described herein).6. Pharmaceutical Compositions

[0221] The present disclosure provides for pharmaceutical compositions comprising, consisting of, or consisting essentially of an engineered TH promoter, nucleic acid molecule, vector, viral vector, host cell, or composition as described herein, and a pharmaceutically acceptable carrier, diluent and / or excipient.

[0222] The pharmaceutical composition may comprise about 1 ng to about 10 mg of total nucleic acid. The pharmaceutical compositions according to the present disclosure are formulated according to the mode of administration to be used. In cases where pharmaceutical compositions are injectable pharmaceutical compositions, they are sterile, pyrogen free and particulate free. An isotonic formulation is preferably used. Generally, additives for isotonicity may include sodium chloride, dextrose, mannitol, sorbitol and lactose. In some cases, isotonic solutions such as phosphate buffered saline are preferred. Stabilizers include gelatine and albumin. In some embodiments, a vasoconstriction agent is added to the formulation.

[0223] The pharmaceutically acceptable excipient may be functional molecules as vehicles, adjuvants, carriers, or diluents. The method of administration will dictate the type of carrier to be used. Any suitable pharmaceutically acceptable excipient for the desired method of administration may be used. The pharmaceutically acceptable excipient may be a transfection facilitating agent The transfection facilitating agent may include surface active agents, such as immune-stimulating complexes (ISCOMS), Freund’s incomplete adjuvant, LPS analogue including monophosphoryl lipid A, muramyl peptides, quinone analogues, vesicles such as squalene and squalene, hyaluronic acid, lipids, liposomes, calcium ions, viral proteins, polyanions, polycations, or nanoparticles, or other known transfection facilitating agents. The transfection facilitating agent may be a polyanion, polycation, including poly-L-glutamate (LGS), or lipid. The transfection facilitating agent may be poly-L-glutamate. The poly-L- glutamate may be present in the pharmaceutical composition at a concentration less than 6 mg / mL. The pharmaceutical composition may include transfection facilitating agents such as lipids, liposomes, including lecithin liposomes or other liposomes known in the art, as a DNA- liposome mixture (see for example W09324640), calcium ions, viral proteins, polyanions, polycations, or nanoparticles, or other known transfection facilitating agents. Preferably, the transfection facilitating agent is a polyanion, polycation, including poly- L-glutamate (LGS), or lipid.

[0224] In an aspect, a disclosed formulation can comprise (i) one or more active agents, (ii) biologically active agents, (iii) one or more pharmaceutically active agents, (iv) one or more immune-based therapeutic agents, (v) one or more clinically approved agents, or (vi) a combination thereof. In an aspect, a disclosed composition can comprise one or moreproteasome inhibitors. In an aspect, a disclosed composition can comprise one or more immunosuppressives or immunosuppressive agents. In an aspect, an immunosuppressive agent can be anti -thymocyte globulin (ATG), cyclosporine (CSP), mycophenolate mofetil (MMF), or a combination thereof. In an aspect, a disclosed formulation can comprise an RNA therapeutic. An RNA therapeutic can comprise RNA-mediated interference (RNAi) and / or antisense oligonucleotides (ASO). In an aspect, a disclosed formulation can comprise a disclosed small molecule.

[0225] In an aspect, a disclosed pharmaceutical formulation can treat and / or prevent progression of a neurological disease or disorder as described herein. In an aspect, a disclosed pharmaceutical formulation can treat and / or prevent progression of a synucleinopathy. In an aspect, a disclosed pharmaceutical formulation can treat and / or prevent progression of an SNCA associated disease disorder. In an aspect, a disclosed pharmaceutical formulation can treat and / or prevent Parkinson’s disease (PD) progression. In an aspect, a disclosed pharmaceutical formulation can treat and / or prevent progression of dementia with Lewy Bodies (DLB).7. Cell Types

[0226] Any of these delivery methods and / or routes of administration can be utilized, with a myriad of cell types, for example, including, but not limited to eukaryotic cells or prokaryotic cells. In some embodiments, the eukaryotic cell can be any eukaryotic cell from any eukaryotic organism. Non-limiting examples of eukaryotic organisms include mammals, insects, amphibians, reptiles, birds, fish, fungi, plants, and / or nematodes. In some embodiments, the cell is a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is a neuronal cell. For example, the cell may be a midbrain dopaminergic neuron (mDA). The cell may be a basal forebrain cholinergic neuron (BFCN). In other embodiments, the cell may be a neural progenitor cell. For example, the cell may be a dopaminergic (ventral midbrain) Neural Progenitor Cell (MD NPC). The cell may comprise a mutation in the SNCA gene. The cell may be a human induced Pluripotent Stem Cell (hiPSC).8. Compositions and Uses

[0227] The present disclosure provides for compositions comprising TH promoters (e.g., engineered TH promoters) as described herein and their and uses for targeting the SNCA gene in specific neuronal populations to allow for targeted, tailored, control of synuclein expression in different regions to allow for improved treatment of neurological diseases or disorders (e.g., SNCA-related or synucleinopathy diseases or disorders).

[0228] The present disclosure provides for a composition comprising (a) a recombinant CRISPR-based endonuclease; (b) one or more recombinant polypeptide having an enzymatic activity, wherein the CRISPR-based endonuclease and the one or more polypeptides are recombinantly expressed using a TH promoter (e.g., engineered TH promoter) as described herein, and optionally (c) one or more guide RNA targeting (i) a neurodegenerative disease (NDD) -relevant gene; (ii) a promoter region of the NDD-relevant gene; (iii) an intron of the NDD-relevant gene or flanking sequence thereof; (iv) an untranslated region (UTR) of the NDD-relevant gene; or (v) or any combination thereof.

[0229] The present disclosure provides for a means for modulating a dopaminergic neuron, comprising (a) an engineered TH promoter as described herein; (b) a nucleic acid molecule comprising an engineered TH promoter as described herein; (c) a vector comprising an engineered TH promoter as described herein; (d) a viral vector comprising an engineered TH promoter as described herein; (e) a host cell comprising an engineered TH promoter as described herein; (f) a composition comprising an engineered TH promoter as described herein; or (g) a pharmaceutical composition comprising an engineered TH promoter as described herein.

[0230] The present disclosure provides for a method of effecting genetic or epigenetic modulation in a dopaminergic neuron, the method comprising contacting the dopaminergic neuron with (a) an engineered TH promoter as described herein; (b) a nucleic acid molecule comprising an engineered TH promoter as described herein; (c) a vector comprising an engineered TH promoter as described herein; (d) a viral vector comprising an engineered TH promoter as described herein; (e) a host cell comprising an engineered TH promoter as described herein; (f) a composition comprising an engineered TH promoter as described herein; (g) a pharmaceutical composition comprising an engineered TH promoter as described herein, (h) a means for modulating a dopaminergic neuron comprising an engineered TH promoter as described herein. For example, the method may result in a genetic or epigenetic modulation of at least about 5%, 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% as compared to a control. In some embodiments, the expression of the NDD- relevant gene may be reduced by at least 20%. In some embodiments, the modulation of genetic or epigenetic measurements of the NDD-relevant gene may be reduced by at least 90%. The method may reduce the NDD-relevant gene expression to physiological levels in a control. In an aspect, the NDD-relevant gene of the method of effecting genetic or epigenetic modulation in a dopaminergic neuron is SNCA.

[0231] The present disclosure provides for a method of in vivo modulation of expression of a neurodeg enerative disease (NDD)-relevant gene in a dopaminergic neuron-specific manner in asubject in need thereof, the method comprising administering to the subject a therapeutically effective amount of (a) an engineered TH promoter as described herein; (b) a nucleic acid molecule comprising an engineered TH promoter as described herein; (c) a vector comprising an engineered TH promoter as described herein; (d) a viral vector comprising an engineered TH promoter as described herein; (e) a host cell comprising an engineered TH promoter as described herein; (f) a composition comprising an engineered TH promoter as described herein; (g) a pharmaceutical composition comprising an engineered TH promoter as described herein, (h) a means for modulating a dopaminergic neuron comprising an engineered TH promoter as described herein, wherein the therapeutically effective amount is an amount sufficient to modulate expression of the NDD-relevant gene in the subject. For example, the method may result in a modulation of expression of a neurodegenerative disease (NDD)-relevant gene of at least about 5%, 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% as compared to a control. In some embodiments, the expression of the NDD-relevant gene may be reduced by at least 20%. In some embodiments, the expression the NDD-relevant gene may be reduced by at least 90%. The method may reduce the NDD-relevant gene expression to physiological levels in a control. In an aspect, the NDD-relevant gene of the method of effecting genetic or epigenetic modulation in a dopaminergic neuron is SNCA.

[0232] The present disclosure provides for a method of treating, preventing, or ameliorating one or more symptom of a neurodegenerative disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of (a) an engineered TH promoter as described herein; (b) a nucleic acid molecule comprising an engineered TH promoter as described herein; (c) a vector comprising an engineered TH promoter as described herein; (d) a viral vector comprising an engineered TH promoter as described herein; (e) a host cell comprising an engineered TH promoter as described herein; (f) a composition comprising an engineered TH promoter as described herein; (g) a pharmaceutical composition comprising an engineered TH promoter as described herein, (h) a means for modulating a dopaminergic neuron comprising an engineered TH promoter as described herein, wherein the therapeutically effective amount is an amount sufficient to reduce one or more pathological phenotype associated with the neurodegenerative disease or disorder. In an aspect, the NDD-relevant gene of the method of treating, preventing, or ameliorating one or more symptom of a neurodegenerative disease or disorder in a subject in need thereof is SNCA.

