Methods for detecting RHD incompatibilty in pregnant blood and plasma samples

Abstract

Disclosed herein includes a method of detecting RhD incompatibility during pregnancy, comprising: a) extracting DNA from a blood sample of a pregnant mother; b) performing qPCR on the DNA to determine Ct values of at least one RhD exon and at least one internal control gene; and c) calculating a ΔCt value between the at least one RhD exon and at least one internal control gene.

Description

METHODS FOR DETECTING RHD INCOMPATIBILTY IN PREGNANT BLOOD AND PLASMA SAMPLES CROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 547,906, filed November 9, 2023, and U.S. Provisional Application No. 63 / 602,023, filed November 22, 2023, the contents of which are hereby incorporated by reference in their entirety. BACKGROUND

[0002] Rhesus (Rh) incompatibility refers to the discordant pairing of maternal and fetal Rh types. It is associated with the development of maternal Rh sensitization and hemolytic disease of the neonate (HDN). An individual can be classified as RhD positive if their erythrocytes express the Rh D antigen; otherwise, an individual is RhD negative if they do not. This phenomenon becomes clinically significant if a mother that is RhD negative becomes sensitized to the D antigen and subsequently, produces anti-D antibodies (i.e., alloimmunization) that can bind to and potentially lead to the destruction of RhD positive erythrocytes. This is of particular concern if an RhD negative mother is carrying an RhD positive fetus, which can result in consequences along the spectrum of HDN ranging from self-limited hemolytic anemia to severe hydrops fetalis.

[0003] Currently, management of Rh incompatibility in RhD negative women, regardless of the RhD status of the fetus, includes administration of prophylactic Rh D immunoglobulin (RhIg) at 28 weeks gestation. If the neonate is found to be Rh-positive after delivery, those same unsensitized Rh-negative women should be given RhIg within 72 hours of delivery. This method however results in unnecessary treatment of pregnant women carrying Rh negative fetuses.

[0004] Therefore, there remains a need for an accurate, non-invasive test, to determine RhD incompatibility between a mother and fetus, to avoid unnecessary treatment of the mother. 4862-6122-2014.1SUMMARY

[0005] In one aspect, the present disclosure provides a method for preparing a non-naturally occurring composition of amplified DNA useful for analyzing RhD incompatibility during pregnancy, comprising: a) extracting DNA from a blood sample of a pregnant mother; b) preparing a composition of amplified DNA by performing qPCR on the DNA extracted in (a) or DNA derived therefrom; and c) analyzing the composition of amplified DNA from (b) to determine Ct values of at least one RhD exon and at least one internal control gene, wherein a ΔCt value between the at least one RhD exon and at least one internal control gene is useful for analyzing RhD incompatibility during pregnancy. In some embodiments, the DNA may be cell- free DNA and / or genomic DNA (gDNA). In some embodiments, cell-free DNA and / or gDNA is used to prepare a NGS library.

[0006] In some embodiments, a ΔCt value greater than a threshold indicates RhD incompatibility between the mother and fetus.

[0007] In some embodiments, the at least one RhD exon is RhD exon 7, RhD exon 5, RhD exon 4, RhD Exon 6 and / or RhD exon 10. In some embodiments, the at least one internal control gene is AGO1.

[0008] In some embodiments, performing qPCR comprises amplification of at least one nucleic acid, wherein the at least one nucleic acid comprises a sequence at least 85-95% identical to one or more of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, or a complement thereof. In some embodiments, performing qPCR comprises using one or more primer pairs comprising the sequences selected from SEQ ID NOs: 1 and 2, SEQ ID NOs: 4 and 5, and / or SEQ ID NOs: 7 and 8, or a complement thereof. In some embodiments, performing qPCR comprises using one or more probes. In some embodiments, the one or more probes are capable of specifically hybridizing to a nucleic acid comprising the sequence of SEQ ID NO: 3, SEQ ID NO: 6, and / or SEQ ID NO: 9, or a complement thereof.

[0009] In one aspect the present disclosure provides a method for preparing a non-naturally occurring composition of amplified DNA useful for determining a risk of RhD incompatibility during pregnancy, comprising: a) extracting cell-free DNA from a blood sample of a pregnant 2 4862-6122-2014.1mother; b) preparing a composition of amplified DNA by performing qPCR on the DNA extracted in (a) or DNA derived therefrom; c) analyzing the composition of amplified DNA to determine Ct values of at least one RhD exon and at least one internal control gene, wherein a ΔCt value between the at least one RhD exon and at least one internal control gene is useful for determining a risk of RhD incompatibility during pregnancy. In some embodiments, the method further comprises determining a risk of RhD incompatibility when the ΔCt value is greater than a threshold.

[0010] In some embodiments, the threshold is between 0 and 1. In some embodiments, the threshold is about 0.8. In some embodiments, the at least one RhD exon is RhD exon 7 and / or RhD exon 5. In some embodiments, the at least one internal control gene is AGO1.

[0011] In some embodiments, the methods provided herein further comprise administering Rh immune-globulin when RhD incompatibility is determined. In some embodiments, the methods further comprise testing the blood sample of the mother for Rhesus antibodies when RhD incompatibility is determined.

[0012] In one aspect the present disclosure provides a kit comprising: a) a first primer pair that specifically hybridizes to a nucleic acid having the sequence of SEQ ID NO: 10 or a complement thereof and a first probe capable of specifically hybridizing to the sequence of SEQ ID NO: 10 or a complement thereof; b) a second primer pair that specifically hybridizes to a nucleic acid having the sequence of SEQ ID NO: 11 or a complement thereof and a second probe capable of specifically hybridizing to the sequence of SEQ ID NO: 11 or a complement thereof; and c) a third primer pair that specifically hybridizes to a nucleic acid having the sequence of SEQ ID NO: 12 or a complement thereof and a third probe capable of specifically hybridizing to the sequence of SEQ ID NO: 12 or a complement thereof.

[0013] In some embodiments, at least one member of the first primer pair comprises the sequence of SEQ ID NOs: 1 or 2 and the first probe comprises a sequence of SEQ ID NO: 3, or a complement thereof. In some embodiments, at least one member of the second primer pair comprises the sequence of SEQ ID NOs: 4 or 5 and the second probe comprises a sequence of SEQ ID NO: 6, or a complement thereof. In some embodiments, at least one member of the third primer pair comprises the sequence of SEQ ID NOs: 7 or 8 and the third probe comprises a sequence of SEQ 3 4862-6122-2014.1ID NO: 9, or a complement thereof. In some embodiments, the first, second, and third probes further comprise a detectable label.

[0014] In one aspect the present disclosure provides a method of treating RhD incompatibility, comprising: a) extracting cell-free DNA from a blood sample of a pregnant mother; b) preparing a composition of amplified DNA by performing qPCR on the extracted in (a) or DNA derived therefrom; c) analyzing the composition of amplified DNA to determine Ct values of at least one RhD exon and at least one internal control gene; and d) administering Rh immune-globulin to the pregnant mother when the ΔCt value between the at least one RhD exon and at least one internal control gene is greater than a threshold. In some embodiments, the DNA may be cell-free DNA and / or genomic DNA (gDNA). In some embodiments, cell-free DNA and / or gDNA is used to prepare a NGS library. In some embodiments, the threshold is between 0 and 1. In one aspect the present disclosure provides a method for preparing a non-naturally occurring composition of amplified DNA useful for analyzing RhD incompatibility during pregnancy, comprising: a) extracting DNA from a blood sample of a pregnant mother; b) preparing a composition of amplified DNA by performing qPCR on the DNA extracted in (a) or DNA derived therefrom to amplify at least one nucleic acid using one or more primer pairs comprising the sequences selected from SEQ ID NOs: 1 and 2, SEQ ID NOs: 4 and 5, and / or SEQ ID NOs: 7 and 8, or a complement thereof. In some embodiments, the DNA is cell-free DNA and / or gDNA. In some embodiments, the cell-free DNA and / or gDNA is used to prepare a NGS library. In some embodiments, a ΔCt value greater than a threshold indicates Rhesus incompatibility between the mother and fetus. In some embodiments, the at least one RhD exon is RhD exon 7, RhD exon 5, RhD exon 4, and / or RhD exon 10. In some embodiments, the at least one internal control gene is AGO1. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1. Shows Ct values of RhD major groups determined by qPCR of 184 samples from the training sub-library (n=89) and the testing sub-library (n=95 cases). 23 samples were RhD Negative, one sample with the RhD variant with Exon 7 positive but Exon 5 negative was placed in the RhD Negative group for graphic analysis, and 160 samples were RhD Positive. Ct values of 4 4862-6122-2014.1RhD positive control samples are also shown (n=2). Ct = 0 or Ct ≥ 40 was used to separate RhD positive and negative samples, indicated by the dotted line.

[0016] Figure 2. Shows delta Ct (ΔCt) values of the RhD Positive Group identified in FIG. 1 (n=160). ΔCt is calculated by subtracting the Ct value of the control gene from the Ct value of the RhD exon, i.e., ΔCt=Ctexon-Ctcontrol. The RhD Positive Group was divided into two subgroups based on ΔCt. The Fetus Positive Sub-Group (n=62) was identified as having ΔCt > 0 and included samples from RhD negative mothers with RhD positive fetuses. The Maternal Positive Sub-Group (n=98) was identified as having ΔCt < 0 and included samples from RhD positive mothers with RhD positive or negative fetuses. ΔCt of RhD positive control samples are also shown (n=2). Results matched NGS data for the cohort (n=184), which included the training sub-library (n=89) and the testing sub-library (n=95 cases).

[0017] Figure 3. Shows Ct values of RhD major groups determined by qPCR of 94 samples from the verification sub-library (n=94). 4 samples were RhD Negative and 90 samples were RhD Positive. Ct values of a RhD positive control sample are also shown. Ct = 0 or Ct ≥ 40 was used to separate RhD positive and negative samples, indicated by the dotted line.

[0018] Figure 4. Shows delta Ct (ΔCt) values of the RhD Positive Group identified in FIG. 3 (n=90). ΔCt is calculated by subtracting the Ct value of the control gene from the Ct value of the RhD exon, i.e., ΔCt=Ctexon-Ctcontrol. The RhD Positive Group was divided into two subgroups based on ΔCt. The Fetus Positive Sub-Group (n=9) was identified as having ΔCt > 1 and included samples from RhD negative mothers with RhD positive fetuses. The Maternal Positive Sub-Group (n=81) was identified as having ΔCt < 1 and included samples from RhD positive mothers with RhD positive or negative fetuses. ΔCt of a RhD positive control sample are also shown. Results matched NGS data for the verification sub-library from FIG. 3 (n=94).

[0019] Figure 5. Shows the observed low limit of detection (LOD) of RhD positive DNA template input for RhD Exon 7 with Exon 7 + AGO12-plex qPCR in a 15 µl qPCR reaction. Results indicate an LOD of 6 pg. Ct was detected in at least 2 out of 3 duplicated wells.

[0020] Figure 6. Shows the observed low limit of detection (LOD) of RhD positive DNA template input for RhD Exon 5 in a 10 µl single-plex qPCR reaction. Results indicate an LOD of 5 4862-6122-2014.1below 16 pg. Ct was detected in at least 2 out of 3 duplicated wells. DETAILED DESCRIPTION

[0021] The present invention generally relates to the field of non-invasive prenatal screening (NIPS), particularly NIPS using cell-free DNA (cfDNA) found in maternal plasma. More particularly, the present invention provides methods, compositions and kits suitable for identifying RhD incompatibility in maternal blood samples. The invention is based on qPCR detection of Ct values for RhD and a control nucleic acid, and subsequent calculation of ΔCt. Definitions

[0022] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one skilled in the art to which the present technology belongs.

[0023] As used herein, unless otherwise stated, the singular forms “a,” “an,” and “the” include plural reference. Thus, for example, a reference to “an oligonucleotide” includes a plurality of oligonucleotide molecules, and a reference to “a nucleic acid” is a reference to one or more nucleic acids.

[0024] As used herein, the term “about” in reference to a number is generally taken to include numbers that fall within a range of 1%–10% in either direction (greater than or less than) of the number unless otherwise stated or otherwise evident from the context.

[0025] As used herein, the terms “AGO” or “AGO1” refers to the Argonaute RISC Catalytic Component 1 reference gene used herein.

