Method and composition for preventing or treating myopia

Abstract

The purpose of the present invention is to provide a method for preventing or treating myopia, and a composition that is used therein. The present invention provides a method and a composition that are for inhibiting, ameliorating, or treating myopia by administering berberine, taurine, lipoic acid, a salt of any of these, or a derivative of any of these.

Description

Methods and compositions for preventing or treating myopia

[0001] The present invention relates to methods and compositions for preventing or treating myopia, more specifically, to compositions that act on immune cells in the choroid to inhibit the progression of myopia, more specifically, by inducing polarization into M2 macrophages or by modulating the function of choroidal resident immune cells, such as by administering a mast cell stabilizer, a chemical mediator release inhibitor, or lactic acid bacteria.The present invention also relates to methods and compositions for preventing or treating myopia by administering berberine, taurine, or lipoic acid, or salts thereof, or derivatives thereof.

[0002] Myopia refers to a condition in which the focal spot is focused in front of the retina due to axial elongation of the eye; the longer the axial length, the more severe the myopia. As the prevalence of myopia increases, there has been growing interest in the factors involved in the development of myopia and methods for slowing and preventing myopia progression. Recent studies have suggested that the choroid is important in regulating ocular growth and the development of myopia, and choroidal thinning has been shown to be a structural characteristic of myopia. The negative correlation between choroidal thickness and axial length suggests that changes in choroidal thickness may be a predictive biomarker for axial elongation. However, the detailed mechanisms by which the choroid contributes to the development and progression of myopia remain unclear.

[0003] The choroid, a tissue rich in fine blood vessels that covers the outer retina, not only supplies oxygen and nutrients to retinal cells but also growth factors involved in tissue remodeling of the outer sclera and regulating eye growth. A decrease in choroidal thickness or blood flow contributes to scleral ischemia and hypoxia, which are thought to affect scleral structural changes that lead to axial elongation. Therefore, maintaining or increasing choroidal thickness and blood flow is attracting attention as a new target for the prevention and treatment of myopia.

[0004] Methods have been proposed to slow the progression of myopia by maintaining or increasing choroidal thickness, such as crocetin intake (see Non-Patent Document 1) and violet light irradiation (Non-Patent Document 2).

[0005] Crocetin is known to have anti-inflammatory and immunomodulatory effects, and is known to exert its effects by adjusting the balance of Th1 / Th2 and Th17 / Treg in T cells and suppressing the NF-κB pathway in cells that produce inflammatory mediators (TNF-α, IL-6, IFN-γ, etc.), such as macrophages (Non-patent documents 3-5).

[0006] The choroid contains 13 types of cells, four of which are immune cells. Tissue-resident immune cells are responsible for maintaining tissue homeostasis and structure in addition to immune responses. For example, it has been reported that choroidal thinning occurs in mice lacking macrophages or mice in which mast cell degranulation is induced (Non-Patent Documents 6-7).

[0007] Patent Document 1 describes that lipoic acid and its derivatives are effective in treating presbyopia and cataracts. Patent Document 2 also describes that lipoic acid choline ester is effective in treating presbyopia. However, Patent Documents 1 and 2 do not describe or suggest the relationship between lipoic acid and its derivatives and myopia.

[0008] International Publication No. 2009 / 111633 Brochure Patent No. 7091318

[0009] Mori et al., Sci Rep. 2019. 22;9(1):295.Jiang et al. Proc Natl Acad Sci USA. 2021. 1;118(22):e2018840118.Oxid Med Cell Longev. 2021 Sep 10;2021:6631929.Eur J Pharmacol. 2012 Jan 15;674(2-3):391-6.Biofactors. 2023 Feb 6. doi: 10.1002 / biof.1942.Elife. 2020 Apr 1;9:e55564.FASEB J. 2020 Aug;34(8):10117-10131.

[0010] The present disclosure aims to provide a method for preventing or treating myopia and a composition used therein, particularly a composition that targets choroid-resident immune cells, particularly macrophages and mast cells.

[0011] Myopia is a major cause of visual impairment and has emerged as a global public health concern. One of the main structural characteristics of myopia is a corresponding reduction in choroidal thickness, and evidence suggests that choroidal macrophages play a critical role in maintaining choroidal thickness. Nevertheless, the influence of choroidal macrophages on myopia remains unclear. Here, we discovered that continuous intraperitoneal injection of clodronate liposomes depletes choroidal macrophages and induces myopia, confirming their crucial role in the development of myopia. Based on the phenotypic characteristics of macrophages, experiments were then designed to investigate the effects of different macrophage polarization directions on the development of myopia. We discovered that lipopolysaccharide (LPS) injection can induce the polarization of choroidal M1 macrophages, leading to a reduction in choroidal thickness and myopia. Conversely, injection of IL-4 or IL-13 induces polarization of choroidal M2 macrophages, thickening the choroid and suppressing myopia progression. Furthermore, we demonstrated that the opposing effects of M1 and M2 macrophages on myopia progression may be related to their influence on choroidal thickness, inflammation, and oxidative stress responses. These findings establish the importance of choroidal macrophages in the development of myopia and offer new strategies for myopia treatment.

[0012] That is, the present inventors have found that administration of berberine, taurine, or lipoic acid, or salts thereof, or derivatives thereof is effective in preventing and treating myopia.

[0013] Furthermore, the present inventors have found that polarization of choroidal macrophages into M2 macrophages suppresses choroidal thinning and is effective in preventing and treating myopia.

[0014] Furthermore, mast cells are distributed in large numbers around small blood vessels and are also present in the choroid, a tissue composed of blood vessels, suggesting their involvement in maintaining the morphology of the choroid. The present inventors have found that the progression of myopia is suppressed by instilling a drug (mast cell stabilizer) that inhibits mast cell degranulation. Specifically, the present inventors have found that the progression of myopia is suppressed by instilling a mast cell stabilizer (sodium cromoglycate, pemirolast potassium), a type of antiallergic drug, into a mouse model of myopia induced by wearing minus lenses. Furthermore, the instillation of another antiallergic drug, an antihistamine (levocabastine), into mice undergoing myopia induction by wearing minus lenses did not suppress the progression of myopia.

[0015] Furthermore, it is known that administration of lactic acid bacteria such as Lactobacillus paracasei induces and activates polarization toward M2 macrophages. The present inventors have found that administration of lactic acid bacteria such as Lactobacillus paracasei inhibits the progression of myopia. Taking these findings into account, along with the findings of Non-Patent Documents 6 and 7, it is believed that maintaining the choroidal structure (thickness) through intervention targeting immune cells resident in the choroid would inhibit the progression of myopia. These findings suggest that a composition that targets immune cells present in the choroid, such as macrophages and mast cells, and induces their respective properties to an appropriate state would have the effect of inhibiting the progression of myopia. The present invention is based on these findings and encompasses the following aspects.

[0016] [Aspect A-1] A composition for use in preventing or treating myopia, comprising an M2 macrophage polarization inducer and / or a mast cell stabilizer. [Aspect A-2] The composition according to Aspect A-1, wherein the M2 macrophage polarization inducer comprises at least one selected from the group consisting of berberine, taurine, and salts thereof and derivatives thereof, and the mast cell stabilizer comprises at least one selected from the group consisting of azulene sulfonic acid, taurine, and salts thereof and derivatives thereof. [Aspect A-3] The composition according to Aspect A-1 or A-2, wherein the prevention or treatment of myopia is based on the suppression of at least one selected from the group consisting of a decrease in refractive index, axial elongation, and choroidal thinning. [Aspect A-4] The composition according to Aspect A-1 or A-2, wherein the dosage form is an eye drop. [Aspect A-5] A method for suppressing or treating myopia, comprising administering a therapeutically effective amount of an M2 macrophage polarization inducer and / or a mast cell stabilizer to a subject in need of treatment. [Aspect A-6] Use of an M2 macrophage polarization inducer and / or a mast cell stabilizer in the manufacture of a medicament for suppressing or treating myopia. [Aspect B-1] A method for suppressing, ameliorating, or treating myopia, comprising administering a therapeutically effective amount of berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof to a subject in need of treatment. [Aspect B-2] The method according to Aspect 1, wherein berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof is contained in a pharmaceutical composition, supplement, or food. [Aspect B-3] The method according to Aspect 1, wherein a decrease in refraction, axial elongation, and / or choroidal thinning are suppressed. [Aspect B-4] A composition for suppressing or treating myopia, containing a therapeutically effective amount of berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof. [Aspect B-5] A supplement for suppressing or improving myopia, containing an effective amount of berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof.[Aspect B-6] A food for suppressing or improving myopia, comprising an effective amount of berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof. [Aspect B-7] Use of berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof, in the manufacture of a medicament for suppressing or treating myopia. [Aspect B-8] Use of berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof, for suppressing or treating myopia. [Aspect B-9] A composition for use in suppressing or treating myopia, comprising an M2 macrophage polarization inducer and / or a mast cell stabilizer. [Aspect B-10] The composition according to Aspect 9, wherein the M2 macrophage polarization inducer comprises at least one selected from the group consisting of berberine, taurine, and salts thereof and derivatives thereof, and the mast cell stabilizer comprises at least one selected from the group consisting of azulene sulfonic acid, taurine, and salts thereof and derivatives thereof. [Aspect B-11] The composition according to Aspect 9 or 10, wherein the effect is based on suppressing at least one selected from the group consisting of a decrease in refractive index, axial elongation, and choroidal thinning. [Aspect B-12] The composition according to any one of Aspects 9 to 11, wherein the dosage form is an eye drop. [Aspect B-13] A method for suppressing or treating myopia, comprising administering a therapeutically effective amount of an M2 macrophage polarization inducer and / or a mast cell stabilizer to a subject in need of such treatment. [Aspect B-14] Use of an M2 macrophage polarization inducer and / or a mast cell stabilizer in the manufacture of a medicament for suppressing or treating myopia.

[0017] The present disclosure provides a novel method for preventing and treating myopia by administering berberine, taurine, or lipoic acid, or a salt or derivative thereof. The present disclosure also provides a novel method for preventing and treating myopia by regulating the function of choroidal resident immune cells, more specifically, by inducing polarization into M2 macrophages in the choroid, or by administering a mast cell stabilizer, a chemical mediator release inhibitor, or lactic acid bacteria.