[0233] The present disclosure provides for a method of treating, preventing, or ameliorating one or more symptom of a synucl einop athy in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of (a) an engineered TH promoteras described herein; (b) a nucleic acid molecule comprising an engineered TH promoter as described herein; (c) a vector comprising an engineered TH promoter as described herein; (d) a viral vector comprising an engineered TH promoter as described herein; (e) a host cell comprising an engineered TH promoter as described herein; (f) a composition comprising an engineered TH promoter as described herein; (g) a pharmaceutical composition comprising an engineered TH promoter as described herein, (h) a means for modulating a dopaminergic neuron comprising an engineered TH promoter as described herein, wherein the therapeutically effective amount is an amount sufficient to reduce one or more pathological phenotype associated with the synucleinopathy. In an aspect, the NDD-relevant gene of the method of treating, preventing, or ameliorating one or more symptom of a synucleinopathy in a subject in need thereof is SNCA. In an aspect, the synucleinopathy is selected from Parkinson’s disease (PD) or dementia with Lewy bodies (DLB). a. Composition for Epigenome Modification of a SNCA Gene

[0234] In an aspect, the present disclosure provides for compositions and means for epigenome modification of a SNCA gene in a neuronal-type specific manner (e.g., specific for dopaminergic neurons). The epigenome modification can activate or repress expression of the SNCA gene either directly or indirectly. The SNCA gene has been associated with synucleinopathies. Indeed, accumulating evidence by the inventors suggests that elevated levels of SNCA are pathogenic and reduction in SNCA levels can rescue disease- related cellular-phenotypes, including SER129-phosphorylated a-synuclein, a marker of a-synuclein aggregates and neuronal viability.

[0235] Accordingly, the composition includes, but not limited to, a composition for epigenome modification of SNCA gene in a neuronal-type specific manner that comprises, consists or, or consists essentially of: (i) CRISPR / deactivated(d)SaCas9; and (ii) selected gRNA targeted at SNCA-intron 1 regulatory region fused with a synthetic repressor molecule of KRAB / MeCp2(TRD) and driven by dopaminergic neuron-specific promoter engineered from Tyrosine Hydroxylase (TH) transcriptional sequences.

[0236] Another aspect of the present disclosure provides a composition for epigenome modification of a SNCA gene in a neuronal-type specific manner. b. Methods of Modulating SNCA Gene Expression

[0237] In an aspect, the present disclosure provides for methods of in vivo modulation of expression of a SNCA gene in a neuronal-type specific manner. The method can include in vivo modulation of expression of SNCA gene in a cell. The method can include in vivo modulationof expression of a SNCA gene in a subject. The method can include administering to the cell or subject the presently disclosed composition, polynucleotide, vector, host cell, or pharmaceutical composition for epigenome modification of a SNCA gene in a dopaminergic neuron cell-type specific manner. The method can include administering to the cell or subject a pharmaceutical composition comprising the same.

[0238] an aspect, the present disclosure provides for a method of in vivo modulation of expression of a SNCA gene in a cell or a subject in a neuronal-type specific manner (e.g., dopaminergic neuron specific manner). The method comprises, consists of, or consists essentially of contacting the cell or subject with at least one of said composition, said nucleic acid molecule, said vector, said host cells, said pharmaceutical composition, or combinations thereof, in an amount sufficient to modulate expression of the gene.

[0239] Another embodiment of the present disclosure is directed to a method of treating a disease or disorder associated with elevated SNCA expression levels in a subject in a neuronal cell-type specific manner. The method comprises, consists of, or consists essentially of administering to the subject, or a cell in the subject, at least one of said composition, said nucleic acid molecule, said vector, said host cell, said pharmaceutical composition, or combinations thereof such that the disease or disorder associated with elevated SNCA expression is treated.

[0240] In yet other embodiments, the disclosure provides a method of in vivo modulating expression of a SNCA gene in a cell or a subject, the method comprising, consisting or, or consisting essentially of contacting the cell or subject with a composition comprising, consisting of, or consisting essentially of: (i) CRISPR / deactivated(d)SaCas9; and (ii) selected gRNA targeted at SNCA-intron 1 regulatory region fused with a synthetic repressor molecule of KRAB / MeCp2(TRD) and driven by dopaminergic neuron specific promoter engineered from Tyrosine Hydroxylase (TH) transcriptional sequences.

[0241] In some embodiments, administration of the composition, polynucleotide, vector, host cell, or pharmaceutical composition for epigenome modification of a SNCA gene may result in reduced expression of the SNCA gene in the cell or subject. For example, the method may result in a reduction in SNCA gene expression of at least about 5%, 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% as compared to a control. In some embodiments, the expression of SNCA gene may be reduced by at least 20%. In some embodiments, the expression of SNCA gene may be reduced by at least 90%. The method may reduce SNCA gene expression to physiological levels in a control.

[0242] In some embodiments, administration of the composition, polynucleotide, vector, host cell, or pharmaceutical composition for epigenome modification of a SNCA gene may result in a reduction in levels of n-synuclein in the cell or subject. For example, the method may result in reduction in levels of SNCA of at least about 5%, 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% as compared to a control. In some embodiments levels of SNCA may be reduced by at least 25%. In some embodiments, levels of SNCA may be reduced by at least 36%.

[0243] In some embodiments, administration of the composition, polynucleotide, vector, host cell, or pharmaceutical composition for epigenome modification of a SNCA gene may result in reduced mitochondrial superoxide production in the cell or subject. For example, the method may result in a reduction in mitochondrial superoxide production at least about 5%; 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100'% as compared to a control. In some embodiments, mitochondrial superoxide production may be reduced by at least 25%. In some embodiments, administration of the composition, polynucleotide, vector, host cell, or pharmaceutical composition for epigenome modification of a SNCA gene may result in increased cell viability. For example, cell viability may be increased at least 1 fold compared to a control. For example, cell viability may be increased at least 1 fold, at least 1.2 fold, at least 1.4 fold, at least 1 .6 fold, at least 1.8 fold, at least 2 fold, at least 2.5 fold, at least 5 fold, or at least 10 fold compared to control. In some embodiments, cell viability may be increased at least 1.4 fold compared to control. c. Methods of Treating SNCA-related Diseases

[0244] Another aspect of the present disclosure is directed to a method of treating a disease or disorder associated with elevated SNCA expression levels (e.g., Parkinson’s Disease) in a subject in a neuronal -type specific manner. The method comprises, consists of or consists essentially of administering to the subject, or a cell in the subject, at least one of said composition, said nucleic acid molecule, said vector, said host cell, said pharmaceutical composition, or combinations thereof such that the disease or disorder associated with elevated SNCA expression is treated.

[0245] In some embodiments, the disease comprises a neurodegenerative disease and / or disorder. In other embodiments, the neurodegenerative disease and / or disorder comprises Parkinson’s Disease.

[0246] Another aspect of the present disclosure is directed to a method of in vivo modulating expression of a SNCA gene in a cell or a subject in a neuronal -type specific manner. Themethod comprises, consists of, or consists essentially of administering to the subject, or contacting the cell, at least one of said composition, said nucleic acid molecule, said vector, said host cell, said pharmaceutical composition, or combinations thereof such that the expression of SNCA gene in the subject of the cell is modulated.

[0247] In yet another embodiment, the present disclosure is directed to a viral vector system for epigenome modification of an SNCA gene in a neuronal-type specific manner. The viral vector system comprises, consists of or consists essentially of: (i) CRISPR / deactivated(d)SaCas9; and (ii) selected gRNA targeted at SNCA-intron 1 regulatory region fused with a synthetic repressor molecule of KRAB / MeCp2(TRD) and driven by dopaminergic neuron specific promoter engineered from Tyrosine Hydroxylase (TH) transcriptional sequences.9. Neurodegenerative Disorders / Synucleinopathies

[0248] A neurodegenerative diseases or disorder as described herein (e.g., such an in a method of use of a TH promoter as described herein) are characterized by, resulting from, or resulting in the progressive loss of structure or function of neurons, including death of neurons. Neurodegenerative diseases include, for example, Alzheimer’s Disease (AD), amyloidosis, amyotrophic lateral sclerosis (ALS), Parkinson’s Disease (PD), Huntington’s Disease, prion disease, motor neuron disease, spinocerebellar ataxia, spinal muscular atrophy, neuronal loss, cognitive defect, primary age-related tauopathy (PART) / Neurofibrillary tangle-predominant senile dementia, chronic traumatic encephalopathy including dementia pugilistica, dementia with Lewy Bodies (DLB) (also referred to as Lewy body dementia (LBD)), neuroaxonal dystrophies, and multiple system atrophy, progressive supranuclear palsy, Pick’s Disease, corticobasal degeneration, some forms of frontotemporal lobar degeneration, frontotemporal dementia and parkinsonism linked to chromosome 17, Lytico-Bodig disease (Parkinson- dementia complex of Guam), ganglioglioma, gangliocytoma, meningioangiomatosis, postencephalitic parkinsonism, subacute sclerosing panencephalitis, lead encephalopathy, tuberous sclerosis, Hallervorden-Spatz disease, and lipofuscinosis.

