Methods and compositions for modifying flowering time genes in plants

Abstract

Methods and compositions are provided for modifying the flowering time and / or maturity time of soybean plants to enable them to be cultivated in a variety of geographical locations having different day lengths. Modified soybean plants are disclosed comprising non-natural mutant alleles at the E1, E2, E3, E4, E1La and / or E1Lb locus. The modified plants have a shorter flowering and / or maturity time than control plants.

Description

[0001] Docket No.83142-CN-REG-ORG-P1 METHODS AND COMPOSITIONS FOR MODIFYING FLOWERING TIME GENES IN PLANTS STATEMENT REGARDING ELECTRONIC SUBMISSION OF A SEQUENCE LISTING A Sequence Listing in ST.26 format, submitted under 37 C.F.R. § 1.821, entitled 83142-CN-REG-ORG-P1_SEQLIST.xml, 165 kb in size, generated on April 10, 2024, and filed via EFS-Web is provided in lieu of a paper copy. This Sequence Listing is hereby incorporated by reference into the specification for its disclosures. FIELD This disclosure relates to the field of plant biotechnology. In particular, it relates to methods and compositions for modifying the flowering time and / or maturity time of photoperiodic plants to enable them to be cultivated in a variety of geographical locations having different day lengths. BACKGROUND Soybean (Glycine max) is a valuable field crop. Soybean oil extracted from the seed is employed in a number of retail products such as cooking oil, baked goods, margarines and the like. Soybean is also used as a grain as a food source for both animals and humans. Soybean meal is a component of many foods and animal feed. Production of edible protein ingredients from soybean offers a healthier and less expensive replacement for animal protein in meats as well as dairy-type products. The typical growth cycle of full-season soybean begins with an extended period of vegetative growth. The vegetative stages begin with emergence of the Docket No.83142-CN-REG-ORG-P1 hypocotyl out of the soil (VE) followed by unrolling of a pair of unifoliate leaves on the first node just above the cotyledons (VC). At this stage, the leaves are sufficiently unrolled so the leaf edges do not touch. Following VC, the plant goes from V1 (where fully developed leaves unfold at a first node) to Vn as trifoliate leaves unfold at each of a number of nodes (n). The reproductive stages begin when a first open flower is present at any node on the main stem of the plant (R1 or beginning bloom). The first flower is typically towards the bottom of the plant. As the plant moves into full bloom, it enters into R2. At this stage, there is an open flower at one of the two uppermost nodes on the main stem with a fully developed flower. The reproductive stages include pod development (R3 and R4), seed development (R5 and R6), and finally maturity (R7 and R8). In R3, of beginning pod stage, there is a pod that is at least three-sixteenths- inch-long at one of the four uppermost nodes on the main stem with a fully developed leaf. In R4, or full pod, there is a at least three-quarter inch-long pod at one of the four uppermost nodes on the main stem with a fully developed leaf. In R5, or beginning seed stage, there is at least a one-eighth inch-long seed in a pod at one of the four uppermost nodes on the main stem with a fully developed leaf. In the R6 or full seed stage, there is a pod containing a green seed that fills the pod cavity at one of the four uppermost nodes on the main stem with a fully developed leaf. In the R7 or beginning maturity stage, there is at least one normal pod on the main stem that has reached its mature pod color. In the R8 or full maturity stage, at least 95 percent of the pods have reached their mature pod color. After R8, five to 10 days of drying weather are required to reduce soybean moisture levels to less than 15 percent. Most flowering plants respond to daily photoperiodic cycles and are classified as either short day (SD) or long day (LD) plants based on the photoperiod conditions required to induce flowering. Photoperiod conditions experienced by a plant, in turn, are a function of the geographical location (e.g., latitude or longitude) where they are cultivated. Soybeans are short-day (SD) plants requiring days to be Docket No.83142-CN-REG-ORG-P1 shorter than a critical value to induce flowering. Soybean varieties are classified into maturity groups according to their response to the photoperiod, such as based on the number of days till flowering occurs. For example, with a typical planting date of May 1st for most North American soy varieties, the vegetative period of soybean growth can last from 55-65 days with flowering beginning around mid-July. Plant breeders and growers are always looking for new methods to manipulate the cultivation and yield of a plant, especially for agronomically important crops. For example, soybean breeders are interested in soybean varieties that can be cultivated in a wide range of geographical locations. Thus, there is a continuing need in the art for improved compositions and methods that modify agronomic traits related to flowering time. Various genes have been identified and found to play roles in the control of flowering time and maturity of soybean. The present disclosure provides methods of creating novel, and non-natural, allelic variations of genes involved in soybean’s photoperiodic response, and using specific allele combinations to provide soybean plants having a range of modified flowering times. SUMMARY Methods and systems are provided for providing edited plants (e.g., soybean plants) having a flowering time and / or maturity time that is altered or modified from a natural flowering time (e.g., from a corresponding control plant that in unedited). In embodiments, the soybean plants have a flowering time and / or maturity time that is smaller (e.g., significantly smaller or slightly smaller) than the flowering time of the control plant. Compositions are also provided for nucleic acid molecules (e.g., expression cassettes or vectors) capable of introducing targeted edits in the genome of a plant cell, particularly in the locus of selected plant genes involved in regulating flowering and / or maturity and / or photoperiodic response, resulting in the creation of novel mutant alleles of the flowering and / or maturity and / or photoperiodic response genes. In embodiments, the resulting mutant alleles comprise sequences that when Docket No.83142-CN-REG-ORG-P1 included in the genome a plant, confer the plants with a modified (e.g., smaller) flowering time and / or maturity time as compared to plants not comprising the mutant alleles. In embodiments, compositions resulting from different allelic combinations of the mutant alleles confer the plants with a modified (e.g., shorter / smaller) number of days for flowering, number of days for maturity, and / or number of days between flowering and maturity as compared to plants not comprising the allelic combination. Such compositions, and methods of using such compositions, enable plants to be produced that can be grown in a variety of geographical locations, including locations with shorter or longer days. Embodiments of the invention include nucleic acid molecules comprising a nucleotide sequence encoding a mutation at an E1, E2, E3, E4, E1La and / or E1Lb locus of a genome of a soybean plant or plant cell, resulting in a novel allele at the E1, E2, E3, E4, E1La and / or E1Lb locus. In embodiments, the mutation is introduced through an expression cassette comprising a nucleic acid sequence encoding the mutation at the specified locus operably linked to a promoter. In embodiments, one or more of the nucleotide sequence(s) encoding a mutation at the E1, E2, E3, E4, E1La, or E1Lb locus is operably linked to a promoter (e.g., the same or a different promoter). In embodiments, the mutation is introduced into the E1, E2, E3, E4, E1La and / or E1Lb locus of the genome of a soybean plant through genome editing (e.g., genome modification using a site directed nuclease. Embodiments of the invention include plants or plant cells comprising the novel alleles at the E1, E2, E3, E4, E1La and / or E1Lb locus. Further methods of the invention also include the use of mutagenesis and recombination (for example directed using chimeric oligonucleotides, Meganucleases, Zinc Fingers, TALEN or CRISPR) to introduce specific strand breaks, recombinational insertions and mutations so as to engineer in situ changes in plant genomes so that the thus mutated plant genome is then altered at the E1, E2, E3, E4, E1La and / or an E1Lb locus. As a result, the plant is able to express one or more of a mutant protein at the E1, E2, E3, E4, E1La and / or E1Lb locus, and the plant is thus Docket No.83142-CN-REG-ORG-P1 made to have an altered flowering time profile. Thus, the invention also includes altered flowering time plants, varieties and their seed and progeny that are derived from the product of application of the above methods of the invention. Embodiments of the invention include example methods for establishing where a soybean plant, or seed thereof, should be grown. In example embodiments, the method comprises a)introducing, such as via genome modification using a site directed nuclease, a mutation at an E1, E2, E3, E4, E1La and / or E1Lb locus of a genome of a soybean plant; b) selfing the plant for one or more generations to generate a progeny plant that is homozygous at each of mutated loci; c) obtaining DNA from said progeny plant; d) determining an allelic combination of said progeny plant via a first assay of the DNA indicative of a type of mutation introduced at a first E1, E2, E3, E4, E1La, or E1Lb locus and a second assay of the DNA indicative of a type of mutation introduced at a second and distinct E1, E2, E3, E4, E1La, or E1Lb locus; and e) assigning a change in flowering time of the plant based on the determined allelic combination, wherein the change in flowering time is relative to a control plant not comprising the allelic combination. In embodiments, the editing of an endogenous gene at the E1, E2, E3, E4, E1La and / or E1Lb locus comprises editing using a DNA modification enzyme (e.g., a site directed nuclease). In embodiments, the editing comprises transforming a plant cell with an expression cassette comprising (i) a nucleic acid that encodes the site-directed nuclease; and (ii) a nucleic acid that encodes at least one guide RNA (gRNA) directed to a target sequence. In embodiments, the at least one gRNA is directed to a first target sequence at the E1, E2, E3, E4, E1La and / or E1Lb locus. In example embodiments, the at least one gRNA is directed to a target sequence comprising a second target sequence at the E1, E2, E3, E4, E1La and / or E1Lb locus. In embodiments, the nucleic acid that encodes the site-directed nuclease is operably linked to a first promoter and the nucleic acid that encodes the at least one gRNA is operably linked to a second promoter. In embodiments, the expression cassette further comprises an enhancer operably linked to the first promoter or the second promoter. In embodiments, the site directed Docket No.83142-CN-REG-ORG-P1 nuclease is selected from the group consisting of meganucleases (MNs), zinc-finger nucleases (ZFNs), transcription- activator like effector nucleases (TALENs), Cas9 nuclease, Cfp1 nuclease, dCas9-Fokl, dCpf1 -Fokl, chimeric Cas9-cytidine