[0026] As used herein, the terms “amplify” or “amplification” with respect to nucleic acid sequences, refer to methods that increase the representation of a population of nucleic acid sequences in a sample. Copies of a particular target nucleic acid sequence generated in vitro in an amplification reaction are called “amplicons” or “amplification products”. Amplification may be exponential or linear. A target nucleic acid may be DNA (such as, for example, genomic DNA and 6 4862-6122-2014.1cDNA) or RNA. While the exemplary methods described hereinafter relate to amplification using polymerase chain reaction (PCR), numerous other methods such as isothermal methods, rolling circle methods, etc., are available to the skilled artisan. The skilled artisan will understand that these other methods may be used either in place of, or together with, PCR methods. See, e.g., Saiki, “Amplification of Genomic DNA” in PCR PROTOCOLS, Innis et al., Eds., Academic Press, San Diego, CA 1990, pp 13-20; Wharam, et al., Nucleic Acids Res. 29(11):E54-E54 (2001).

[0027] An “amplification mixture” as used herein is a mixture of reagents that are used in a nucleic acid amplification reaction, but does not contain primers or sample. An amplification mixture comprises a buffer, dNTPs, and a DNA polymerase. An amplification mixture may further comprise at least one of MgCl2, KCl, nonionic and ionic detergents (including cationic detergents).

[0028] An “amplification master mix” or “qPCR master mix” comprises an amplification mixture, primers, and / or probes for amplifying one or more target nucleic acids, but does not contain the sample to be amplified.

[0029] The terms “complement”, “complementary” or “complementarity” as used herein with reference to polynucleotides (i.e., a sequence of nucleotides such as an oligonucleotide or a target nucleic acid) refer to the Watson / Crick base-pairing rules. The complement of a nucleic acid sequence as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5' end of one sequence is paired with the 3’ end of the other, is in “antiparallel association.” For example, the sequence “5'-A-G-T-3’” is complementary to the sequence “3’-T-C-A-5’.” Certain bases not commonly found in naturally-occurring nucleic acids may be included in the nucleic acids described herein. These include, for example, inosine, 7- deazaguanine, Locked Nucleic Acids (LNA), and Peptide Nucleic Acids (PNA). Complementarity need not be perfect; stable duplexes may contain mismatched base pairs, degenerative, or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide, ionic strength and incidence of mismatched base pairs. A complement sequence can also be an RNA sequence complementary to the DNA sequence or its complement sequence, and can also be a cDNA. 7 4862-6122-2014.1

[0030] The term “substantially complementary” as used herein means that two sequences hybridize under stringent hybridization conditions. The skilled artisan will understand that substantially complementary sequences need not hybridize along their entire length. In particular, substantially complementary sequences may comprise a contiguous sequence of bases that do not hybridize to a target sequence, positioned 3' or 5' to a contiguous sequence of bases that hybridize under stringent hybridization conditions to a target sequence.

[0031] As used herein, a “cycle threshold” (Ct) for an analyte is the PCR cycle at which the fluorescence signal crosses a specified fluorescence threshold. The Ct depends on the amplification reaction efficiency which includes starting template copy number, organism lysis, PCR amplification, hybridization or cleavage of a fluorogenic probe and sensitivity of detection. The Ct provides a relative measure of the concentration of the target nucleic acid in the PCR reaction. Many factors other than the concentration of the target nucleic acid can impact the absolute value of Ct. However, artifacts from the reaction mix or instrument that change the fluorescence measurements associated with the Ct calculation will result in template-independent changes to the Ct value.

[0032] As used herein, “delta Ct” or ΔCt” refers to the difference in Ct values for two genes. For example, in some embodiments described herein, ΔCt is calculated by subtracting the Ct value of the control gene from the Ct value of a RhD exon, i.e., ΔCt = Ctexon - Ctcontrol. In some embodiments, ΔCt is calculated by subtracting the Ct value of AGO1 from the Ct value of RhD exon 5, ΔCt = Ctexon5 – CtAGO1. In some embodiments, ΔCt is calculated by subtracting the Ct value of AGO1 from the Ct value of RhD exon 7, ΔCt = Ctexon7 – CtAGO1. In some embodiments, when ΔCt is calculated from both the Ct value of RhD exon 7 and RhD exon 5 qPCR assay results, the Ctcontrol is the average AGO1 Ct value from both RhD qPCR assays, i.e., the Exon 7 + AGO1 assay and the Exon 5 + AGO1 assay. In some embodiments, ∆Ct may be calculated by subtracting the Ct value of AGO1 from the Ct value of RhD exon 4, RhD exon 6 or RhD exon 10. For example, in some embodiments ΔCt is calculated by subtracting the Ct value of AGO1 from the Ct value of RhD exon 4, ΔCt = Ctexon4 – CtAGO1. In some embodiments ΔCt is calculated by subtracting the Ct value of AGO1 from the Ct value of RhD exon 6, ΔCt = Ctexon6 – CtAGO1. In some embodiments, ΔCt is calculated by subtracting the Ct value of AGO1 from the Ct value of RhD exon 10, ΔCt = Ctexon10 – CtAGO1. 8 4862-6122-2014.1

[0033] As used herein, the term “detecting” refers to determining the presence of a target nucleic acid in the sample. Detection does not require the method to provide 100% sensitivity and / or 100% specificity.

[0034] As used herein, the term “direct amplification” refers to a nucleic acid amplification reaction in which the target nucleic acid is amplified from the sample without prior purification, extraction, or concentration.

[0035] As used herein, the term “extraction” refers to any action taken to remove nucleic acids from other (non-nucleic acid) material present in the sample. The term extraction includes mechanical or chemical lysis, addition of detergent or protease, or precipitation and removal of non-nucleic acids such as proteins.

[0036] The term “fluorophore” as used herein refers to a molecule that absorbs light at a particular wavelength (excitation frequency) and subsequently emits light of a longer wavelength (emission frequency). The term “donor fluorophore” as used herein means a fluorophore that, when in close proximity to a quencher moiety, donates or transfers emission energy to the quencher. As a result of donating energy to the quencher moiety, the donor fluorophore will itself emit less light at a particular emission frequency that it would have in the absence of a closely positioned quencher moiety.

[0037] “Gene” as used herein refers to a DNA sequence that comprises regulatory and coding sequences necessary for the production of an RNA, which may have a non-coding function (e.g., a ribosomal or transfer RNA) or which may include a polypeptide or a polypeptide precursor. The RNA or polypeptide may be encoded by a full-length coding sequence or by any portion of the coding sequence so long as the desired activity or function is retained. Although a sequence of the nucleic acids may be shown in the form of DNA, a person skilled in the art recognizes that the corresponding RNA sequence will have a similar sequence with the thymine being replaced by uracil, i.e., “T” is replaced with “U.”

[0038] The term “hybridize” as used herein refers to a process where two substantially complementary nucleic acid strands (at least about 65% complementary over a stretch of at least 14 to 25 nucleotides, at least about 75%, or at least about 90% complementary) anneal to each 9 4862-6122-2014.1other under appropriately stringent conditions to form a duplex or heteroduplex through formation of hydrogen bonds between complementary base pairs. Hybridizations are typically and preferably conducted with probe-length nucleic acid molecules, preferably 15-100 nucleotides in length, more preferably 18-50 nucleotides in length. A variety of nucleic acid hybridization techniques may be used, including without limitation those in, e.g., Sambrook, et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is influenced by such factors as the degree of complementarity between the nucleic acids, stringency of the conditions involved, and the thermal melting point (Tm) of the formed hybrid. Those skilled in the art understand how to estimate and adjust the stringency of hybridization conditions such that sequences having at least a desired level of complementarity will stably hybridize, while those having lower complementarity will not. For examples of hybridization conditions and parameters, see, e.g., Sambrook, et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, N.Y.; Ausubel, F. M. et al.1994, Current Protocols in Molecular Biology, John Wiley & Sons, Secaucus, N.J. In some embodiments, specific hybridization occurs under stringent hybridization conditions. An oligonucleotide or polynucleotide (e.g., a probe or a primer) that is specific for a target nucleic acid will “hybridize” to the target nucleic acid under suitable conditions.

[0039] As used herein, the terms “individual”, “patient”, or “subject” can be an individual organism, a vertebrate, a mammal, or a human. In a preferred embodiment, the individual, patient or subject is a human.

[0040] As used herein, the term “library” refers to a collection of nucleic acid sequences, e.g., a collection of nucleic acids derived from whole genomic, sub-genomic fragments, cell-free DNA, cell-free DNA fragments, cDNA, cDNA fragments, RNA, RNA fragments, or a combination thereof. In one embodiment, a portion or all of the library nucleic acid sequences comprises an adapter sequence. The adapter sequence can be located at one or both ends. The adapter sequence can be useful, e.g., for a sequencing method (e.g., an NGS method), for amplification, for reverse transcription, or for cloning into a vector. In some embodiments described here, the libraries are constructed from cell-fee DNA and / or gDNA. 10 4862-6122-2014.1

[0041] As used herein, the term “multiplex PCR” refers to the simultaneous generation of two or more PCR products or amplicons within the same reaction vessel. Similarly, a “2-plex PCR” refers to the simultaneous generation of two PCR products or amplicons within the same reaction vessel. Each PCR product is primed using a distinct primer pair. A multiplex reaction may further include specific probes for each product that are labeled with different detectable moieties.

[0042] “Next generation sequencing” or “NGS” as used herein, refers to any sequencing method that determines the nucleotide sequence of either individual nucleic acid molecules (e.g., in single molecule sequencing) or clonally expanded proxies for individual nucleic acid molecules in a high throughput parallel fashion (e.g., greater than 103, 104, 105or more molecules are sequenced simultaneously). In one embodiment, the relative abundance of the nucleic acid species in the library can be estimated by counting the relative number of occurrences of their cognate sequences in the data generated by the sequencing experiment. Certain exemplary next generation sequencing methods that may be used in some of the embodiments that follow are described in, e.g., in Metzker, M. Nature Biotechnology Reviews 11 :31-46 (2010).

[0043] A “sequence read” or simply “read” as used herein refers to sequence information of a nucleic acid fragment obtained through a sequencing assay, such as a next generation sequencing (NGS) assay.

[0044] The terms “non-invasive prenatal testing (NIPT)” and “non-invasive prenatal screening (NIPS)” are used interchangeably herein and refer to maternal sample tests for disorders such as Rh incompatibility.

[0045] As used herein, the term “nucleic acid” refers to a deoxyribonucleotide (DNA), ribonucleotide polymer (RNA), RNA / DNA hybrids and polyamide nucleic acids (PNAs) in either single- or double-stranded form, and unless otherwise limited, would encompass known analogs of natural nucleotides that can function in a similar manner as naturally occurring nucleotides.

[0046] As used herein, the term “cell-free DNA” or “cfDNA” to any free-floating DNA existing in a sample, such as the blood plasma of a pregnant patient or a transplant recipient. Cell-free DNA found in a pregnant woman's blood may contain DNA originating from both the mother and the 11 4862-6122-2014.1fetus. Cell free DNA found in a transplant recipient may contain DNA originating from the recipient and the donor. The term “cell-free fetal DNA” or “cffDNA” as used herein refers to fetal DNA circulating freely in the maternal system, such as in the mother's bloodstream. Through various mechanisms, cffDNA may, for example, originate from the trophoblasts making up the placenta. In some cases, the fetal DNA may be fragmented and make its way into the maternal bloodstream via shedding of the placental micro-particles into the maternal bloodstream. In some cases, cffDNA can first be observed in maternal blood as early as 7 weeks gestation, and increases in the amount as the pregnancy progresses. The cffDNA may be sampled by venipuncture on the mother and provides the basis for non-invasive prenatal diagnosis and testing.

[0047] The term “fetal fraction” as used herein refers to the percentage of cell-free DNA found in a pregnant mother's test sample that originates from the fetus. For example, if 10% of cell-free DNA found in a mother's blood sample is of a fetal origin, the fetal fraction is determined to be 10%. In some embodiments, fetal fraction is used as a parameter for sample quality and for determining whether a maternal sample should be included in the analysis. Particularly, in some embodiments, when the fetal fraction of a sample is below a predetermined threshold, the maternal sample is excluded. In some embodiments, the threshold ranges between about 1% to about 5%. In some embodiments, the threshold is about 4%.