[0018] Myopia is associated with a persistent decrease in macrophages present in the choroid of 3- and 8-week-old mice. (A) Three-week-old wild-type C57BL / 6JJc1 mice were injected with 0.1 ml / 10 g body weight of clodronate liposomes or control liposomes once every two days (n = 12 per group). Refraction, axial length, and choroidal thickness were measured at baseline and 8 days after four injections using an infrared photorefractive optical coherence tomography (SD-OCT) system. (B) Compared with the control group, the clodronate liposome (Clolip)-injected group showed greater refractive change (P < 0.001), axial eye growth (P < 0.01), and a thinner choroid (P < 0.001). Bars represent the mean + / - standard deviation. (C) The percentage of macrophages in the choroid was analyzed using flow cytometry. Macrophages were identified as CD11b+ and F4 / 80+ cells present in the H3-UR region. The proportion of macrophages in the clodronate liposome-injected group was significantly reduced compared with the control liposome-injected group (P < 0.05). (D) Eight-week-old wild-type C57BL / 6JJc1 mice (four per group, unless otherwise indicated) were injected every two days with 0.1 ml / 10 g body weight of clodronate liposomes or control liposomes. Refraction, axial length, and choroidal thickness were measured at baseline and 8 days after four injections using an infrared photorefractive optical coherence tomography (SD-OCT) system. (E) Compared with the control group, the clodronate liposome (Clolip)-injected group showed significantly greater refractive change (P < 0.01), elongation of axial length (P < 0.05), and a thinner choroid (P < 0.01). Bars represent the mean ± standard deviation. Differences between groups were compared using a t-test. *P<0.05. **P<0.01. ***P<0.001. Polarization of M1 macrophages in the choroid can induce myopia in a mouse model. (A) Three-week-old wild-type C57BL / 6JJc1 mice were divided into two groups (four per group unless otherwise indicated). One group was intraperitoneally injected with 10 μl / g of LPS, and the other group was intraperitoneally injected with PBS. The injections continued for two weeks, and refraction, axial length, and choroidal thickness were measured weekly using an infrared photorefractive optical coherence tomography (SD-OCT) system.Choroidal blood perfusion was measured by OCTA. Additionally, choroidal samples were collected for real-time PCR. (B) Compared with the PBS-injected group, the LPS-injected group exhibited significantly greater refractive change (P<0.001), significant axial eye growth (P<0.001), and significantly thinner choroids (P<0.001). Bars represent the mean + / - standard deviation. (C) Choroidal blood perfusion was significantly reduced 2 weeks after LPS injection compared with the PBS-injected group. (D) TNF-α and IL-6 mRNA levels significantly increased 2 weeks after LPS injection. P values ​​were obtained from t-tests. *P<0.05. **P<0.01. ***P<0.001. Suppression of myopia progression by polarization of choroidal M2 macrophages was demonstrated in a mouse model of lens-induced myopia. Three-week-old wild-type C57BL / 6JJc1 mice were injected with 0.1 μg / 100 μl of IL-4, and choroidal samples were collected at 0, 24, and 48 hours post-injection for flow cytometry and real-time PCR. (A) Macrophages in the H3-UR region express CD11b. + and F4 / 80 + The proportion of macrophages was significantly increased after IL-4 injection (P<0.001). M2 macrophages in Q2-UR cells expressed CD206 +M2 macrophages were identified as M2 macrophages. 48 hours after IL-4 injection, M2 macrophages were dramatically polarized (P<0.05). (B) Real-time PCR results showed that mRNA expression levels of Mrc1 and CD163 significantly increased 48 hours after IL-4 injection. (C) Three-week-old wild-type C57BL / 6JJc1 mice were divided into two groups and injected with 0.1 μg / 100 μl of IL-4 or PBS every other day to induce myopia (four injections per group unless otherwise indicated). Refraction, axial length, and choroidal thickness were measured using an infrared photorefractive optical coherence tomography (SD-OCT) system at the early (3-week-old) and final (6-week-old) stages of myopia induction. (D) Eyes treated with -30D lenses showed significantly greater refractive change (P<0.01), greater axial length elongation (P<0.05), and increased choroidal thickness (P<0.001) compared with eyes treated with 0D lenses from PBS-injected mice. Mice injected with 0.1 μg / 100 μl IL-4 showed significantly smaller refractive change (P<0.05), smaller changes in axial length (P<0.05), and a statistically significant positive change in choroidal thickness (P<0.001). Bars represent the mean + / - standard deviation. (E) To evaluate changes in choroidal blood perfusion, 3-week-old mice were divided into three groups: both eyes fitted with 0D lenses (control 0D group), binocular myopia induction (control -30D group), and binocular myopia induction by IL-4 injection once every other day (IL-4-30D group). Choroidal blood perfusion was assessed using OCTA at the early (3 weeks after birth) and final (6 weeks after birth) stages of myopia induction. Choroidal blood perfusion was significantly reduced in the control-30D group compared with the control-0D group. Therefore, choroidal blood perfusion was significantly improved in the IL-4-30D group compared with the control-30D group. (F) Mice used for choroidal blood perfusion measurements were euthanized at 6 weeks after birth, and choroids were collected for flow cytometry. Results showed that mice treated with -30D lenses and injected with IL-4 had a significantly higher percentage of M2 macrophages than mice treated with -30D lenses and injected with PBS. P values ​​correspond to comparisons performed using one-way ANOVA. *P<0.05; **P<0.01; ***P<0.001.The effect of macrophage polarization direction on oxidative stress response. (A) Experimental design for evaluating Nox2, Nox4, Mmp2, and Mmp9 mRNA expression in the choroid during M1 and M2 macrophage polarization. Three-week-old wild-type C57BL / 6JJc1 mice were injected with LPS to polarize M1 macrophages, and IL-4 was injected into the polarized M2 macrophages. The control group was injected with PBS. For real-time PCR and ELISA experiments, choroidal samples were collected 24 hours after LPS injection, 24 and 48 hours after IL-4 injection, and after PBS injection. (B) Comparison of Nox2, Nox4, Mmp2, and Mmp9 mRNA expression in the choroid between the control and M1 macrophage polarization groups showed a significant increase in the LPS-injected group. (C) Quantitative PCR analysis of the choroid 48 hours after IL-4 injection showed a corresponding decrease in Nox2, Mmp2, and Mmp9 mRNA expression, corresponding to M2 macrophage polarization. (D) ELISA analysis showed that choroidal 8-OHdG concentrations were decreased in the IL-4-injected group compared with the control group (P<0.01). Conversely, choroidal 8-OHdG concentrations were increased in the LPS-injected group compared with the IL-4-injected group (P<0.05). P values ​​indicate comparison with control, one-way ANOVA, or t-test. *P<0.05. **P<0.01. ***P<0.001. EPA administration inhibited the progression of myopia induced by LPS injection. Three-week-old wild-type C57BL / 6JJc1 mice were divided into three groups (n=4): control, LPS-injected, and LPS-administered with EPA. Changes in refraction, axial length, and choroidal thickness were measured after 3 weeks of feeding. (A) Compared to the large changes in refraction caused by LPS injection, the changes in refraction after EPA administration were smaller (P<0.01). (B) Compared to the increase in the ratio of axial length to body weight caused by LPS injection, EPA feeding decreased the ratio of axial length to body weight (P<0.001). (C) Choroidal thinning occurred in the LPS-injected group, but EPA administration significantly improved choroidal thickness (P<0.05). P values ​​indicate comparison with control using one-way analysis of variance. *P<0.05. **P<0.01. ***P<0.001.IL-13 injection inhibited myopia progression and increased choroidal blood perfusion in a mouse model of lens-induced myopia. (A) Choroidal samples were collected 48 hours after IL-13 and PBS injections and subjected to flow cytometry analysis designed to evaluate the optimal time for M2 macrophage polarization. (B) Flow cytometry analysis demonstrated that both the macrophage ratio and M2 macrophage ratio were significantly increased 48 hours after IL-13 injection compared with the PBS-injected group. (C) Three-week-old mice were divided into three groups: one group fitted with 0D lenses in both eyes (control 0D group), one group in which binocular myopia was induced (control-30D group), and one group in which binocular myopia was induced and injected with IL-13 (IL-13-30D group). IL-13 injections were administered every two days. Refraction, axial length, and choroidal thickness were measured using an infrared photorefractive optical coherence tomography (OCTA) system at the early (3 weeks after birth) and late (6 weeks after birth) stages of myopia induction. (D) The control-30D group showed significantly greater refractive change (P<0.001), greater axial length elongation (P<0.05), and thinner choroid (P<0.001) compared with the control-0D group. The IL-13-30D group showed significantly smaller refractive change (P<0.001), smaller axial length change (P<0.05), and a statistically significant positive change in choroidal thickness (P<0.001). Bars represent the mean + / - standard deviation. (E) Choroidal blood perfusion was measured using OCTA. Choroidal blood perfusion was significantly decreased in the control-30D group compared with the control-0D group. Correspondingly, choroidal blood perfusion was significantly improved in the IL-13-30D group compared with the control-30D group. (F) The proportion of M2 macrophages in the choroid was significantly increased in the IL-13-30D group compared with the control-30D group. P values ​​indicate comparison with control by one-way analysis of variance or t-test. *P<0.05. **P<0.01. ***P<0.001. Continuous berberine instillation can suppress the progression of myopia in mice. Three-week-old wild-type C57BL / 6JJc1 mice were divided into control 0D group, control-30D group, 2% DMSO-30D group, and berberine-30D group (n=4).The instillation frequency of 2% DMSO and 0.26 mg / ml berberine was once daily. After 3 weeks of instillation, changes in refraction, axial length, and choroidal thickness were measured using SD-OCT. (A) Compared with the control 0D group, changes in refraction were observed in the control-30D group and the 2% DMSO group (P<0.001). Compared with the 2% DMSO group, smaller changes in refraction were observed in the berberine-30D group (P<0.001). (B) Compared with the axial length increases in the control-30D group and the 2% DMSO group (P<0.05), the berberine-30D group showed smaller increases in axial length (P<0.05). (C) Compared with the control 0D group, choroidal thickness decreased in the control-30D group and the 2% DMSO-30D group (P<0.001). Conversely, choroidal thickness improved in the berberine-30D group compared with the 2% DMSO-30D group (P<0.001). P values ​​indicate a comparison with the control using one-way analysis of variance. *P<0.05. **P<0.01. ***P<0.001. Results of myopia induction by LPS administration. (A) Schematic diagram of the experimental schedule. (B) Graphs showing changes in refractive index (left), axial length (center), and choroidal thickness (right). Graphs showing changes in expression of M1 macrophage marker genes and oxidative stress-related genes following LPS administration. Results of M2 macrophage polarization induction by IL-4 administration. (A) Schematic diagram of the experimental schedule. (B) Graphs showing changes in CD206 protein and phosphorylated STAT6 expression in the choroid following IL-4 administration. (C) Graphs showing changes in mRNA expression of CD163 and CD206 following IL-4 administration. Graphs showing changes in the expression of M2 macrophage marker genes and oxidative stress-related genes due to IL-4 administration. Results of an experiment to suppress myopia progression by IL-4 administration. (A) A diagram showing the experimental schedule. (B) A diagram showing changes in refraction (left), axial length (center), and choroidal thickness (right) due to IL-4 administration during the myopia induction period. Results of myopia progression suppression and M2 macrophage polarization induction by IL-13 administration. (A) A diagram showing the experimental schedule.(B) Graphs showing changes in refraction (upper left), axial length (upper right), choroidal thickness (lower left), and blood flow (lower right) following IL-13 administration during the myopia induction period. (C) Graphs showing changes in macrophage count and M2 macrophage ratio following myopia induction and IL-13 administration. Results showing the myopia-suppressing effect of mast cell stabilizer eye drops. (A) Graph showing change in axial length. (B) Graph showing change in refraction. (C) Graph showing change in choroidal thickness. The left graph shows the control group vs. the pemirolast potassium eye drop group, and the right graph shows the control group vs. the cromoglycate eye drop group. *p<0.05, **p<0.01, ***p<0.001, student's t-test. Graphs comparing the myopia-suppressing effects of mast cell stabilizer eye drops and histamine receptor inhibitors. (A) Graph showing change in axial length. (B) Graph showing the change in refractive index. (C) Graph showing the change in choroidal thickness. From left to right, the groups are the control group, the levocabastine eye drop group (a histamine receptor inhibitor), and the pemirolast potassium eye drop group (a mast cell stabilizer). *p<0.05, **p<0.01, ***p<0.001, student's t-test. Results show the myopia progression inhibitory effect of Lactobacillus paracasei administration. (A) Graph showing the change in axial length. (B) Graph showing the change in refractive index. (C) Graph showing the change in choroidal thickness. The left side shows the control group, and the right side shows the Lactobacillus paracasei-treated group. Graphs showing the myopia inhibitory effect of berberine chloride administered once or three times daily. (A) Graph showing the experimental schedule. (B) Graph showing the refractive index and its change in the groups with and without myopia induction. (C) A graph showing the axial length and its change in the group with and without myopia induction. A graph showing the myopia suppression effect of administration of berberine chloride, sodium azulene sulfonate, or taurine. (A) A diagram showing the experimental schedule. (B) A graph showing the change in refractive value and its difference in the group with and without myopia induction. (C) A graph showing the change in axial length and its difference in the group with and without myopia induction.(D) A graph showing the change in choroidal thickness and the difference therebetween between the group with and without myopia induction. A graph showing the myopia-suppressing effect of administration of berberine chloride and sodium azulene sulfonate. (A) A diagram showing the experimental schedule. (B) A graph showing the change in refraction between the group with and without myopia induction. (C) A graph showing the change in axial length between the group with and without myopia induction. (D) A graph showing the change in choroidal thickness between the group with and without myopia induction. A graph showing the myopia-suppressing effect of administration of berberine chloride and sodium azulene sulfonate, berberine chloride and taurine, or berberine chloride, sodium azulene sulfonate, and taurine. (A) A diagram showing the experimental schedule. (B) A graph showing the change in refraction between the group with and without myopia induction. (C) A graph showing the change in axial length between the group with and without myopia induction.

[0019] The present invention will be described in detail below. The present invention is not limited to the following embodiments and examples, and includes various modifications and applications within the scope of the gist of the present invention.

[0020] [Method for Suppressing or Treating Myopia] As described above, in recent years, it has become clear that choroidal thinning is involved in the onset of myopia. As a result of extensive research into factors that control this thinning, the present inventors have discovered that changes in the state (polarization) of macrophages in the choroid alter choroidal thickness and control the progression of myopia. Macrophages are classified into M1 and M2 macrophages. M1 macrophages are primarily involved in the initiation of inflammation, while M2 macrophages play an antagonistic role in terminating and suppressing inflammation. The present inventors have first discovered that inducing polarization of M1 macrophages in the choroid leads to choroidal thinning and the progression of myopia, while inducing polarization of M2 macrophages inhibits choroidal thinning and the progression of myopia. Mast cells are also found in large numbers around small blood vessels and in the choroid, a tissue composed of blood vessels, suggesting their involvement in maintaining choroidal morphology. The present inventors have found that instillation of a drug (mast cell stabilizer) that inhibits mast cell degranulation suppresses myopia progression. Furthermore, it is known that administration of lactic acid bacteria, such as Lactobacillus paracasei, induces and activates M2 macrophage polarization. The present inventors have found that administration of lactic acid bacteria, such as Lactobacillus paracasei, suppresses myopia progression. Thus, the present inventors have found that regulating the function of choroidal resident immune cells can suppress myopia progression. Thus, one aspect of the present disclosure relates to methods for inhibiting, ameliorating, or treating myopia by modulating the function of choroidal resident immune cells, more specifically, by polarizing macrophages into M2 macrophages in the choroid, or by administering a mast cell stabilizer, a chemical mediator release inhibitor, or lactic acid bacteria.One aspect of the present disclosure relates to a method for suppressing, ameliorating, or treating myopia by modulating the function of choroidal resident immune cells, more specifically, by inducing polarization to M2 macrophages in the choroid using an M2 macrophage polarization inducer, or by administering a mast cell stabilizer, a chemical mediator release inhibitor, or lactic acid bacteria. One aspect of the present disclosure relates to a method for suppressing a decrease in refraction, axial elongation, and / or choroidal thinning in a subject in need of treatment, comprising modulating the function of choroidal resident immune cells, more specifically, by delivering an M2 macrophage polarization inducer to the subject's choroid, or administering a mast cell stabilizer, a chemical mediator release inhibitor, or lactic acid bacteria. Furthermore, one aspect of the present disclosure relates to a screening method for searching for substances that modulate the function of choroidal resident immune cells, such as components that promote polarization into M2 macrophages, in order to control choroidal thinning, which is a mechanism of myopia onset, and a screening method for searching for components that are effective in preventing and treating myopia.One aspect of the present disclosure relates to a method for suppressing, ameliorating, or treating myopia by administering berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof.