deaminase, chimeric Cas9-adenine deaminase, chimeric FEN1 -Fokl, and Mega- TALs, a nickase Cas9 (nCas9), chimeric dCas9 non-Fokl nuclease and dCpfl non- Fokl nuclease. In embodiments, the editing includes introducing into the locus a mutation selected from the group consisting of an allele replacement, one or a plurality of base insertions, one or a plurality of base deletions. In embodiments, the editing further comprises regenerating a transformed T0 plant from the transformed plant cell, the transformed T0 plant having a plurality of T1 seed, wherein the plurality of T1 seed contain a plurality of unique edits in the E1, E2, E3, E4, E1La and / or E1Lb locus; growing a plurality of T1 plants from the T1 seed; selfing the T1 plants for one or more generations, and selecting a progeny plant that is homozygous at the E1, E2, E3, E4, E1La and / or E1Lb locus. In embodiments, the method further comprises sequencing the E1, E2, E3, E4, E1La and / or E1Lb locus of the progeny plant; sequencing the E1, E2, E3, E4, E1La and / or E1Lb locus of the T0 plant; aligning the E1, E2, E3, E4, E1La and / or E1Lb locus sequence of the T0 plant with the corresponding sequence of the progeny plant to determine the type of mutation introduced into the E1, E2, E3, E4, E1La and / or E1Lb locus. In embodiments, the allelic combination comprises: a loss of function allele or a partial function allele at one or more of the E1, E2, E3, E4, E1La and / or E1Lb locus. In embodiments, assigning a change in flowering time comprises assigning a relative maturity group value relative to the control plant not comprising one or more mutant alleles at the E1, E2, E3, E4, E1La and / or E1Lb locus, wherein optionally the control plant comprises a wild-type allele at the respective E1, E2, E3, E4, E1La and / or E1Lb locus. In embodiments, assigning a change in flowering time comprises assigning a number of days by which the flowering time is advanced for the soybean plant relative to the control plant. Docket No.83142-CN-REG-ORG-P1 In other embodiments, a method of producing a soybean plant with a modified flowering time is provided. In example embodiments, the method comprises introducing an edit into a first gene at the E1, E2, E3, E4, E1La and / or E1Lb locus of a plant cell to generate a mutant allele having reduced function of a protein at the E1, E2, E3, E4, E1La and / or E1Lb locus relative to a wild-type allele at the same locus. In embodiments, the method further comprises introducing a second edit in a second E1, E2, E3, E4, E1La and / or E1Lb locus of the plant cell to produce a mutant having reduced function of the mutated protein relative to a wild-type protein; and regenerating an edited plant from the edited plant cell; and selfing the edited plant to obtain an edited progeny comprising having allelic combination comprising the first and second mutant alleles, wherein the edited progeny has a flowering time that is modified relative to the flowering time of a control plant comprising the wild-type alleles at one or both of the mutated positions. The mutation can result in a partial loss of function or a loss of function mutation. Embodiments of the invention further include gene edited plants and edited progeny plants comprising any of the recited allelic combinations. In embodiments, the flowering time of the edited progeny plant is modified (e.g., longer or shorter) than the flowering time of the control plant. In embodiments, a relative maturity group value of the edited progeny plant is different from the relative maturity group value of the control plant. BRIEF DESCRIPTION OF THE SEQUENCES IN THE SEQUENCE LISTING SEQ ID NO: 1 is the genomic sequence of wild-type (WT) E1. SEQ ID NO: 2 is the genomic sequence of WT E1La. SEQ ID NO: 3 is the genomic sequence of WT E1Lb. SEQ ID NO: 4 is the genomic sequence of WT E2. SEQ ID NO: 5 is the genomic sequence of WT E3. SEQ ID NO: 6 is the genomic sequence of WT E4. SEQ ID NO: 7 is the nucleotide coding sequence of wild-type (WT) E1. Docket No.83142-CN-REG-ORG-P1 SEQ ID NO: 8 is the nucleotide coding sequence of an E1 mutant having a 1bp insertion of an adenine at position 199 relative to the WT gene. SEQ ID NO: 9 is the nucleotide coding sequence of an E1 mutant having a 1bp insertion of a guanine at position 199 relative to the WT gene. SEQ ID NO: 10 is the nucleotide coding sequence of WT E1La. SEQ ID NO: 11 is the nucleotide coding sequence of a E1La mutant having a 1bp insertion at position 167 relative to the WT gene. SEQ ID NO: 12 is the nucleotide coding sequence of WT E1Lb. SEQ ID NO: 13 is the nucleotide coding sequence of a E1Lb mutant having a 1bp insertion at position 167 relative to the WT gene. SEQ ID NO: 14 is the nucleotide coding sequence of WT E2. SEQ ID NO: 15 is the nucleotide coding sequence of a E2 mutant having a 1bp deletion of position 89 relative to the WT gene. SEQ ID NO: 16 is the nucleotide coding sequence of a E2 mutant having a 14bp deletion of positions 81-94 relative to the WT gene. SEQ ID NO: 17 is the nucleotide coding sequence of a E2 mutant having an 8bp deletion of positions 89-96 relative to the WT gene. SEQ ID NO: 18 is the nucleotide coding sequence of WT E3. SEQ ID NO: 19 is the nucleotide coding sequence of a E3 mutant having a 1bp insertion at position 181 relative to the WT gene. SEQ ID NO: 20 is the nucleotide coding sequence of a E3 mutant having a 256-bp deletion and a 5-bp insertion within positions 158-413 relative to the WT gene. SEQ ID NO: 21 is the nucleotide coding sequence of a E3 mutant having a 4bp deletion of positions 178-181 relative to the WT gene. SEQ ID NO: 22 is the nucleotide coding sequence of a E3 mutanthaving a 1bp insertion at position 10 relative to the WT gene. SEQ ID NO: 23 is the nucleotide coding sequence of WT E4. SEQ ID NO: 24 is the nucleotide coding sequence of a E4 mutant having a 3bp deletion of positions 150-152 relative to the WT gene. Docket No.83142-CN-REG-ORG-P1 SEQ ID NO: 25 is the nucleotide coding sequence of a E4 mutant having a 2bp deletion of positions 151-152 relative to the WT gene. SEQ ID NO: 26 is the amino acid sequence of wild-type (WT) E1protein. SEQ ID NO: 27 is the amino acid sequence of a E1 mutant whose nucleotide coding sequence has a 1bp insertion of an adenine at position 199 relative to the WT gene. SEQ ID NO: 28 is the amino acid sequence of a E1 mutant whose nucleotide coding sequence has a 1bp insertion of a guanine at position 198 relative to the WT gene. SEQ ID NO: 29 is the amino acid sequence of WT E1Laprotein. SEQ ID NO: 30 is the amino acid sequence of a E1La mutant whose nucleotide coding sequence has a 1bp insertion at position 167 relative to the WT gene. SEQ ID NO: 31 is the amino acid sequence of WT E1Lb protein. SEQ ID NO: 32 is the amino acid sequence of a E1Lb mutant whose nucleotide coding sequence has a 1bp insertion at position 167 relative to the WT gene. SEQ ID NO: 33 is the amino acid sequence of WT E2 protein. SEQ ID NO: 34 is the amino acid sequence of a E2 mutant whose nucleotide coding sequence has a 1bp deletion of position 89 relative to the WT gene. SEQ ID NO: 35 is the amino acid sequence of a E2 mutant whose nucleotide coding sequence has a 14bp deletion of positions 81-94 relative to the WT gene. SEQ ID NO: 36 is the amino acid sequence of a E2 mutant whose nucleotide coding sequence has an 8bp deletion of positions 89-96 relative to the WT gene. SEQ ID NO: 37 is the amino acid sequence of WT E3 protein. SEQ ID NO: 38 is the amino acid sequence of a E3 mutant whose nucleotide coding sequence has a 1bp insertion at position 181 relative to the WT gene. SEQ ID NO: 39 is the amino acid sequence of a E3 mutant whose nucleotide coding sequence has a 256-bp deletion and a 5-bp insertion within positions 158-413 relative to the WT gene. SEQ ID NO: 40 is the amino acid sequence of a E3 mutant whose nucleotide coding sequence has a 4bp deletion of positions 178-181 relative to the WT gene. Docket No.83142-CN-REG-ORG-P1 SEQ ID NO: 41 is the amino acid sequence of a E3 mutantwhose nucleotide coding sequence has a 1bp insertion at position 10 relative to the WT gene. SEQ ID NO: 42 is the amino acid sequence of WT E4 protein SEQ ID NO: 43 is the amino acid sequence of a E4 mutant whose nucleotide coding sequence has a 3bp deletion of positions 150-152 relative to the WT gene. SEQ ID NO: 44 is the amino acid sequence of a E4 mutant whose nucleotide coding sequence has a 2bp deletion of positions 151-152 relative to the WT gene. SEQ ID NO: 45 is the GmE1 target sequence. SEQ ID NO: 46 is the GmE1 sense sequence. SEQ ID NO: 47 is the GmE1 antisense sequence. SEQ ID NO: 48 is the GmE1 forward primer . SEQ ID NO: 49 is the GME1 reverse primer. SEQ ID NO: 50 is the GmE2 target sequence. SEQ ID NO: 51 is the GmE2 sense sequence. SEQ ID NO: 52 is the GmE2 antisense sequence. SEQ ID NO: 53 is the GmE2 forward primer. SEQ ID NO: 54 is the GME2 reverse primer. SEQ ID NO: 55 is the GmE3 target sequence. SEQ ID NO: 56 is the GmE3 sense sequence. SEQ ID NO: 57 is the GmE3 antisense sequence. SEQ ID NO: 58 is the GmE3 forward primer. SEQ ID NO: 59 is the GME3 reverse primer. SEQ ID NO: 60 is the GmE1laE1lb target sequence. SEQ ID NO: 61 is the GmE1laE1lb sense sequence. SEQ ID NO: 62 is the GmE1 antisense sequence. SEQ ID NO: 63 is the E1la forward primer. SEQ ID NO: 64 is the E1La reverse primer. SEQ ID NO: 65 is the E1lb forward primer. SEQ ID NO: 66 is the E1LB reverse primer. Docket No.83142-CN-REG-ORG-P1 SEQ ID NO: 67 is the GmE4 target sequence. SEQ ID NO: 68 is the GmE4 sense sequence. SEQ ID NO: 69 is the GmE4 antisense sequence. SEQ ID NO: 70 is the E4 forward primer. SEQ ID NO: 71 is the E4 reverse primer. SEQ ID NO: 72 is the --- target sequence. SEQ ID NO: 73 is the --- target sequence. SEQ ID NO: 74 is the nucleotide coding sequence of a E4 mutant having a 7bp deletion of positions 149-155 relative to the WT gene. SEQ ID NO: 75 is the nucleotide coding sequence of a E4 mutant having a 61bp deletion of positions 148-208 relative to the WT gene. SEQ ID NO: 76 is the nucleotide coding sequence of a E4 mutant having a 1bp insertion of a T after position 151 relative to the WT gene. SEQ ID NO: 77 is the amino acid sequence of a E4 mutant whose nucleotide coding sequence has a 7bp deletion of positions 149-155 relative to the WT gene. SEQ ID NO: 78 is the amino acid sequence of a E4 mutant whose nucleotide coding sequence has a 61bp deletion of positions 148-208 relative to the WT gene. SEQ ID NO: 79 is the amino acid sequence of a E4 mutant whose nucleotide coding sequence has a 1bp insertion of a T after position 151 relative to the WT gene. BRIEF DESCRIPTION OF THE FIGURES The present application includes the following figures. The figures are intended to illustrate certain embodiments and / or features of the compositions and methods, and to supplement any description(s) of the compositions and methods. The figures do not limit the scope of the compositions and methods, unless the written description expressly indicates that such is the case. FIG.1A shows the various developmental phases of a soybean plant. FIG.1B depicts variation in soy pod coloration upon maturity. Docket No.83142-CN-REG-ORG-P1 FIG.2 represents flowering time (FIG.2A) and maturity (FIG.2B) of WT and homozygous GmE4 mutants under long-day (LD) (top panels) and short-day (SD) (bottom panels) conditions, respectively. n, exact numbers