[0048] As used herein, “oligonucleotide” refers to a molecule that has a sequence of nucleic acid bases on a backbone comprised mainly of identical monomer units at defined intervals. The bases are arranged on the backbone in such a way that they can bind with a nucleic acid having a sequence of bases that are complementary to the bases of the oligonucleotide. The most common oligonucleotides have a backbone of sugar phosphate units. A distinction may be made between oligodeoxyribonucleotides that do not have a hydroxyl group at the 2' position and oligoribonucleotides that have a hydroxyl group at the 2' position. Oligonucleotides may also include derivatives, in which the hydrogen of the hydroxyl group is replaced with organic groups, e.g., an allyl group. Oligonucleotides that function as primers or probes are generally at least about 10-15 nucleotides in length or up to about 70, 100, 110, 150 or 200 nucleotides in length, and more preferably at least about 15 to 25 nucleotides in length. Oligonucleotides used as primers or probes for specifically amplifying or specifically detecting a particular target nucleic acid generally are capable of specifically hybridizing to the target nucleic acid. 12 4862-6122-2014.1

[0049] A “positive control nucleic acid” or “internal positive amplification control” as used herein is a nucleic acid known to be present in a sample at a certain amount or level. In some embodiments, a positive control nucleic acid is not naturally present in a sample and is added to the sample prior to subjecting the reaction-sample mixture to real-time polymerase chain reaction. In some embodiments, the positive control nucleic acid is an artificially prepared DNA sample comprising a percentage of RhD positive DNA. In some embodiments, the positive control nucleic acid comprises between 0.1% and 100% RhD positive DNA. In some embodiments, the internal positive amplification control for the RhD qPCR is the AGO1 gene, which is naturally present in each sample. In some embodiments, one or more additional or alternative internal positive amplification controls may be used. For example, in some embodiments, other endogenous genes from human blood may be used with the methods described herein such as RPLR0 and PPIB.

[0050] As used herein, the term “primer” refers to an oligonucleotide, which is capable of acting as a point of initiation of nucleic acid sequence synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a target nucleic acid strand is induced, i.e., in the presence of different nucleotide triphosphates and a polymerase in an appropriate buffer (“buffer” includes pH, ionic strength, cofactors etc.) and at a suitable temperature. One or more of the nucleotides of the primer can be modified for instance by addition of a methyl group, a biotin or digoxigenin moiety, a fluorescent tag or by using radioactive nucleotides. A primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5′ end of the primer, with the remainder of the primer sequence being substantially complementary to the strand. The term primer as used herein includes all forms of primers that may be synthesized including peptide nucleic acid primers, locked nucleic acid primers, phosphorothioate modified primers, labeled primers, and the like. The term “forward primer” as used herein means a primer that anneals to the anti-sense strand of double-stranded DNA (dsDNA). A “reverse primer” anneals to the sense- strand of dsDNA.

[0051] Primers are typically at least 10, 15, 18, or 30 nucleotides in length or up to about 100, 110, 125, or 200 nucleotides in length. In some embodiments, primers are preferably between about 15 to about 60 nucleotides in length, and most preferably between about 25 to about 40 nucleotides 13 4862-6122-2014.1in length. In some embodiments, primers are 15 to 35 nucleotides in length. There is no standard length for optimal hybridization or polymerase chain reaction amplification. An optimal length for a particular primer application may be readily determined in the manner described in H. Erlich, PCR Technology, PRINCIPLES ANDAPPLICATION FORDNA AMPLIFICATION, (1989).

[0052] A “primer extension reaction” refers to a synthetic reaction in which an oligonucleotide primer hybridizes to a target nucleic acid and a complimentary copy of the target nucleic acid is produced by the polymerase-dependent 3’-addition of individual complementary nucleotides. In some embodiments, the primer extension reaction is PCR.

[0053] As used herein, the term “primer pair” refers to a forward and reverse primer pair (i.e., a left and right primer pair) that can be used together to amplify a given region of a nucleic acid of interest.

[0054] “Probe” as used herein refers to nucleic acid that interacts with a target nucleic acid via hybridization. A probe may be fully complementary to a target nucleic acid sequence or partially complementary. The level of complementarity will depend on many factors based, in general, on the function of the probe. Probes can be labeled or unlabeled, or modified in any of a number of ways. A probe may specifically hybridize to a target nucleic acid. Probes may be DNA, RNA or a RNA / DNA hybrid. Probes may be oligonucleotides, artificial chromosomes, fragmented artificial chromosome, genomic nucleic acid, fragmented genomic nucleic acid, RNA, recombinant nucleic acid, fragmented recombinant nucleic acid, peptide nucleic acid (PNA), locked nucleic acid, oligomer of cyclic heterocycles, or conjugates of nucleic acid. Probes may comprise modified nucleobases, modified sugar moieties, and modified internucleotide linkages. A probe may be used to detect the presence or absence of a methylated target nucleic acid. Probes are typically at least about 10, 15, 20, 25, 30, 35, 40, 50, 60, 75, 100 nucleotides or more in length.

[0055] A “probe element” as used herein refers to a stretch of nucleotides that (a) is associated with a primer in that it is connected to or located adjacent to the primer nucleic acid sequence, and (b) specifically hybridizes under stringent conditions to a target nucleic acid sequence to be detected. 14 4862-6122-2014.1

[0056] As used herein, the term “primer-probe detection system” refers to a method for real-time PCR or qPCR. This method utilizes a bi-functional molecule (referred to herein as a primer-probe), which contains a PCR primer element covalently linked by a polymerase-blocking group to a probe element. Additionally, each primer-probe molecule contains a fluorophore that interacts with a quencher to reduce the background fluorescence. Primer-probes, as used herein, may comprise a 3' primer with a 5' extended probe tail comprising a hairpin structure which possesses a fluorophore / quencher pair. During PCR, the polymerase is blocked from extending into the probe tail by the inclusion of a blocker, such as hexethylene glycol (HEG) for example. During the first round of amplification the 3' target-specific primer anneals to the target nucleic acid and is extended such that the primer-probe is now incorporated into the newly synthesized strand, which possesses a newly synthesized target region for the 5' probe. During the next round of denaturation and annealing, the probe region of the primer-probe hairpin loop will hybridize to the target, thus separating the fluorophore and quencher and creating a measurable signal. Such primer-probes are described in Whitcombe et al., Nature Biotech 17: 804-807 (1999). SCORPION primers are exemplary primer-probes.

[0057] The term “quencher moiety” as used herein means a molecule that, in close proximity to a donor fluorophore, takes up emission energy generated by the donor and either dissipates the energy as heat or emits light of a longer wavelength than the emission wavelength of the donor. In the latter case, the quencher is considered to be an acceptor fluorophore. The quenching moiety can act via proximal (i.e., collisional) quenching or by Förster or fluorescence resonance energy transfer (“FRET”). Quenching by FRET is generally used in TaqMan® probes while proximal quenching is used in molecular beacon and Scorpion™ type probes.

[0058] A “reaction-sample mixture” as used herein refers to a mixture containing amplification master mix and a sample.

[0059] As used herein, the term “Rh phenotype” refers to determining the presence or absence of antigens of the Rh blood group, specifically red cell antigens C, D and E. An individual is either Rh positive or Rh negative for a given antigen. For example, a RhD negative individual does not express antigen D, whereas an RhD positive individual does express antigen D. 15 4862-6122-2014.1

[0060] As used herein, the term “Rh negative” refers to a RhD negative phenotype. The RhD negative phenotype, found in approximately 15% of the population, can be caused by three main mechanisms: 1. RhD deletion, where the entire RhD gene is deleted; 2. RhD*psi (or RhD*Ψ), a pseudo gene with a duplication insert and a nucleotide change that creates a stop codon; and 3. RhD-CE-D hybrid (or RhD*IIIa-CE(4-7)-D), in which certain RhD exons are deleted and replaced by RHCE exons. Different genotype variants resulting divergent RhD phenotypes may be associated with the presence of RhD exon 7 and the absence of RhD exon 5, as shown in FIG. 1 for example. See, e.g., Wagner et al., BMC Genet. 2001:2:10; Finning et al., BMJ 2008;336:816; De Haas, et al., BMJ 2016;355:i5789. Exon genotype vs. phenotype is summarized in Table 1 below. Table 1. RhD exon expression vs RhD phenotype RhD Exon 7 RhD Exon 5 Result Interpretation of RhD Major Group Based on qPCR Assay qPCR Assay Ct Value in RhD Negative Mother Positive Positive Fetus RhD Positive Positive Negative RhD Variant Detected in Fetus Negative Negative Fetus RhD Negative (deletion or RhD-CE-D hybrid)

[0061] As used herein, “Rh incompatibility” occurs when a Rh negative mother is pregnant with a Rh positive fetus. This phenomenon becomes clinically significant if a mother that is Rh negative becomes sensitized to a Rh antigen, for example the D antigen, and subsequently produces anti-D antibodies (i.e., alloimmunization) that can bind to and potentially lead to the destruction of RhD positive erythrocytes. This is of particular concern if an RhD negative mother is carrying an RhD positive fetus, where the RhD incompatibility can result in consequences along the spectrum of HDN ranging from self-limited hemolytic anemia to severe hydrops fetalis.

[0062] As used herein, “maternal Rh sensitization” occurs when red cells from a Rh positive fetus cross the placenta and sensitize a Rh negative mother, especially at parturition. When mother that is RhD negative becomes sensitized to the Rh antigens present on the red blood cells, the mother will produce anti-RH antibodies (i.e., alloimmunization). The mother's antibodies may then, in a subsequent pregnancy, cause haemolytic disease of the newborn if the fetus is Rhesus positive. 16 4862-6122-2014.1

[0063] As used herein, the term “sample” refers to clinical samples obtained from a patient. In preferred embodiments, a sample is obtained from a biological source (i.e., a “biological sample”), such as tissue, bodily fluid, or microorganisms collected from a subject. Sample sources include, but are not limited to, mucus, sputum (processed or unprocessed), bronchial alveolar lavage (BAL), bronchial wash (BW), blood, bodily fluids, cerebrospinal fluid (CSF), urine, plasma, serum, or tissue (e.g., biopsy material).

[0064] The term “specific” as used herein in reference to an oligonucleotide primer means that the nucleotide sequence of the primer has at least 12 bases of sequence identity with a portion of the nucleic acid to be amplified when the oligonucleotide and the nucleic acid are aligned. An oligonucleotide primer that is specific for a nucleic acid is one that, under the stringent hybridization or washing conditions, is capable of hybridizing to the target of interest and not substantially hybridizing to nucleic acids which are not of interest. Higher levels of sequence identity are preferred and include at least 75%, at least 80%, at least 85%, at least 90%, at least 85- 95% and more preferably at least 98% sequence identity. Sequence identity can be determined using a commercially available computer program with a default setting that employs a variety of algorithms. As used herein, sequences that have “high sequence identity” have identical nucleotides at least at about 50% of aligned nucleotide positions, preferably at least at about 60% of aligned nucleotide positions, and more preferably at least at about 75% of aligned nucleotide positions.

[0065] As used herein “TaqMan^ PCR detection system” refers to a method for real-time PCR or quantitative PCR (qPCR). In this method, a TaqMan^ probe which hybridizes to the amplified nucleic acid segment may be included in the amplification master mix. The TaqMan^ probe comprises a donor and a quencher fluorophore on either end of the probe and in close enough proximity to each other so that the fluorescence of the donor is taken up by the quencher. However, when the probe hybridizes to the amplified segment, the 5'-exonuclease activity of the Taq polymerase cleaves the probe thereby allowing the donor fluorophore to emit fluorescence which can be detected.

[0066] The terms “target nucleic acid” or “target sequence” as used herein refer to a nucleic acid sequence of interest to be detected and / or quantified in the sample to be analyzed. Target nucleic 17 4862-6122-2014.1acid may be composed of segments of a chromosome, a complete gene with or without intergenic sequence, segments or portions of a gene with or without intergenic sequence, or sequence of nucleic acids which probes or primers are designed. Target nucleic acids may include a wild-type sequence(s), a mutation, deletion, insertion or duplication, tandem repeat elements, a gene of interest, a region of a gene of interest or any upstream or downstream region thereof. Target nucleic acids may represent alternative sequences or alleles of a particular gene. Target nucleic acids may be derived from genomic DNA, cDNA, or RNA. Impact of Rhesus incompatibility

[0067] Rh incompatibility between a pregnant mother and her in utero fetus exists when the mother has Rh negative blood and her fetus has Rh positive blood (e.g., due to the fetus's father having Rh positive blood). During pregnancy, when blood from an Rh positive fetus mixes with blood from an Rh negative mother, the mother's body naturally generates antibodies that may affect the current pregnancy with the fetus and / or future pregnancies with other fetuses, in such examples, the antibodies may target and / or attack Rh proteins in the blood of the fetus and / or in the blood of any babies of future pregnancies. Such attacks may cause a decrease in red blood cells and potentially cause a plurality of diseases and / or complications (e.g., anemia, jaundice, brain damage, heart failure, or death for the fetus(s).