[0021] <Substances Modulating the Function of Choroidal-Resident Immune Cells> Substances modulating the function of choroidal-resident immune cells are substances that modulate the function of choroidal-resident immune cells. Preferred examples of substances modulating the function of choroidal-resident immune cells include substances that modulate the function of choroidal-resident immune cells to suppress inflammation in the choroid and substances that modulate the choroid to create an anti-inflammatory environment. Examples of choroidal-resident immune cells include macrophages and mast cells. Examples of substances modulating the function of choroidal-resident immune cells include M2 ​​macrophage polarization inducers, mast cell stabilizers, chemical mediator release inhibitors, and lactic acid bacteria.

[0022] <M2 Macrophage Polarization Inducers> Macrophages are classified into inflammatory M1 macrophages and anti-inflammatory M2 macrophages, which have different functions. They polarize and express specific functions in response to signals from cytokines, stimulatory components, and the like. Therefore, the M2 macrophage polarization inducers of the present disclosure include various substances involved in signal transduction that induces polarization into M2 macrophages in the choroid, and proteins, peptides, nucleic acid drugs, low-molecular-weight compounds, high-molecular-weight compounds, and the like can be used without particular limitation. Examples include cytokines such as IL-4 and IL-13 produced by Th2 cells, as well as the leucine zipper transcription factor c-Maf and the carbohydrate-binding lectin galectin-3. Furthermore, it is known that there are several populations of M2 macrophages, and in addition to the aforementioned IL-4 and IL-13 that induce M2a macrophages, other substances that can be cited as M2 macrophage polarization inducers in the present disclosure include IL-10 and glucocorticoid hormones (GCs) that are involved in the induction of M2c macrophages, and TLR2, TLR4, TLR7, TLR9 and their ligands (ligands for TLRs) that are involved in the induction of M2d macrophages.

[0023] Furthermore, examples of the M2 macrophage polarization inducer in the present disclosure include various low molecular weight compounds, for example, bisantrene dihydrochloride, triptolide, lovastatin, QS11, regorafenib, sorafenib, ixazomib, GW-843682X, KW 2449, axitinib, JTE 013, purmorphamine, arcyriaflavin A, dasatinib, NVP-LDE225, 1-naphthyl PP1 (1-naphthyl PP1), and the like. PP1), MGCD-265, bosutinib, berberine or a salt thereof, taurine or a salt thereof, retinol, tocopherol, cyanocobalamin, or a derivative thereof (e.g., retinol palmitate, tocopherol acetate), etc., preferably berberine or a salt thereof, more preferably berberine chloride.

[0024] Agonists of the above-mentioned substances can also be used as M2 macrophage polarization inducers. Those skilled in the art can evaluate whether a substance has the ability to induce M2 macrophage polarization by culturing cells, such as monocytic cell lines (RAW264 cells, J774 cells, U937 cells), mouse peritoneal macrophages, or bone marrow-derived macrophages, in a medium containing the substance to be evaluated, and using an in vitro evaluation system to evaluate the expression of M2 macrophage markers. In addition to the M2 macrophage polarization inducers specifically described herein, M2 macrophage polarization inducers suitable for use in the methods and compositions of the present disclosure can be obtained.

[0025] When the M2 macrophage polarization inducer is a protein or peptide, it can be administered to a subject in the form of DNA or RNA encoding it. The nucleic acid encoding the M2 macrophage polarization inducer can be administered to a subject using a plasmid or expression vector. The expression vector can be, for example, a viral vector, particularly an adenoviral vector, but is not limited to this. Other usable viral vectors include retrovirus, adeno-associated virus, poxvirus, baculovirus, vaccinia, herpes simplex, Epstein-Barr virus, geminivirus, and caulimovirus vectors. The nucleic acid encoding the M2 macrophage polarization inducer can contain regulatory elements for specifically expressing the protein in the choroid or RPE. That is, the nucleic acid encoding the M2 macrophage polarization inducer can be operably linked to regulatory elements such as a promoter or enhancer.

[0026] <Mast cell stabilizer> A mast cell stabilizer is also called a mast cell stabilizer or a mast cell stabilizing drug. A mast cell stabilizer is, for example, a drug that suppresses the release of allergens from mast cells, for example, a drug that stabilizes the cell membrane of mast cells to suppress the release of allergens from mast cells. Examples of mast cell stabilizers include ashitazanolast hydrate solution (Zeperin), amlexanox (Elix), pemirolast or a salt thereof (e.g., pemirolast potassium (Alegisal), pemirolast potassium (Pemilaston)), cromoglycic acid or a salt thereof (e.g., sodium cromoglycate (Intal)), tranilast or a salt thereof (e.g., tranilast (Rizaben), tranilast (Tramelas)), ibudilast (Ketas), β2-adrenergic agonist, cromolyn sodium, ketochi Examples of the anti-inflammatory drug include phen, methylxanthine, omalizumab, quercetin, azulene sulfonic acid or a salt thereof, taurine or a salt thereof, pyridoxine or a salt thereof (e.g., pyridoxine hydrochloride), tocopherol, or a derivative thereof (e.g., tocopherol acetate), and the like. Preferred examples include cromoglycic acid or a salt thereof, tranilast or a salt thereof, pemirolast or a salt thereof, azulene sulfonic acid or a salt thereof, and taurine or a salt thereof. More preferred examples include sodium azulene sulfonate and taurine.

[0027] <Chemical mediator release inhibitors> Chemical mediator release inhibitors are drugs that suppress allergic reactions by inhibiting the release of chemical mediators from immune cells such as mast cells. For example, they are drugs that stabilize the cell membrane of mast cells to prevent histamine and other substances from being released outside, and they are drugs that inhibit the release of allergens (substances that cause allergic reactions), such as histamine, LTB4, LTC4, LTD4, PGD2, TXB2, and PAF, from mast cells. Examples of chemical mediator release inhibitors include ashitazanolast hydrate solution (Zeperin), amlexanox (Elix), pemirolast potassium (Alegisal), pemirolast potassium (Pemilaston), cromoglycate sodium (Intal), tranilast (Rizaben), tranilast (Tramelas), ibudilast (Ketas), β2-adrenergic agonists, cromolyn sodium, cromoglycic acid, ketotifen, methylxanthines, omalizumab, pemirolast, and quercetin, and preferably cromoglycic acid or pemirolast, or a salt thereof.

[0028] <Lactic acid bacteria> Examples of lactic acid bacteria include homolactic acid bacteria and heterolactic acid bacteria. Examples of lactic acid bacteria include coccoid lactobacilli and rod-shaped lactobacilli. Examples of lactic acid bacteria include gram-positive bacteria, rod-shaped bacteria or coccoid bacteria, no spores, no motility, produce 50% or more lactic acid relative to the glucose consumed, and require niacin (B3). Examples of lactic acid bacteria include intestinal lactic acid bacteria, animal lactic acid bacteria, plant lactic acid bacteria, marine lactic acid bacteria, etc. Examples of lactic acid bacteria include lactobacilli and actinomycetes. Examples of Lactobacillales lactic acid bacteria include Lactobacillus lactic acid bacteria, Enterococcus lactic acid bacteria, Lactococcus lactic acid bacteria, Pediococcus lactic acid bacteria, Leuconostoc lactic acid bacteria, Streptococcus lactic acid bacteria, etc. Examples of Actinomycetes lactic acid bacteria include Bifidobacterium lactic acid bacteria. Examples of lactic acid bacteria of the genus Lactobacillus include Lactobacillus paracasei, Lactobacillus plantarum, Lactobacillus brevis, Lactobacillus delbrueckii, Lactobacillus acidophilus, Lactobacillus casei, Lactobacillus bulgaricus, Lactobacillus gasseri, Lactobacillus acidophilus, Lactobacillus fructivorans, Lactobacillus hilgardii, Lactobacillus rhamnosus, Lactobacillus plantarum, Lactobacillus casei Shirota, etc. Examples of lactic acid bacteria of the genus Enterococcus include Enterococcus faecalis and Enterococcus faecium, etc.Examples of lactic acid bacteria of the genus Lactococcus include Lactococcus lactis and Lactococcus cremoris. Examples of lactic acid bacteria of the genus Pediococcus include Pediococcus damnosus. Examples of lactic acid bacteria of the genus Leuconostoc include Leuconostoc mesenteroides. Examples of lactic acid bacteria of the genus Streptococcus include Streptococcus thermophiles and Streptococcus mutans. Examples of lactic acid bacteria of the genus Bifidobacterium include Bifidobacterium bifidum and Bifidobacterium adolescentis. Administration of Lactobacillus paracasei has been shown to improve the symptoms of non-alcoholic steatohepatitis by shifting hepatic Kupffer cells (resident liver macrophages) to the M2 state (Sohn et al., Dig Dis Sci, 2015 Nov;60(11):3340-50). Administration of Lactobacillus paracasei has been shown to alleviate blue light-induced retinal degeneration by activating M2 macrophages (Morita et al., Nutrients, 2018 Dec15;10(12):1991). Administration of Lactobacillus plantarum has been shown to alleviate colitis by promoting polarization from M1 to M2 macrophages (Jang et al., Int Immunopharmacol, 2014 Jul;21(1):186-92). Administration of Lactobacillus brevis is known to alleviate colitis by promoting polarization from M1 to M2 macrophages (Jang et al., J Appl Microbiol, 2013 Sep;115(3):888-96). Thus, lactic acid bacteria of the Lactobacillus order, such as the Lactobacillus genus, are known to induce and activate polarization to M2 macrophages.Therefore, the lactic acid bacterium is preferably a lactic acid bacterium of the order Lactobacillales, such as the genus Lactobacillus.

[0029] <Berberine> Berberine is a type of benzylisoquinoline alkaloid found in plants such as Phellodendron amurense (Rutaceae) and Coptis japonica (Ranunculaceae), and is represented by the following formula: Examples of berberine, its salts, or derivatives thereof include berberine chloride, berberine sulfate, berberine tannate, and the like.

[0030] <Taurine> Taurine is a substance with the structural formula H2N-CH2-CH2-SO3H. Taurine is also known as aminoethylsulfonic acid. The IUPAC name for taurine is 2-aminoethanesulfonic acid. Taurine is represented by the following formula: Examples of taurine, its salts, or derivatives thereof include tauroursodeoxycholic acid, hypotaurine, phosphorylated tau protein, taurocholic acid (TCA), and thiotaurine (TTAU).

[0031] <Lipoic acid> Lipoic acid is an optically active organic compound that is an essential cofactor for many enzymes, an antioxidant, and contains a carboxyl group and a cyclic disulfide. The oxidized form of lipoic acid is β-lipoic acid, and the reduced form is dihydrolipoic acid. An example of lipoic acid is shown by the following formula: Examples of lipoic acid, salts thereof, or derivatives thereof include α-lipoic acid, β-lipoic acid, dihydrolipoic acid, dextrorotatory lipoic acid, lipoic acid choline ester, and (R)-(+)-(7-hydroxy-2-oxo-2H-chromen-4-yl)methyl 5-(1,2-dithiolan-3-yl)pentanoate, which is represented by the following formula:

[0032] DDSs can be used to deliver choroid-resident immune cell function modulators, such as M2 macrophage polarization inducers, mast cell stabilizers, and chemical mediator release inhibitors, to the subject's choroid. For example, when the choroid-resident immune cell function modulators, such as M2 macrophage polarization inducers, mast cell stabilizers, and chemical mediator release inhibitors, are nucleic acids, DNA or RNA (messenger RNA) encoding the choroid-resident immune cell function modulators, such as M2 macrophage polarization inducers, mast cell stabilizers, and chemical mediator release inhibitors, can be administered to a subject using a DDS such as liposomes. Other available DDSs include charged lipids, nucleic acid-protein complexes, and biopolymers. Furthermore, choroid-resident immune cell function modulators, such as M2 macrophage polarization inducers, mast cell stabilizers, and chemical mediator release inhibitors, can be administered to a subject in the form of proteins. Administration can be by topical administration, for example, to the choroid.