[0249] SNCA-related diseases or disorders may be characterized by abnormal expression of the SNCA gene compared to control subjects without the SNCA-related disorder. In some aspects, the SNCA related disease or disorder is characterized by increased expression of SNCA gene compared to control. In other aspects, the SNCA-related disease or disorder is characterized by decreased ex-pression of SNCA gene compared to control. In some aspects, the SNCA-related disease or disorder is a neurodegenerative disorder.

[0250] Synucleinopathies are neurodegenerative disorders that share a common pathological lesion of intracellular protein aggregates largely composed of the a-synuclein protein named, Lewy Bodies (LBs) and Lewy-related neurites. While these spectrum diseases exhibit neuropathological similarities, each disease presents distinct characteristics. The cell types and brain regions containing the LBs differ, particularly in early disease stages, so that while LBs in dopaminergic neurons are the primary early disease characteristic of PD, early stages of DLB have LBs primarily in the amygdala and cerebral cortex, as well as basal forebrain cholinergic neurons. SNCA gene (encodes the a-synuclein protein) was implicated as a highly significant genetic risk factor for synucleinopathies including, Parkinson’s disease (PD) and dementia with LB(DLB). Accumulating evidence have suggested that elevated levels of wild type a-synuclein are causative in the pathogenesis of synucleinopathies. Elevated levels of wild-type SNCA- mRNA in affected brain regions obtained from synucleinopathies patients is observed: in midbrain tissues from sporadic PD brains compared to controls, and in cortical brain tissues from LBV / AD compared to AD-only controls. These observations further underscore the unmet need for precision medicine in synucleinopathies; that is to say, targeting the precise gene in the precise brain cell-type of the affected brain region. For example, targeting SNCA gene in cholinergic neurons of the cortex and dopaminergic neurons of the sub-nigra as a therapeutics strategy for DLB and PD, respectively.

[0251] Synucleinopathies may be neurodegenerative diseases or disorders characterized by the abnormal accumulation of aggregates of alpha-synuclein protein (which is encoded by the SNCA gene). Accumulation of aggregates may occur in neurons, nerve fibers, or glial cells. In some aspects, these aggregates are clinically referred to as “Lewy bodies” (LBs) and / or Lewy- related neurites. Different synucleinopathies can occur depending on the location of these aggregates. For instance, LBs in dopaminergic neurons are the primary early disease characteristic of Parkinson’s disease (PD), early stages of dementia with Lewy bodies (DLB) have LBs primarily in the amygdala and cerebral cortex, as well as basal forebrain cholinergic neurons. Thus, synucleinopathies can include Parkinson’s disease (PD), dementia with Lewy bodies (DLB), and multiple system atrophy. In some aspects, a synucleinopathy disclosed herein may be Parkinson’s disease (PD). In other aspects, the synucleinopathy disclosed herein may be dementia with Lewy bodies (DLB).10. Kits

[0252] Provided herein are kits, which may be used for epigenome modification of a neurodegenerative disease related gene (e.g., SNCA gene). The kit may comprise the engineered TH promoter of claim as described herein, the nucleic acid molecule comprising the engineeredTH promoter as described herein, the vector comprising the engineered TH promoter as described herein, the viral vector comprising the engineered TH promoter as described herein, the host cell comprising the engineered TH promoter as described herein; the composition comprising the engineered TH promoter as described herein; the pharmaceutical composition comprising the engineered TH promoter as described herein; or the means for modulating a dopaminergic neuron comprising the engineered TH promoter as described herein, and instructions for use.

[0253] The kit may comprise instructions for using the disclosed engineered TH promoter, nucleic acid molecule, vector, vial vector, host cell, composition, pharmaceutical composition and mean for modulating a dopaminergic neuron , polynucleotide, vector, or pharmaceutical composition. Instructions included in kits may be affixed to packaging material or may be included as a package insert. While the instructions are typically written or printed materials, they are not limited to such. Any medium capable of storing such instructions and communicating them to an end user is contemplated by this disclosure. Such media include, but are not limited to, electronic storage media (e.g., magnetic discs, tapes, cartridges, chips), optical media (e.g., CD ROM), and the like. As used herein, the term "instructions" may include the address of an internet site that provides the instructions.

[0254] TABLE 3 below provides a listing of sequences disclosed in the application and throughout the Examples. It is contemplated that any aspect or feature of any of the individual sequences described in TABLE 3 (e.g., engineered TH promoters, nucleic acid molecules, vectors, etc.) (or any positive or negative directional strand complementary thereto) may be used in part or totality for an aspect of the engineered TH promoter, the nucleic acid molecule, the vector, the viral vector, the host cell, the composition, the pharmaceutical composition, any of the methods, or the means for modulating a dopaminergic neuron, each of which are described herein, and each comprising the engineered TH promoter as described herein. In other words, the sequences shown below may annotated by a skilled artisan and its features, or fragment thereof, implemented into any aspect of the invention as describe herein.

[0255] In one aspect, the invention as described herein comprises all that is disclosed, whole or in part, with the sequences provided in TABLE 3.11. TABLE 3: LISTING OF SEQUENCESEXAMPLES

[0256] It will be readily apparent to those skilled in the art that other suitable modifications and adaptations of the methods of the present disclosure described herein are readily applicable and appreciable, and may be made using suitable equivalents without departing from the scope of the present disclosure or the aspects and embodiments disclosed herein. Having now described the present disclosure in detail, the same will be more clearly understood by reference to the following examples, which are merely intended only to illustrate some aspects and embodiments of the disclosure, and should not be viewed as limiting to the scope of the disclosure.1. Example 1: Developing engineered TH promoter sequences based on chromatin accessibility profiling

[0257] Chromatin accessibility of DNA regulatory elements is a critical aspect of gene expression in eukaryotic cells. Chromatin is a combination of DNA and proteins, such as histones, which associate with the nucleic acids to tightly compact long strands of DNA into condensed forms in order to fit inside the nucleus of eukaryotic cells. Regulatory elements that are accessible to cellular machinery, such as transcription factors, are typically active.

[0258] Single nucleus transposase-accessible chromatin using sequencing (snATAC-seq) is a technique for quantification of DNA accessibility at a single cell level. ATAC-seq utilizes transposase enzymes to insert sequencing adapters at accessible chromatin sites, which enables a genome-wide profiling of transcription factor binding accessibility. Here we utilized a granular single cell resolution ATAC-seq methods adapted from Schab et al., Acta Neuropatholica Comm. (2024), the disclosure of which is incorporated by reference thereto. The snATAC-seq experiments were designed to profile chromatin accessibility landscapes in order to identifychromatin accessible sites across the tyrosine hydroxylase (TH) genomic region including near the TH promoter (e.g., human chromosome 11, location: 1 Ip 15.5).

[0259] Briefly, nuclei were isolated from the temporal cortex tissues of 12 human Parkinson’s disease subjects and 12 control subjects. snATAC-seq libraries were prepared with the 10X Genomics platform using the Chromium Next GEM Single Cell ATAC Library and Gel Bead vl.l kit, Chip H Single Cell kit, and Single Index Kit N Set A (10X Genomics) according to manufacturer’s instructions. Libraries were sequenced on a NovaSeq 6000S, using a sequencing depth of 400 million reads per sample.

[0260] Data analysis was performed to identify all peaks (which represent open chromatin sites) at both cell-type and subtype levels. The following steps were performed for the snATAC-seq data analysis: a. snATAC-seq data processing

[0261] As described previously (Gamache et al., Cell Biosci 13: 185 (2023)), DNA fragments acquired from snATAC-seq were sequenced and converted to FastQ format, and then mapped to GENCODE’s human release 32 reference (Frankish et al., Nucleic Acids Res 47:D766-D773 (2019) ) and counted using CellRanger-ATAC 1.2.0 (10X Genomics). Remaining nuclei were screened using the following QC metrics: (I) Nucleosome signal: Ratio of mononucleosome fragments (147 to 294 bp) to nucleosome free fragments (< 147 bp). Nuclei having a nucleosome signal of > 4 were excluded; (II) Transcription start site (TSS) enrichment: Ratio of aggregated, normalized read signal centered around a reference set of TSS’s compared to signal in the TSS flanking regions. Nuclei with TSS enrichment scores < 2 were excluded (III) Percent reads in peaks: Proportion of fragments per cell mapping to peak regions. Cells with < 15% of reads in peaks were excluded; (IV) Total peak region fragments: Cells with < 1000 peak region fragments were excluded due to low sequencing depth. Additionally, cells in the upper 1% in each sample distribution were excluded as a precaution against multiplets; (V) Blacklist ratio: Proportion of fragments mapping to sequences associated with technical artifacts. Cells with > 5% of fragments mapping to blacklisted regions were excluded (see Stuart et al., Nat Methods 18: 1333-1341 (2021); Amemiya et al., Sci Rep 9:9354 (2019)).