[0068] When an Rh incompatibility exists between a mother and her fetus, treatment is available for the mother to prevent generation of antibodies (e.g., by administering injections of Rh immune- globulin) and / or destruction of any antibodies that have been generated. Accordingly, the treatment may maintain safety of the fetus by protecting the fetus's Rh positive blood and or red blood cells. Previous techniques for detecting Rh incompatibility between an Rh negative mother and her Rh positive fetus involve various invasive methods (e.g., amniocentesis, including probing the uterus of the mother) and non-invasive methods (e.g., ultrasounds, maternal blood sampling). Invasive methods may be painful and / or, in some instances, dangerous for the mother and / or fetus. Previous non-invasive methods, though considered relatively safe, themselves, are performed periodically (e.g., monthly) by a mother's healthcare provider. Accordingly, a considerable amount of time (up to a month or more) may pass between an existence of Rh incompatibility taking place and detection of the Rh incompatibility. In some instances, the mother’s antibodies may already have 18 4862-6122-2014.1caused untreatable damage to the fetus and / or the fetus's blood system. Thus, it is desirable to detect an Rh incompatibility between a mother and her fetus as soon as possible so that the mother may receive treatment to ensure the safety of the fetus. Biological Sample Collection and Preparation

[0069] The cell-free nucleic acid may be isolated from any type of suitable liquid biological specimen or sample (e.g., a test sample). A sample or test sample can be any specimen that is isolated or obtained from a subject or part thereof (e.g., a human subject, a pregnant female, a fetus). Non-limiting examples of specimens include fluid from a subject, including: blood or a blood product (e.g., serum, plasma, or the like), umbilical cord blood, amniotic fluid, cerebrospinal fluid, spinal fluid, lavage fluid (e.g., bronchoalveolar, gastric, peritoneal, ductal, ear, arthroscopic), washings of female reproductive tract, urine, feces, sputum, saliva, nasal mucous, prostate fluid, lavage, semen, lymphatic fluid, bile, tears, sweat, breast milk, breast fluid, the like or combinations thereof. In some embodiments, a liquid biological sample is a blood plasma or serum sample. The term “blood” as used herein refers to a blood sample or preparation from a pregnant woman or a woman being tested for possible pregnancy. The term encompasses whole blood, blood product or any fraction of blood, such as serum, plasma, buffy coat, or the like. Blood or fractions thereof often comprise nucleosomes (e.g., maternal and / or fetal nucleosomes). Nucleosomes comprise nucleic acids and are sometimes cell-free or intracellular. Blood also comprises buffy coats. Buffy coats are sometimes isolated by utilizing a ficoll gradient. Buffy coats can comprise white blood cells (e.g., leukocytes, T-cells, B-cells, platelets, and the like). In certain embodiments buffy coats comprise maternal and / or fetal nucleic acid. Blood plasma refers to the fraction of whole blood resulting from centrifugation of blood treated with anticoagulants. Blood serum refers to the watery portion of fluid remaining after a blood sample has coagulated. Fluid samples often are collected in accordance with standard protocols hospitals or clinics generally follow. For blood, an appropriate amount of peripheral blood (e.g., between 3-40 milliliters) often is collected and can be stored according to standard procedures prior to or after preparation. A fluid sample from which nucleic acid is extracted may be acellular (e.g., cell-free). In some embodiments, a fluid or tissue sample may contain cellular elements or cellular remnants. In some embodiments, fetal cells or cancer cells may be included in the sample. In some embodiments the cells, cellular elements or cellular remnants are removed from the liquid sample prior to nucleic acid extraction. 19 4862-6122-2014.1

[0070] A sample often is heterogeneous, by which is meant that more than one type of nucleic acid species is present in the sample. For example, heterogeneous nucleic acid can include, but is not limited to, (i) fetal derived and maternal derived nucleic acid, (ii) cancer and non-cancer nucleic acid, (iii) pathogen and host nucleic acid, (iv) transplant donor and recipient nucleic acid; or (v) mutated and wild-type nucleic acid.

[0071] For prenatal applications of technology described herein, fluid sample can be collected from a female at a gestational age suitable for testing, or from a female who is being tested for possible pregnancy. Suitable gestational age may vary depending on the prenatal test being performed. In certain embodiments, a pregnant female subject sometimes is in the first trimester of pregnancy, at times in the second trimester of pregnancy, or sometimes in the third trimester of pregnancy. In certain embodiments, a fluid sample is collected from a pregnant female between about 1 to about 45 weeks of fetal gestation (e.g., at 1-4, 4-8, 8-12, 12-16, 16-20, 20-24, 24-28, 28-32, 32-36, 36-40 or 40-44 weeks of fetal gestation), or between about 5 to about 28 weeks of fetal gestation (e.g., at 6, 7, 8, 9,10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26 or 27 weeks of fetal gestation). In certain embodiments a fluid sample is collected from a pregnant female during or just after (e.g., 0 to 72 hours after) giving birth (e.g., vaginal or non-vaginal birth (e.g., surgical delivery)).

[0072] Various methods for preparing serum or plasma from maternal blood may be used. For example, a pregnant woman's blood can be placed in a tube containing EDTA or a specialized commercial product such as Streck BCT collection tubes (Streck), which stabilizes white blood cells, preventing the release of genomic DNA, allowing isolation of high-quality cell-free DNA, and plasma can then be obtained from whole blood through centrifugation. Serum may be obtained with or without centrifugation-following blood clotting. If centrifugation is used then it is typically, though not exclusively, conducted at an appropriate speed, e.g., 1,500-3,000 times g. Plasma or serum may be subjected to additional centrifugation steps before being transferred to a fresh tube for cfDNA extraction. In some embodiments, cfDNA can be extracted using a kit. For example, the Qiagen Circulating Nuclei Acid Kit can be used. In some embodiments, the QIAsymphony circulating DNA Kit may be used for automated cfDNA extraction. In some embodiments, gDNA may be extracted using the QIAgen DNeasy Blood and Tissue Kit. 20 4862-6122-2014.1Quantitative PCR

[0073] Amplification of target nucleic acids can be detected by any of a number of available methods such as gel electrophoresis, column chromatography, hybridization with a probe, sequencing, melting curve analysis, or “real-time” detection.

[0074] Detection of target nucleic acids can be conducted in real time in an amplification assay (e.g., qPCR). In one aspect, the amplified products can be directly visualized with fluorescent DNA-binding agents including but not limited to DNA intercalators and DNA groove binders. Because the amount of the intercalators incorporated into the double-stranded DNA molecules is typically proportional to the amount of the amplified DNA products, one can conveniently determine the amount of the amplified products by quantifying the fluorescence of the intercalated dye using a variety of optical systems. DNA-binding dyes suitable for this application include, as non-limiting examples, SYBR green, SYBR blue, DAPI, propidium iodine, Hoeste, SYBR gold, ethidium bromide, acridines, proflavine, acridine orange, acriflavine, fluorcoumanin, ellipticine, daunomycin, chloroquine, distamycin D, chromomycin, homidium, mithramycin, ruthenium polypyridyls, anthramycin, and the like.

[0075] Other fluorescent labels such as sequence specific probes can be employed in the amplification reaction to facilitate the detection and quantification of the amplified products. Probe-based quantitative amplification relies on the sequence-specific detection of a desired amplified product. It utilizes fluorescent, target-specific probes (e.g., TaqMan® and Scorpion probes) resulting in increased specificity and sensitivity.

[0076] In real-time quantitative PCR, the accumulation of amplification product is measured continuously in both standard dilutions of target DNA and samples containing unknown amounts of target DNA. A standard curve is constructed by correlating initial template concentration in the standard samples with the number of PCR cycles (Ct) necessary to produce a specific threshold concentration of product. In the test samples, target PCR product accumulation is measured after the same Ct, which allows interpolation of target DNA concentration from the standard curve.

[0077] In some embodiments, amplified nucleic acids are detected by hybridization with a specific probe. Probe oligonucleotides, complementary to a portion of the amplified target sequence may 21 4862-6122-2014.1be used to detect amplified fragments. In some embodiments, hybridization may be detected in real-time. In an alternate embodiment, hybridization is not detected in real-time. Amplified nucleic acids for each of the target sequences may be detected simultaneously (i.e., in the same reaction vessel such as multiplex PCR) or individually (i.e., in separate reaction vessels). In certain embodiments, multiple target nucleic acids are detected simultaneously, using two or more distinguishably-labeled (e.g., via different detectable moieties such as color), gene-specific oligonucleotide probes, one which hybridizes to the first target sequence and the other which hybridizes to the second target sequence.

[0078] In some embodiments, the different primer pairs are labeled with different distinguishable detectable moieties. Thus, for example, HEX and FAM fluorescent dyes may be present on different primer pairs in the multiplex PCR and associated with the resulting amplicons. In other embodiments, the forward primer is labeled with one detectable moiety, while the reverse primer is labeled with a different detectable moiety, e.g. FAM dye for a forward primer and HEX dye for a reverse primer. Use of different detectable moieties is useful for discriminating between amplified products which are of the same length or are very similar in length.

[0079] For sequence-modified nucleic acids, the target may be independently selected from the top strand or the bottom strand. Thus, all targets to be detected may comprise top strand, bottom strand, or a combination of top strand and bottom strand targets.

[0080] One general method for qPCR uses fluorescent probes such as the TaqMan® probes, molecular beacons, and Scorpion primer-probes. Real-time qPCR quantifies the initial amount of the template with more specificity, sensitivity and reproducibility, than other forms of quantitative PCR, which detect the amount of final amplified product. Real-time PCR does not detect the size of the amplicon. The probes employed in Scorpion™ and TaqMan® technologies are based on the principle of fluorescence quenching and involve a donor fluorophore and a quenching moiety.

[0081] qPCR is performed using any suitable instrument capable of detecting the accumulation of the PCR amplification product. Most commonly, the instrument is capable of detecting fluorescence from one or more fluorescent labels. For example, real-time detection on the instrument (e.g., an ABI Real-Time PCR System 7500® sequence detector) monitors fluorescence and calculates the measure of reporter signal, or Rn value, during each PCR cycle. The threshold 22 4862-6122-2014.1cycle, or Ct value, is the cycle at which fluorescence intersects the threshold value. The threshold value can be determined by the sequence detection system software or manually.

[0082] In some embodiments, the probes employed are detectably labeled and the detecting is accomplished by detecting the probe label for each amplification product. A quencher may further be associated with the detectable label which prevents detection of the label prior to amplification of the probe's target. TaqMan® probes are examples of such probes.

[0083] TaqMan® probes (Heid et al., Genome Res. 6: 986-994, 1996) use the fluorogenic 5' exonuclease activity of Taq polymerase to measure the amount of target sequences in DNA samples. TaqMan® probes are oligonucleotides that contain a donor fluorophore usually at or near the 5' base, and a quenching moiety typically at or near the 3' base. The quencher moiety may be a dye such as TAMRA or may be a non- fluorescent molecule such as 4-(4 - dimethylaminophenylazo) benzoic acid (DABCYL). See Tyagi et al., 16 Nature Biotechnology 49-53 (1998). When irradiated, the excited fluorescent donor transfers energy to the nearby quenching moiety by FRET rather than fluorescing. Thus, the close proximity of the donor and quencher prevents emission of donor fluorescence while the probe is intact.

[0084] TaqMan® probes are designed to anneal to an internal region of a PCR product. When the polymerase replicates a template on which a TaqMan® probe is bound, its 5' exonuclease activity cleaves the probe. This terminates the activity of the quencher (no FRET) and the donor fluorophore starts to emit fluorescence which increases in each cycle proportional to the rate of probe cleavage. Accumulation of PCR product is detected by monitoring the increase in fluorescence of the reporter dye. If the quencher is an acceptor fluorophore, then accumulation of PCR product can be detected by monitoring the decrease in fluorescence of the acceptor fluorophore.

[0085] In certain embodiments, qPCR is performed using a bifunctional primer-probe detection system (e.g., Scorpion™ primers). With Scorpion primers, sequence-specific priming and PCR product detection is achieved using a single molecule. The Scorpion primer maintains a stem-loop configuration in the unhybridized state. The fluorophore is attached to the 5' end and is quenched by a moiety coupled to the 3' end, although in certain embodiments, this arrangement may be switched. The 3' portion of the stem and / or loop also contains sequence that is complementary to 23 4862-6122-2014.1the extension product of the primer and is linked to the 5' end of a specific primer via a non- amplifiable monomer. After extension of the primer moiety, the specific probe sequence is able to bind to its complement within the extended amplicon, thus opening up the hairpin loop. This prevents the fluorescence from being quenched and a signal is observed. A specific target is amplified by the reverse primer and the primer portion of the Scorpion^ primer, resulting in an extension product. A fluorescent signal is generated due to the separation of the fluorophore from the quencher resulting from the binding of the probe element of the Scorpion^ primer to the extension product.