[0033] Delivery of a choroid-resident immune cell function modulator, such as an M2 macrophage polarization inducer, a mast cell stabilizer, or a chemical mediator release inhibitor, to the subject's choroid may be achieved by transplanting cells that secrete a choroid-resident immune cell function modulator, such as an M2 macrophage polarization inducer, a mast cell stabilizer, or a chemical mediator, or berberine, taurine, lipoic acid, or a salt thereof, or a derivative thereof, into the subject. The cells that secrete a choroid-resident immune cell function modulator, such as an M2 macrophage polarization inducer, a mast cell stabilizer, or a chemical mediator, or berberine, taurine, lipoic acid, or a salt thereof, or a derivative thereof, may be, for example, retinal pigment epithelial cells (RPE). Alternatively, the cells may be genetically engineered to secrete substances that regulate the function of choroid-resident immune cells, such as M2 macrophage polarization inducers, mast cell stabilizers, and chemical mediators, or berberine, taurine, or lipoic acid, or salts or derivatives thereof.

[0034] The subject in the method for inhibiting or treating myopia of the present disclosure can be a mammal, including a human, or a non-human mammal, including a dog, cat, cow, or horse, but is preferably a human.

[0035] [Composition for Inhibiting or Treating Myopia (hereinafter also referred to as "Composition for Use in Inhibiting or Treating Myopia")] One aspect of the present disclosure relates to a composition for inhibiting, ameliorating, or treating myopia using an M2 macrophage polarization inducer, a mast cell stabilizer, a choroid-resident immune cell function modulator such as a chemical mediator release inhibitor, lactic acid bacteria, berberine, taurine, lipoic acid, or a salt thereof or a derivative thereof. More specifically, one embodiment of the present disclosure relates to a composition for inhibiting or treating myopia containing a therapeutically effective amount of an M2 macrophage polarization inducer, a mast cell stabilizer, a choroid-resident immune cell function modulator such as a chemical mediator release inhibitor, lactic acid bacteria, berberine, taurine, or lipoic acid, or a salt thereof or a derivative thereof. Such compositions can be used to deliver to the subject's choroid an M2 macrophage polarization inducer, a mast cell stabilizer, a choroid-resident immune cell function regulator such as a chemical mediator release inhibitor, lactic acid bacteria, berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof. Such compositions can be pharmaceutical compositions, foods, or supplements.

[0036] The pharmaceutical composition according to the present disclosure is administered, for example, to the eye. Examples of the administration form of the composition include eye drops (including instillation of eye ointment and eyewash), subconjunctival administration, intraconjunctival sac administration, and sub-Tenon administration.

[0037] The dosage form of the composition is not particularly limited, but examples thereof include eye drops, eye ointments, injections, patches, gels, inserts, etc., and eye drops are preferred. These can be prepared using conventional techniques commonly used in the art.

[0038] Eye drops can be prepared using an appropriate combination of isotonic agents such as sodium chloride, potassium chloride, and concentrated glycerin; buffers such as sodium phosphate, sodium acetate, and epsilon-aminocaproic acid; surfactants such as polyoxyethylene sorbitan monooleate, polyoxyl 40 stearate, and polyoxyethylene hydrogenated castor oil; stabilizers such as sodium citrate and sodium edetate; and preservatives such as parabens. The pH should be within the range acceptable for ophthalmic preparations, but is usually preferably within the range of 4 to 8. Eye ointments can be prepared using commonly used bases such as white petrolatum and liquid paraffin.

[0039] Furthermore, the pharmaceutical composition according to the present disclosure can be administered not only to the ocular topical route but also via any route of administration, such as enteral administration (oral, tube feeding, infusion, etc.) or parenteral administration (intravenous, intraarterial, transdermal, intramuscular injection, etc.). The dosage form of the composition used for these administration forms can be selected appropriately, and can be, for example, solid preparations such as tablets, granules, powders, capsules, and chewable preparations, or liquid preparations such as solutions, syrups, injections, and infusions. The pharmaceutical composition according to the present disclosure can contain other ingredients in appropriate amounts as long as they do not impair the effects of the present invention. Examples of other ingredients include any carrier, buffer, diluent, excipient, suspending agent, lubricant, adjuvant, vehicle, delivery system, emulsifier, tablet disintegrant, absorbent, preservative, surfactant, colorant, flavoring, or sweetener. These ingredients can be formulated singly or in appropriate combinations of two or more.

[0040] The content of the M2 macrophage polarization inducer, mast cell stabilizer, choroidal resident immune cell function regulator such as a chemical mediator release inhibitor, lactic acid bacteria, berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof in 100% by weight of the pharmaceutical composition can be appropriately set, for example, within the range of 0.001 to 99.99% by weight.

[0041] The dosage of the pharmaceutical composition according to the present disclosure is not particularly limited and can be appropriately selected depending on the dosage form, the age and body weight of the recipient, the degree of desired effect, etc. The dosage of the M2 macrophage polarization inducer, mast cell stabilizer, choroid-resident immune cell function regulator such as a chemical mediator release inhibitor, lactic acid bacteria, berberine, taurine, or lipoic acid, or a salt thereof, or a derivative thereof, can be, for example, 100 to 1,000,000 nmol, preferably 150 to 100,000 nmol, per day, and the administration frequency can be, for example, 1 to 100 times per month.

[0042] From the viewpoint of more effectively suppressing or treating myopia, the composition for use in the prevention or treatment of myopia according to the present disclosure preferably contains an M2 macrophage polarization inducer and / or a mast cell stabilizer, and more preferably contains an M2 macrophage polarization inducer and a mast cell stabilizer. When an M2 macrophage polarization inducer and a mast cell stabilizer are combined, a single component that functions as both an M2 macrophage polarization inducer and a mast cell stabilizer may be combined, or different components may be combined.

[0043] When different components are blended as the M2 macrophage polarization inducer and the mast cell stabilizer, preferred combinations and their mass ratios are shown in Table 1.

[0044] When the composition according to the present disclosure contains berberine, a salt thereof, or a derivative thereof as an M2 macrophage polarization inducer, the content of berberine, a salt thereof, or a derivative thereof in 100% (w / v) of the composition is preferably 0.005 to 0.025% (w / v), more preferably 0.012 to 0.025% (w / v), and even more preferably 0.025% (w / v), from the viewpoint of more effectively suppressing or treating myopia.

[0045] When the composition according to the present disclosure contains azulene sulfonic acid, a salt thereof, or a derivative thereof as a mast cell stabilizer, the content of azulene, a derivative thereof, or a salt of the derivative in 100 (w / v)% of the composition is preferably 0.04 to 0.02 (w / v)%, more preferably 0.01 to 0.02 (w / v)%, and even more preferably 0.02 (w / v)%, from the viewpoint of more effectively suppressing or treating myopia.

[0046] When the composition according to the present disclosure contains taurine, or a salt thereof, or a derivative thereof as an M2 macrophage polarization inducer or mast cell stabilizer, the content of taurine, or a salt thereof, or a derivative thereof in 100 (w / v)% of the composition is preferably 0.1 to 1 (w / v)%, more preferably 0.5 to 1 (w / v)%, and even more preferably 1 (w / v)%, from the viewpoint of more effectively suppressing or treating myopia.

[0047] When the composition of the present disclosure contains cromoglycic acid, its salt, or a derivative thereof as a mast cell stabilizer, the content of cromoglycic acid, its derivative, or a salt of the derivative in 100 (w / v)% of the composition is preferably 1 to 2 (w / v)% from the viewpoint of more effectively suppressing or treating myopia.

[0048] When the composition of the present disclosure contains tranilast, a salt thereof, or a derivative thereof as a mast cell stabilizer, the content of tranilast, a derivative thereof, or a salt of said derivative in 100 (w / v)% of the composition is preferably 0.25 to 0.5 (w / v)% from the viewpoint of more effectively suppressing or treating myopia.

[0049] When the composition of the present disclosure contains pyridoxine, its salt, or a derivative thereof as a mast cell stabilizer, the content of pyridoxine, its derivative, or a salt of said derivative in 100 (w / v)% of the composition is preferably 0.01 to 0.1 (w / v)% from the viewpoint of more effectively suppressing or treating myopia.

[0050] When the composition according to the present disclosure contains tocopherol, a salt thereof, or a derivative thereof as an M2 macrophage polarization inducer or a mast cell stabilizer, the content of tocopherol, a derivative thereof, or a salt of the derivative in 100 (w / v)% of the composition is preferably 0.005 to 0.05 (w / v)% from the viewpoint of more effectively suppressing or treating myopia.

[0051] When the composition according to the present disclosure contains retinol, a salt thereof, or a derivative thereof as a mast cell stabilizer, the content of retinol, a derivative thereof, or a salt of said derivative in 100 (w / v)% of the composition is preferably 10,000 to 50,000 I.U. / 100 mL, from the viewpoint of more effectively suppressing or treating myopia.

[0052] When the composition according to the present disclosure contains an M2 macrophage polarization inducer and / or a mast cell stabilizer, the composition is preferably in the form of eye drops.

[0053] When the composition according to the present disclosure is an eye drop preparation containing an M2 macrophage polarization inducer and / or a mast cell stabilizer, from the viewpoint of more effectively suppressing or treating myopia, the eye drop preparation is preferably administered at least once a day, and more preferably 1 to 6 times a day.

[0054] When the composition according to the present disclosure is an eye drop containing an M2 macrophage polarization inducer and / or a mast cell stabilizer, from the viewpoint of more effectively suppressing or treating myopia, the eye drop is preferably administered in an amount of one or more drops at a time, and more preferably one to three drops at a time.

[0055] When the composition according to the present disclosure is an eye drop containing an M2 macrophage polarization inducer and / or a mast cell stabilizer, it is preferably administered for 3 weeks or longer in order to more effectively suppress or treat myopia.

[0056] From the viewpoint of more effectively inhibiting or treating myopia, the composition according to the present disclosure is preferably administered during the period of normal axial length elongation that occurs as a result of growth.

[0057] From the viewpoint of more effectively suppressing or treating myopia, the composition according to the present disclosure is preferably for pediatric use. In the present disclosure, "child" means a child under the age of 15. In children, normal axial elongation usually occurs as they grow.

[0058] In addition, the composition according to the present disclosure can be food or supplement.The form of food or supplement can be, for example, liquid, solid, tablet, granule, powder, capsule, paste, gel, etc., for example, the above-mentioned solid or liquid preparations, etc. can be arbitrarily selected.Specific examples of food include various general processed foods such as fruit juice drinks, vegetable juices, soft drinks, tea, soups, puddings, yogurt, cake premix products, confectioneries, cookies, candies, gummies, chewing gum, as well as special purpose foods, foods for specified health uses, nutrient-functional foods, functional foods, nutritional supplements, health supplements, nutritionally fortified foods, nutritionally adjusted foods, etc., such as supplements, drinks, etc.

[0059] The food or supplement according to the present disclosure may contain any functional ingredients (vitamins, minerals, etc.), any excipients, any additives (flavoring agents, sweeteners, acidulants, coloring agents, thickeners, binders, strengthening agents, disintegrants, buffers, surfactants, solubilizers, resorption promoters, dispersants, stabilizers, gelling agents, emulsifiers, antioxidants, surfactants, preservatives, moisture-proofing agents, pH adjusters, coloring agents, soothing agents, isotonicity agents, etc.).

[0060] One aspect of the present disclosure relates to the use of an M2 macrophage polarization inducer, a mast cell stabilizer, a choroidal resident immune cell function modulator such as a chemical mediator release inhibitor, lactic acid bacteria, berberine, taurine, or lipoic acid, or a salt or derivative thereof, for suppressing or treating myopia. Another aspect of the present disclosure relates to the use of an M2 macrophage polarization inducer, a mast cell stabilizer, a choroidal resident immune cell function modulator such as a chemical mediator release inhibitor, lactic acid bacteria, berberine, taurine, or lipoic acid, or a salt or derivative thereof, in the manufacture of a medicament for suppressing or treating myopia.

[0061] [Screening Method] One aspect of the present disclosure relates to a screening method for discovering components that promote polarization of macrophages into M2 macrophages in order to control choroidal thinning, a mechanism of myopia development, and a screening method for discovering components effective in the prevention and treatment of myopia. In some embodiments, the screening method includes the steps of (i) administering a candidate substance to a model animal and (ii) measuring the axial length, choroidal thickness, and refractive index of the model animal. In some embodiments, the screening method includes the steps of (i) administering a candidate substance to the model animal and (ii) measuring the expression of a choroid-resident immune cell marker, such as an M2 macrophage marker, in a sample derived from the model animal. In some embodiments, the screening method further includes the step of (iii) measuring the expression of a choroid-resident immune cell marker, such as an M1 macrophage marker. In some embodiments, the present invention also includes an in vitro screening method in which cells, such as monocytic cell lines (e.g., RAW264 cells, J774 cells, U937 cells), mouse peritoneal macrophages, and choroid-resident immune cells (e.g., bone marrow-derived macrophages), are cultured in a medium containing a candidate substance, and the expression of choroid-resident immune cell markers, such as M2 macrophage markers, is evaluated. In some embodiments, the model animal may be an animal undergoing myopia induction treatment. In some embodiments, choroid-resident immune cell markers, such as M2 macrophage markers, may be CD163, CD206, arginase, or IL-10. Methods for measuring choroid-resident immune cell markers, such as macrophage markers, include quantitative PCR, flow cytometry, immunostaining, luciferase assay, and arginase activity staining.