[0262] Seurat 4.0.1, Signac 1.3.0, and Harmony 0.1.0 R packages were used for subsequent processing (see Stuart et al., Cell 177: 1888-1902 e21 (2019); Stuart et al., Nat Methods 18: 1333- 1341 (2021); Korsunsky et al., Nat Methods 16: 1289-1296 (2019)). Latent semantic indexing (LSI) was used to create a low-rank approximation of the data (Cusanovich et al., Cell 174: 1309-1324. e!8, (2018)). The 24 datasets were term frequency-inverse document frequency(TF-IDF) normalized and aggregated to form a joint peak-by-cell count matrix. Singular value decomposition (SVD) was then performed on this dataset, followed by standardization of left singular vectors, representing LSI components. Correlation of each component with sequencing depth was then measured. The first dimension was removed from downstream analysis due to high sequencing depth correlation (rho = 0.7) (Stuart et al., Nat Methods 18: 1333-1341 (2021)). Remaining LSI components were then adjusted with using the RunHarmony function to remove batch effects prior to data clustering. As in snRNA dimensionality reduction, dimensions 2 through 30 were used for clustering and subsequent analysis.

[0263] Clusters were constructed from the adjusted LSI embeddings of the integrated dataset using the FindNeighbors and FindClusters Seurat functions, with ^-nearest neighbors = 20, and cluster resolution = 1. The data were then projected onto a 2D surface via UMAP to evaluate cluster resolution. b. Cell type annotation of snATAC-seq nuclei

[0264] Cell type annotation of the snATAC cells was performed using the integrated snRNA dataset as a reference (see Gamache et al., Cell Biosci 13: 185 (2023); Stuart et al., Cell 177: 1888-1902 e21 (2019)). “Gene activity” matrices were constructed for each nucleus from snATAC samples by counting fragments mapped to gene promoters (2000 bp upstream to 200 bp downstream of TSS). These matrices were log-normalized following promoter region fragment quantifications. The FindTransf er Anchors Seurat function was then employed to annotate the snATAC data using the snRNA data as reference, with reduction via canonical correlation analysis. This entails computation of cross correlation between snATAC and snRNA cell variable features. After L2 normalization, the left and right singular vectors from the SVD of this matrix are taken as the canonical correlation vectors. A mutual nearest neighbor approach then used to find anchors between the datasets, representing biologically similar cell states across modalities. Major cell type prediction scores were calculated for each nucleus using the weighted combination of the ^-nearest anchors. The cell type with the maximum prediction score was the predicted cell type identity. Nuclei with maximum prediction scores of < 0.5 were excluded. “Hybrid” nuclei were identified using the same metric as for snRNA- seq data above, and excluded.

[0265] The FindTransfer Anchors and TransferData Seurat functions were used to link snATAC clusters to snRNA clusters. The downstream analyses were performed on the linked clusters. c. Peak calling

[0266] Peak regions were predicted empirically within each sample separately using the MACS2 algorithm on each cluster (see Gamache et al., Cell Biosci 13: 185 (2023); Zhang et al., Genome Biol 9:R137 (2008)). Peaks were designated as regions having a p value of < 10e-5. The Multi Sample Peak Calling (MSPC) software package was used (Jalili et al., Bioinformatics (Oxford, England) 31 :2761-2769 (2015)) to combine peaks into a consensus set for each cluster, with Fisher’s method used to evaluate overlapping peaks across samples. Peaks occurring in at least 2 samples, with an FDR of < 0.05 from Fisher’s combined probability test were used as the consensus set for downstream analysis. d. Differential chromatin accessibility analysis

[0267] In order to identify differential accessible peaks (DAPs) at both the cell type and subtype levels between Parkinson’s disease and normal control samples within our snATAC-seq dataset, we employed the NEBULA algorithm (He et al., Commun Biol 4:629 (2021)). Covariate selection for differential analyses was conducted and for snATAC-seq data, age, sex, PMI, and number of nuclei after QC filtering were selected as covariates for differential peak accessibility analysis.

[0268] To determine chromatin accessible regions for the tyrosine hydroxylase (TH) promoter, human chromosome 11 (chrl 1) was analyzed. Peaks and the DAP were selected based on excitatory (EXC) and inhibitory (INH) neuronal clusters within the TH locus and ~10kb upstream of the transcription start site (TSS) of TH. Results are shown in FIG. 1. The overlapping DAP region was located at chrl 1-2178003-2179352. Overlapping peaks were located at chrl 1-2175664-2175864, which was identified as PEAK1; chrl 1-2171475-2171692, which was identified as PEAK2; chrl 1-2171822-2172140, which was identified as PEAK3; chrl 1-2166129-2166957, which was identified as PEAK4; chrl 1-2175443-2175643, which was identified as PEAK5, and chrl 1-2163898-2164113, which was identified as PEAK6.

[0269] The identified PEAK1, PEAK2, PEAK3, PEAK4, PEAK5, PEAK6 and DAP were graphically overlayed onto a genome browser view of the human TH gene locus within chromosome 11 (hg38) at positions 2,163,292-2,181,877 (see FIGS. 2A-2B). As shown in FIG. 2B, which features annotation of the full length TH promoter, PEAK2 and PEAK3 were located near the 5’UTR region. PEAK1, PEAK5, and the DAP were located at the full length TH promoter region. PEAK4 and PEAK6 were located upstream of the full length TH promoter.

[0270] After confirming the accessibility of the identified peaks via ATAC-seq and proximity with the TH promoter, the PEAK1, PEAK2, PEAK3, and the PEAK5 sequences identified inExample 1 were deemed critical to TH promoter functionality, as well as PEAK4 and PEAK6 to a lesser extent due to distance from the TH promoter. It was conceived that a combination of the PEAK1, PEAK2, PEAK3, and the PEAK5 sequences, or fragments thereof, could be assembled so as to generate an engineered TH promoter having a reduced number of nucleotides while still maintaining capability of TH promoter function. An engineered TH promoter was generated by fusing a PEAK3 fragment and a PEAK2 fragment, and testing verified functional activity as a TH promoter, as shown below.2. Example 2: Developing engineered TH promoter sequences based on a characterized human TH gene

[0271] An engineered TH promoter was developed from a full fragment human TH gene that contains about 13 kb sequence of the human tyrosine hydroxylase (hTHp) (see in Coker et al., Biochem Biophys Res Commun. 1988 Dec 30; 157(3): 1341-7 (1998)). This fragment was further trimmed to 2.6 kb shown driving high levels of GFP expression in TH-positive cells of the substantia nigra of embryonic and adult mice as well as in TH neurons when used in the lentiviral vector context (see Sun et al., Molecular Therapy-Nucleic Acids 35.1 (2024)). Intriguingly, we and others identified that the sequences of the hTHp shown a low degree of homology with the mouse and rat TH promoters. In fact, comparative analysis of the sequences of human, rat, and mouse TH promoters revealed only five small regions of high homology. These five evolutionary conserved regions (CRs) were originally identified and numbered in numeric progression from the 5' end of human TH promoter (Romano et al., Journal of cellular physiology, 204.2 (2005): 666-677). Furthermore, the combinations of those CRs were previously attempted in vitro by Romano et al., using lentiviral vector.

[0272] Here, all 5 CR sequences (e.g., SEQ ID NOS:91-95) were assembled to engineer a minimal human TH promoter capable of being efficiently packaged into AAV vector particles. The sequences were arranged in the order of CR1-CR2-CR3-CR4-CR5 (SEQ ID NO:96), as shown in FIG. 2A as CI, CII, CIII, CIV, and CV, respectively. The orientation of CR1-CR2- CR3-CR4-C5 is unique in that the fragments are in a different order than CI-CV as shown in the overlay on human chromosome 11. The engineered CR1-CR2-CR3-CR4-CR5 TH promoter was fused to a 5’UTR (SEQ ID NO: 139), and tested in AAV vector (e.g., pBK1989). Results for this engineered TH promoter were successful, as demonstrated in a GFP reporter assay (see FIG. 9)3. Example 3: Development of all-in-one AAV gene repression platform targetingSNCA

[0273] Experiments were formed to engineer a gene-silencing platform having reduced size, in order to be accommodated as a payload within the size restrictions of an AAV vector. A screening strategy was utilized that was based on a dual reporter system, as depicted in FIG. 2. A reporter vector expressing dGFP and NLuc genes was packaged into LV particles. In this design, the reporter was performed using the LV vector and the therapeutic / repressor was using the AAV vector. The expression vector cassette also carried a puromycin resistance marker for selection. HEK293T cells were used to create a stable reporter cell line. The cells were transduced at MOI = 0.2 to ensure integration at the rate of 1 copy per cell. Importantly, both dGFP and NLuc are characterized by short protein half-lives, making them ideal for the evaluation of gene expression changes.

[0274] The dGFP and NLuc proteins were expressed from the CAG / SNCA Intron 1 promoter, which was targeted with gRNAs (as described in FIG. 4). Two gRNAs sequences were selected for targeting the SNCA intron 1 regulatory region (gRNAl and gRNA2). The first, CjCas9 gRNAl, targets a region around transcription initiation site, and gRNA2 targets an upstream sequence of the SNCA intron. CjCas9 and SaCas9 and their deactivated forms recognize two different PAM motifs (CjCas9 PAM NNNNRYAC) and SaCas9 (PAM NGRRT / N). The experimental design allowed for screening of the efficiency of dCas9 paired with different effector repressors. The efficiency of repression correlates with the level of downregulation of the expression of alpha-Syn as well as dGFP and Luc.