[0086] In some embodiments, the probes employed in the disclosed methods comprise or consist of short fluorescently labeled DNA sequences designed to detect sections of DNA sequence with a genetic variation such as those disclosed in French et al., Mol Cell Probes, 5(6):363-74 (2001), incorporated by reference herein in its entirety. HyBeacons® are an example of this type of probe.

[0087] In some embodiments of the method, at least one primer of each primer pair or at least one probe in the amplification reaction comprises a detectable moiety. Alternatively, the detectable moiety may be on a probe that is attached to the primer, such as with a primer-probe. In some embodiments, the detectable moiety or label is a fluorophore. Suitable fluorescent moieties include, but are not limited to the following fluorophores: 4-acetamido-4'-isothiocyanatostilbene- 2,2'disulfonic acid, acridine and derivatives (acridine, acridine isothiocyanate), Alexa Fluors (Alexa Fluor® 350, Alexa Fluor® 488, Alexa Fluor® 546, Alexa Fluor® 555, Alexa Fluor® 568, Alexa Fluor® 594, Alexa Fluor® 647 (Molecular Probes)), 5-(2'-aminoethyl)aminonaphthalene- 1-sulfonic acid (EDANS), 4-amino-N-[3-vinylsulfonyl)phenyl]naphthalimide-3,5 disulfonate (Lucifer Yellow VS), N-(4-anilino-1-naphthyl)maleimide, anthranilamide, BODIPY® R-6G, BOPIPY® 530 / 550, BODIPY® FL, Brilliant Yellow, Cal Fluor Red 610® (CFR610), coumarin and derivatives (coumarin, 7-amino-4-methylcoumarin (AMC, Coumarin 120), 7-amino-4- trifluoromethylcouluarin (Coumarin 151)), Cy2®, Cy3®, Cy3.5®, Cy5®, Cy5.5®, cyanosine, 4',6-diaminidino-2-phenylindole (DAPI), 5', 5”-dibromopyrogallol-sulfonephthalein (Bromopyrogallol Red), 7-diethylamino-3-(4'-isothiocyanatophenyl)-4-methylcoumarin, diethylenetriamine pentaacetate, 4,4'-diisothiocyanatodihydro-stilbene-2,2'-disulfonic acid, 4,4'- diisothiocyanatostilbene-2,2'-disulfonic acid, 5-[dimethylamino]naphthalene-1-sulfonyl chloride (DNS, dansyl chloride), 4-(4'-dimethylaminophenylazo)benzoic acid (DABCYL), 4- 24 4862-6122-2014.1dimethylaminophenylazophenyl-4'-isothiocyanate (DABITC), EclipseTM (Epoch Biosciences Inc.), eosin and derivatives (eosin, eosin isothiocyanate), erythrosin and derivatives (erythrosin B, erythrosin isothiocyanate), ethidium, fluorescein and derivatives (5-carboxyfluorescein (FAM), 5’6-FAM (56-FAM), 5-(4,6-dichlorotriazin-2-yl)aminofluorescein (DTAF), 2',7'-dimethoxy-4'5'- dichloro-6-carboxyfluorescein (JOE), fluorescein, fluorescein isothiocyanate (FITC), hexachloro- 6-carboxyfluorescein (HEX), QFITC (XRITC), tetrachlorofluorescein (TET), fluorescamine, IR144, IR1446, lanthamide phosphors, Malachite Green isothiocyanate, 4-methylumbelliferone, ortho cresolphthalein, nitrotyrosine, pararosaniline, Phenol Red, B-phycoerythrin, R- phycoerythrin, allophycocyanin, o-phthaldialdehyde, Oregon Green®, propidium iodide, pyrene and derivatives (pyrene, pyrene butyrate, succinimidyl 1-pyrene butyrate), QSY® 7, QSY® 9, QSY® 21, QSY® 35 (Molecular Probes), Reactive Red 4 (Cibacron® Brilliant Red 3B-A), rhodamine and derivatives (6-carboxy-X-rhodamine (ROX), 6-carboxyrhodamine (R6G), lissamine rhodamine B sulfonyl chloride, rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine green, rhodamine X isothiocyanate, sulforhodamine B, sulforhodamine 101, sulfonyl chloride derivative of sulforhodamine 101 (Texas Red), N,N,N',N'-tetramethyl-6- carboxyrhodamine (TAMRA), tetramethyl rhodamine, tetramethyl rhodamine isothiocyanate (TRITC), riboflavin, rosolic acid, terbium chelate derivatives, Quasar 670®, and VIC®.

[0088] Suitable quenchers are selected based on the fluorescence spectrum of the particular fluorophore. Useful quenchers include, for example, the Black Hole™ quenchers BHQ-1, BHQ 2, and BHQ-3 (Biosearch Technologies, Inc.), ZEN, 3IABkFQ, and the ATTO-series of quenchers (ATTO 540Q, ATTO 580Q, and ATTO 612Q; Atto-Tec GmbH). RhD Incompatibility Screening Assay of the Present Technology

[0089] In various embodiments of the present disclosure, primers and probes are used in the methods described herein to amplify and detect target nucleic acid sequences of Rhesus D antigen and one or more control nucleic acid sequences. In some embodiments, the one or more control nucleic acid sequence comprises an Argonaute RISC Component 1 (AGO1) nucleic acid sequence.

[0090] In some embodiments, the control nucleic acid sequence comprises a sequence that is at least 85-95% identical to 25 4862-6122-2014.1GTTCGGCTTTCACCAGTCTGTGCGCCCTGCCATGTGGAAGATGATGCTCAACATTGA TGGTGAGTGGGGAGAGCTATGGAG (SEQ ID NO: 12), and a forward primer comprising 5’ GTTCGGCTTTCACCAGTCT 3’ (SEQ ID NO: 7), a reverse primer comprising 5’ GAGTGGGGAGAGCTATGGAG 3’ (SEQ ID NO: 8) and a detectably labelled nucleic acid probe that hybridizes to a sequence comprising 5’ CTGCCATGTGGAAGATGATGCTCAACA 3’ (SEQ ID NO: 9) are used to amplify the control nucleic acid sequence. Primers used to amplify the 81 bp AGO1 control nucleic acid sequence are described in Fan et al. (PNAS, 2008;105(42):16266-16271) and Sillence et al. (Clin Chem, 2017; 63(8):1388-1397). The control nucleic acid probe sequence disclosed herein may be conjugated to a 5Sun fluorescent dye attachment and a 3IABkFQ quencher. The nucleic acid probe may additionally comprise an internal quencher such as ZEN. The nucleic acid probe may therefore comprise a sequence of 5SUN / CTGCCATGT / ZEN / GGAAGATGATGCTCAACA / 3IABkFQ (SEQ ID NO: 15).

[0091] In some embodiments, primers and probes are used in the methods described herein to amplify and detect exon 7 (RhD exon 7) and / or exon 5 (RhD exon 5) of the Rhesus D antigen target nucleic acid sequences.

[0092] In some embodiments, the primers and probes of the present technology are used in the methods described herein to amplify and detect a RhD exon 5 target nucleic acid comprising a sequence that is at least 85-95% identical to SEQ ID NO: 10, or a complement thereof. Alternatively or additionally, the primers and probes of the present technology are used in the methods described herein to amplify and detect a RhD exon 7 target nucleic acid comprising a sequence that is at least 85-95% identical to SEQ ID NO: 11, or a complement thereof.

[0093] In some embodiments, the target nucleic acid sequence comprises a sequence that is at least 85-95% identical to CGCCCTCTTCTTGTGGATGTTCTGGCCAAGTTTCAACTCTGCTCTGCTGAGAAGTCCA ATCGAAAGGAAGAATGCCGTGTTC (SEQ ID NO: 10), and a forward primer comprising 5’ CGCCCTCTTCTTGTGGATG 3’ (SEQ ID NO: 1), a reverse primer comprising 5’ GAAAGGAAGAATGCCGTGTTC 3’ (SEQ ID NO: 2) and a detectably labelled nucleic acid probe that hybridizes to a sequence comprising 5’ TCTGGCCAAGTTTCAACTCTGCTCTGCT 3’ (SEQ ID NO: 3) are used to amplify the control nucleic acid sequence. Primers used to amplify 26 4862-6122-2014.1the 82 bp exon 5 nucleic acid sequence are described in Finning et al. (BMJ, 2008; 336:816-818) and Sillence et al. (Clin Chem, 2017; 63(8):1388-1397). The control nucleic acid probe sequence disclosed herein may be conjugated to a 56-FAM fluorescent dye attachment and a 3IABkFQ quencher. The nucleic acid probe may additionally comprise an internal quencher such as ZEN. The nucleic acid probe may therefore comprise a sequence of 56-FAM / TCTGGCCAA / ZEN / GTTTCAACTCTGCTCTGCT / 3IABkFQ (SEQ ID NO: 13).

[0094] In some embodiments, the target nucleic acid sequence comprises a sequence that is at least 85-95% identical to CAGCTCCATCATGGGCTACAACTTCAGCTTGCTGGGTCTGCTTGGAGAGATCATCTA CATTGTGCTGCTGGTGCT (SEQ ID NO: 11), and a forward primer comprising 5’ CAGCTCCATCATGGGCTACAA 3’ (SEQ ID NO: 4), a reverse primer comprising 5’ TCTACATTGTGCTGCTGGTGCT 3’ (SEQ ID NO: 5) and a detectably labelled nucleic acid probe that hybridizes to a sequence comprising 5’ AGCTTGCTGGGTCTGCTTGGAGAGATC 3’ (SEQ ID NO: 6) are used to amplify the control nucleic acid sequence. Primers used to amplify the 75 bp exon 7 nucleic acid sequence are described in Finning et al. (BMJ, 2008; 336:816-818) and Sillence et al. (Clin Chem, 2017; 63(8):1388-1397). The control nucleic acid probe sequence disclosed herein may be conjugated to a 56-FAM fluorescent dye attachment and a 3IABkFQ quencher. The nucleic acid probe may additionally comprise an internal quencher such as ZEN. The nucleic acid probe may therefore comprise a sequence of 56-FAM / AGCTTGCTG / ZEN / GGTCTGCTTGGAGAGATC / 3IABkFQ (SEQ ID NO: 14).

[0095] As explained herein, Rh incompatibility occurs when a mother’s Rhesus status is negative and a fetus’ Rhesus status is positive. The screening assay of the present invention detects RhD incompatibility based on the RhD ΔCt method described herein. First, the maternal samples are separated based on the presence or absence of RhD exon 7 and / or 5, i.e. the “Positive Group” vs the “Negative Group”, with a Ct value equal to 0 or greater than a threshold indicating RhD negative. Those samples that express RhD, i.e. the positive group, can then be separated into two sub-groups, i.e. the “Maternal Positive Sub-Group” (maternal positive, fetus positive or negative) and the “Fetus Positive Sub-Group” (maternal negative, fetus positive). As explained herein, the Fetus Positive Sub-Group will be Rhesus incompatible and will possess a RhD ΔCt value above a threshold. 27 4862-6122-2014.1

[0096] More specifically, the Ct value of the control nucleic acid is subtracted from the Ct value of the RhD nucleic acid to give a RhD ΔCt. A RhD ΔCt that exceeds a threshold indicates RhD incompatibility between the mother and fetus, i.e. a RhD negative mother and a positive fetus. RhD incompatibility diagnosis based on the RhD ΔCt value is summarized in Table 2 below. Table 2. Rhesus incompatibility diagnosis based on the RhD ΔCt values ∆Ct(Exon 7- Mother RhD Fetus RhD Exon 7 Ct and / or AGO1) and / or Rh Status Status Exon 5 Ct ∆Ct(Exon 5- Incompatible AGO1) Within Ct Negative Positive threshold > ∆Ct threshold Yes Negative or Within Ct Positive Positive threshold < ∆Ct threshold No Ct = 0 or > Ct Negative Negative threshold N / A No Diagnosis of Rhesus Incompatibility and RhD Incompatibility

[0097] Current methods of diagnosing Rh incompatibility prenatally rely on invasive procedures such as amniocentesis, which impose risk to the fetus and / or mother. Previous non-invasive methods (e.g., ultrasounds, maternal blood sampling), though considered relatively safe, themselves, are performed periodically (e.g., monthly) by a mother's healthcare provider. Accordingly, a considerable amount of time (up to a month or more) may pass between an existence of Rh incompatibility taking place and detection of the Rh incompatibility. In some instances, the mother’s antibodies may already have caused untreatable damage to the fetus and / or the fetus's blood system. Thus, it is desirable to detect an Rh incompatibility between a mother and her fetus as soon as possible so that the mother may receive treatment to prevent sensitization and ensure the safety of future pregnancies. More recently, efforts have been made to use circulating cell-free fetal DNA in RhD negative maternal plasma for non-invasive prenatal diagnostics of fetal RhD status. In each of these cases however, maternal Rhesus status must first be known.