[0062] Substances identified by such screening methods can be used to inhibit or treat myopia.

[0063] While preferred embodiments of the present invention are described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only, and that various modifications, changes, and substitutions may be made by those skilled in the art without departing from the invention. It should be understood that various alternative embodiments of the invention described herein may be used in practicing the invention. Furthermore, the contents of all publications, including patents and patent applications, referenced herein should be construed as incorporated by reference as if expressly set forth herein.

[0064] The present invention will be explained in more detail below by way of experimental examples.

[0065] Materials and Methods: Mice. The Ethics Committee for Animal Research at Keio University School of Medicine approved all procedures, which followed the Society for Research in Vision and Ophthalmology's Statement on the Use of Animals in Ophthalmic and Vision Research, the Keio University Institutional Guidelines for Animal Experiments, and the Reporting of Animal Experiments: In Vivo Experiments (ARRIVE) guidelines. Furthermore, the principle of random allocation was implemented in this study. Wild-type male C57BL / 6J mice were provided by CLEA Japan, Inc. These mice were housed in standard transparent mouse cages (29 × 18 × 13 cm), four or five per cage, in a pathogen-free environment maintained at 23 ± 3°C under approximately 50 lux background fluorescent lighting (color temperature: 5000 K), with a 12-h diurnal cycle, and with constant access to regular chow (MF, Oriental Yeast Co., Ltd., Tokyo, Japan) and tap water. All animals were randomly assigned.

[0066] LIM Mouse Model: The mouse LIM model was created as previously described [Jiang, X. et al. A highly efficient murine model of experimental myopia. Scientific Reports 8, 1-12 (2018)]. Briefly, mice were placed under general anesthesia using a mixture of midazolam (Sandoz KK, Tokyo, Japan), medetomidine (Domitor®, Orion Corporation, Espoo, Finland), and butorphanol tartrate (MMB) (Meiji Seika Pharma Co., Ltd., Tokyo, Japan). Eyeglass frames were designed to fit the contours of the mouse's head and printed using a 3D printer. To induce myopia, negative 30D lenses were constructed using polymethyl methacrylate (PMMA). The left and right eyes of the glasses were adjusted to the shape of the frame on the mouse's skull and screwed onto a joint called a stick, which allows the left and right frames to be repositioned or removed for cleaning. The stick was then glued to the mouse's skull using a self-curing dental adhesive system. Induction began once the mice had fully recovered from anesthesia, and the lenses were removed for cleaning at least twice a week.

[0067] Measurement of refraction, axial length, and choroidal thickness: Refraction was measured using an infrared photorefractor (Steinbeis Transfer Center, Stuttgart, Baden-Württemberg, Germany) as previously reported [Jiang, X. et al. A highly efficient murine model of experimental myopia. Scientific reports 8, 1-12 (2018)]. After measuring refraction, axial length and choroidal thickness were measured using an SD-OCT system (Envisu R4310, Leica Microsystems, Wetzlar, Germany). For each mouse, measurements of refraction, axial length, and choroidal thickness were performed before the start of LIM (0W) and at the end of LIM (3W). Before measurements, mouse eyes were treated with mydriatic eye drops containing 0.5% tropicamide and 0.5% phenylephrine (Santen Pharmaceutical Co., Ltd., Osaka, Japan) to ensure pupil dilation and cycloplegia. After pupil dilation, mice were placed under general anesthesia using MMB. It is important to prevent corneal injury during measurement. Axial length was measured as the perpendicular distance from the anterior corneal surface to the retinal pigment epithelium layer near the optic nerve [Jiang, X. et al. A highly efficient murine model of experimental myopia. Scientific reports 8, 1-12 (2018)]. Choroidal thickness was determined by quantifying the circular area of ​​the disc at the posterior surface of the choroid using ImageJ software [Dysli, C., Enzmann, V., Sznitman, R. & Zinkernagel, MS. Quantitative analysis of mouse retinal layers using automated segmentation of spectral domain optical coherence tomography images. Translational vision science & technology 4, 9-9 (2015)].

[0068] Measurement of choroidal blood perfusion: Choroidal blood perfusion was measured at the beginning (3 weeks after birth) and end (6 weeks after birth) of myopia induction using a SS-OCT / OCTA device (XEPHILIO OCT-S1, Canon Medical Systems, Tokyo, Japan). The measurement method was described previously [Hou, J. et al. Ginkgo biloba extracts improve choroidal circulation leading to suppression of myopia in mice. Scientific Reports 13, 3772 (2023)]. Briefly, mice were dilated under general anesthesia before measurement, as in the case of refraction measurements. Choroidal blood perfusion was measured using en face angiography to identify the optic nerve as the central region. Choroidal blood perfusion signals were obtained from B-scan images of the corresponding positions. In the B-scan images, areas covered with red noise points were areas without blood perfusion. ImageJ quantitative analysis was used to calculate the non-blood perfused area in the choroid and to assess the percentage of blood perfused area in the choroid.

[0069] Flow cytometry: Mice were deeply anesthetized with an overdose of MMB before being euthanized by cervical dislocation. The eyes were immediately enucleated, and the anterior segment, vitreous, and retina were discarded. Choroidal tissue was carefully scraped from the sclera-choroid complex and collected in tubes (10 choroidal tissues / tube). Then, the tissue was treated with digestion buffer (0.75 mg / ml collagenase A, Fujifilm, Tokyo, Japan) in complete Dulbecco's Modified Eagle Medium (DMEM) at 37°C for 45 minutes. The digested choroidal mixture was transferred onto a cell strainer, and 5 ml of cold complete DMEM was added to pass the cells through the strainer into a new 50 ml tube while crushing undigested choroidal fragments using the end of a syringe plunger. Aggregated choroidal cells were dissociated into a single-cell suspension by differential centrifugation. The cells were washed by adding 700 μl of flow cytometry staining (FACS) buffer (80 μl of 0.5 mol / L ethylenediaminetetraacetic acid (EDTA) and 0.1 g of bovine serum albumin (BSA) in 20 ml of PBS (pH 7.4) solution) to the cell suspension. The pellet was resuspended in 10 μl of Fc block solution (1:10 Fc block) (BD Biosciences, New Jersey, USA) for 10 min and stained with a mixture of fluorochrome-conjugated antibodies (1:200 FITC anti-mouse / human CD11b M1 / 70, BioLegend, California, USA), (1:200 APC / Cyanine7 anti-mouse F4 / 80, BioLegend, California, USA), and (1:200 CD206, AbD Serotec, Kidlington, near Oxford, UK) for at least 45 min, and finally covered with 0.1 mg / ml Hoechst (DOJINDO, Amsterdam, The Netherlands) for 10 min. All incubations were performed on ice and protected from light. Data were acquired on a CytoFLEX S flow cytometer using CytExpert software (Beckman Coulter Life Sciences, Inc., Indiana, USA). Offline data analysis was performed using CyExpert software.

[0070] Clodronate liposome treatment: Clodronate liposomes (Liposoma BV, Amsterdam, The Netherlands) were injected intraperitoneally into C57BL / 6J mice at a dose of 0.10 ml / 10 g (once every other day) from P21 to P28 or from P56 to P63. Control groups were injected with an equivalent volume of PBS liposomes as described above. Refraction, axial length, and choroidal thickness were measured before and after the four injections. Mice were then euthanized, and choroidal samples were collected.

[0071] LPS treatment: Lipopolysaccharide derived from Escherichia coli O111:B4 (Merck, Tokyo, Japan) was dissolved in PBS and injected intraperitoneally to induce systemic M1 macrophage polarization. The LPS concentration was 10 mg / ml, and the injection dose increased proportionally with mouse weight, giving 10 μg of LPS per gram of mouse. Because LPS injection significantly reduced mouse body weight, mouse weight was monitored and recorded before each injection. Additionally, a corresponding volume of PBS was injected intraperitoneally as a vehicle control.

[0072] EPA administration: EPA-supplemented diet containing 5% EPA (EPADEL®, Mochida Pharmaceutical Co., Ltd., Tokyo, Japan) and regular diet were prepared as previously reported [Mori, K. et al. Lipidomic analysis revealed n-3 polyunsaturated fatty acids suppressed choroidal thinning and myopia progression in mice. The FASEB Journal 36, e22312 (2022)]. Briefly, EPA ethyl ester was mixed with powdered regular diet and tap water was added. The mixture was formed into small cylinders, dried, and consumed. Feeding with the EPA-mixed diet began and ended with the induction of myopia.

[0073] IL-4 / IL-13 treatment: To induce systemic M2 macrophage polarization, recombinant mouse IL-4 (214-14) and IL-13 (210-13) (PeproTech, New Jersey, USA) were dissolved in PBS at the same concentration of 0.1 μg / 100 μl and injected intraperitoneally into mice once every two days. The control group received the same volume of PBS intraperitoneally. The injections were administered during myopia induction. To ensure normal growth, mice were weighed and recorded before each injection.

[0074] Berberine chloride eye drops: A berberine chloride hydrate (TCI, Tokyo, Japan) solution was freshly prepared in DMSO. Measurement of the concentration of the berberine chloride eye drops revealed that berberine chloride hydrate is insoluble in water at room temperature. Dissolution was attempted using 100% DMSO, and the solubility of berberine chloride hydrate in 100% DMSO at room temperature was found to be approximately 13 mg / ml. The current concentration of berberine chloride eye drops is 0.26 mg / ml. Furthermore, DMSO, a dissolution vector, has been reported to exert cytotoxic effects at certain concentrations. Therefore, to check for solvent toxicity, an untreated control group should be included along with a DMSO solvent control [Galvao, J. et al. Unexpected low-dose toxicity of the universal solvent DMSO. The FASEB Journal 28, 1317-1330 (2014)]. To maintain the concentration of berberine chloride hydrate at 0.26 mg / ml and to minimize the concentration of DMSO, the final concentration of berberine chloride eye drops was 0.26 mg / ml, dissolved in 2% DMSO. In addition, a parallel control group of mice with 2% DMSO was also set up to observe its effect on myopia.

[0075] Real-time quantitative PCR (qPCR): After euthanasia, mice were immediately enucleated and retinal, choroidal, and scleral tissues were harvested, frozen in liquid nitrogen, and stored at -80°C for later use. Mouse total RNA was extracted from retinal, choroidal, and scleral tissues using TRIzol (TRI Reagent) (MOR, Miami, FL, USA, #TR118). Small RNAs were isolated using RWT (QIAGEN, Hilden, Germany, #1067933) and RPE buffer (QIAGEN, Hilden, Germany, #1018013). RNA samples were dissolved in RNase-free water (TAKARA HOLDINGS Inc., Kyoto, Japan, 9012) and analyzed using a spectrophotometer (NanoDrop; Thermo Fisher Scientific, Waltham, MA, USA). The extracted RNA was converted to cDNA via RNA denaturation, DNase reaction, and reverse transcription according to the manufacturer's instructions. mRNA gene expression was determined using SYBR Green RT-PCR on cDNA templates. PCR was performed using a StepOnePlus Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). mRNA expression of each gene was assessed using the comparative Ct (ΔΔCT) method and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA expression, which was used as a reference gene. qPCR primer sequences were as follows:Mouse Il6 forward: CTACCCCAATTTCCAATGCT (SEQ ID NO: 1) Mouse Il6 reverse: ACCACAGTGAGGAATGTCCA (SEQ ID NO: 2) Mouse Tnfa forward: CTGTAGCCCACGTCGTAGC (SEQ ID NO: 3) Mouse Tnfa reverse: TTGAGATCCATGCCGTTG (SEQ ID NO: 4) Mouse Mrc1 forward: TCGAGACTGCTGCTGAGTCCA (SEQ ID NO: 5) Mouse Mrc1 reverse: AGACAGGATTGTCGTTCAACCAAAG (SEQ ID NO: 6) Mouse Nox2 forward: ACTCCTTGGAGCACTGG (SEQ ID NO: 7) Mouse Nox2 reverse: GTTCCTGTCCAGTTGTCTTCG (SEQ ID NO: 8) Mouse Nox4 forward: TGAACTACAGTGAAGATTTCCTTGAAC (SEQ ID NO: 9) Mouse Nox4 reverse: GACACCCGTCAGACCAGGAA (SEQ ID NO: 10) Mouse Mmp2 forward: CAAGTTCCCCGGCGAT (SEQ ID NO: 11) Mouse Mmp2 reverse: TTCTGGTCAAGGTCAC (SEQ ID NO: 12) Mouse Mmp9 forward: GGACCCGAAGCGGACA (SEQ ID NO: 13) Mouse Mmp9 reverse: CGTCGTCGAAATGGGC (SEQ ID NO: 14) Mouse GAPDH forward: AGGAGCGAGACCCCACTAAC (SEQ ID NO: 15) Mouse GAPDH reverse: GATGACCCTTTTGGCTCCAC (SEQ ID NO: 16).