of individual plants identified. *, homozygous GmE4 mutants exhibit highly significant early flowering (p<0.05). DAE, days after emergence. The flowering time is shown as the mean value ± SE. FIG.3 represents expression patterns of flowering-related genes in WT plants and GmE4 mutants. RNA was extracted from trifoliate leaves sampled and the shoot apex at 4 h after 15 days after emergency (SD; FIG.3A) and 30 days after emergence (LD; FIG.3B). Relative transcript levels were quantified by qRT-PCR and normalized to GmActin expression. Average values ± SE for three replications are shown for each data point. DEFINITIONS All technical and scientific terms used herein, unless otherwise defined below, are intended to have the same meaning as commonly understood by one of ordinary skill in the art. References to techniques employed herein are intended to refer to the techniques as commonly understood in the art, including variations on those techniques and / or substitutions of equivalent techniques that would be apparent to one of skill in the art. While the following terms are believed to be well understood by one of ordinary skill in the art, the following definitions are set forth to facilitate explanation of the presently disclosed subject matter. Following long-standing patent law convention, the terms “a,” “an,” and “the” refer to “one or more” when used in this application, including the claims. For example, the phrase “a cell” refers to one or more cells, and in some embodiments can refer to a tissue and / or an organ. Similarly, the phrase “at least one”, when employed herein to refer to an entity, refers to, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, Docket No.83142-CN-REG-ORG-P1 40, 45, 50, 75, 100, or more of that entity, including but not limited to all whole number values between 1 and 100 as well as whole numbers greater than 100. Unless otherwise indicated, all numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about.” The term “about,” as used herein when referring to a measurable value such as an amount of mass, weight, time, volume, concentration or percentage is meant to encompass variations of in some embodiments ±20%, in some embodiments ±10%, in some embodiments ±5%, in some embodiments ±1%, in some embodiments ±0.5%, and in some embodiments ±0.1% from the specified amount, as such variations are appropriate to perform the disclosed methods and / or employ the discloses compositions, nucleic acids, polypeptides, etc. Accordingly, unless indicated to the contrary, the numerical parameters set forth in this specification and attached claims are approximations that can vary depending upon the desired properties sought to be obtained by the presently disclosed subject matter. As used herein, the term “allele” refers to a variant or an alternative nucleotide sequence of a gene or at a particular genetic locus. Such an allele can be considered (i) wild-type or (ii) mutant if one or more mutations or edits are present in the nucleic acid sequence of the mutant allele relative to the wild-type allele. In diploids, a single allele is inherited by a progeny individual separately from each parent at each locus. The two alleles of a given locus present in a diploid organism occupy corresponding places on a pair of homologous chromosomes, although one of ordinary skill in the art understands that the alleles in any particular individual do not necessarily represent all of the alleles that are present in the species. A mutant allele for a gene may have a reduced or eliminated activity or expression level for the gene relative to the wild-type allele. For diploid organisms such as corn Docket No.83142-CN-REG-ORG-P1 and soy, a first allele can occur on one chromosome, and a second allele can occur at the same locus on a second homologous chromosome. If one allele at a locus on one chromosome of a plant is a mutant allele and the other corresponding allele on the homologous chromosome of the plant is wild type, then the plant is described as being heterozygous for the mutant allele. However, if both alleles at a locus are mutant alleles, then the plant is described as being homozygous for the mutant alleles. A plant homozygous for mutant alleles at a locus may comprise the same mutant allele or different mutant alleles if heteroallelic or biallelic. “Allelic variation” refers to the phenomenon of variation in the sequence form of an allele at a given genetic locus. Allelic variation results in the creation of two or more allelic variants. The variants may be naturally occurring and reflective of genetic differences among individuals of the same species. Such natural variations can occur as a result of natural breeding patterns. Alternatively, the variants may be non- naturally occurring, and artificially created (e.g., by a breeder or a scientist), such as using mutagenesis and / or gene editing techniques. In embodiments of the invention, allelic variants of the soybean E1, E2, E3, E4, E1La and / or E1Lb loci are created through gene editing methods that result in the introduction of a mutation. In additional or alternative embodiments of the invention, allelic variants of the soybean E1, E2, E3, E4, E1La and / or E1Lb loci may be created through chemical mutagenesis, transposon insertion or excision, or any other known mutagenesis technique. In example embodiments, the mutation introduced into the E1, E2, E3, E4, E1La and / or E1Lb locus is an allele replacement, one or a plurality of base pair insertions, or one or a plurality of base pair deletions. The base pair insertions or base pair deletions may include a 3n base mutation wherein a multiple of 3 base pairs are deleted or inserted (e.g., insertion or deletion of 3bp, 6bp, 9bp, 12bp, 15bp, 18bp, etc.), thereby not affecting the reading frame of the gene. Alternatively, the base pair insertion or deletion may not be a multiple of 3 base pairs (e.g., an insertion or Docket No.83142-CN-REG-ORG-P1 deletion of 1 bp, 2bp, 4bp, 5bp, 7bp, 8bp, 10bp, 11bp, 13bp, 14 bp, etc.), thereby affecting the reading frame of the gene. In various embodiments, the mutation is a truncation mutation wherein the mutation can result in the introduction of a stop codon into the gene at a location upstream of the transcription terminus of the corresponding wild-type gene. Transcription of the resulting mutant allele is terminated at the newly introduced stop codon, resulting in a truncated protein that is shorter than the corresponding wild-type protein. In other embodiments, the mutation is an in-frame deletion mutation wherein deletion of an integral multiple of three base pairs (that is, 3n base pairs) occurs. Since three base pairs encode a single amino acid, the result of the in-frame deletion is that the reading frame of the transcript is maintained (that is, no frameshift mutations are introduced), however, the transcript generated from the mutant allele encodes a mutated protein that is shorter than the corresponding wild-type protein. Both the in- frame deletion and truncation mutations in the gene result in a mutated allele that encodes a shortened protein having reduced function (e.g., partial loss of function or complete loss of function) compared to the protein encoded by the wild-type (i.e., unmutated) allele. As used herein, an “allelic combination” refers to the specific combination of alleles present at more than one characterized location or loci. Embodiments of the invention include a plurality of allelic combinations at the E1, E2, E3, E4, E1La and / or E1Lb loci. Non-limiting examples of allelic variations or combinations of mutant alleles include: i. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; ii. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; Docket No.83142-CN-REG-ORG-P1 iii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; iv. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; v. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; vi. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; vii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; viii. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; ix. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; x. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xi. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xii. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xiii. a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xiv. a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xv. a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; xvi. a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23 Docket No.83142-CN-REG-ORG-P1 xvii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; xviii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; xix. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; xx. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; xxi. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; xxii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; xxiii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; Docket No.83142-CN-REG-ORG-P1 xxiv. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xxv. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xxvi. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xxvii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xxviii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xxix. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; xxx. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; Docket No.83142-CN-REG-ORG-P1 xxxi. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; xxxii. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; xxxiii. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; xxxiv. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; xxxv. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; xxxvi. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; xxxvii. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; Docket No.83142-CN-REG-ORG-P1 xxxviii. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xxxix. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xl. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xli. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xlii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; xliii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; xliv. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; Docket No.83142-CN-REG-ORG-P1 xlv. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; xlvi. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; xlvii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; xlviii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xlix. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; l. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; li. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; Docket No.83142-CN-REG-ORG-P1 lii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; liii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; liv. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; lv. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; lvi. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; lvii. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; lviii. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; Docket No.83142-CN-REG-ORG-P1 lix. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; lx. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; lxi. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; lxii. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; lxiii. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; lxiv. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; lxv. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; Docket No.83142-CN-REG-ORG-P1 lxvi. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; lxvii. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; lxviii. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; lxix. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; lxx. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; lxxi. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; lxxii. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; Docket No.83142-CN-REG-ORG-P1 lxxiii. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; lxxiv. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; lxxv. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; lxxvi. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; lxxvii. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; lxxviii. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; lxxix. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; Docket No.83142-CN-REG-ORG-P1 lxxx. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; lxxxi. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; lxxxii. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; lxxxiii. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; lxxxiv. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; lxxxv. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; lxxxvi. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; Docket No.83142-CN-REG-ORG-P1 lxxxvii. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; lxxxviii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; lxxxix. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; xc. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xci. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xcii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xciii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; Docket No.83142-CN-REG-ORG-P1 xciv. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xcv. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; xcvi. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; xcvii. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; xcviii. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xcix. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; c. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; Docket No.83142-CN-REG-ORG-P1 ci. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; cii. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; ciii. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; civ. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; cv. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; cvi. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; cvii. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 3bp deletion Docket No.83142-CN-REG-ORG-P1 of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; cviii. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; cix. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; cx. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; cxi. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; cxii. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; cxiii. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated Docket No.83142-CN-REG-ORG-P1 allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; cxiv. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; cxv. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; cxvi. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; cxvii. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; cxviii. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; cxix. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; cxx. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele Docket No.83142-CN-REG-ORG-P1 at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; cxxi. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; cxxii. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; cxxiii. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; cxxiv. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; cxxv. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; cxxvi. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; cxxvii. a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; and a mutated Docket No.83142-CN-REG-ORG-P1 allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; cxxviii. a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; and cxxix. a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23. In other embodiments, other allelic variants include: i. a mutated allele at any of the foregoing E1 loci combined with a mutation in one or more of any of the foregoing E1La, E1Lb, E2, E3, and E4 loci; ii. a mutated allele at any of the foregoing E2 loci combined with a mutation in one or more of any of the foregoing E1, E1La, E1Lb, E3, and E4 loci; iii. a mutated allele at any of the foregoing E3 loci combined with a mutated allele in one or more of any of the foregoing E1, E2, E1La, E1Lb, and E4 loci; iv. a mutated allele at any of the foregiong E4 loci combined with a mutated allele in one or more of any of the foregoing E1, E2, E3, E1La, or E1Lb loci; v. a mutated allele at any of the foregoing E1La loci combined with a mutated allele in one or more of any of the foregoing E1, E2, E3, E4, or E1Lb loci; and vi. a mutated allele at any of the foregoing E1Lb loci combined with a mutated allele in one or more of any of the foregoing E1, E2, E3, E4, or E1La loci. In non-limiting examples, allelic variants include: i. a mutated allele at the E1 locus; ii. a mutated allele at the E1 locus and a mutated allele at the E2 locus; iii. a mutated allele at the E1 locus and a mutated allele at the E3 locus; Docket No.83142-CN-REG-ORG-P1 iv. a mutated allele at the E2 locus; v. a mutated allele at the E2 locus and a mutated allele at the E3 locus; vi. a mutated allele at the E3 locus; vii. a mutated allele at the E3 locus and a mutated allele at the E4 locus; viii. a mutated allele at the E1LA locus and a mutated allele at the E1LB locus; and ix. a mutated allele at the E4 locus. In embodiments, the allelic variants comprise one or more of: i. SEQ ID NO: 8; ii. SEQ ID NO: 8 in combination with SEQ ID NO: 15; iii. SEQ ID NO: 9 in combination with SEQ ID NO: 20; iv. SEQ ID NO: 16; v. SEQ ID NO: 17 in combination with SEQ ID NO: 21 vi. SEQ ID NO: 22; vii. SEQ ID NO: 19 in combination with SEQ ID NO: 24; viii. SEQ ID NO: 11 in combination with SEQ ID NO: 13; ix. SEQ ID NO: 25; x. SEQ ID NO: 74; xi. SEQ ID NO: 75; and xii. SEQ ID NO: 76. In various embodiments: i. the nucleotide sequence encoding an E1 mutant having a 1bp insertion of an adenine at position 199 of SEQ ID NO: 7 is set forth in SEQ ID NO: 8 and encodes the amino acid sequence set forth in SEQ ID NO: 27; ii. the nucleotide sequence encoding an E1 mutant having a 1bp insertion of a guanine at position 199 of SEQ ID NO: 7 is set forth in SEQ ID NO: 9 and encodes the amino acid sequence set forth in SEQ ID NO: 28; Docket No.83142-CN-REG-ORG-P1 iii. the nucleotide sequence encoding an E1La mutant having a 1bp insertion at position 167 of SEQ ID NO: 10 is set forth in SEQ ID NO: 11 and encodes the amino acid sequence set forth in SEQ ID NO: 30; iv. the nucleotide sequence encoding an E1Lb mutant having a 1bp insertion at position 167 of SEQ ID NO: 12 is set forth in SEQ ID NO: 13 and encodes the amino acid sequence set forth in SEQ ID NO: 32; v. the nucleotide sequence encoding an E2 mutant having a 1bp deletion of position 89 of SEQ ID NO: 14 is set forth in SEQ ID NO: 15 and encodes the amino acid sequence set forth in SEQ ID NO: 34; vi. the nucleotide sequence encoding an E2 mutant having a 14bp deletion of positions 81-94 of SEQ ID NO: 14 is set forth in SEQ ID NO: 16 and encodes the amino acid sequence set forth in SEQ ID NO: 35; vii. the nucleotide sequence encoding an E2 mutant having an 8bp deletion of positions 89-96 of SEQ ID NO: 14 is set forth in SEQ ID NO: 17 and encodes the amino acid sequence set forth in SEQ ID NO: 36; viii. the nucleotide sequence encoding an E3 mutant having a 1bp insertion at position 181 of SEQ ID NO: 18 is set forth in SEQ ID NO: 19 and encodes the amino acid sequence set forth in SEQ ID NO: 38; ix. the nucleotide sequence encoding an E3 mutant having a 256-bp deletion and a 5-bp insertion within positions 158-413 of SEQ ID NO: 18 is set forth in SEQ ID NO: 20 and encodes the amino acid sequence set forth in SEQ ID NO: 39; x. the nucleotide sequence encoding an E3 mutant having a 4bp deletion of positions 178-181 of SEQ ID NO: 18 is set forth in SEQ ID NO: 21 and encodes the amino acid sequence set forth in SEQ ID NO: 40; xi. the nucleotide sequence encoding an E3 mutant having a 1bp insertion at position 10 of SEQ ID NO: 18 is set forth in SEQ ID NO: 22 and encodes the amino acid sequence set forth in SEQ ID NO: 41; Docket No.83142-CN-REG-ORG-P1 xii. the nucleotide sequence encoding an E4 mutant having a 3bp deletion of positions 150-152 of SEQ ID NO: 23 is set forth in SEQ ID NO: 24 and encodes the amino acid sequence set forth in SEQ ID NO: 43; xiii. the nucleotide sequence encoding an E4 mutant having a 2bp deletion of positions 151-152 of SEQ ID NO: 23 is set forth in SEQ ID NO: 25 and encodes the amino acid sequence set forth in SEQ ID NO: 44; xiv. the nucleotide sequence encoding an E4 mutant having a 7bp deletion of positions 149-155 of SEQ ID NO: 23 is set forth in SEQ ID NO: 74 and encodes the amino acid sequence set forth in SEQ ID NO: 77 xv. the nucleotide sequence encoding an E4 mutant having a 61bp deletion of positions 148-208 of SEQ ID NO: 23 is set forth in SEQ ID NO: 75 and encodes the amino acid sequence set forth in SEQ ID NO: 78; and xvi. the nucleotide sequence encoding an E4 mutant having a 1bp insertion after position 151 of SEQ ID NO: 23 is set forth in SEQ ID NO: 76 and encodes the amino acid sequence set forth in SEQ ID NO: 79. In embodiments, the flowering time of a non-naturally occurring soybean plant comprising any of the non-naturally occurring allelic combinations disclosed above is modified relative to a control plant having a wild-type allele at the corresponding locus that was mutated or, where multiple loci are mutated, relative to a control plant having a wild-type allele at one or all of the corresponding mutated loci. For example, the non-naturally occurring plant may have more than one of the mutant alleles described herein at the E1, E2, E3, E4, E1La or E1Lb locus but the control plant may only have a corresponding wild-type allele at some (e.g., one) but not all loci. In this scenario, a mutation at more than one allele may have an altered flowering time compared to a control plant that has one corresponding wild-type allele but mutated at one or more of the other mutated alleles. As a non-limiting example, a non-naturally occurring soybean plant having a mutation at the E1 and the Docket No.83142-CN-REG-ORG-P1 E2 locus may have an altered flowing time relative to a control plant that is wild-type at one of the E1 or E2 loci, and mutated at the other of the E1 or E2 loci. In embodiments, the modified flowering time of a non-naturally occurring soybean plant comprising a mutant allele at one or more of the