[0098] In one aspect, the present disclosure provides a method of detecting RhD incompatibility during pregnancy, comprising: a) extracting DNA from a blood sample of a pregnant mother; b) 28 4862-6122-2014.1performing qPCR on the DNA to determine Ct values of at least one RhD exon and at least one internal control gene; and c) calculating the ΔCt value between the at least one RhD exon and at least one internal control gene. In one embodiment of the present disclosure, RhD incompatibility can be diagnosed when the ΔCt value is above a threshold. In some embodiments the DNA is cell- free DNA and / or genomic DNA. In some embodiments, a NGS library may be prepared from the extracted DNA and used to perform the qPCR of step b).

[0099] In one aspect, the present disclosure provides a method of determining a risk of RhD incompatibility during pregnancy, comprising: a) extracting DNA from a blood sample of a pregnant mother; b) performing qPCR on the DNA to determine Ct values of at least one RhD exon and at least one internal control gene; c) calculating the ΔCt value between the at least one RhD exon and at least one internal control gene; and d) indicating a risk of RhD incompatibility when the ΔCt value is greater than a threshold. In some embodiments, the DNA is cell-free DNA and / or gDNA. In some embodiments, a NGS library may be prepared from the extracted DNA and used to perform the qPCR of step b).

[0100] In some embodiments, the methods disclosed herein determine the Ct value of RhD exon 7, RhD exon 5, RhD exon 4, RhD exon 6 and / or RhD exon 10. In some embodiments, the methods disclosed herein determine the Ct value of AGO1.

[0101] In some embodiments, performing qPCR comprises amplification of at least one nucleic acid, wherein the at least one nucleic acid comprises a sequence at least 85-95% identical to one or more of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, or a complement thereof. Performing qPCR comprises one or more primer pairs comprising the sequences selected from SEQ ID NOs: 1 and 2, SEQ ID NOs: 4 and 5, and / or SEQ ID NOs: 7 and 8, or a complement thereof.

[0102] In some embodiments, performing qPCR comprises using one or more probes. In some embodiments, the probes are capable of specifically hybridizing to a nucleic acid the sequence of SEQ ID NO: 3, SEQ ID NO: 6, and / or SEQ ID NO: 9, or a complement thereof. In some embodiments, the probes are detectably labelled. In some embodiments, the probes comprise SEQ ID NOs: 13, 14, and / or 15, or a complement thereof. 29 4862-6122-2014.1

[0103] In some embodiments, the ΔCt value is calculated by subtracting the Ct value of AGO1 from the Ct value of RhD exon 5, i.e., ΔCt = Ctexon5-CtAGO1. In some embodiments, the ΔCt value is calculated by subtracting the Ct value of AGO1 from the Ct value of RhD exon 7, i.e., ΔCt = Ctexon7-CtAGO1. In some embodiments, the ΔCt value is calculated by averaging the ΔCt = Ctexon5- CtAGO1and ΔCt = Ctexon7-CtAGO1. In some embodiments, when ΔCt is calculated from both the Ct value of RhD exon 7 and RhD exon 5 qPCR assay results, the Ctcontrolis the average AGO1 Ct value from both RhD qPCR assays, i.e., the Exon 7 + AGO1 assay and the Exon 5 + AGO1 assay.

[0104] In some embodiments, RhD incompatibility can be diagnosed when the ΔCt value is above a threshold. In some embodiments the threshold is between ≥0 and ≤1. In some embodiments the threshold is between ≥0.4 and ≤1.2. In some embodiments the threshold is about 0. In some embodiments the threshold is about 0.1. In some embodiments the threshold is about 0.2. In some embodiments the threshold is about 0.3. In some embodiments the threshold is about 0.4. In some embodiments the threshold is about 0.5. In some embodiments the threshold is about 0.6. In some embodiments the threshold is about 0.7. In some embodiments the threshold is about 0.8. In some embodiments the threshold is about 0.9. In some embodiments the threshold is about 1.0. In some embodiments the threshold is about 1.1. In some embodiments the threshold is about 1.2. Management of Rhesus Incompatibility and RhD Incompatibility

[0105] Current methods of managing Rh incompatibility include providing prophylactic treatment in a Rh negative mother, regardless of the Rh status of the fetus. A Rh immuno-globulin injection is given to the mother at 28 weeks of gestation. Further Rh immune-globulin injections are also required if a miscarriage occurs or any other bleeding evens during the pregnancy. After the birth of the child, if the Rh status of the child is determined to be positive, a second shot is administered to the mother. The methods provided herein, will allow for the restriction of Rh immune-globulin injections, only to those RhD negative mothers carrying a RhD positive child.

[0106] One aspect of the present disclosure provides a method for treating RhD incompatibility comprising: a) extracting DNA from a blood sample of a pregnant mother; b) performing qPCR on the DNA to determine Ct values of at least one RhD exon and at least one internal control gene; c) calculating the ΔCt value between the at least one RhD exon and at least one internal control 30 4862-6122-2014.1gene; and d) administering Rh immuno-globulin to the pregnant mother when the ΔCt value is greater than a threshold. In some embodiments, the DNA is cfDNA or genomic DNA.

[0107] In some embodiments, Rh incompatibility is treated with Rh immuno-globulin at around 28 weeks gestation. In some embodiments, Rh incompatibility is treated with Rh immune-globulin within 72 hours of giving birth. In some embodiments, Rh incompatibility is treated with Rh immune-globulin within 72 hours of a possible exposure of the mother to Rh positive blood, for example after miscarriage of a RhD positive fetus by a RhD negative mother.

[0108] In some embodiments, mothers of pregnancies determined to be Rh incompatible can also be tested for the presence of Rh antibodies. The presence of Rh antibodies in a Rh negative mother indicates that the mother has been exposed to Rh positive red blood cells from wither this, or a previous Rh positive pregnancy. The presence of Rh antibodies while carrying a Rh negative fetus could lead to severe hemolytic disease in the fetus and newborn. Therefore testing pregnancies determined to be Rh incompatible for the presence of Rhesus antibodies will allow for appropriate treatment plans to be put in place, and therefore reduce the likelihood of miscarriage in a Rh incompatible pregnancy. Kits

[0109] The present disclosure also provides kits for determining RhD incompatibility. In some embodiments, the kit comprises at least two primer pairs and at least two probes for amplifying and detecting one or more RhD antigen target nucleic acids and one or more control nucleic acids. In some embodiments, the kits comprise a primer pair that amplifies a control nucleic acid corresponding to the AGO1 gene or other alternative genes. In some embodiments, the kit comprises one or more primer pairs that amplify a target nucleic acid corresponding to RhD exon 7, exon 5, exon 4, exon 6 and / or RhD exon 10.

[0110] In one aspect, the kits disclosed herein comprise a first primer pair that specifically hybridizes to a nucleic acid having the sequence of SEQ ID NO: 10 or a complement thereof and a first probe capable of specifically hybridizing to the sequence of SEQ ID NO: 10 or a complement thereof; a second primer pair that specifically hybridizes to a nucleic acid having the sequence of SEQ ID NO: 11 or a complement thereof and a second probe capable of specifically 31 4862-6122-2014.1hybridizing to the sequence of SEQ ID NO: 11 or a complement thereof; and a third primer pair that specifically hybridizes to a nucleic acid having the sequence of SEQ ID NO: 12 or a complement thereof and a third probe capable of specifically hybridizing to the sequence of SEQ ID NO: 12 or a complement thereof. In some embodiments, the probes may comprise a detectable label.

[0111] In some embodiments, the kits disclosed herein comprise a primer pair comprising the sequence of SEQ ID NOs: 1 and / or 2 and a probe comprising a sequence of SEQ ID NO: 3, or a complement thereof. In some embodiments, the kits disclosed herein comprise a primer pair comprising the sequence of SEQ ID NOs: 4 and / or 5 and a probe comprising a sequence of SEQ ID NO: 6, or a complement thereof. In some embodiments, the kits disclosed herein comprise a primer pair comprising the sequence of SEQ ID NOs: 7 and / or 8 and a probe comprising a sequence of SEQ ID NO: 9, or a complement thereof.

[0112] The kit may further comprise one or more of: wash buffers and / or reagents, hybridization buffers and / or reagents, labeling buffers and / or reagents, dilution buffers and / or reagents, qPCR master mix and / or reagents, and detection means. The buffers and / or reagents are usually optimized for the particular amplification / detection technique for which the kit is intended. Protocols for using these buffers and reagents for performing different steps of the procedure may also be included in the kit.

[0113] The kit additionally may comprise an assay definition scan card and / or instructions such as printed or electronic instructions for using the oligonucleotides in an assay. In some embodiments, a kit comprises an amplification reaction mixture or an amplification master mix. Reagents included in the kit may be contained in one or more containers, such as a vial. WORKING EXAMPLES Example 1 - Materials and Methods

[0114] Sample libraries: A total of 278 individual samples (cases) were used from previously prepared and purified NGS libraries derived from cfDNA. The samples were divided into three sub-libraries: a training sub-library (n=89 cases) was used to train qPCR conditions and to establish and explore qPCR data analysis criteria, so that the RhD qPCR detection level is able to properly 32 4862-6122-2014.1fit NovaSeq NGS detection level; a blinded testing sub-library (n=95 cases) was used to confirm the qPCR conditions and RhD qPCR data analysis criteria established from the training sub- library; and a blinded verification sub-library (n=94), used to further verify the feasibility of the qPCR testing.

[0115] cfDNA and gDNA templates: cfDNA template was extracted from 10.2 mL pooled EDTA plasma samples, where a single plasma pool was made by combining 50 human single donor EDTA plasmas from Innovative Research in one pool. cfDNA template which is positive for both RhD exon 7 and exon 5 was used as 100% RhD positive controls during RhD qPCR testing development and verification (Data not shown). gDNA templates were extracted from certain cell lines purchased from Coriell Institute for Medical Research. gDNA templates with known RhD status were used to make contrived RhD 2% child positive control and for low limit detection (LOD) testing. gDNA libraries from previous prepared and purified NGS libraries derived from mononucleosome DNA (Mono DNA); Mono DNA was generated from cultured cells treated by Micrococcal nuclease (Mnase) digestion. RhD status of cfDNA and gDNA was confirmed by RhD qPCR.

[0116] qPCR: quantitative PCR was performed using PrimerTime® Gene Expression Master Mix (2X) from Integrated DNA Technologies. DNA templates used included cfDNA, gDNA and NGS library. RhD qPCR 10X assay mixes for RhD exon 5, RhD exon 7, and AGO1 assays were made as indicated in Table 3 below. Table 3. Recipe of 10X qPCR Assay Mix for RhD qPCR RhD qPCR Primers and Probe Assay 10X Mix Final Concentration Forward Primer 5 µM Reverse Primer 5 µM Probe 2.5 µM

[0117] RhD qPCR working mixes (i.e., Amplification master mixes) for RhD 2-plex qPCRs were prepared to compare different total reaction volumes. Equal qPCR detection results were obtained for total reaction volumes of 10 µl, 15 µl, and 20 µl. qPCR working mix recipe for a 15 µl reaction volume is indicated in Table 4 below. Primer and probe sequences are listed in Table 6 below. 33 4862-6122-2014.1Table 4. Recipe of RhD 2-Plex qPCR Assay in 15 uL reaction RhD 2-Plex qPCR Reaction Mix Final concentration or volume in 15 µl IDT PrimerTime GX 2X Master Mix 1X 10X Assay Mix if Exon 5 (or Exon 7) 0.25 µM for each primer and 0.125 µM for 10X Assay Mix of AGO1each probeDNA template 1.0 uL

[0118] A low limit of detection (LOD) assay was performed to determine the minimum amount of DNA required to detect each of RhD exon 5, RhD exon 7, and AGO1 in 2-plex assays. It was found as little as 6.0 pg of DNA was required to detect both RhD exon 7 and AGO1 in RhD exon 7 + AGO12-plex assay (FIG.5); as little as 12.0 pg of DNA was required to detect both RhD exon 5 and AGO1 in RhD 5 + AGO 2-plex assay (Data not shown). In general, as little as 12.0 pg of DNA is required for a RhD 2-plex qPCR testing. In addition, it was found that as little as 15.625 pg of DNA was required to detect RhD exon 5 in a single-plex assay (FIG. 6).