[0076] 8-OHdG ELISA: To assess oxidative stress, 8-oxo-2'-deoxyguanosine (8-OHdG) levels in choroidal tissue were measured using a commercially available enzyme-linked immunosorbent assay (ELISA) kit according to the manufacturer's instructions (Uscn Life Science, Wuhan, China). Because this assay uses a competitive inhibition enzyme immunoassay technique, the concentration of 8-OHdG in the sample was inversely correlated with the assay signal intensity. The concentration of 8-OHdG in each sample was calculated using a standard curve generated from standard proteins and analyzed using Boster's ELISA Online Calculator.

[0077] Statistical Analysis: In our study, we used independent t-tests and one-way analysis of variance (ANOVA) (Microsoft Excel 2003, USA) to analyze the statistical significance of all data. All results are presented as mean standard deviation (SD), and results with a P value of <0.05 were considered statistically significant.

[0078] Research Approval: All procedures were approved by the Keio University Animal Care and Use Committee (approval number: 16017). All methods and experimental protocols complied with the National Institutes of Health (NIH) Guidelines for the Treatment of Laboratory Animals and the ARVO Animal Statement for the Use of Animals in Ophthalmic and Vision Research.

[0079] Results: Example 1 Continuous intraperitoneal injection of clodronate liposomes may deplete choroidal macrophages and cause myopia: It has previously been reported that choroidal resident macrophages positively influence choroidal thickness and maintain vascular integrity [Yang, X. et al. CSF1R blockade induces macrophage ablation and results in mouse choroidal vascular atrophy and RPE disorganization. Elife 9, e55564 (2020)]. In contrast, a series of animal models have demonstrated that choroidal thinning is an inevitable change in the development of experimental myopia and a prominent feature in the development of myopia [Liu, Y., Wang, L., Xu, Y., Pang, Z. & Mu, G. The influence of the choroid on the onset and development of myopia: from perspectives of choroidal thickness and blood flow. Acta Ophthalmologica 99, 730-738 (2021); Zhang, S. et al. Changes in choroidal thickness and choroidal blood perfusion in guinea pig myopia. Investigative Ophthalmology & Visual Science 60, 3074-3083 (2019); Hung, L.-F., Wallman, J. & Smith, E.L. Vision-dependent changes in the choroidal thickness of macaque monkeys. Investigative Ophthalmology & Visual Science 41, 1259-1269 (2000); NICKLA, DL, WILDSOET, C. & WALLMAN, J.Visual influences on diurnal rhythms in ocular length and choroidal thickness in chick eyes. Experimental eye research 66, 163-181 (1998); Read, SA, Alonso-Caneiro, D., Vincent, SJ & Collins, MJ Longitudinal changes in choroidal thickness and eye growth in childhood. Investigative ophthalmology & visual science 56, 3103-3112 (2015)]. To investigate the influence of choroidal resident macrophages on myopia in a mouse model, 3-week-old C57BL / 6J mice were randomly divided into two groups and intraperitoneally injected with clodronate or phosphate-buffered saline (PBS) liposomes. In the clodronate liposome group, after macrophage uptake, the clodronate liposomes were degraded by lysosomal phospholipases, releasing clodronate into macrophages and inducing apoptosis, thereby promoting macrophage depletion [Weisser, S.B., van Rooijen, N. & Sly, L.M. Depletion and reconstitution of macrophages in mice. JoVE (Journal of Visualized Experiments), e4105 (2012)]. The injection volume of clodronate liposomes was 0.1 ml per 10 g of mouse, and the injection frequency was once every two days. Refraction, axial length, and choroidal thickness were measured using an infrared photorefractive element and a spectral-domain optical coherence tomography (SD-OCT) system, respectively, before and 8 days after injection (Figure 1A). Mice injected with clodronate liposomes had a higher refractive shift (-7.30±3.61D vs. +1.17±4.40D, P<0.001) and axial length elongation (0.08±0.02mm vs. 0.05±0.02mm, P<0.The mice injected with clodronate liposomes showed a decrease in choroidal resident macrophages (0.01), resulting in a thinner choroid compared with the PBS liposome-injected group (-1.56 ± 0.89 mm vs. 1.09 ± 0.51 mm, P < 0.001) (Figure 1B). Flow cytometry analysis of the percentage of choroidal resident macrophages showed a corresponding decrease 8 days after clodronate liposome injection compared with the control group (2.583 ± 0.002% vs. 9.290 ± 0.018%, P < 0.05) (Figure 1C). These results indicate that clodronate liposome injection depletes choroidal resident macrophages, promotes choroidal thinning, and induces myopia in 3-week-old mice. Previous studies have shown that choroidal thickness in mice tends to stabilize after approximately 8 weeks of age [Zhang, Y. et al. Vascular endothelial growth factor from retinal pigment epithelium is essential in choriocapillaris and axial length maintenance. PNAS Nexus 1, pgac166 (2022)]. However, it remains unclear whether a decrease in choroidal macrophages in adult mice also contributes to myopia. To rule out the possibility that choroidal macrophage depletion could cause myopia independently of the choroidal thickness developmental stage, we injected 8-week-old adult mice with clodronate liposomes or PBS liposomes in a similar manner and observed changes in refraction, axial length, and refractive index. Choroidal thickness was analyzed 8 days later (Figure 1D). Intraperitoneal injection of clodronate liposomes significantly reduced body weight while depleting resident macrophages, which could affect the comparison of axial length changes. To avoid the influence of changes in body weight on axial length, changes in axial length were expressed as the ratio of axial length to body weight. The clodronate liposome-injected group had a larger refractive shift (-7.52±2.57D vs. +1.52±4.91D, P<0.01), a larger axial length / body weight ratio (0.168±0.015mm / g vs. 0.155±0.002mm / g, P<0.05), and a thinner choroid (-2.39±1.33mm vs. -0.12±1.48mm, P<0.05) compared with the PBS liposome-injected group.01) was observed (Figure 1E), suggesting that clodronate liposome injection is responsible for the depletion of choroidal resident macrophages and choroidal thinning, which leads to myopia regardless of whether the choroid is developed or not.

[0080] Example 2: Continuous intraperitoneal injection of LPS stimulates choroidal M1 macrophage polarization and induces myopia in a mouse model. Based on their activation state and function, macrophages are classified into two categories: M1 (classically activated macrophages) and M2 (alternatively activated macrophages), which exhibit pro-inflammatory and anti-inflammatory properties, respectively [Mosser, D.M. & Edwards, J.P. Exploring the full spectrum of macrophage activation. Nature Reviews Immunology 8, 958-969 (2008)]. Because upregulation of allergic inflammation is associated with myopia progression in animal models [Wei, C.-C. et al. Allergic conjunctivitis-induced retinal inflammation promotes myopia progression. BioMedicine 28, 274-286 (2018)], we investigated whether M1 macrophage polarization could induce myopia in a mouse model. Mice were divided into LPS (10 mg / ml)-injected and PBS-injected groups for daily intraperitoneal injection. To determine myopia progression, refraction, axial length, and choroidal thickness were measured using SD-OCT before injection, 1 week after injection, and 2 weeks after injection (Figure 2A). One week after LPS injection, LPS-injected mice showed a change in refraction (-9.21 ± 5.91 D vs. +2.91 ± 3.91 D, P < 0.001), an increase in axial length / weight (0.28 ± 0.01 mm / g vs. 0.22 ± 0.005 mm / g, P < 0.001), and choroidal thinning (-1.11 ± 0.90 mm vs. 1.36 ± 0.70 mm, P < 0.001) compared with mice injected with PBS for one week.Injections were continued until the end of the 2-week period, and LPS-injected mice maintained significantly higher refractive change (-7.23 ± 4.36 D vs. +8.41 ± 7.01 D, P < 0.001), increased axial length to body weight ratio (0.20 ± 0.005 mm / g vs. 0.17 ± 0.004 mm / g, P < 0.01), and choroidal thinning (-1.77 ± 1.02 mm vs. 2.05 ± 0.66 mm, P < 0.001) compared with PBS-injected mice (Figure 2B). Choroidal blood perfusion was measured by optical coherence tomography angiography (OCTA). The results showed that choroidal blood perfusion in mice injected with LPS for 2 weeks was reduced compared with that in mice injected with PBS (37.36 ± 3.74% area vs. 46.79 ± 4.74% area, P < 0.001) (Figure 2C). These data indicate that intraperitoneal injection of LPS can induce myopia in a mouse model. Choroidal samples were collected for real-time polymerase chain reaction (PCR) analysis to verify the polarization of M1 macrophages in the choroid stimulated by intraperitoneal injection of LPS. The expression levels of the proinflammatory cytokines TNF and Il6 were significantly upregulated in LPS-injected choroidal samples compared with PBS-injected choroidal samples (Figure 2D). These data indicate that intraperitoneal injection of LPS polarizes choroidal M1 macrophages, promotes the release of proinflammatory cytokines, and induces myopia in a mouse model.As reported in LPS-treated macrophages, the secretion of proinflammatory cytokines (TNFA and IL6) was significantly attenuated by eicosapentaenoic acid (EPA), which inhibits myopia progression [Mullen, A., Loscher, C.E. & Roche, H.M. "Anti-inflammatory effects of EPA and DHA are dependent upon time and dose-response elements associated with LPS stimulation in THP-1-derived macrophages." The Journal of nutritional biochemistry 21, 444-450 (2010); Mori, K. et al. "Lipidomic analysis revealed n-3 polyunsaturated fatty acids suppressed choroidal thinning and myopia progression in mice." The FASEB Journal 36, e22312 (2022)]. Therefore, an experiment was designed in which LPS-induced myopic mice were fed an EPA diet, and it was found that myopia did not progress (Figure 5A, B, C). Taken together, these data suggest that the LPS-induced phenotypic switch to M1 macrophages is associated with the development of myopia.

[0081] Example 3: Continuous intraperitoneal injection of IL-4 / IL-13 promoted choroidal M2 macrophage polarization and inhibited myopia progression in a mouse model of LIM. We found that intraperitoneal injection of LPS enhanced the expression of proinflammatory cytokines in the choroid and promoted myopia progression. Conversely, polarization of choroidal M2 macrophages should inhibit myopia progression. Previous studies have demonstrated that IL-4 and IL-13, as anti-inflammatory interleukins, can directly activate M2 macrophages, which can be identified by the expression of M2 macrophage markers such as CD206 and mannose receptor 1 (Mrc1), also known as CD163 [Yao, Y., Xu, X.-H. & Jin, L. Macrophage polarization in physiological and pathological pregnancy. Frontiers in Immunology 10, 792 (2019)]. Specifically, to investigate the frequency of continuous IL-4 injection, we compared the percentage of M2 macrophages in the choroid at 0, 24, and 48 hours after intraperitoneal injection of 0.1 μg / 100 μl IL-4. F4 / 80 and CD11b-positive cells were considered macrophages, and CD206 was used as a marker to identify M2 macrophages. Flow cytometry analysis showed an increase in the percentage of macrophages (6.73 ± 0.22% vs. 3.78 ± 0.41%, P < 0.001) and M2 macrophages (43.57 ± 4.72% vs. 30.33 ± 8.35%, P < 0.05) 48 hours after intraperitoneal IL-4 injection compared with 0 hours (Figure 3A). Under the same conditions, real-time PCR detection after IL-4 injection showed that Mrc1 and CD163 mRNA expression in the choroid was enhanced 48 hours after IL-4 injection (Figure 3B). These results indicated that the optimal frequency of IL-4 injection was once every two days. Next, we investigated whether promoting M2 macrophage polarization by alternate-day IL-4 injection could suppress myopia progression in the LIM mouse model.All 3-week-old mice underwent LIM in the same manner as previously established and received PBS or 0.1 μg / 100 μl IL-4 injections until 6 weeks of age (Figure 3C). In the PBS-injected group, eyes treated with -30 diopter (D) lenses showed a refractive change (-11.52 ± 4.91 D vs. +12.45 ± 8.19 D, P < 0.01), an increase in axial length (0.22 ± 0.01 mm vs. 0.18 ± 0.01 mm / g, P < 0.05), and a decrease in choroidal thickness (-1.74 ± 0.66 mm vs. 3.91 ± 0.95 mm, P < 0.001) compared with eyes treated with 0 D lenses. In contrast, the IL-4-injected group showed choroidal thickening (1.39 ± 0.19 mm vs. -1.74 ± 0.66 mm, P < 0.001), smaller axial elongation (0.19 ± 0.01 mm vs. 0.22 ± 0.01 mm / g, P < 0.05), and smaller refractive change (-1.39 ± 2.91 D vs. -11.52 ± 4.91 D, P < 0.05) in eyes with -30D lenses compared with the PBS-injected group with -30D lenses (Figure 3D). To demonstrate the effect of continuous IL-4 injection on choroidal blood perfusion, 3-week-old mice were divided into three groups: the control 0D group (both eyes treated with 0D lenses), the control -30D group (bilateral myopia induction), and the IL-4-30D group (bilateral myopia induction by IL-4 injection once every two days). Using OCTA, we measured choroidal blood perfusion at the beginning (3 weeks of age) and end (6 weeks of age) of myopia induction. Results showed that 3 weeks after myopia induction, choroidal blood perfusion was lower in the IL4-30D group compared with the control 0D group (8.59 ± 5.90% area vs. -6.29 ± 8.73% area, P < 0.01). Nevertheless, choroidal blood perfusion was improved in the IL4-30D group compared with the control -30D group (-6.29 ± 8.73% area vs. 1.54 ± 9.34% area, P < 0.05) (Figure 3E).To visualize M2 macrophage polarization, we measured choroidal blood perfusion at the final stage and then collected choroidal samples for flow cytometry. Data analysis revealed a corresponding increase in the proportion of M2 macrophages in the IL-4-injected group with -30D lenses compared with the PBS-injected group with -30D lenses (46.52 ± 0.05% vs. 35.71 ± 0.06%, P < 0.05) (Figure 3F). Collectively, these findings indicate that IL-4 injection can inhibit the development of myopia in the LIM mouse model by stimulating M2 macrophage polarization in the choroid and improving choroidal blood perfusion. To reinforce the conclusion that M2 macrophages can inhibit myopia progression, we performed the same experiment using 0.1 μg / 100 μl IL13 injection instead of IL-4 injection. The results also showed that M2 macrophages were polarized 48 h after IL-13 injection (Figure 6A, B). The results of the LIM mouse model combined with IL-13 injection were as expected: IL-13 also polarized M2 macrophages, inhibited myopia progression, and improved choroidal blood perfusion in the LIM mouse model (Fig. 6C, D, E, F).