[0275] This study focused on catalytically inactive mutants of two small Cas9 proteins, which were derived from Campylobacter jejuni (dCjCas9) and Staphylococcus aureus (dSaCas9) (results are shown in FIGS. 5A and 5B, respectively). The following effector proteins (hereby repressors) were tested following their fusion with dCjCas9 and dCjCas9 proteins: first, dCjCas9 and dSaCas9 were fused with heterochromatin proteins la and lb (HP la and HP lb, respectively). The repressive chromoshadow domain (CSD) of HP1 both with and without the hinge region was used. The chromoshadow domain is responsible for the multimerization of HP1 and the formation / maintenance of compact heterochromatin structures, while the hinge region is responsible for additional transcriptional regulation via interaction with histone H3 and other repressive effectors. Next, we tested alternative repression domains: the TRD from Nuclear inhibitor of protein phosphatase 1 (NIPP1), a representative Kriippel associated box (KRAB) domain from Zinc finger protein 10 (K0X1), and a KRAB-MeCP2(TRD) combination. The screening methods were developed from Kantor et al., Nature Communications, Nat Commun 15, 7259 (2024), which is incorporated in its entirety by reference thereto, whichpreviously selected effectors (e.g., repressors) using a different reporter system, which formed the basis for this repressor selection panel.

[0276] FIG. 3 depicts the reporter system used to evaluate the transcription repression of the developed system. Constructs were selected for further testing following the screening are AAV-dCjCas9 / dSaCas9-KRAB-MeCP2-gRNAl (which targets PSS region of the Intron 1 of the SNCA). The level of transcriptional repression highlighting each of the constructs are shown at days 14 and 21 (FIG. 5C). The corresponding plasmids were packaged into AAV2.9 viral particles and concentrated as described in the Methods of Kantor et al., Nature Communications, Nat Commun 15, 7259 (2024). Titers of the produced vectors were measured by real-time PCR. All vectors consistently achieved high physical titers. Furthermore, the physical titers obtained from the additional vectors that were produced were similar to those obtained from a naive vector carrying no CRISPR / Cas components (data not shown). HEK293T cells-stably were transduced with the reporter lentiviral vector carrying SNCA, GFP and Luc ORFs. Western blotting was performed using alpha-Syn and GAPDH Ab and the ratio was determined for the presentation of the results. dCj / SaCas9-KRAB-MeCP2(TRD), demonstrated substantial silencing and was selected for further testing. The dCjCas9- KRAB- MeCP2(TRD) / [SNCA intron 1 gRNAl] reduced the level of SNCA expression by about 70%, and dSaCas9-KRAB-MeCP2(TRD) / [CMV gRNAl] lowered it by about 80%. Interestingly, gRNAl consistently outperformed gRNA2 (see FIGS. 5A-5B) showing greater reductions in the signal across all effectors, not just KRAB-MeCP2(TRD). As such AAV-dSaCas9-KRAB- MeCP2(TRD)-gRNAl was selected for further testing.4. Example 4: Selection of AAV serotypes in CNS

[0277] The expression level of construct various AAV serotypes was tested (AAV serotypes 2, 5, 9 and PHPeB) using GFP-reporter vector (pBK313). Prior to transduction with the AAVs, human IPCs were differentiated into organoids. Then, the expression of GFP was evaluated at day 1, 4, 5, 9, and 12 post-transductions. The most efficient expression was achieved for the vector packaged into AAV-PHPeB capsids.5. Example 5: Bilateral injection model for testing AAV / dCas9 repressor systems

[0278] The A53T mutation of human SNCA induces formation of annular and tubular protofibrils and is linked to autosomal dominant, early-onset Parkinson’s disease. An AAV inducer of overexpression of human A53T-a-synuclein was developed for testing efficacy of AAV / dCas9 repressor systems, using a bilateral injection model, as shown in FIG. 7. “AAV / A53T-human SNCA” represents an AAV inducer of overexpression of human A53T-a-synuclein. “AAV / dCas-no repressor” represents an AAV / dSaCas9 construct with no repressor and no-gRNA. “AAV / dCas-TH repressor” represents an AAV / TH-dSaCas9-KRAB- MECP2(TRD) / gRNAl construct having an engineered TH promoter having the nucleic acid sequence of SEQ ID NO:86. In the model, results are obtained following bilateral stereotaxic injection into the substantia nigra of mice. After incubation (e.g., two weeks), immunohistochemistry is performed to assess human a-synuclein expression in the substantia nigra (e.g., total a-synuclein, pS129 a-synuclein, or aggregated a-synuclein).6. Example 6: In-vivo testing of engineered TH promoter-driven AAV / dCas9 repressor system using a bilateral injection model

[0279] AAV / dCas9 repressor systems were tested using a bilateral injection model by inducing overexpression of human A53T-a-synuclein. For the experimental design, C54BL / 6 mice age 16 weeks were subjected to bilateral stereotaxic injection into the substantia nigra, as shown in FIG. 7 and immunohistochemistry to assess mouse tyrosine hydroxylase expression in the substantia nigra and striatum, as a marker of dopaminergic neurons.

[0280] A53T alpha-synuclein AAV vector was co-injected with an AAV -inactive control into the left substantia nigra (SN). A53T alpha-synuclein AAV vector was co-injected with the TH- AAV-repressor (vector pBK2115) into the right SN at IxlO14vg / ml. The control is 8xl012vg / ml. Immunohistochemistry visualization of total a-synuclein, pS129 a-synuclein, and aggregated a-synuclein was performed and quantified. Representative images of brain slices 2- weeks post-injection are provided in FIG. 8A, showing expression of total human SNCA, SNCA pS129, aggregated SNCA (Agg), mouse tyrosine hydroxylase (TH) and DAPI staining in the SN.

[0281] The TH-AAV-repressor significantly reduced expression of total human SNCA, and aggregated SNCA in the right SN (see FIG. 8B). Expression of TH was not significantly different in right SN compared to the left SN (see FIG. 8C). Representative images showing expression of mouse TH and DAPI staining in the striatum are provided in FIG. 8D. Expression of TH was higher in the right striatum (FIG. 8E).7. Example 7: In vitro testing of engineered TH promoters using GFP expression

[0282] To test additional engineered TH promoters, an a GFP assay was performed. Neuro-2A cells were transduced with 5 ul of the virus at the total of 2xlO10vp (M01s=10,000). The tested pBK313-2 and pBK313-2 vectors are naive GFP vectors. The tested pBK1989 vector comprises an engineered TH-promoter (CI-CII-CIII-CIV-CV-5'UTR). The tested pBK1990 comprises a full version of the TH promoter. The tested pBK2095 vector comprises an engineered THpromoter based on snATAC-seq results. Cells were imaged at day 7 post transduction (seeFIG. 9)8. Discussion

[0283] These studies demonstrate strategies for identifying portions of the full length TH promoter that are critical for functioning as targeting dopaminergic neurons. These portions of the TH promoter were assembled into functional fragments of the TH reporter having reduced size. The smaller form factor of these engineered TH promoters provide a means for incorporating TH promoter specificity into viral vectors having reduced payload capacity (e.g., AAV vectors). As demonstrated herein, the engineered TH promoters can be used to drive expression in dopaminergic neurons and provide additional cargo capacity for viral vectors generally (and AAV specifically), for improved approaches to gene therapy using vectors.

[0284] One skilled in the art will readily appreciate that the present disclosure is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The present disclosure described herein are presently representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the present disclosure. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the present disclosure as defined by the scope of the claims.

[0285] No admission is made that any reference, including any non-patent or patent document cited in this specification, constitutes prior art. In particular, it will be understood that, unless otherwise stated, reference to any document herein does not constitute an admission that any of these documents forms part of the common general knowledge in the art in the United States or in any other country. Any discussion of the references states what their authors assert, and the applicant reserves the right to challenge the accuracy and pertinence of any of the documents cited herein. All references cited herein are fully incorporated by reference, unless explicitly indicated otherwise. The present disclosure shall control in the event there are any disparities between any definitions and / or description found in the cited references.