E1, E2, E3, E4, E1La or E1Lb loci is smaller (e.g., slightly smaller or significantly smaller) than the flowering time of a control plant. In embodiments of the invention, the allelic combination of a plant at the E1, E2, E3, E4, E1La or E1Lb loci may be determined via molecular marker-based assays, such as an assay of the DNA of the plant indicative of a type of mutation introduced at each locus. In embodiments, the allelic combination is indicative of a change in flowering time of the plant relative to a control plant not comprising the allelic combination (e.g., a control plant comprising one or more of the wild-type alleles or comprising wild type alleles at all corresponding loci). As used herein, the term “and / or” when used in the context of a list of entities, refers to the entities being present singly or in combination. Thus, for example, the phrase “A, B, C, and / or D” includes A, B, C, and D individually, but also includes any and all combinations and subcombinations of A, B, C, and D (e.g., AB, AC, AD, BC, BD, CD, ABC, ABD, and BCD). In some embodiments, one of more of the elements to which the “and / or” refers can also individually be present in single or multiple occurrences in the combinations(s) and / or subcombination(s). As used herein, the phrase “associated with” refers to a recognizable and / or assayable relationship between two entities. For example, the phrase “associated with soybean maturity” refers to a trait, locus, gene, allele, marker, phenotype, etc., or the Docket No.83142-CN-REG-ORG-P1 expression thereof, the presence or absence of which can influence a number of days a soybean plant spends in a vegetative state. As such, a marker is “associated with” a trait when it is linked to it and when the presence of the marker is an indicator of whether and / or to what extent the desired trait or trait form will occur in a plant / germplasm comprising the marker. Similarly, a marker is “associated with” an allele when it is linked to it and when the presence of the marker is an indicator of whether the allele is present in a plant / germplasm comprising the marker. For example, “a marker associated with an allele for soybean maturity gene E1” refers to a marker whose presence or absence can be used to predict whether an E1 allele is present and responsible for the flowering time of the plant. A “dominant maturity allele” is an allele that, when present either in single copy (heterozygous) or two copies (homozygous), affects the maturity of the plant. A “recessive maturity allele” is an allele that affects the maturity of the plant only when present in two copies (homozygous), and does not affect the maturity of a plant when present in a single copy (heterozygous). The term “comprising,” which is synonymous with “including,” “containing,” and “characterized by,” is inclusive or open-ended and does not exclude additional, unrecited elements and / or method steps. “Comprising” is a term of art that means that the named elements and / or steps are present, but that other elements and / or steps can be added and still fall within the scope of the relevant subject matter. As used herein, the phrase “consisting of” excludes any element, step, or ingredient not specifically recited. When the phrase “consists of” appears in a clause of the body of a claim, rather than immediately following the preamble, it limits only the element set forth in that clause; other elements are not excluded from the claim as a whole. As used herein, the phrase “consisting essentially of” limits the scope of the related disclosure or claim to the specified materials and / or steps, plus those that do not Docket No.83142-CN-REG-ORG-P1 materially affect the basic and novel characteristic(s) of the disclosed and / or claimed subject matter. With respect to the terms “comprising,” “consisting essentially of,” and “consisting of,” where one of these three terms is used herein, the presently disclosed and claimed subject matter can include in some embodiments the use of either of the other two terms. For example, if a subject matter relates in some embodiments to soybean plants that comprise in their genome a genomic interval comprising a mutant E1, E2, E3, E4, E1La or E1Lb allele, it is understood that the disclosed subject matter thus also encompasses soybean plants with genomic intervals that in some embodiments consist essentially of the mutant E1, E2, E3, E4, E1La or E1Lb allele as well as soybean plants with genomic intervals that in some embodiments consist of the mutant E1, E2, E3, E4, E1La or E1Lb allele. Similarly, it is also understood that in some embodiments the methods for the disclosed subject matter comprise the steps that are disclosed herein, in some embodiments the methods for the presently disclosed subject matter consist essentially of the steps that are disclosed, and in some embodiments the methods for the presently disclosed subject matter consist of the steps that are disclosed herein. As used herein, a “cultivar” is a race or variety of a plant that has been created or selected intentionally and maintained through cultivation. As used herein, “determinate growth habit” refers to ceasing of vegetative growth after the main stem terminates in a cluster of flowers. In comparison, “indeterminate growth habit” refers to the development of leaves and flowers simultaneously throughout a portion of their reproductive period, with one to three pods at the terminal apex. Docket No.83142-CN-REG-ORG-P1 As used herein, the term “gene” refers to a hereditary unit including a sequence of DNA that occupies a specific location on a chromosome and that contains the genetic instruction for a particular characteristic or trait in an organism. A “genetic map” is a description of genetic linkage relationships among loci on one or more chromosomes within a given species, generally depicted in a diagrammatic or tabular form. The genetic map is distinct from a physical map which is a description of the location of a genetic element (e.g., gene, allele, chromosomal locus, marker, etc.) on a sequenced chromosome. As used herein, the term “human-induced mutation” refers to any mutation that occurs as a result of either direct or indirect human action. This term includes, but is not limited to, mutations obtained by any method of targeted mutagenesis and gene editing. As used herein, “introduced” means delivered, expressed, applied, transported, transferred, permeated, or other like term to indicate the delivery, whether of nucleic acid or protein or combination thereof, of a desired object to an object. For example, nucleic acids encoding a site directed nuclease and optionally at least one guide RNA may be introduced into a plant embryo. Likewise, extant editing machinery (comprising a site directed nuclease protein and optionally at least one guide RNA) may be introduced into sterilized soybean seeds upon application of appropriate cell- penetrating chemicals and / or peptides. As used herein, “line” refers to a group of individual plants from the similar parentage with similar traits. An “elite line” is any line that has resulted from breeding and selection for superior agronomic performance. Additionally, an elite line is sufficiently homogenous and homozygous to be used for commercial production. Docket No.83142-CN-REG-ORG-P1 Elite lines may be used in the further breeding efforts to develop new elite lines. An elite plant is any plant from an elite line. As used herein, “locus” is a chromosomal locus or region where a polymorphic nucleic acid, trait determinant, gene, or marker is located. A “locus” can be shared by two homologous chromosomes to refer to their corresponding locus or region. As used herein, the terms “marker probe” and “probe” refer to a nucleotide sequence or nucleic acid molecule that can be used to detect the presence or absence of a sequence within a larger sequence, e.g., a nucleic acid probe that is complementary to all of or a portion of the marker or marker locus, through nucleic acid hybridization. Marker probes comprising about 8, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more contiguous nucleotides can be used for nucleic acid hybridization. As used herein, the term “molecular marker” can be used to refer to a genetic marker, as defined above, or an encoded product thereof (e.g., a protein) used as a point of reference when identifying the presence / absence of a gene or allele (such as an allele at a soybean maturity associated locus, such as at an E1 and / or E1LB locus). A molecular marker can be derived from genomic nucleotide sequences or from expressed nucleotide sequences (e.g., from an RNA, a cDNA, etc.). The term also refers to nucleotide sequences complementary to or flanking the marker sequences, such as nucleotide sequences used as probes and / or primers capable of amplifying the marker sequence. Nucleotide sequences are “complementary” when they specifically hybridize in solution (e.g., according to Watson-Crick base pairing rules). This term also refers to the genetic markers that indicate a trait by the absence of the nucleotide sequences complementary to or flanking the marker sequences, such as nucleotide sequences used as probes and / or primers capable of amplifying the marker sequence. As used herein, the terms “nucleotide sequence,” “polynucleotide,” “nucleic acid sequence,” “nucleic acid molecule,” and “nucleic acid fragment” refer to a polymer of Docket No.83142-CN-REG-ORG-P1 RNA or DNA that is single- or double-stranded, optionally containing synthetic, non- natural, and / or altered nucleotide bases. A “nucleotide” is a monomeric unit from which DNA or RNA polymers are constructed and consists of a purine or pyrimidine base, a pentose, and a phosphoric acid group. Nucleotides (usually found in their 5′- monophosphate form) are referred to by their single letter designation as follows: “A” for adenylate or deoxyadenylate (for RNA or DNA, respectively), “C” for cytidylate or deoxycytidylate, “G” for guanylate or deoxyguanylate, “U” for uridylate, “T” for deoxythymidylate, “R” for purines (A or G), “Y” for pyrimidines (C or T), “K” for G or T, “H” for A or C or T, “I” for inosine, and “N” for any nucleotide. As used herein, “modified” in the context of a plant, plant seed, plant part, plant cell, and / or plant genome, refers to a plant, plant seed, plant part, plant cell, and / or plant genome comprising an engineered change in the expression level and / or coding sequence of one or more of an E1, E2, E3, E4, E1LA, or E1LB gene relative to a wild-type or control plant, plant seed, plant part, plant cell, and / or plant genome, such as via a genome editing event or mutation affecting (e.g., reducing or eliminating) the expression level or activity of one or more endogenous E1, E2, E3, E4, E1LA, and / or E1LB genes. The term “modified” may further refer to a plant, plant seed, plant part, plant cell, and / or plant genome having one or more mutations affecting expression of one or more endogenous E1, E2, E3, E4, E1LA, or E1LB genes introduced through chemical mutagenesis, transposon insertion or excision, or any other known mutagenesis technique, or introduced through genome editing. For clarity, therefore, a modified plant, plant seed, plant part, plant cell, and / or plant genome includes a mutated and / or edited plant, plant seed, plant part, plant cell, and / or plant genome having a modified