[0082] Example 4: Berberine, an eye drop that polarizes M2 macrophages, inhibits myopia progression with continued use. Recognizing that M2 macrophage polarization may inhibit myopia progression, we used an M2 macrophage-activating drug as an eye drop to examine its effect on myopia progression. Several studies have shown that berberine promotes the polarization of M1 macrophages to the M2 anti-inflammatory phenotype in mice [Lin, J. et al., "Berberine, a traditional Chinese medicine, reduces inflammation in adipose tissue, polarizes M2 macrophages, and increases energy expenditure in mice fed a high-fat diet." Medical Science Monitor: International Medical Journal of Experimental and Clinical Research 25, 87 (2019); Wang, Q.-Z. et al., "Berberine promotes M1 proinflammatory phenotype to M2 anti-inflammatory phenotype polarization in macrophage cell line RAW264. 7." Basic & Clinical Medicine 39, 646 (2019)]. To examine the role of berberine eye drops in the progression of myopia, we examined and compared changes in refraction, axial length, and choroidal thickness in 3-week-old C57BL / 6J mice after 3 weeks of myopia induction and administration of either berberine or dimethyl sulfoxide (DMSO) eye drops. The control-30D group (wearing -30D lenses in both eyes) and the 2% DMSO-30D group (inducing bilateral myopia with daily application of 2% DMSO eye drops) showed greater changes in refraction (P < 0.001), increased axial length (P < 0.05), and decreased choroidal thickness (P < 0.001) compared with the control 0D group (wearing 0D lenses in both eyes).Furthermore, the berberine-30D group (bilateral myopia induced by daily 0.26 mg / ml eye drops) had smaller refractive index changes (2.12 ± 1.63 D vs. -5.25 ± 2.89 D, P < 0.001), smaller axial elongation (0.19 ± 0.02 mm vs. 0.22 ± 0.04 mm / g, P < 0.05), and a thicker choroid (0.79 ± 0.64 mm vs. -1.56 ± 0.76 mm, P < 0.001) compared with the 2% DMSO-30D group. These results suggest that agents used to activate M2 macrophage polarization may inhibit the development of myopia (Figure 7A, B, C).

[0083] Example 5: Effects of LPS and IL-4 injection on nicotinamide adenine dinucleotide phosphate (NADPH) oxidation activity: We speculated that the polarization direction of macrophages may affect the development or suppression of myopia through their pro- or anti-inflammatory properties. However, the mechanisms underlying this association remain largely unknown. LPS-treated M1 macrophages are associated with high levels of reactive oxygen and nitrogen species (ROS and RNS, respectively) and matrix metalloproteinase (MMP) activity, and ROS production is important for M1 macrophage activation and function [Virag, L., Jaen, RI, Regdon, Z., Bosca, L. & Prieto, P. Self-defense of macrophages against oxidative injury: Fighting for their own survival. Redox Biology 26, 101261 ​​(2019); Covarrubias, A., Byles, V. & Horng, T. ROS sets the stage for macrophage differentiation. Cell research 23, 984-985 (2013)]. Similarly, excessive production of ROS can impair blood perfusion to the retina, and circulatory disorders during the progression of myopia can lead to oxidative stress [Coviltir, V. et al. Update on myopia risk factors and microenvironmental changes. Journal of ophthalmology 2019 (2019); Francisco, B.-M., Salvador, M. & Amparo, N. Oxidative stress in myopia. Oxidative Medicine and Cellular Longevity 2015 (2015)].To investigate whether M1 macrophage polarization induces myopia by promoting ROS and oxidative stress responses, and whether M2 macrophage polarization suppresses myopia progression by inhibiting ROS release and oxidative stress responses, we examined mRNA expression of NADPH oxidase 2 (Nox2), the most important enzyme. Expression of Nox4, Mmp2, and Mmp9 was observed in the choroid after LPS or IL-4 injection (Figure 4A). Quantitative analysis showed increased mRNA expression of Nox2, Nox4, Mmp2, and Mmp9 in the LPS-injected group compared with the PBS-injected group (Figure 4B). In contrast, 48 hours after IL-4 injection, mice showed decreased mRNA expression of Nox2, Mmp2, and Mmp9 (Figure 4C). Because 8-hydroxy-2-deoxyguanosine (8-OHdG) is a useful marker for assessing oxidative DNA damage [Halliwell, B. Why and how should we measure oxidative DNA damage in nutritional studies? How far have we come? The American Journal of Clinical Nutrition 72, 1082-1087 (2000)], we investigated 8-OHdG levels in the choroid after intraperitoneal injection of LPS or IL-4. The IL-4-injected group showed a decrease in choroidal 8-OHdG concentrations compared with the control group (P < 0.01). In contrast, choroidal 8-OHdG concentrations were higher in the LPS-injected group compared with the IL-4 group (P < 0.05) (Figure 4D). Taken together, these data suggest that polarized M1 macrophages may induce myopia by promoting oxidative stress, whereas polarized M2 macrophages may inhibit myopia progression by suppressing the oxidative stress response.

[0084] Example 6: Choroidal Thinning and Myopia Induced by LPS Administration To confirm whether polarization into M1 macrophages is involved in choroidal thinning and myopia, the expression of polarization marker genes in the choroid after LPS administration and measurements of choroidal thickness, axial length, and refractive index were performed.

[0085] We measured choroidal thickness, axial length, and refractive index in mice treated with LPS for 2 weeks and in control mice treated with PBS, and calculated the changes (Fig. 8A, B).The eyes were then enucleated and the expression of polarization marker genes was measured by quantitative PCR (Fig. 9).

[0086] C57BL6J mice (n = 4 per group) were used. LPS solution was administered intraperitoneally to the LPS-treated group at a dose of 10 mg / kg BW daily. PBS was administered to the PBS-treated group instead of LPS solution.

[0087] (Measurement of axial length, choroidal thickness, and refractive index) The axial length, choroidal thickness, and refractive index of mice in each group were measured. Measurements of axial length and choroidal thickness were performed using a spectral-domain optical coherence tomography (Envisu R4310, Leica). Refractive index was measured using an infrared photorefractor for mice (made by Professor Schaeffel, University of Tübingen).

[0088] (Electron Microscopic Observation of the Choroid) Eyes from each group of mice were harvested and fixed overnight at 4°C in 2.5% glutaraldehyde in phosphate-buffered saline (PBS) and rinsed for 1 hour in 0.1 M sodium cacodylate buffer. Next, they were fixed for 2 hours in 1% OsO₄ in 0.1 M cacodylate buffer and then dehydrated through graded ethanol solutions. The eyes were then infiltrated overnight in a 1:2 mixture of propylene oxide and Epon-Araldite and embedded in 100% resin. Blocks were sectioned and observed using a transmission electron microscope (JEM1400 plus; JEOL) at an accelerating voltage of 100 kV.

[0089] (Evaluation of Gene Marker Expression) Choroidal, retinal, and scleral samples were collected from mice administered LPS for 2 weeks as described above, and the expression of M1 macrophage marker genes and oxidative stress-related genes was analyzed by quantitative PCR.

[0090] (Results) Compared to the control group administered PBS, the LPS-administered group showed a decrease in refraction (Fig. 8B, left), axial elongation (Fig. 8B, center), and choroidal thinning (Fig. 8B, right) at both the 1-week and 2-week administration periods.

[0091] Furthermore, gene expression analysis revealed increased expression of M1 marker genes and oxidative stress-related genes, particularly in the choroid (Figure 9).

[0092] These results confirmed that an increase in M1 macrophages in the choroid induces myopia.

[0093] Example 7: Polarization to M2 Macrophages and Myopia-Suppressing Effect of IL-4 and IL-13 Administration. M1 macrophages are primarily involved in the initiation of inflammation, while M2 macrophages play an antagonistic role in terminating and suppressing inflammation. Because M1 macrophages have a myopia-inducing effect, M2 macrophages are thought to have an inhibitory effect on myopia progression. Therefore, we administered IL-4, a cytokine required for M2 macrophage polarization, to mice, and analyzed the expression levels of M2 macrophage markers CD163 and CD206 to determine whether M2 polarization occurred in the choroid (Figures 10A and 10B).

[0094] IL-4 administration: C57BL6J mice (n = 4 per group) were intraperitoneally administered 0.1 μg / 100 μl (10 μg / kg BW) of IL-4 solution. Choroid, retina, and liver samples were collected at 0 h (before administration) and 4, 24, and 48 h after administration, and the expression of M2 macrophage marker genes was analyzed by Western blot and real-time PCR (Figure 10). Choroid and retina samples were also collected at 0 h (before administration) and 4 and 24 h after administration, and the expression of oxidative stress-related genes was analyzed by real-time PCR (Figure 11).

[0095] We also administered IL-4 to mice undergoing myopia induction to evaluate its myopia-suppressing effect (Figure 11). C57BL6 mice undergoing myopia induction (-30D lenses, n = 4) were intraperitoneally administered 0.1 μg / 100 μl (10 μg / kg BW) of IL-4 solution for 3 weeks. C57BL6J mice undergoing myopia induction (0D lenses, -30D lenses, n = 4 per group) served as controls. After 3 weeks, refraction, axial elongation, and choroidal thinning were measured as in Example 6.

[0096] (Results) As a result, IL-4 administration increased the expression of M2 markers CD163 and CD206 in the choroid (Fig. 10B, C), confirming polarization to M2 macrophages. Furthermore, gene expression analysis revealed increased expression of M2 macrophage marker genes and suppressed expression of oxidative stress-related genes (Fig. 12). These results suggest that IL-4 administration induces polarization to M2 macrophages, suppresses expression of oxidative stress-related genes, and inhibits the progression of myopia (Fig. 12).

[0097] Furthermore, administration of IL-4 during the myopia induction period was confirmed to suppress the decrease in refraction (Fig. 12B, left), the elongation of the eye axis (Fig. 12B, center), and the thinning of the choroid (Fig. 12B, right).

[0098] These results confirmed that the polarization of choroidal macrophages into M2 by IL-4 administration has a myopia-suppressing effect.

[0099] <IL-13 Administration> IL-13, a cytokine known to polarize macrophages toward M2, similar to IL-4, was administered during the myopia induction period. Similar to the results for IL-4, administration of IL-13 suppressed axial elongation, myopia progression, and choroidal thinning associated with minus lens wear, and induced polarization toward M2 macrophages in C57BL6J mice (Figure 13). Blood flow changes and macrophage counts were measured as follows. Blood flow changes were measured using a wavelength-swept optical coherence tomography (OCT S-1, Canon). Macrophage counts were measured after choroid digestion using F4 / 80 and CD11b antibodies using a flow cytometer (CytoFLEX S, Beckman Coulter). M2 macrophage counts were measured in the same manner as for macrophage counts, except for the addition of a staining step with CD206 antibody.

[0100] As shown in the results of Examples 6 and 7, it was confirmed that myopia can be induced or suppressed by controlling the state of macrophages, particularly in the choroid. From the perspective of suppressing the progression of myopia and treating it, this indicates that promoting polarization into M2 macrophages is particularly effective in achieving this.

[0101] Example 8: Suppression of myopia progression by instillation of a mast cell stabilizer To verify the effect of instillation of a mast cell stabilizer on the suppression of myopia progression, a lens-induced myopia model was used in which myopia was induced in mice by wearing minus lenses. Cromolyn solution (4% solution) or pemirolast potassium (0.1% solution) was administered by instillation once daily during the myopia induction period.