Claims

CLAIMSWhat is claimed is:

1. An engineered tyrosine hydroxylase (TH) promoter, comprising(a) the nucleic acid sequence of TCCACCTTCCTGCACGGAGCCCTCTGGGCTTCCCTCCATACCCCACCA CCCTCCACCACTTCCGCCGTCCCTGTGGTTACAGCCCCTGCCACCATG GCCGTAAGGAATGCTGAGCCAGCTCCACAATGGAGCGTGTTCTCTCTC AACAGCCTCTCAGCCCGAGGCTTAATCACCCAGATTAATCACCCAGCA CGTCTGTG (SEQ ID NO: 131) or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either;(b) the nucleic acid sequence ofCACAGGGACAGGCATCACCTCACCCTCCCCCAACAGGGACTCAAACA CCAGGCACAGGGGATGCCGCTGTGCCCAGGCCTCCACATCCACGCCG CGTCCCAGGGGTTTGCATGGACCCTGAGCCTGGGGCTGCCAGCCAGG CTGGGGAGTAGCAGAGGCAGCTGGCACCAGCCCTGGGCTCCGGTCCA CTGCGGCCGCCGGGCACCTACCTGCCCTC (SEQ ID NO: 132) or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either;(c) the nucleic acid sequence ofCCTGGCCCAGCAGCCTCTTATAAGCTGAGCTGACGTCAAAGCCCCCTC TGGGTCCCCCACCTTCCCCTCCTTACATCCCCCACCCCTGCCTGCTGTG CCTGATGGAGGCGGGGGTGGGTGAGGAAGGAGGGAGGCGCAGGAGA AAGGGCTCGTCCGTGGAATCTAATTGCCTTCACTCCCCAGCCCTGTCT GAATCATCCTCAGCCCGCGGGCTTGCGGGGACCAGGGGCTCGTGCTCT GCGGGGGGCTGAGACAGCCAGGGTCCCCTTGGCCCCACAGCCCTCAA GAGAGCACACAGGGAGGGGCTTTCTGGCAGCC (SEQ ID NO: 133) or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either;(d) the nucleic acid sequence of TCTCTGGAGGCCGAGGTCACGCCCCAAGAGACCCCTGGGGCCAGCAT ACTGGCCCCTGGGAAGGAGAAGGGCTGGAGCGGAGCCCCACCAGGG GGGGCTATGAGGTGGGGCCAGGAGTGAGGGCCGACCCAGGCCAGATC AGAGACAAAACAGGTGACCAGGGGAGTGGGGGCCCCGCAGAGGTCTGAGGAGCCCTTGCT (SEQ ID NO: 135) or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either; or(e) a nucleic acid sequence comprising a combination of two or more of the nucleic acid sequences set forth in any one of SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, or SEQ ID NO: 135, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof, in any order, wherein the combination is selected from(i) SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, and SEQ ID NO: 135, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(ii) SEQ ID NO: 131, SEQ ID NO: 132, and SEQ ID NO: 133, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(iii) SEQ ID NO: 131, SEQ ID NO: 132, and SEQ ID NO: 135, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(iv) SEQ ID NO: 131, SEQ ID NO: 133, and SEQ ID NO: 135, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(v) SEQ ID NO: 132, SEQ ID NO: 133, and SEQ ID NO: 135, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(vi) SEQ ID NO: 131 and SEQ ID NO: 132, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(vii) SEQ ID NO: 131 and SEQ ID NO: 133, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(viii) SEQ ID NO: 131 and SEQ ID NO: 135, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(ix) SEQ ID NO: 132 and SEQ ID NO: 133, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(x) SEQ ID NO: 132 and SEQ ID NO: 135, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof; or(xi) SEQ ID NO: 133 and SEQ ID NO: 135, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof.

2. The engineered TH promoter of claim 1, comprising a nucleic acid sequence comprising a combination of SEQ ID NO: 132 or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof, and SEQ ID NO: 133 or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof.

3. The engineered TH promoter of claim 1 or claim 2, wherein(a) the fragment of SEQ ID NO: 132 or a nucleic acid sequence having reverse complementarity thereto comprises or consists of the nucleic acid sequence of GCATCACCTCACCCTCCCCCAACAGGGACTCAAACACCAGGCACAGG GGATGCCGCTGTGCCCAGGCCTCCACATCCACGCCGCGTCCCAGGGGT TTGCATGGACCCTGAGCCTGGGGCTGCCAGCCAGGCTGGGGAGTAGC AGAGGCAGCTGGCACCAGCCCTGGGCTCCGGTCCACTGCGGCCGCCG GGCACCTAC (SEQ ID NO: 83) or GTAGGTGCCCGGCGGCCGCAGTGGACCGGAGCCCAGGGCTGGTGCCA GCTGCCTCTGCTACTCCCCAGCCTGGCTGGCAGCCCCAGGCTCAGGGT CCATGCAAACCCCTGGGACGCGGCGTGGATGTGGAGGCCTGGGCACA GCGGCATCCCCTGTGCCTGGTGTTTGAGTCCCTGTTGGGGGAGGGTGA GGTGATGC (SEQ ID NO: 82), and(b) the fragment of SEQ ID NO: 133 or a nucleic acid sequence having reverse complementary comprises or consists of the nucleic acid sequence of CCAGCAGCCTCTTATAAGCTGAGCTGACGTCAAAGCCCCCTCTGGGTC CCCCACCTTCCCCTCCTTACATCCCCCACCCCTGCCTGCTGTGCCTGAT GGAGGCGGGGGTGGGTGAGGAAGGAGGGAGGCGCAGGAGAAAGGGC TCGTCCGTGGAATCTAATTGCCTTCACTCCCCAGCCCTGTCTGAATCAT CCTCAGCCCGCGGGCTTGCGGGGACCAGGGGCTCGTGCTCTGCGGGG GGCTGAGACAGCCAGGGTCCCCTTGGCCCCACAGCCCTCAAGAGAGC ACACAGGGAGGGGC (SEQ ID NO: 79) or GCCCCTCCCTGTGTGCTCTCTTGAGGGCTGTGGGGCCAAGGGGACCCT GGCTGTCTCAGCCCCCCGCAGAGCACGAGCCCCTGGTCCCCGCAAGC CCGCGGGCTGAGGATGATTCAGACAGGGCTGGGGAGTGAAGGCAATT AGATTCCACGGACGAGCCCTTTCTCCTGCGCCTCCCTCCTTCCTCACCC ACCCCCGCCTCCATCAGGCACAGCAGGCAGGGGTGGGGGATGTAAGG AGGGGAAGGTGGGGGACCCAGAGGGGGCTTTGACGTCAGCTCAGCTT ATAAGAGGCTGCTGG (SEQ ID NO: 78).The engineered TH promoter of any one of claims 1-3, comprising or consisting of the nucleic acid sequence of GCATCACCTCACCCTCCCCCAACAGGGACTCAAACACCAGGCACAGGGGAT GCCGCTGTGCCCAGGCCTCCACATCCACGCCGCGTCCCAGGGGTTTGCATGG ACCCTGAGCCTGGGGCTGCCAGCCAGGCTGGGGAGTAGCAGAGGCAGCTGG CACCAGCCCTGGGCTCCGGTCCACTGCGGCCGCCGGGCACCTACCCAGCAGC CTCTTATAAGCTGAGCTGACGTCAAAGCCCCCTCTGGGTCCCCCACCTTCCCC TCCTTACATCCCCCACCCCTGCCTGCTGTGCCTGATGGAGGCGGGGGTGGGT GAGGAAGGAGGGAGGCGCAGGAGAAAGGGCTCGTCCGTGGAATCTAATTGC CTTCACTCCCCAGCCCTGTCTGAATCATCCTCAGCCCGCGGGCTTGCGGGGA CCAGGGGCTCGTGCTCTGCGGGGGGCTGAGACAGCCAGGGTCCCCTTGGCCC CACAGCCCTCAAGAGAGCACACAGGGAGGGGC (SEQ ID NO: 87), or GCCCCTCCCTGTGTGCTCTCTTGAGGGCTGTGGGGCCAAGGGGACCCTGGCT GTCTCAGCCCCCCGCAGAGCACGAGCCCCTGGTCCCCGCAAGCCCGCGGGCT GAGGATGATTCAGACAGGGCTGGGGAGTGAAGGCAATTAGATTCCACGGAC GAGCCCTTTCTCCTGCGCCTCCCTCCTTCCTCACCCACCCCCGCCTCCATCAG GCACAGCAGGCAGGGGTGGGGGATGTAAGGAGGGGAAGGTGGGGGACCCA GAGGGGGCTTTGACGTCAGCTCAGCTTATAAGAGGCTGCTGGGTAGGTGCCC GGCGGCCGCAGTGGACCGGAGCCCAGGGCTGGTGCCAGCTGCCTCTGCTACT CCCCAGCCTGGCTGGCAGCCCCAGGCTCAGGGTCCATGCAAACCCCTGGGAC GCGGCGTGGATGTGGAGGCCTGGGCACAGCGGCATCCCCTGTGCCTGGTGTT TGAGTCCCTGTTGGGGGAGGGTGAGGTGATGC (SEQ ID NO: 88).