[0119] qPCR was run in triplicate for each sample and each target (Table 7) using the RhD 2-Plex qPCR protocol indicated in Table 5 below, on QuantStudio 6 Flex real-time qPCR instrument. Table 5. RhD 2-Plex qPCR Protocol qPCR reaction volume: 15 µl qPCR cycles Temperature Time Signal Capture Temperature Ramp Speed 1 cycle 95 ºC 3 m No 1.9 ºC / s 50 cycles 95 ºC 10 s No 1.9 ºC / s 58 ºC 15 s No 1.8 ºC / s 72 ºC 20 s Yes 1.9 ºC / s Table 6. List of RhD Primers and Probes Name Sequence 5’- 3’ SEQ ID NO RhD Exon 5 Fwd CGCCCTCTTCTTGTGGATG 1 RhD Exon 5 Rev GAACACGGCATTCTTCCTTTC 2 RhD Exon 5 TCTGGCCAAGTTTCAACTCTGCTCTGCT 3 Probe RhD Exon 7 Fwd CAGCTCCATCATGGGCTACAA 4 RhD Exon 7 Rev AGCACCAGCAGCACAATGTAGA 5 34 4862-6122-2014.1RhD Exon 7 AGCTTGCTGGGTCTGCTTGGAGAGATC 6 Probe AGO1 Fwd GTTCGGCTTTCACCAGTCT 7 AGO1 Rev CTCCATAGCTCTCCCCACTC 8 AGO1 Probe CTGCCATGTGGAAGATGATGCTCAACA 9 RhD Exon 5 56-FAM / TCTGGCCAA / ZEN / GTTTCAACTCTGCTCTGC 13 Probe T / 3IABkFQ RhD Exon 7 56-FAM / AGCTTGCTG / ZEN / GGTCTGCTTGGAGAGAT 14 Probe C / 3IABkFQ AGO1 Probe 5SUN / CTGCCATGT / ZEN / GGAAGATGATGCTCAACA / 15 3IABkFQ Table 7. Target sequences for RhD Exon 5, RhD exon 7, and AGO1 Amplicon Sequence SEQ ID NO RhD Exon 5 CGCCCTCTTCTTGTGGATGTTCTGGCCAAGTTTCAACTC 10 TGCTCTGCTGAGAAGTCCAATCGAAAGGAAGAATGCCG TGTTC RhD Exon 7 CAGCTCCATCATGGGCTACAACTTCAGCTTGCTGGGTCT 11 GCTTGGAGAGATCATCTACATTGTGCTGCTGGTGCT AGO1 GTTCGGCTTTCACCAGTCTGTGCGCCCTGCCATGTGGAA 12 GATGATGCTCAACATTGATGGTGAGTGGGGAGAGCTAT GGAG

[0120] qPCR testing results are shown in Table 8 below. Experiments were run using two different template DNAs, prepared as explained above. Exon 5, exon 7, and AGO1 assays generated expected RhD detection results, which have similar Ct values between each template DNA. qPCR QC testing also showed similarity in amplification efficiency between the RhD Exon5+AGO1 assay and the Exon7+AGO1 assay (data not shown). Table 8. qPCR QC data of RhD qPCR Sample Target Ct Mean Ct SD Ct detected in wells cfDNA 1 Exon 5 31.886 0.102 3 out of 3 wells cfDNA 1 AGO1 with Exon 5 32.239 0.129 3 out of 3 wells cfDNA 1 Exon 7 32.169 0.176 3 out of 3 wells cfDNA 1 AGO1 with Exon 7 32.010 0.036 3 out of 3 wells cfDNA 2 Exon 5 31.672 0.143 3 out of 3 wells cfDNA 2 AGO1 with Exon 5 31.948 0.045 3 out of 3 wells cfDNA 2 Exon 7 32.032 0.323 3 out of 3 wells 35 4862-6122-2014.1cfDNA 2 AGO1 with Exon 7 31.990 0.087 3 out of 3 wells Water Exon 5 0 3 out of 3 wells Water AGO1 with Exon 5 0 3 out of 3 wells Water Exon 7 0 3 out of 3 wells Water AGO1 with Exon 7 0 3 out of 3 wells

[0121] In some embodiments, a conformational RhD qPCR may be performed for any samples having questionable qPCR data and / or ΔCt values. For instance, in some embodiments a conformational RhD qPCR may be performed when a ΔCt value of a sample is within 0.5 of a determined threshold. Another instance when a conformational RhD qPCR may performed is when two RhD exon assays (i.e., exon 7 and exon 5) are performed and result in either a large difference between the Ct values of AGO1 from each of the two assays, e.g., a > 0.5 Ct difference is observed, or when different sub-grouping results are observed on ∆Ct(exon7-AGO1) and ∆Ct(exon5-AGO1) results. A conformational RhD qPCR may also be performed when RhD qPCR QC check for qPCR control samples on the qPCR plate are not passed.

[0122] For RhD confirmation qPCR, it is recommended to perform all samples and all assays on the same plate if it is possible. When RhD confirmation qPCR is required, the confirmed qPCR data is incorporated into the data set prior to final qPCR data analysis and RhD group and sub- group calling. Example 2 - Development of the qPCR assay for RhD exon 5, RhD exon 7, and AGO1 gene amplicons

[0123] The training sub-library (n=89) was used to develop qPCR assays for RhD Exon 5, exon7, and the AGO1 gene amplicons. Additionally, RhD+ 2% child contrived samples were used to mimic RhD+ 2% fetus control and cfDNA from pooled plasma was used as RhD+ 100% maternal control (data not shown). Concentrations of each sample were measured using Quant-It BR kit, with concentrations ranging from 23.51 ng / µl to 135.16 ng / µl. Each sample was tested with both Exon 5 + AGO1 and Exon 7 + AGO1 assays in three replicates.

[0124] Initial experiments were performed on the training sub-library (n=89). Based on NGS data, the training sub-library (n=89) was separated into three sub-groups, prior to RhD qPCR testing as indicated in Table 9 below. 36 4862-6122-2014.1Table 9. RhD status of samples from the training sub-library determined by NGS Mother RhD status Fetus RhD status n Positive Positive or negative 11 Negative Negative 23 Negative Positive 55

[0125] Based on the concentration of the samples, a 2X dilution in DNA suspension buffer (DSB) was tested by qPCR first to eliminate any possible false negative cases. Results of the RhD testing using a 2X dilution are shown in Table 10 below. Table 10. Summary of RhD testing results with 2X dilution: qPCR vs NGS (the training sub- library, n=89) RhD Status Call RhD NGS Call 1 RhD NGS Call 2 qPCR vs qPCR NGS RhD positive (n=11) RhD positive maternal RhD positive maternal (n=11) 11 vs 11 RhD positive (n=57) RhD negative maternal RhD positive fetal (n=55) 57 vs 55 RhD negative (n=21) RhD negative fetal (n=23) 21 vs 23

[0126] Two false positive samples were detected using the 2X dilution. These two samples were temporarily excluded from the qPCR assay development. The qPCR results for the 2X diluted samples, summarized in Table 11 below, indicate that the qPCR Ct detection level must be optimized to adapt to the NGS RhD detection level. qPCR Ct values of both Exon 5 and Exon 7 of the RhD positive fetus subgroup (n=55), defined by NGS, were 28.95 and 28.67, respectively. These Ct levels may be too high to avoid possible false positive results. The two false positives reported above also suggest this.

[0127] Although two false positive fetal results were observed in the 2X dilution data, using a cut off Ct value of 40 (i.e., Ct ≥ 40 and / or Ct = 0) for both RhD Exon 5 and RhD Exon7, the RhD negative maternal group and the RhD positive maternal group, as called by NGS, were correctly separated with qPCR. Table 11. Summary Ct values of RhD positive groups with 2X dilution 37 4862-6122-2014.1RhD RhD Ct Mean Ct Mean Ct Mean Ct Mean Ct Mean Status qPCR Exon 5 Exon 7 AGO1 w / AGO1 w / AGO1 Call NGS Items Exon 5 Exon 7 (average AGO1 w / Exon 5 / Exon 7) Rh control Mean 23.92 23.97 26.05 25.14 25.59 (maternal (n=11) positive) RhD Mean 28.95 28.67 26.42 25.63 26.06 positive (n=55) fetus

[0128] Based on the results with a 2X dilution, samples were then subsequently diluted 16X and tested, in order to make the RhD qPCR detection level to fit the RhD detection level of the NoveSeq NGS (Tables 12 and 13). Table 12. Summary of RhD testing results with 16X dilution: qPCR vs NGS (the training sub-library, n=89) RhD Status Call RhD NGS Call 1 RhD NGS Call 2 qPCR vs qPCR NGS RhD positive (n=11) RhD positive maternal RhD positive maternal (n=11) 11 vs 11 RhD positive (n=55) RhD negative maternal RhD positive fetal (n=55) 55 vs 55 RhD negative (n=23) RhD negative fetal (n=23) 23 vs 23 Table 13. Summary Ct values of RhD positive groups with 16X dilution RhD RhD Ct Mean Ct Mean Ct Mean Ct Mean Ct Mean Status qPCR Exon 5 Exon 7 AGO1 w / AGO1 w / AGO1 Call NGS Items Exon 5 Exon 7 (average AGO1 w / Exon 5 / Exon 7) Rh control Mean 27.03 27.29 29.12 28.3 28.71 (maternal (n=11) positive) RhD Mean 32.07 32.01 29.55 29.55 29.55 positive (n=55) fetus 38 4862-6122-2014.1

[0129] With the 16X dilution, RhD qPCR results 100% matched with NGS RHD calls in all 89 cases (Table 12). Example 3 - Development of the RhD ΔCt assay to distinguish the Maternal Positive Sub- Group from the Fetus Positive Sub-Group

[0130] A new method was next developed, herein referred to as the “RhD ΔCt method”, where the RhD qPCR ΔCt difference is utilized to differentiate the Maternal Positive Sub-Group from the Fetus Positive Sub-Group, within the Positive Group.

[0131] The following ΔCt criteria for RhD qPCR was preliminarily established for the RhD ΔCt method based on the training sub-library (n=89): Maternal Positive Sub-Group had a ΔCt(Exon - AGO1) < 0; and Fetus Positive Sub-Group had a ΔCt(Exon - AGO1) > 0.

[0132] Additionally, no correlation was seen between the RhD qPCR Ct values, the ΔCt related values, and the CFE values detected by NGS (data not shown). Example 4 – Confirmation of the qPCR conditions and RhD qPCR data analysis criteria established from the training sub-library

[0133] The blinded testing sub-library (n=95 cases) and a non-template control (n=1) was used to confirm the qPCR conditions and RhD qPCR data analysis criteria established from the training sub-library above. Based on the detected qPCR Ct values, using Ct ≥ 40 and / or Ct = 0 criteria, the 96 samples were divided into the following three groups: Negative Group (n=1 sample); Positive Group (n=94 samples); and Non-Template Control Group (n=1 sample). The one sample was placed in the Negative Group for graphic analysis, where a RhD variant was detected by qPCR, based on the expression of exon 7, but not exon 5. FIG. 1 shows the combined qPCR results from the training sub-library (n=89) and the blinded testing sub-library (n=95 cases).

[0134] Based on the ΔCt (Exon – AGO1) value, using a threshold of 0, established from the training sub-library, the Positive Group (n=94) was separated into the following two sub-groups: Fetus Positive Sub-Group (n=7); and Maternal Positive Sub-Group (n=87). ΔCt value analysis indicated the detected RhD variant with exon 7 positive but exon 5 negative in the one sample was 39 4862-6122-2014.1of fetal origin. FIG. 2 shows the combined ΔCt results from the training sub-library (n=89) and the blinded testing sub-library (n=95 cases).

[0135] The data collected from the blinded testing sub-library (n=95), was then compared to NGS data to determine the accuracy of the newly developed RhD ΔCt method. As can be seen in Table 14 below, there was 100% accuracy in determining Rh incompatibility, i.e., Rhesus negative mother with a Rhesus positive fetus (n=7). Table 14. Summary of the RhD qPCR vs NGS results for the blinded testing sub-library (n=95) RhD Group RhD Sub-Group RhD NGS RhD NGS Sub- qPCR vs NGS Call qPCR Call qPCR Group Call Group Call RhD positive RhD maternal RhD positive 87 vs 87 (n=87) positive sub- maternal group (n=87) (n=87) RhD positive RhD fetus RhD negative RhD positive 7 vs 7 (n=7) positive sub- maternal fetal (n=7) group (n=7) (n=8) RhD variant RhD variant RhD negative 1 vs 1 detected (n=1) detected in fetus fetal (n=1) (n=1)

[0136] The qPCR results for the blinded testing sub-library are correlated to the NGS calls. This demonstrates that it is feasible to use the established qPCR Ct criteria to correctly separate RhD Positive Group and Negative Group in maternal samples, while it is suggested to treat the cases having RhD variant with RhD exon 7 positive but exon 5 negative as RhD positive for downstream RhIg treatment. See, e.g., De Haas, et al. (BMJ 2016;355:i5789); Most importantly, this shows that it is feasible to use the RhD ΔCt method of the present invention, which is associated with the described RhD system here, to further differentiate the Fetus Positive Sub-Group and the Maternal Positive Sub-Group within the Positive Group. Example 5 – Method verification

[0137] A blinded verification sub-library (n=94) and a non-template control (n=1) was used to for verification study of the above method. Based on the detected qPCR Ct values, using Ct ≥ 40 and / or Ct = 0 criteria, the 95 samples were divided into the following three groups: Negative Group 40 4862-6122-2014.1(n=4 sample); Positive Group (n=90 samples); and Non-Template Control Group (n=1 sample). (FIG. 3.)