expression level, expression pattern, and / or coding sequence of one or more E1, E2, E3, E4, E1LA, or E1LB gene(s) relative to a wild-type or control plant, plant seed, plant part, plant cell, and / or plant genome. Modified plants may be homozygous or heterozygous for any given mutation or edit, and / or may be bi-allelic at the E1, E2, E3, E4, E1LA, or E1LB gene locus. A modified plant is bi-allelic for Docket No.83142-CN-REG-ORG-P1 the E1, E2, E3, E4, E1LA, or E1LB gene if each copy of the gene is modified by a different allele (i.e., different mutation(s) and / or edit(s)), wherein each allele lowers the expression level and / or activity of the gene. Modified plants or seeds may contain various molecular changes that affect expression of E1, E2, E3, E4, E1LA, or E1LB gene(s), including genetic and / or epigenetic modifications. Modified plants, plant parts, seeds, etc., may have been subjected to mutagenesis, genome editing or site- directed integration (e.g., without being limiting, via methods using site-specific nucleases), genetic transformation (e.g., without being limiting, via methods of Agrobacterium transformation or microprojectile bombardment), or a combination thereof. Such “modified” plants, plant seeds, plant parts, and plant cells include plants, plant seeds, plant parts, and plant cells that are offspring or derived from “modified” plants, plant seeds, plant parts, and plant cells that retain the molecular change (e.g., change in expression level and / or activity) to the E1, E2, E3, E4, E1LA, or E1LB gene. A modified seed provided herein may give rise to a modified plant provided herein. A modified plant, plant seed, plant part, plant cell, or plant genome provided herein may comprise a recombinant DNA construct or vector or genome edit as provided herein. A “modified plant product” may be any product made from a modified plant, plant part, plant cell, or plant chromosome provided herein, or any portion or component thereof. As used herein, the term “nucleotide sequence identity” refers to the presence of identical nucleotides at corresponding positions of two polynucleotides. Polynucleotides have “identical” sequences if the sequence of nucleotides in the two polynucleotides is the same when aligned for maximum correspondence (e.g., in a comparison window). Sequence comparison between two or more polynucleotides is generally performed by comparing portions of the two sequences over a comparison window to identify and compare local regions of sequence similarity. The comparison window is generally from about 20 to 200 contiguous nucleotides. The “percentage of sequence identity” for polynucleotides, such as about 50, 55, 60, 65, 70, 75, 80, 85, Docket No.83142-CN-REG-ORG-P1 90, 95, 98, 99 or 100 percent sequence identity, can be determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window can include additions or deletions (i.e., gaps) as compared to the reference sequence for optimal alignment of the two sequences. In some embodiments, the percentage is calculated by: (a) determining the number of positions at which the identical nucleic acid base occurs in both sequences; (b) dividing the number of matched positions by the total number of positions in the window of comparison; and (c) multiplying the result by 100. Optimal alignment of sequences for comparison can also be conducted by computerized implementations of known algorithms, or by visual inspection. Readily available sequence comparison and multiple sequence alignment algorithms are, respectively, the Basic Local Alignment Search Tool (BLAST) and ClustalW / ClustalW2 / Clustal Omega programs available on the Internet (e.g., the website of the EMBL-EBI). Other suitable programs include, but are not limited to, GAP, BestFit, Plot Similarity, and FASTA, which are part of the Accelrys GCG Package available from Accelrys, Inc. of San Diego, Calif., United States of America. See also Smith & Waterman, 1981; Needleman & Wunsch, 1970; Pearson & Lipman, 1988; Ausubel et al., 1988; and Sambrook & Russell, 2001. The term “open reading frame” (ORF) refers to a nucleic acid sequence that encodes a polypeptide. In some embodiments, an ORF comprises a translation initiation codon (i.e., start codon), a translation termination (i.e., stop codon), and the nucleic acid sequence there between that encodes the amino acids present in the polypeptide. The terms “initiation codon” and “termination codon” refer to a unit of three adjacent nucleotides (i.e., a codon) in a coding sequence that specifies initiation and chain termination, respectively, of protein synthesis (mRNA translation). As used herein, the terms “phenotype,” “phenotypic trait” or “trait” refer to one or more traits of a plant or plant cell. The phenotype can be observable to the naked eye, Docket No.83142-CN-REG-ORG-P1 or by any other means of evaluation known in the art, e.g., microscopy, biochemical analysis, or an electromechanical assay. In some cases, a phenotype is directly controlled by a single gene or genetic locus (i.e., corresponds to a “single gene trait”). In other cases, a phenotype is the result of interactions among several genes, which in some embodiments also results from an interaction of the plant and / or plant cell with its environment. In the case of soybean maturity genes such as E1, E2, E3, E4, E1LA, or E1LB, the phenotypic trait includes one or more or a combination of flowering time, post- flowering time, relative maturity, maturity time, maturity group and number of days from flowering of the soybean plant to beginning of maturity. In particular embodiments, the phenotypic trait measured is a flowering time and includes a measure of time elapsed between the VE and R1 phase of a modified soybean plant (see FIG.1A for the various stages) relative to a control plant. In another embodiment, the phenotypic trait measured is a maturity time and includes a measure of time elapsed between the R1 and R7 phase, or R1 and R8 phase, of the modified soybean plant (see FIG.1A for the various stages) relative to a control plant. The number of days may vary, relative to a control plant comprising wild-type alleles at both loci, based on the specific allelic combination of the plant. In example embodiments of the invention, a modified soybean plant comprising a mutant E1, E2, E3, E4, E1LA, and / or E1LB allele has a flowering time and / or maturity time that is significantly smaller than that of a control plant. Further, a soybean plant comprising a mutant allele at more than one of the E1, E2, E3, E4, E1LA, or E1LB loci has a flowering time and / or maturity time that is significantly smaller than that of a control plant. A duration or degree by which the flowering time is reduced is further based on the nature of the mutant allele, such as based on whether the mutated allele results in a gain of function, complete loss of function, or partial loss of function of the gene product. Furthermore, the duration or degree by Docket No.83142-CN-REG-ORG-P1 which the flowering time is reduced may be based on whether the allele is homozygous or heterozygous (e.g., bi-allelic), and whether the allele is homozygous recessive or dominant. As used herein, a modified plant having a flowering time and / or maturity time that is “slightly smaller” than a control plant has a flowering time and / or maturity time that is between 1 and 10 days shorter than the control plant (e.g., shorter than that of the control plant by at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or 10days). In embodiments, the flowering time of a modified plant is slightly smaller than the control plant if the flowering time is shorter by 1-2 days, 1-3 days, 1- 4 days, 1-5 days, 1-6 days, 1-7 days, 1-8 days, 1-9 days or 1-10 days. In comparison, a modified plant having a flowering time and / or maturity time that is “significantly smaller” than the control plant has a flowering time and / or maturity time that is at least 10 days shorter than that of the control plant, such as between 10- 100 days shorter than the control plant (e.g., shorter than that of the control plant by at least 10 days, 10-20 days 10-30 days, 10-40 days, 10-50 days, 10-60 days, 10-70 days, 10-80 days, 10-90 days or 10-100 days or any range therebetween such as 20-30 days, 20-40 days, 30-40 days, 40-50 days, 50-60 days, 70-80 days, 80-90 days, 90- 100 days, and so on). As used herein, the term “photoperiodic response” or “photoperiodism” refers to the physiological reaction of a plant to the relative lengths of light and dark periods. Photoperiod responsive plants may be “short-day”, “long-day” or “day-neutral” plants. Photoperiodism affects flowering by inducing the shoot to produce floral buds instead of leaves and lateral buds. Soybean, for example, is a short-day (SD) plant. In embodiments of the invention, soybean flowering time is assessed. Short day plants flower when the night lengths exceed their critical photoperiod and cannot flower under short nights. They require a continuous period of darkness before floral Docket No.83142-CN-REG-ORG-P1 development can begin. Natural nighttime light, such as moonlight or lightning, is not of sufficient brightness or duration to interrupt flowering. Typically, short-day (i.e. long-night) plants flower as days grow shorter (e.g., late summer and fall in the northern hemisphere). The length of the dark period required to induce flowering differs among species and varieties of a species. Long-day plants flower when the night length falls below their critical photoperiod. These plants typically flower as days get longer (e.g., late spring and early summer in the northern hemisphere). As used herein, “flowering time” or “days to flowering” is an estimate of a duration (e.g., in terms of hours, days, weeks, etc.) elapsed between initiation of first flowering and seed emergence. In embodiments of the invention, flowering time of a soybean plant is modified or altered, relative to a control plant, through the introduction of novel non-naturally occurring alleles in genes involved in soybean maturity, particularly E1, E2, E3, E4, E1LA, or E1LB genes. In particular embodiments, flowering time is defined as a number of days elapsed for a soybean plant to transition from a VE stage (e.g., seeds emergence wherein cotyledons have been pulled through the soil surface for at least 50% of the seeds) to an R1 stage (e.g., beginning of flowering wherein at least 50% of the plants have at least one flower on any node). In particular embodiments, maturity time or post flowering time is defined as a number of days elapsed for a soybean plant to transition from the R1 stage (e.g., beginning of bloom wherein there is one open flower at any node on the main stem) to an R7 stage (wherein any pod has reached a mature pod color) or from the R1 stage to an R8 stage (wherein 95% of the pods have reached their mature pod color). A description of the various development stages of a soybean plant and mature soy pod coloration is provided at FIGS.1A and 1B as reference. As used herein, “relative maturity group” or “relative maturity value” or “RM” can be any indicative number, symbol, or combination of both, that provides an indication of when a plant will mature. In embodiments, the relative maturity value is indicative of Docket No.83142-CN-REG-ORG-P1 an average number of days that elapse between flowering time and maturity time or between flowering and