5. An engineered tyrosine hydroxylase (TH) promoter, comprising(a) the nucleic acid sequence of CCAAAGTAATCACATGGCAAACAAGCCCTGTCTAAATATCAC (SEQ ID NO:91) or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either;(b) the nucleic acid sequence ofGTGAGTGACTAATGAGAACTGAATGCCGCTCTTATTGCTTTT (SEQ ID NO:92) or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either;(c) the nucleic acid sequence of CCCAATTATCCCTAAGTG (SEQ ID NO:93) or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either;(d) the nucleic acid sequence of GCTCCATCTGATGGCCTCATTAGGGATAATTGCTCTGGCATTTGGGTC TGA (SEQ ID NO: 94) or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either;(e) the nucleic acid sequence of CGAATTAAAAAGCAATATTTGTATCAGTGGAAGACATTTGCTGAAAG GTTAAATCCACAT (SEQ ID NO: 95) or a nucleic acid sequence having reverse complementarity thereto or a fragment thereof either; or(f) a nucleic acid sequence comprising a combination of two or more of the nucleic acid sequences set forth in any one of SEQ ID NOS:91-95 or nucleic acid sequences having reverse complementarity thereto each or fragments thereof, in any order, wherein the combination is selected from(i) SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(ii) SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, and SEQ ID NO:94, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(iii) SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(iv) SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:94, and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(v) SEQ ID NO:91, SEQ ID NO:93, SEQ ID NO:94, and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(vi) SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(vii) SEQ ID NO:91, SEQ ID NO:92, and SEQ ID NO:93, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(viii) SEQ ID N0:91, SEQ ID NO:92, and SEQ ID NO:94, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(ix) SEQ ID NO:91, SEQ ID NO:92, and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(x) SEQ ID NO:91, SEQ ID NO:93, and SEQ ID NO:94, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(xi) SEQ ID NO:91, SEQ ID NO:93, and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(xii) SEQ ID NO:91, SEQ ID NO:94, and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(xiii) SEQ ID NO: 92, SEQ ID NO: 93, and SEQ ID NO: 94, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(xiv) SEQ ID NO:92, SEQ ID NO:93, and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(xv) SEQ ID NO:92, SEQ ID NO:94, and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(xvi) SEQ ID NO:93, SEQ ID NO:94, and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(xvii) SEQ ID NO:91 and SEQ ID NO:92, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(xviii) SEQ ID NO:91 and SEQ ID NO:93, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(xix) SEQ ID NO:91 and SEQ ID NO:94, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(xx) SEQ ID NO:91 and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(xxi) SEQ ID NO:92 and SEQ ID NO:93, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(xxii) SEQ ID NO:92 and SEQ ID NO:94, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(xxiii) SEQ ID NO:92 and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(xxiv) SEQ ID NO:93 and SEQ ID NO:94, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof;(xxv) SEQ ID NO:93 and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof; or(xxvi) SEQ ID NO:94 and SEQ ID NO:95, or nucleic acid sequences having reverse complementarity thereto each or fragments thereof, and optionally a nucleic acid sequence of a 5’UTR.

6. The engineered TH promoter of claim 5, comprising the nucleic acid sequence of CCAAAGTAATCACATGGCAAACAAGCCCTGTCTAAATATCACGTGAGTGACT AATGAGAACTGAATGCCGCTCTTATTGCTTTTCCCAATTATCCCTAAGTGGCT CCATCTGATGGCCTCATTAGGGATAATTGCTCTGGCATTTGGGTCTGACGAAT TAAAAAGCAATATTTGTATCAGTGGAAGACATTTGCTGAAAGGTTAAATCCA CAT (SEQ ID NO: 96) or ATGTGGATTTAACCTTTCAGCAAATGTCTTCCACTGATACAAATATTGCTTTT TAATTCGTCAGACCCAAATGCCAGAGCAATTATCCCTAATGAGGCCATCAGA TGGAGCCACTTAGGGATAATTGGGAAAAGCAATAAGAGCGGCATTCAGTTCT CATTAGTCACTCACGTGATATTTAGACAGGGCTTGTTTGCCATGTGATTACTT TGG (SEQ ID NO: 97).

7. The engineered TH promoter of claim 5 or 6, comprising a 5’UTR, wherein the 5’UTR comprises the nucleic acid sequence of CTGGAGGCTGGATTCCCCGTCTTGGGGCTTTCTGGGTCGGTCTGCCACGAGG TTCTGGTGTTCATTAAAAGTGTGCCCCTGGGCTGCCAGAAAGCCCCTCCCTGT GTGCTCTCTTGAGGGCTGTGGGGCCAAGGGGACCCTGGCTGTCTCAGCCCCC CGCAGAGCACGAGCCCCTGGTCCCCGCAAGCCCGCGGGCTGAGGATGATTC AGACAGGGCTGGGGTTATAAGAGGCTGCTGGGCCAGGGCTGTGGAGACGGA GCCCGGACCTCCACACTGAGCCATGC (SEQ ID NO: 140) or a nucleic acid sequence having reverse complementary thereto.

8. The TH promoter of any one of claims 5-7, comprising the nucleic acid sequence of CCCAAAGTAATCACATGGCAAACAAGCCCTGTCTAAATATCACGTGAGTGAC TAATGAGAACTGAATGCCGCTCTTATTGCTTTTCCCAATTATCCCTAAGTGGC TCCATCTGATGGCCTCATTAGGGATAATTGCTCTGGCATTTGGGTCTGACGAA TTAAAAAGCAATATTTGTATCAGTGGAAGACATTTGCTGAAAGGTTAAATCC ACATGCTGGAGGCTGGATTCCCCGTCTTGGGGCTTTCTGGGTCGGTCTGCCAC GAGGTTCTGGTGTTCATTAAAAGTGTGCCCCTGGGCTGCCAGAAAGCCCCTC CCTGTGTGCTCTCTTGAGGGCTGTGGGGCCAAGGGGACCCTGGCTGTCTCAG CCCCCCGCAGAGCACGAGCCCCTGGTCCCCGCAAGCCCGCGGGCTGAGGAT GATTCAGACAGGGCTGGGGTTATAAGAGGCTGCTGGGCCAGGGCTGTGGAG ACGGAGCCCGGACCTCCACACTGAGCCATGC (SEQ ID NO: 139) or GCATGGCTCAGTGTGGAGGTCCGGGCTCCGTCTCCACAGCCCTGGCCCAGCA GCCTCTTATAACCCCAGCCCTGTCTGAATCATCCTCAGCCCGCGGGCTTGCGG GGACCAGGGGCTCGTGCTCTGCGGGGGGCTGAGACAGCCAGGGTCCCCTTG GCCCCACAGCCCTCAAGAGAGCACACAGGGAGGGGCTTTCTGGCAGCCCAG GGGCACACTTTTAATGAACACCAGAACCTCGTGGCAGACCGACCCAGAAAG CCCCAAGACGGGGAATCCAGCCTCCAGCATGTGGATTTAACCTTTCAGCAAA TGTCTTCCACTGATACAAATATTGCTTTTTAATTCGTCAGACCCAAATGCCAG AGCAATTATCCCTAATGAGGCCATCAGATGGAGCCACTTAGGGATAATTGGG AAAAGCAATAAGAGCGGCATTCAGTTCTCATTAGTCACTCACGTGATATTTA GACAGGGCTTGTTTGCCATGTGATTACTTTGG (SEQ ID NO: 141).

9. A nucleic acid molecule comprising:(a) a nucleic acid sequence encoding a CRISPR-based endonuclease;(b) a nucleic acid sequence encoding one or more polypeptide having an enzymatic activity;(c) a nucleic acid sequence of one or more guide RNA targeting(i) a neurodegenerative disease (NDD)-relevant gene;(ii) a promoter region of the NDD-relevant gene;(iii) an intron of the NDD-relevant gene or flanking sequence thereof;(iv) an untranslated region (UTR) of the NDD-relevant gene; or(v) any combination thereof, and(d) one or more neuron specific regulatory element operably linked to the CRISPR- based endonuclease and / or the one or more polypeptide having an enzymaticactivity, wherein the one or more neuron specific regulatory element comprises the engineered TH promoter of any one of claims claim 1-8.

10. The nucleic acid molecule of claim 9, wherein the CRISPR-based endonuclease and the one or more polypeptide having the enzymatic activity are encoded as a fusion protein, optionally wherein the CRISPR-based endonuclease and the one or more polypeptide having the enzymatic activity are linked by at least one linker.

11. The nucleic acid molecule of claim 9 or 10, wherein the CRISPR-based endonuclease is deactivated.

12. The nucleic acid molecule of any one of claims 9-11, wherein the CRISPR-based endonuclease is a deactivated Cas9 (dCas9).

13. The nucleic acid molecule of claim 12, wherein the dCas9 is selected from a deactivated Staphylococcus aureus Cas9 (dSaCas9), deactivated Streptococcus pyogenes Cas9 (dSpCas9), deactivated Campylobacter jejuni Cas9 (dCjCas9), or variant dCas9 endonuclease.

14. The nucleic acid molecule of claim 13, wherein the dCas9 is dSaCas9.

15. The nucleic acid molecule of claim 14, wherein the dSaCas9 comprises the amino acid sequence of SEQ ID NO:9 or SEQ ID NO: 11, or an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO:9 or SEQ ID NO: 11 or a fragment thereof either.

16. The nucleic acid molecule of claim 13, wherein the dCas9 is dCjCas9.

17. The nucleic acid molecule of claim 16, wherein the dCjCas9 comprises the amino acid sequence of SEQ ID NO: 7, or an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 7 or a fragment thereof.

18. The nucleic acid molecule of any one of claims 9-17, wherein the enzymatic activity of the one or more polypeptide comprises transcription activation activity, transcriptionrepression activity, transcription release factor activity, histone modification activity, nucleic acid association activity, methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, or any combination thereof.

19. The nucleic acid molecule of claim 18, wherein the enzymatic activity of the one or more polypeptides comprises transcription repression activity.

20. The nucleic acid molecule of any one of claims 9-19, wherein the one or more encoded polypeptide having enzymatic activity is selected from heterochromatin protein la (HP la), heterochromatin protein lb (HP lb), methyl -CpG-binding domain protein 1 (MBD1), methyl-CpG-binding domain protein 2, Krtippel-Associated Box (KRAB), nuclear inhibitor of protein phosphatase-1 (NIPP1), methyl-CpG binding protein 2 (MeCP2), DNA (cytosine-5)-methyltransferase 3 A (DNMT3 A), any combination thereof, or any fusion thereof.