[0138] Based on the detected ΔCt(Exon – AGO1) value ranges shown in Table 15 below, the cut- off threshold value was adjusted as the following: for the Fetus Positive Sub-Group ΔCt ≥1; and for the Maternal Positive Sub-Group ΔC≤1. Table 15. Range of ΔCt values observed in the blinded verification sub-library (n=94) Sub-Group within ΔCt(Exon 5- ΔCt(Exon 7- Overall ΔCt ΔCt threshold Positive Group AGO1) AGO1) Fetus Positive 2.2 to 5.2 1.5 to 4.4 ≥1.5 1 Maternal Positive -1.66 to 0.33 -2.0 to 0.27 ≤0.27

[0139] Based on the adjusted ΔCt criteria, 90 samples from the Positive Group were further separated by qPCR into the following two sub-groups: Fetus Positive Sub-Group (n=9); and Maternal Positive Sub-Group (n=81) (FIG. 4.).

[0140] As shown in Table 16 below, the qPCR results for the blinded verification sub-library (n=94) have 100% correlation with the NGS calls. Table 16. Summary of the RhD qPCR vs NGS results for the blinded verification sub-library (n=94) RhD Group Call RhD Sub-group Call RhD Sub-Group Call NGS qPCR vs qPCR qPCR NGS RhD negative (n=4) RhD negative (n=4) 4 vs 4 RhD positive (n=90) RhD positive maternal RhD positive maternal 81 vs 81 (n=81) (n=81) RhD negative maternal RhD negative maternal 9 vs 9 (n=9) (n=9)

[0141] The results from the blinded verification sub-library further demonstrates that it is feasible to use the established qPCR Ct criteria to correctly separate RhD Positive Group and Negative Group in maternal samples, and that it is feasible to use the RhD ΔCt method of the present invention to further differentiate the Fetus Positive Sub-Group and the Maternal Positive Sub- Group, within the Positive Group. 41 4862-6122-2014.1Example 6 – Refinement of the ΔCt threshold value

[0142] The three sub-libraries were then combined, i.e., the training sub-library (n=89), the blinded testing sub-library (n=95), and the blinded verification sub-library (n=94), for a total of 278 samples.

[0143] Based on the detected qPCR Ct values, 278 samples were able to be divided into the following 2 major RhD qPCR groups: Positive Group (n=250); and the Negative Group (n=28).

[0144] Based on the overall ΔCt (Exon – AGO1) range detected from 278 samples (Table 17), the cut-off value of criteria was slightly adjusted as the following: For the Fetus Positive Sub-Group ΔCt ≥ 0.8; for the Maternal Positive Group ΔC ≤ 0.8. Table 17. The Range of ΔCt(Exon - AGO1) values observed in 278 samples Tested Sub- Sub-Group ΔCt(Exon 5- ΔCt(Exon 7- Overall ΔCt ΔCt Cut-off Library within AGO1) AGO1) used in each Positive cohort Group Training Sub- Fetus 0.79 to 6.82 0.87 to 4.60 ≥ 0.79 0 Library (n=89) Positive (n=55) Maternal -2.07 to -0.98 -1.78 to -0.55 ≤ -0.55 Positive (n=11) Blinded Fetus 1.8 to 2.6 1.8 to 3.0 ≥ 1.8 0 Testing Sub- Positive Library (n=95) (n=7) Maternal -2.4 to -0.7 -2.3 to -0.3 ≤ -0.3 Positive (n=87) Blinded Fetus 2.2 to 5.2 1.5 to 4.4 ≥ 1.5 1 verification Positive Sub-Library (n=9) (n=94) Maternal -1.66 to 0.33 -2.0 to 0.27 ≤ 0.27 Positive (n=81) Total n=278 Fetus 0.79 to 6.82 0.87 to 4.60 ≥ 0.79 0.8 Positive (n=71) 42 4862-6122-2014.1Maternal -2.4 to 0.33 -2.3 to 0.27 ≤ 0.27 Positive (n=179)

[0145] Based on the adjusted of ΔCt(Exon - AGO1) values, the Positive Group (n=250) was able to be separated into the following two sub-groups: Fetus Positive Sub-Group (n=71); and Maternal Positive Sub-Group (n=179). The RhD status and the grouping results detected blindly by qPCR, 100% correlated with the results called by NGS in all 278 cases (Table 18). Table 18. Summary of the RhD Detection Results, qPCR vs NGS RhD Group Call RhD Sub- RhD Group RhD Sub- qPCR vs NGS qPCR Group Call Call NGS Group Call qPCR NGS Positive Maternal Maternal 179 vs 179 (n=11+87+81=179) Positive (n=179) positive (n=179) Positive Fetus Positive Negative Fetus Positive 71 vs 71 (n=55+7+9=71) (n=71) Maternal (n=99) (n=71) Negative Maternal 28 vs 28 (n=23+1+4=28) Positive (Fetus negative) (n= 28) 43 4862-6122-2014.1

Claims

CLAIMS What is claimed is:

1. A method for preparing a non-naturally occurring composition of amplified DNA useful for analyzing RhD incompatibility during pregnancy, comprising: a) extracting DNA from a blood sample of a pregnant mother; b) preparing a composition of amplified DNA by performing qPCR on the DNA extracted in (a) or DNA derived therefrom; and c) analyzing the composition of amplified DNA from (b) to determine Ct values of at least one RhD exon and at least one internal control gene, wherein a ΔCt value between the at least one RhD exon and at least one internal control gene is useful for analyzing RhD incompatibility during pregnancy.

2. The method of claim 1, wherein the DNA is cell-free DNA and / or gDNA.

3. The method of claim 2, wherein the cell-free DNA and / or gDNA is used to prepare a NGS library.

4. The method of any of claims 1-3, wherein a ΔCt value greater than a threshold indicates Rhesus incompatibility between the mother and fetus.

5. The method of any of claims 1-4, wherein the at least one RhD exon is RhD exon 7, RhD exon 5, RhD exon 4, RhD exon 6 and / or RhD exon 10.

6. The method of any of claims 1-5, wherein the at least one internal control gene is AGO1.

7. The method of any of claims 1-6, wherein performing qPCR comprises amplification of at least one nucleic acid, wherein the at least one nucleic acid comprises a sequence at least 85- 95% identical to one or more of SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, or a complement thereof.

8. The method of any of claims 1-7, wherein performing qPCR comprises using one or more primer pairs comprising the sequences selected from SEQ ID NOs: 1 and 2, SEQ ID NOs: 4 and 5, and / or SEQ ID NOs: 7 and 8, or a complement thereof. 44 -6122-2014.

19. The method of any of claims 1-8, wherein performing qPCR comprises using one or more probes.

10. The method of claim 9, wherein the one or more probes are capable of specifically hybridizing to a nucleic acid comprising the sequence of SEQ ID NO: 3, SEQ ID NO: 6, and / or SEQ ID NO: 9, or a complement thereof.

11. A method for preparing a non-naturally occurring composition of amplified DNA useful for determining a risk of RhD incompatibility during pregnancy, comprising: a) extracting DNA from a blood sample of a pregnant mother; b) preparing a composition of amplified DNA by performing qPCR on the DNA extracted in (a) or DNA derived therefrom; c) analyzing the composition of amplified DNA to determine Ct values of at least one RhD exon and at least one internal control gene, wherein a ΔCt value between the at least one RhD exon and at least one internal control gene is useful for determining a risk of RhD incompatibility during pregnancy.

12. The method of claim 11, further comprising determining a risk of RhD incompatibility when the ΔCt value is greater than a threshold.

13. The method of claims 11 or 12, wherein the DNA is cell-free DNA and / or gDNA.

14. The method of claim 13, wherein the cell-free DNA and / or gDNA is used to prepare a NGS library.

15. The method of any of claims 12-14, wherein the threshold is between 0 and 1. 16 The method of any of claims 12-15, wherein the threshold is about 0.

8.

17. The method of any of claims 12-16, further comprising administering Rh immune- globulin when RhD incompatibility is determined.

18. The method of any of claims 12-17, further comprising testing the blood sample of the mother for Rhesus antibodies when RhD incompatibility is determined. 45 -6122-2014.

119. The method of any of claims 11-18, wherein the at least one RhD exon is RhD exon 7 and / or RhD exon 5.

20. The method of any of claims 11-19, wherein the at least one internal control gene is AGO1.

21. A kit comprising: a) a first primer pair that specifically hybridizes to a nucleic acid having the sequence of SEQ ID NO: 10 or a complement thereof and a first probe capable of specifically hybridizing to the sequence of SEQ ID NO: 10 or a complement thereof; b) a second primer pair that specifically hybridizes to a nucleic acid having the sequence of SEQ ID NO: 11 or a complement thereof and a second probe capable of specifically hybridizing to the sequence of SEQ ID NO: 11 or a complement thereof; and c) a third primer pair that specifically hybridizes to a nucleic acid having the sequence of SEQ ID NO: 12 or a complement thereof and a third probe capable of specifically hybridizing to the sequence of SEQ ID NO: 12 or a complement thereof.

22. The kit of claim 21, wherein at least one member of the first primer pair comprises the sequence of SEQ ID NOs: 1 or 2 and the first probe comprises a sequence of SEQ ID NO: 3, or a complement thereof.

23. The kit of any of claim 21 or claim 22, wherein at least one member of the second primer pair comprises the sequence of SEQ ID NOs: 4 or 5 and the second probe comprises a sequence of SEQ ID NO: 6, or a complement thereof.

24. The kit of any of claims 21-23, wherein at least one member of the third primer pair comprises the sequence of SEQ ID NOs: 7 or 8 and the third probe comprises a sequence of SEQ ID NO: 9, or a complement thereof.

25. The kit of any of claims 21-24, wherein the first, second, and third probes further comprise a detectable label.

26. A method of treating RhD incompatibility, comprising: a) extracting DNA from a blood sample of a pregnant mother; 46 -6122-2014.1b) preparing a composition of amplified DNA by performing qPCR on the DNA extracted in (a) or DNA derived therefrom; c) analyzing the composition of amplified DNA to determine Ct values of at least one RhD exon and at least one internal control gene; and d) administering Rh immune-globulin to the pregnant mother when the ΔCt value between the at least one RhD exon and at least one internal control gene is greater than a threshold.

27. The method of claim 26, wherein the DNA is cell-free DNA and / or gDNA.

28. The method of claim 27, wherein the cell-free DNA and / or gDNA is used to prepare a NGS library.

29. The method of any of claims 25-28, wherein the threshold is between 0 and 1.

30. A method for preparing a non-naturally occurring composition of amplified DNA useful for analyzing RhD incompatibility during pregnancy, comprising: a) extracting DNA from a blood sample of a pregnant mother; b) preparing a composition of amplified DNA by performing qPCR on the DNA extracted in (a) or DNA derived therefrom to amplify at least one nucleic acid using one or more primer pairs comprising the sequences selected from SEQ ID NOs: 1 and 2, SEQ ID NOs: 4 and 5, and / or SEQ ID NOs: 7 and 8, or a complement thereof.

31. The method of claim 30, further comprising analyzing the composition of amplified DNA from (b) to determine Ct values of at least one RhD exon and at least one internal control gene, wherein a ΔCt value between the at least one RhD exon and at least one internal control gene is useful for analyzing RhD incompatibility during pregnancy.

32. The method of claim 30 or 31, wherein the DNA is cell-free DNA and / or gDNA.

33. The method of claim 32, wherein the cell-free DNA and / or gDNA is used to prepare a NGS library. 47 -6122-2014.

134. The method of any of claims 31-33, wherein a ΔCt value greater than a threshold indicates RhD incompatibility between the mother and fetus.

35. The method of any of claims 30-34, wherein the at least one RhD exon is RhD exon 7, RhD exon 5, RhD exon 4, RhD exon 6 and / or RhD exon 10.

36. The method of any of claims 30-35, wherein the at least one internal control gene is AGO1. 48 -6122-2014.1

Images