at last seed pod reaching maturity (e.g., to the R7 stage). Similarly, a change in relative maturity group may be associated with a change in the average flowering time. As an example, in North America, a change in relative maturity of one, from RM 2.0 to RM 3.0 may correlate with a change in maturity time of 10 days. This value may vary based on growing conditions, such as based on whether the plant was grown under short day or long day conditions or based on whether the plant was grown in greenhouse or field conditions. As used herein, “altered” or “modified” as it applies to soybean maturity means increased or decreased at maturity. In this aspect, a mature seed is defined by a seed that is harvested in the field for commercial agricultural practices, such as sale for feed. In an aspect, soybean plants are selected for preferred geographies for expression of at least one phenotypic trait. The phenotypic trait includes altered levels of a substance or a molecule, such as proteins, oils, or gamma linolenic acid. “Altered” can include any relative increase or decrease of function or production of a gene product of interest, in an aspect up to and including complete elimination of function or production of that gene product. When levels of a gene product are compared, such a comparison is preferably carried out between organisms with a similar genetic background. Preferably, a similar genetic background is a background where the organisms being compared share 50% or greater, more preferably 75% or greater, and, even more preferably 90% or greater sequence identity of nuclear genetic material. In another aspect, a similar genetic background is a background where the plants are isogenic except for one or more markers of the present invention. As used herein, the term “plant” can refer to a whole plant, any part thereof, or a cell or tissue culture derived from a plant. Thus, the term “plant” can refer to any of: whole plants, plant components or organs (e.g., leaves, stems, roots, etc.), plant Docket No.83142-CN-REG-ORG-P1 tissues, seeds and / or plant cells, including viable seeds as well as devitalized seeds or seeds that are not capable of regenerating into a whole plant. A plant cell is a cell of a plant, taken from a plant, or derived through culture from a cell taken from a plant. Thus, the term “plant cell” includes without limitation cells within seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, shoots, gametophytes, sporophytes, pollen, and microspores. The phrase “plant part” refers to a part of a plant, including single cells and cell tissues such as plant cells that are intact in plants, cell clumps, and tissue cultures from which plants can be regenerated. Examples of plant parts include, but are not limited to, single cells and tissues from pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, shoots, and seeds; as well as scions, rootstocks, protoplasts, calli, and the like. As used herein, the term “primer” refers to an oligonucleotide which is capable of annealing to a nucleic acid target (in some embodiments, annealing specifically to a nucleic acid target) allowing a DNA polymerase and / or reverse transcriptase to attach thereto, thereby serving as a point of initiation of DNA synthesis when placed under conditions in which synthesis of a primer extension product is induced (e.g., in the presence of nucleotides and an agent for polymerization such as DNA polymerase and at a suitable temperature and pH). In some embodiments, one or more pluralities of primers are employed to amplify plant nucleic acids (e.g., using the polymerase chain reaction; PCR). As used herein, the term “probe” refers to a nucleic acid (e.g., a single stranded nucleic acid or a strand of a double stranded or higher order nucleic acid, or a subsequence thereof) that can form a hydrogen-bonded duplex with a complementary sequence in a target nucleic acid sequence. Typically, a probe is of sufficient length to form a stable and sequence-specific duplex molecule with its complement, and as Docket No.83142-CN-REG-ORG-P1 such can be employed in some embodiments to detect a sequence of interest present in a plurality of nucleic acids. As used herein, the terms “progeny” and “progeny plant” refer to a plant generated from vegetative or sexual reproduction from one or more parent plants. A progeny plant can be obtained by cloning or selfing a single parent plant, or by crossing two or more parental plants. For instance, a progeny plant can be obtained by cloning or selfing of a parent plant or by crossing two parental plants and include selfings as well as the F1 or F2 or still further generations. An F1 is a first-generation progeny produced from parents at least one of which is used for the first time as donor of a trait, while progeny of second generation (F2) or subsequent generations (F3, F4, and the like) are specimens produced from selfings, intercrosses, backcrosses, and / or other crosses of F1s, F2s, and the like. An F1 can thus be (and in some embodiments is) a hybrid resulting from a cross between two true breeding parents (i.e., parents that are true-breeding are each homozygous for a trait of interest or an allele thereof), while an F2 can be (and in some embodiments is) a progeny resulting from self-pollination of the F1 hybrids. As used herein, the phrase “recombination” refers to an exchange of DNA fragments between two DNA molecules or chromatids of paired chromosomes (a “crossover”) over in a region of similar or identical nucleotide sequences. A “recombination event” is herein understood to refer in some embodiments to a meiotic crossover. As used herein, the term “reference sequence” refers to a defined nucleotide sequence used as a basis for nucleotide sequence comparison. As used herein, the term “reference plant” or “control plant” refers to a defined plant used as a basis for genetic and / or phenotypic comparison. In some embodiments, a soybean plant comprising wild-type alleles at each of the E1, E2, E3, E4, E1LA, or Docket No.83142-CN-REG-ORG-P1 E1LB loci is a control plant for comparing to other plants comprising mutant alleles at one or more of the E1, E2, E3, E4, E1LA, or E1LB loci. As used herein, the term “regenerate,” and grammatical variants thereof, refers to the production of a plant from tissue culture. As used herein, the phrase “stringent hybridization conditions” refers to conditions under which a polynucleotide hybridizes to its target subsequence, typically in a complex mixture of nucleic acids, but to essentially no other sequences. Stringent conditions are sequence-dependent and can be different under different circumstances. Longer sequences typically hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Sambrook & Russell, 2001. Generally, stringent conditions are selected to be about 5-10° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH. The Tm is the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Exemplary stringent conditions are those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. Additional exemplary stringent hybridization conditions include 50% formamide, 5×SSC, and 1% SDS incubating at 42° C.; or SSC, 1% SDS, incubating at 65° C.; with one or more washes in 0.2×SSC and 0.1% SDS at 65° C. For PCR, a temperature of about 36° C. is typical for low stringency amplification, although annealing temperatures can vary between about 32° C. and 48° C. (or Docket No.83142-CN-REG-ORG-P1 higher) depending on primer length. Additional guidelines for determining hybridization parameters are provided in numerous references (see e.g., Ausubel et al., 1999). As used herein, the term “trait” refers to a phenotype of interest, a gene that contributes to a phenotype of interest, as well as a nucleic acid sequence associated with a gene that contributes to a phenotype of interest. For example, a “soybean maturity trait” refers to a phenotype as well as a gene (e.g., E1, E2, E3, E4, E1LA, or E1LB) that contributes to soybean maturity and has a nucleic acid sequence (e.g., a soybean maturity-associated gene product) that is associated with a photoperiod response, including a number of days between flowering and pod formation. As used herein, the term “transgene” refers to a nucleic acid molecule introduced into an organism or one or more of its ancestors by some form of artificial transfer technique. The artificial transfer technique thus creates a “transgenic organism” or a “transgenic cell.” It is understood that the artificial transfer technique can occur in an ancestor organism (or a cell therein and / or that can develop into the ancestor organism) and yet any progeny individual that has the artificially transferred nucleic acid molecule or a fragment thereof is still considered transgenic even if one or more natural and / or assisted breedings result in the artificially transferred nucleic acid molecule being present in the progeny individual. As used herein, the term “targeted mutagenesis” or “mutagenesis strategy” refers to any method of mutagenesis that results in the intentional mutagenesis of a chosen gene. Targeted mutagenesis includes the methods CRISPR, TILLING, TALEN, and other methods not yet discovered but which may be used to achieve the same outcome. Docket No.83142-CN-REG-ORG-P1 DETAILED DESCRIPTION Soybean is a short day (SD) plant grown in a wide range of geographical regions and over a wide range of latitudes from equatorial to up to 50 degrees. This wide adaptability has most likely been created by genetic diversity at a large number of the major genes and quantitative trait loci controlling flowering behavior. Photoperiod is one of the leading climatic factors in determining soybean floral development and adaptation to different regions. Short day lengths can hasten flowering, whereas long day lengths can delay flowering. Due to their photoperiodic sensitivity, the cultivation area of each soybean cultivar is restricted to a very narrow range of latitudes to attain its highest yield. Provided herein are plants comprising non-naturally occurring allelic combinations of soybean maturity genes, particularly at E1, E2, E3, E4, E1LA, and / or E1LB loci, that modify the flowering profile (e.g., flowering time, and / or maturity value) of the resulting plant. In some instances, the allelic combination results in a modified soybean maturity profile when the alleles are expressed in a plant or part thereof as compared to a control plant that does not comprise the given allelic combination, such as a control plant comprising wild-type alleles at one or more loci. As a result of the modified flowering profile, the resulting soybean plants, and their progeny plants, can be cultivated and grown in a wider range of latitudes, enabling higher yields. The terms “soybean maturity” and “relative maturity” and “photoperiod response” are used interchangeably herein. Various means of introducing mutations that result in the non-naturally occurring alleles and allelic combinations into the soybean plant are also disclosed, which include transgenic means, gene editing, and breeding. Markers for identifying the presence of these non-naturally occurring alleles in the plant are also disclosed. As used herein, the terms “phenotype,” “phenotypic trait” or “trait” refer to a distinguishable characteristic(s) of a genetically controlled trait. Docket No.83142-CN-REG-ORG-P1 In some embodiments, the plants provided