21. The nucleic acid molecule of claim 20, wherein the one or more polypeptide having the enzymatic activity comprises KRAB and MeCP2.

22. The nucleic acid molecule of claim 21, wherein the KRAB and MeCP2 are encoded as a KRAB-MeCP2 fusion protein (KRAB-MeCP2), optionally wherein the KRAB and MeCP2 are linked by at least one linker.

23. The nucleic acid molecule of claim 22, wherein the KRAB-MeCP2 comprises the amino acid sequence of SEQ ID NO: 17 or SEQ ID NO: 18, or an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO: 17 orSEQ ID NO: 18, or a fragment thereof either.

24. The nucleic acid molecule of any one of claims 9-23, wherein the NDD-relevant gene is selected from APOE, APP, ATXN2, CHMP2B, DCTN1, FIG4, FUS, GBA, GRN, HNRNPA1, HTT, LRRK2, MATR3, OPTN, PARK7, PFN1, PRPH, PSEN1, SETX, SIGMAR1, SNCA, SOD1, SPG11, SQSIM1, TARDBP, TBK1, TBP, TRPM7, TUBA4A, UBQLN2, UCHL1, VAPB, VCP, VPS35, a fragment thereof, a variant thereof, or a chimera thereof.

25. The nucleic acid molecule of any one of claims 9-24, wherein the NDD-relevant gene is a synuclein alpha (SNCA) gene.

26. The nucleic acid molecule of claim 25, wherein the least one gRNA targets an intron of the SNCA gene or flanking sequence thereof.

27. The nucleic acid molecule of claim 26, wherein the at least one gRNA targets intron 1 of the SNCA gene.

28. The nucleic acid molecule of any one of claims 9-27, wherein the at least one gRNA comprises the nucleic acid sequence set forth in any one of SEQ ID NO:46,SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, or SEQ ID NO:68.

29. The nucleic acid molecule of any one of claims 9-28, further comprising one or more additional regulatory elements.

30. The nucleic acid molecule of claim 29, wherein the one or more additional regulatory elements are selected from one or more primer binding sites (PBS), one or more splice donor (SD) sites, one or more splice acceptor (SA) sites, one or more central polypurine tracts (cPPT), one or more polypurine tracts (PPT), one or more Rev Response elements (RRE), one or more Woodchuck Hepatitis Virus Posttranscriptional Regulatory Elements (WPRE), one or more retroviral vector packaging elements, or any combination thereof.

31. A vector, comprising the engineered TH promoter of any one of claims 1-8, or the nucleic acid molecule of any one of claims 9-30.

32. A viral vector, comprising the engineered TH promoter of any one of claims 1-8, or the nucleic acid molecule of any one of claims 9-30.

33. The viral vector of claim 32, wherein the viral vector is selected from an adeno- associated virus-derived viral vector (AAV vector), adenovirus-derived viral vector (AV vector), lenti virus-derived viral vector (LV vector), Moloney murine leukemia virus- derived viral vector (MMLV vector), murine stem cell virus-derived viral vector (MSCV vector), baculovirus-derived viral vector (BV vector), vesicular stomatitis virus-derived viral vector (VSV vector), herpes simplex virus-derived viral vector (HSV vector), vaccinia virus-derived viral vector (VV vector), or a retrovirus-derived viral vector (RV vector).

34. The viral vector of claim 32 or 33, wherein the viral vector is an AAV vector.

35. The viral vector of claim 32 or 33, wherein the viral vector is an LV vector.

36. The viral vector of any one of claims 32-34, comprising a nucleic acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or greater than 95% identity to the sequence set forth in SEQ ID NO:77; SEQ ID NO: 112; SEQ ID NO: 116; SEQ ID NO: 117; SEQ ID NO: 118; SEQ ID NO: 121; SEQ ID NO: 122; SEQ ID NO: 123; SEQ ID NO: 124; SEQ ID NO: 125, or a sequence set forth in TABLE 2, or a nucleic acid sequence having reverse complementarity to thereto, or functional fragments thereof.

37. A host cell, comprising(a) the engineered TH promoter of claim 1 or 8;(b) the nucleic acid molecule of any one of claims 9-30;(c) the vector of claim 31 ; or(d) the viral vector of any one of claims 32-36.

38. A composition comprising:(a) a recombinant CRISPR-based endonuclease;(b) one or more recombinant polypeptide having an enzymatic activity, wherein the CRISPR-based endonuclease and the one or more polypeptides are recombinantly expressed using the TH promoter of any one of claims claim 1-8, and optionally(c) one or more guide RNA targeting(i) a neurodegenerative disease (NDD) -relevant gene;(ii) a promoter region of the NDD-relevant gene;(iii) an intron of the NDD-relevant gene or flanking sequence thereof;(iv) an untranslated region (UTR) of the NDD-relevant gene; or(v) or any combination thereof.

39. A pharmaceutical composition comprising(a) the engineered TH promoter of claim 1 or 8;(b) the nucleic acid molecule of any one of claims 9-30;(c) the vector of claim 31 ;(d) the viral vector of any one of claims 32-36;(e) the host cell of claim 37; or(f) the composition of claim 38,and a pharmaceutically acceptable carrier, diluent and / or excipient.

40. A means for modulating a dopaminergic neuron, comprising(a) the engineered TH promoter of claim 1 or 8;(b) the nucleic acid molecule of any one of claims 9-30;(c) the vector of claim 31 ;(d) the viral vector of any one of claims 32-36;(e) the host cell of claim 37;(f) the composition of claim 38; or(g) the pharmaceutical composition of claim 39.

41. A kit, compri si ng(a) the engineered TH promoter of claim 1 or 8;(b) the nucleic acid molecule of any one of claims 9-30;(c) the vector of claim 31 ;(d) the viral vector of any one of claims 32-36;(e) the host cell of claim 37;(f) the composition of claim 38;(g) the pharmaceutical composition of claim 39; or(h) the means for modulating a dopaminergic neuron of claim 40, and instructions for use.

42. A method of effecting genetic or epigenetic modulation in a dopaminergic neuron, the method comprising contacting the dopaminergic neuron with(a) the engineered TH promoter of claim 1 or 8;(b) the nucleic acid molecule of any one of claims 9-30;(c) the vector of claim 31 ;(d) the viral vector of any one of claims 32-36;(e) the host cell of claim 37;(f) the composition of claim 38;(g) the pharmaceutical composition of claim 39; or(h) the means for modulating a dopaminergic neuron of claim 40.

43. A method of in vivo modulation of expression of a neurodegenerative disease (NDD)- relevant gene in a dopaminergic neuron-specific manner in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of(a) the engineered TH promoter of claim 1 or 8;(b) the nucleic acid molecule of any one of claims 9-30;(c) the vector of claim 31 ;(d) the viral vector of any one of claims 32-36;(e) the host cell of claim 37;(f) the composition of claim 38;(g) the pharmaceutical composition of claim 39; or(h) the means for modulating a dopaminergic neuron of claim 40, wherein the therapeutically effective amount is an amount sufficient to modulate expression of the NDD-relevant gene in the subj ect.

44. The method of claim 43, wherein the NDD-relevant gene is SNCA.

45. A method of treating, preventing, or ameliorating one or more symptom of a neurodeg enerative disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of(a) the engineered TH promoter of claim 1 or 8;(b) the nucleic acid molecule of any one of claims 9-30;(c) the vector of claim 31 ;(d) the viral vector of any one of claims 32-36;(e) the host cell of claim 37;(f) the composition of claim 38;(g) the pharmaceutical composition of claim 39; or(h) the means for modulating a dopaminergic neuron of claim 40, wherein the therapeutically effective amount is an amount sufficient to reduce one or more pathological phenotype associated with the neurodegenerative disease or disorder.

46. The method of claim 45, wherein the NDD-relevant gene is SNCA.

47. A method of treating, preventing, or ameliorating one or more symptom of a synucleinopathy in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of(a) the engineered TH promoter of claim 1 or 8;(b) the nucleic acid molecule of any one of claims 9-30;(c) the vector of claim 31 ;(d) the viral vector of any one of claims 32-36;(e) the host cell of claim 37;(f) the composition of claim 38;(g) the pharmaceutical composition of claim 39; or(h) the means for modulating a dopaminergic neuron of claim 40, wherein the therapeutically effective amount is an amount sufficient to reduce one or more pathological phenotype associated with the synucleinopathy.

48. The method of claim 47, wherein the NDD-relevant gene is SNCA.

49. The method of claim 47 or 48, wherein the synucleinopathy is selected from Parkinson’s disease (PD) or dementia with Lewy bodies (DLB).

50. The method of any one of claims 43-49, wherein the administration to the subject comprises intravenous administration, intracerebral administration, intra-CSF administration, intracerebroventricular (ICV) administration, intraventricular administration, intra-cisterna magna (ICM) administration, intraparenchymal administration, intrathecal (lumbar, cisternal, or both) administration, or any combination thereof.

51. The method of any one of claims 43-50, further comprising administering to the subject a therapeutically effective amount of one or more additional therapeutic agent.

52. The method of claim 51, wherein the one or more additional therapeutic agent comprises an immune modulator.

53. The method of claim 52, wherein the immune modulator is selected from methotrexate, rituximab, intravenous gamma globulin, Tacrolimus, SVP-Rapamycin, bortezomib, or a combination thereof.

Images