[0102] According to the test method described above, axial length, refractive index, and choroidal thickness were measured in mice that underwent myopia induction for 3 weeks and instillation of cromoglycate solution or pemirolast potassium solution, as well as in control mice, and the changes were calculated (Figure 14A, B, C).

[0103] As a result, compared with the control eyes, the minus lens-wearing eyes in the PBS-administered control group showed axial elongation (Fig. 14A), myopia (Fig. 14B), and choroidal thinning (Fig. 14C). On the other hand, the groups administered with cromolyn or pemirolast potassium did not show the above-mentioned changes observed in the PBS-administered group.

[0104] These results confirm that instillation of mast cell stabilizer inhibits the progression of myopia.

[0105] Example 9 Comparison of the Myopia-Suppressing Effects of Mast Cell Stabilizer Eye Drops and Histamine Receptor Inhibitor Eye Drops Antiallergic drugs are broadly divided into two types: mast cell stabilizers, which inhibit mast cell degranulation, and histamine receptor inhibitors, which inhibit the action of histamine secreted by mast cell degranulation. To clarify whether the myopia-suppressing effect of the mast cell stabilizer eye drop in Example 8 was due to the action of the antiallergic drug or to the inhibition of mast cell degranulation, mice that had undergone myopia induction using LIM were administered with pemirolast potassium (0.1% solution) as a mast cell stabilizer and levocabastine solution (0.025% solution) as a histamine receptor inhibitor, and their myopia-suppressing effects were compared. The results are shown in Figure 15.

[0106] 15, the results showed that the pemirolast potassium administration group did not show the axial elongation, myopia in refractive index, and choroidal thinning seen in the control group, as in Example 8. On the other hand, the levocabastine administration group showed the axial elongation, myopia in refractive index, and choroidal thinning seen in the control group.

[0107] These results confirmed that, among anti-allergy drugs, mast cell stabilizers have the effect of suppressing myopia.

[0108] Example 10: Suppression of myopia progression by administration of Lactobacillus paracasei Because induction of M2 macrophages can suppress myopia progression, Lactobacillus paracasei, a lactic acid bacterium contained in Yakult (Yakult Honsha Co., Ltd.), was cultured and grown and administered to myopic model mice. Similar to Examples 8 and 9, axial length, refractive index, and choroidal thickness were measured and the changes calculated ( FIG. 16 ). The results confirmed that administration of lactic acid bacteria suppressed myopia progression ( FIG. 16 ).

[0109] Example 11: Three-times-daily administration of berberine chloride significantly inhibited myopia progression: The effect of the number of daily administrations on the inhibitory effect of berberine on myopia progression was examined. Eye drops were prepared according to the formulations shown in Table 2 below. LIM mouse models were created using 3-week-old mice using the method described above in "LIM Mouse Model." However, a negative 30D lens was constructed in the right eye (-30D group), and no lens was constructed in the left eye (0D group). As shown in Figure 17A, the LIM mouse models were administered placebo eye drops A (Control) once a day or eye drops 1 once a day or three times a day (10:00, 14:00, and 18:00) until 6 weeks of age. Subsequently, the refractive index and axial length of the -30D and 0D groups were measured at 3 weeks of age before administration of the eye drops and at 6 weeks of age after administration of the eye drops, as described above under "Measurements of refractive index, axial length, and choroidal thickness." These values ​​(Ref and AL, respectively) and the changes in refractive index and axial length (Change in Ref and Change in AL, respectively) at 6 weeks of age after administration of the eye drops from 3 weeks of age before administration of the eye drops are shown in Figures 17B and C. Figure 17B shows the results for n = 6 to 7 for each group. Figure 17C shows the results for n = 4 to 6 for each group. In Figures 17B and C, "*," "**," "***," and "****" indicate P values ​​of P<0.05, P<0.01, P<0.001, and P<0.0001, respectively, in statistical analysis using one-way analysis of variance (one-way ANOVA) and least significant difference (LSD). Also, in Figures 17B and C, "0W" refers to the 3-week-old group before administration of the various eye drops, and "3W" refers to the 6-week-old group after administration of the various eye drops. Also, in Figures 17B and C, "Con" refers to the placebo eye drop (Control) group, and "Ber 0.012 1" and "Ber 0.012 3" refer to the groups administered 0.012 (w / v)% berberine chloride eye drops once daily and three times daily, respectively.

[0110]

[0111] 17B and 17C, in the -30D group, when eye drops 1 containing 0.012 (w / v)% berberine chloride were administered three times a day, the change in refractive index (decrease) and the change in ocular axis (elongation) were smaller than when placebo eye drops 1 was administered, and the change in refractive index (decrease) and the change in ocular axis (elongation) tended to be smaller than when eye drops 1 were administered once a day. Therefore, it was shown that administration of berberine chloride three times a day can more effectively suppress the decrease in refractive index and the elongation of ocular axis, and can more effectively suppress myopia, compared with administration of berberine chloride once a day.

[0112] Example 12: Berberine Chloride, Sodium Azulene Sulfonate, or Taurine Inhibited Myopia Progression: We investigated whether eye drops containing 0.025 (w / v)% berberine chloride, 0.02 (w / v)% sodium azulene sulfonate, or 1 (w / v)% taurine inhibited myopia progression. Eye drops were prepared according to the formulations shown in Table 3 below. LIM mouse models were generated from 3-week-old mice using the method described above under "LIM Mouse Model." However, a negative 30D lens was constructed in the right eye (-30D group), and no lens was constructed in the left eye (0D group). As shown in Figure 18A, placebo eye drops B (Control) and eye drops 2 to 4 were administered once daily to the LIM mouse models until they reached 6 weeks of age. The refractive index, axial length, and choroidal thickness of the -30D and 0D mice were measured at 3 weeks of age before administration and at 6 weeks of age after administration, as described above under "Measurements of refractive index, axial length, and choroidal thickness." The changes in refractive index, axial length, and choroidal thickness from 3 weeks of age before administration to 6 weeks of age after administration (referred to as "Change in Ref," "Change in AL," and "Change in ChK") and the differences in refractive index, axial length, and choroidal thickness (calculated by subtracting the changes in the -30D group from the changes in the 0D group) (referred to as "Difference of Ref," "Difference of AL," and "Difference of ChK") are shown in Figures 18B–D. In Figures 18B to 18D, the results are for n=6 to 7 for each group, and "*," "**," "***," and "****" indicate P values ​​of P<0.05, P<0.01, P<0.001, and P<0.0001, respectively, in statistical analysis using a combination of one-way ANOVA and least significant difference (LSD).

[0113]

[0114] As shown in Figures 18B-D, when eye drops 2 containing 0.025 (w / v)% berberine chloride, eye drops 3 containing 0.02 (w / v)% sodium azulene sulfonate, or eye drops 4 containing 1 (w / v)% taurine were administered, the difference in the change in refractive index (Difference of Ref) was small, the difference in the change in axial length (Difference of AL) was negligible, and the difference in the change in choroidal thinning (Difference of ChK) tended to be small compared to when placebo eye drops B was administered. Therefore, it was demonstrated that administration of berberine chloride, sodium azulene sulfonate, or taurine inhibited the decrease in refractive index, axial length, and choroidal thinning, thereby suppressing myopia.

[0115] Example 13: The combination of berberine chloride and sodium azulene sulfonate significantly inhibited the progression of myopia. We investigated whether eye drops containing 0.012 (w / v)% berberine chloride and 0.01 (w / v)% sodium azulene sulfonate inhibited the progression of myopia. Eye drops were prepared according to the formulations shown in Table 4 below. LIM mouse models were created using 3-week-old mice as described in the "LIM Mouse Model" section above. However, a negative 30D lens was constructed in the right eye (-30D group), and no lens was constructed in the left eye (0D group). As shown in Figure 19A, the LIM mouse models were administered placebo eye drops C (Control) and eye drops 5 to 7 once daily until 6 weeks of age. The refractive index, axial length, and choroidal thickness of the -30D and 0D groups were measured at 3 weeks of age before administration and at 6 weeks of age after administration, as described above under "Measurements of refractive index, axial length, and choroidal thickness." The changes in refractive index, axial length, and choroidal thickness (represented by change in refraction, change in AL, and change in ChK, respectively) from 3 weeks of age before administration to 6 weeks of age after administration are shown in Figures 19B–D. Figure 19B shows the results of n=6 to 7 for each group, and Figures 19C to 19D show the results of n=4 to 6 for each group. In Figures 19B to 19D, "*", "**", "***", and "****" indicate P values ​​of P<0.05, P<0.01, P<0.001, and P<0.0001, respectively, in statistical analysis using a combination of one-way ANOVA and least significant difference (LSD).

[0116]

[0117] 19B-D, administration of eye drops 7 containing 0.012 (w / v)% berberine chloride and 0.01 (w / v)% sodium azulene sulfonate tended to result in smaller changes in refractive index (decrease), axial length (elongation), and choroidal thinning compared with administration of eye drops 5 containing 0.012 (w / v)% berberine chloride, eye drops 6 containing 0.01 (w / v)% sodium azulene sulfonate, or placebo eye drops C. Therefore, administration of berberine chloride and sodium azulene sulfonate significantly inhibited the decrease in refractive index, axial length, and choroidal thinning, demonstrating that myopia could be significantly suppressed.

[0118] Example 14: The combination of berberine chloride and sodium azulene sulfonate, the combination of berberine chloride and taurine, and the combination of berberine chloride, sodium azulene sulfonate, and taurine significantly inhibited the progression of myopia. The effects of eye drops containing 0.012 (w / v)% berberine chloride and 0.01 (w / v)% sodium azulene sulfonate, 0.012 (w / v)% berberine chloride and 0.5 (w / v)% taurine, and 0.012 (w / v)% berberine chloride, 0.01 (w / v)% sodium azulene sulfonate, and 0.5 (w / v)% taurine on the progression of myopia were investigated. The eye drops were prepared according to the formulations shown in Table 5 below. LIM mouse models were generated from 3-week-old mice using the method described above in "LIM Mouse Model." However, a negative 30D lens was constructed in the right eye (-30D group), and no lens was constructed in the left eye (0D group). The LIM mouse model was administered placebo eye drops D (Control) and eye drops 8–10 once daily until 6 weeks of age. Refraction and axial length were measured in the -30D and 0D groups at 3 weeks of age before administration and at 6 weeks of age after administration, as described above in "Measurements of refraction, axial length, and choroidal thickness." The changes in refraction and axial length (change in refraction and change in AL, respectively) from 3 weeks of age before administration to 6 weeks of age after administration are shown in Figures 20B–C. Figure 20B shows the results of n=3 to 5 for each group, and Figure 20C shows the results of n=4 to 6 for each group. In Figures 20B and 20C, "*", "**", "***", and "****" indicate P values ​​of P<0.05, P<0.01, P<0.001, and P<0.0001, respectively, in statistical analysis using a combination of one-way ANOVA and least significant difference (LSD).

[0119]

[0120] As shown in Figures 20B-C, when eye drops 8 containing 0.012 (w / v)% berberine chloride and 0.01 (w / v)% sodium azulene sulfonate were administered, when eye drops 9 containing 0.012 (w / v)% berberine chloride and 0.5 (w / v)% taurine were administered, and when eye drops 10 containing 0.012 (w / v)% berberine chloride, 0.01 (w / v)% sodium azulene sulfonate and 0.5 (w / v)% taurine were administered, the change in refractive index (decrease) and the change in axial length (elongation) tended to be smaller compared to when placebo eye drops D was administered. In addition, as shown in Figure 20B, the decrease in refractive index of each of berberine chloride and azulene (eye drops 8), berberine chloride and taurine (eye drops 9), and berberine chloride, azulene, and taurine (eye drops 10) is suppressed in this order, and the decrease is most suppressed when the three components of berberine chloride, azulene, and taurine (eye drops 10) are administered, and myopia is almost completely eliminated.Therefore, it is shown that the administration of berberine chloride and sodium azulene sulfonate, the administration of berberine chloride and taurine, or the administration of berberine chloride, sodium azulene sulfonate, and taurine can significantly suppress the decrease in refractive index and the elongation of the ocular axis, and can significantly suppress myopia.

Claims

1. A composition for use in preventing or treating myopia, comprising an M2 macrophage polarization inducer and / or a mast cell stabilizer.

2. The composition of claim 1, wherein the M2 macrophage polarization inducer comprises at least one selected from the group consisting of berberine, taurine, and salts thereof and derivatives thereof, and the mast cell stabilizer comprises at least one selected from the group consisting of azulene sulfonic acid, taurine, and salts thereof and derivatives thereof.

3. The composition according to claim 1 or 2, wherein the inhibition or treatment of myopia is based on inhibiting at least one selected from the group consisting of a decrease in refractive value, axial elongation, and choroidal thinning.

4. The composition according to claim 1 or 2, wherein the dosage form is eye drops.

5. A method for inhibiting or treating myopia, comprising administering to a subject in need of treatment a therapeutically effective amount of an M2 macrophage polarization inducer and / or a mast cell stabilizer.

6. Use of an M2 macrophage polarization inducer and / or a mast cell stabilizer in the manufacture of a medicament for inhibiting or treating myopia.

Images