herein are a non-naturally occurring variety of soybean having the desired trait. In specific embodiments, the non- naturally occurring variety of soybean is an elite soybean variety. A “non-naturally occurring variety of soybean” is any variety of soybean that does not naturally exist in nature. A “non-naturally occurring variety of soybean” may be produced by any method known in the art, including, but not limited to, transforming a soybean plant or germplasm, transfecting a soybean plant or germplasm, and crossing a naturally occurring variety of soybean with a non-naturally occurring variety of soybean. In some embodiments, a “non-naturally occurring variety of soybean” may comprise one of more heterologous nucleotide sequences. In some embodiments, a “non-naturally occurring variety of soybean” may comprise one or more non-naturally occurring alleles of a naturally occurring gene (i.e., non-naturally occurring mutations introduced into a gene that naturally occurs in soybean). In some embodiments, a “non-naturally occurring variety of soybean” may comprise a non-natural combination of one or more non-naturally alleles of soybean maturity gene (i.e., non- naturally occurring alleles of E1, E2, E3, E4, E1LA, and / or E1LB genes in different combinations that do not naturally occur in the same soybean variety). A "subject plant or plant cell" is one in which genetic alteration, such as a mutation, has been affected as to a gene of interest to create a non-naturally occurring and novel allele, or is a plant or plant cell which is descended from a plant or cell so altered and which comprises the alteration. A "control" or "control plant" or "control plant cell" provides a reference point for measuring changes in phenotype of the subject plant or plant cell. A control plant or plant cell may comprise, for example: (a) a wild-type plant or cell, i.e., of the same genotype as the starting material for the genetic alteration which resulted in the subject plant or cell; (b) a plant or plant cell of the same genotype as the starting material but which has a wild-type allele at each of the E1, E2, E3, E4, E1LA, and E1LB loci; (c) a plant or plant cell of the same genotype as the starting material but which has a wild-type allele at one or more of the E1, E2, Docket No.83142-CN-REG-ORG-P1 E3, E4, E1LA, or E1LB loci; (d) a plant or plant cell which is a non-transformed segregant among progeny of a subject plant or plant cell; (e) a plant or plant cell genetically identical to the subject plant or plant cell but which is not exposed to conditions or stimuli that would induce expression of the gene or allele of interest; or (f) the subject plant or plant cell itself, under conditions in which the gene or allele of interest is not expressed. I. Novel, non-naturally occurring gene alleles that result in a modified soybean flowering time Methods and compositions are provided for producing soybean plants having a modified flowering profile. Such plants comprise non-naturally occurring alleles at one or more of a E1, E2, E3, E4, E1LA, or E1LB locus. These plants can be grown in geographic regions, including latitudes, that are outside of the region they would have been limited to if the allelic combination was not introduced (e.g., relative to a plant comprising any both of the wild-type alleles). In addition to widening the range of cultivation, the yield of the plant is also increased. Site-directed mutations at the E1, E2, E3, E4, E1LA, and / or E1LB loci are followed by selection of alleles encoding mutant forms of the E1, E2, E3, E4, E1LA, and / or E1LB proteins that have reduced activity. Such alleles are useful for making soybean plants that have an altered flowering time. Novel E1, E2, E3, E4, E1LA, or E1LB alleles thus created are especially suitable in the context of in situ-mutated (genome- edited) plants that can be grown in latitudes outside of their unmutated counterparts. Non-limiting examples of allelic combinations resulting from the non-naturally occurring alleles described herein include: (i) a mutant allele of one or more of the E1, E2, E3, E4, E1LA, or E1LB loci resulting in partial expression of the one or more proteins and a wild-type Docket No.83142-CN-REG-ORG-P1 allele at the other of the E1, E2, E3, E4, E1LA, or E1LB loci, wherein the combination of alleles may be selected from: a. a mutant allele at the E1 locus resulting in partial expression of the E1 protein and a wild-type allele at the E2, E3, E4, E1LA, and E1LB loci; b. a mutant allele at the E2 locus resulting in partial expression of the E2 protein and a wild-type allele at the E1, E3, E4, E1LA, and E1LB loci; c. a mutant allele at the E3 locus resulting in partial expression of the E3 protein and a wild-type allele at the E1, E2, E4, E1LA, and E1LB loci; d. a mutant allele at the E4 locus resulting in partial expression of the E4 protein and a wild-type allele at the E1, E2, E3, E1LA, and E1LB loci; e. a mutant allele at the E1LA locus resulting in partial expression of the E1LA protein and a wild-type allele at the E1, E2, E3, E4, and E1LB loci; and f. a mutant allele at the E1LB locus resulting in partial expression of the E1LB protein and a wild-type allele at the E1, E2, E3, E4, and E1LA loci; (ii) a mutant allele of one or more of the E1, E2, E3, E4, E1LA, or E1LB loci resulting in loss of expression of the one or more proteins and a wild-type allele at the other of the E1, E2, E3, E4, E1LA, or E1LB loci, wherein the combination of alleles may be selected from: a. a mutant allele at the E1 locus resulting in loss of expression of the E1 protein and a wild-type allele at the E2, E3, E4, E1LA, and E1LB loci; b. a mutant allele at the E2 locus resulting in loss of expression of the E2 protein and a wild-type allele at the E1, E3, E4, E1LA, and E1LB loci; c. a mutant allele at the E3 locus resulting in loss of expression of the E3 protein and a wild-type allele at the E1, E2, E4, E1LA, and E1LB loci; d. a mutant allele at the E4 locus resulting in loss of expression of the E4 protein and a wild-type allele at the E1, E2, E3, E1LA, and E1LB loci; Docket No.83142-CN-REG-ORG-P1 e. a mutant allele at the E1LA locus resulting in loss of expression of the E1LA protein and a wild-type allele at the E1, E2, E3, E4, and E1LB loci; and f. a mutant allele at the E1LB locus resulting in loss of expression of the E1LB protein and a wild-type allele at the E1, E2, E3, E4, and E1LA loci; (iii) a mutant allele of one or more of the E1, E2, E3, E4, E1LA, or E1LB loci resulting in partial expression of the one or more proteins and a mutant allele at one or more of the other of the E1, E2, E3, E4, E1LA, or E1LB loci resulting in partial expression of the one or more other proteins, wherein the combination of alleles may be selected from: a. a mutant allele at the E1 locus resulting in partial expression of the E1 protein and a mutant allele at one or more of the other of the E2, E3, E4, E1LA, and E1LB loci resulting in partial expression of the one or more other proteins; b. a mutant allele at the E2 locus resulting in partial expression of the E2 protein and a mutant allele at one or more of the other of the E1, E3, E4, E1LA, and E1LB loci resulting in partial expression of the one or more other proteins; c. a mutant allele at the E3 locus resulting in partial expression of the E3 protein and a mutant allele at one or more of the other of the E1, E2, E4, E1LA, and E1LB loci resulting in partial expression of the one or more other proteins; d. a mutant allele at the E4 locus resulting in partial expression of the E4 protein and a mutant allele at one or more of the other of the E1, E2, E3, E1LA, and E1LB loci resulting in partial expression of the one or more other proteins; e. a mutant allele at the E1LA locus resulting in partial expression of the E1LA protein and a mutant allele at one or more of the other of the E1, Docket No.83142-CN-REG-ORG-P1 E2, E3, E4, and E1LB loci resulting in partial expression of the one or more other proteins; and f. a mutant allele at the E1LB locus resulting in partial expression of the E1LB protein and a mutant allele at one or more of the other of the E1, E2, E3, E4, and E1LA loci resulting in partial expression of the one or more other proteins; (iv) a mutant allele of one or more of the E1, E2, E3, E4, E1LA, or E1LB loci resulting in loss of expression of the one or more proteins and a mutant allele at one or more of the other of the E1, E2, E3, E4, E1LA, or E1LB loci resulting in partial expression of the one or more other proteins, wherein the combination of alleles may be selected from: a. a mutant allele at the E1 locus resulting in loss of expression of the E1 protein and a mutant allele at one or more of the other of the E2, E3, E4, E1LA, and E1LB loci resulting in partial expression of the one or more other proteins; b. a mutant allele at the E2 locus resulting in loss of expression of the E2 protein and a mutant allele at one or more of the other of the E1, E3, E4, E1LA, and E1LB loci resulting in partial expression of the one or more other proteins; c. a mutant allele at the E3 locus resulting in loss of expression of the E3 protein and a mutant allele at one or more of the other of the E1, E2, E4, E1LA, and E1LB loci resulting in partial expression of the one or more other proteins; d. a mutant allele at the E4 locus resulting in loss of expression of the E4 protein and a mutant allele at one or more of the other of the E1, E2, E3, E1LA, and E1LB loci resulting in partial expression of the one or more other proteins; e. a mutant allele at the E1LA locus resulting in loss of expression of the E1LA protein and a mutant allele at one or more of the other of the E1, Docket No.83142-CN-REG-ORG-P1 E2, E3, E4, and E1LB loci resulting in partial expression of the one or more other proteins; and f. a mutant allele at the E1LB locus resulting in loss of expression of the E1LB protein and a mutant allele at one or more of the other of the E1, E2, E3, E4, and E1LA loci resulting in partial expression of the one or more other proteins; (v) a mutant allele of one or more of the E1, E2, E3, E4, E1LA, or E1LB loci resulting in partial expression of the one or more proteins and a mutant allele at one or more of the other of the E1, E2, E3, E4, E1LA, or E1LB loci resulting in loss of expression of the one or more other proteins, wherein the combination of alleles may be selected from: a. a mutant allele at the E1 locus resulting in partial expression of the E1 protein and a mutant allele at one or more of the other of the E2, E3, E4, E1LA, and E1LB loci resulting in loss of expression of the one or more other proteins; b. a mutant allele at the E2 locus resulting in partial expression of the E2 protein and a mutant allele at one or more of the other of the E1, E3, E4, E1LA, and E1LB loci resulting in loss of expression of the one or more other proteins; c. a mutant allele at the E3 locus resulting in partial expression of the E3 protein and a mutant allele at one or more of the other of the E1, E2, E4, E1LA, and E1LB loci resulting in loss of expression of the one or more other proteins; d. a mutant allele at the E4 locus resulting in partial expression of the E4 protein and a mutant allele at one or more of the other of the E1, E2, E3, E1LA, and E1LB loci resulting in loss of expression of the one or more other proteins; e. a mutant allele at the E1LA locus resulting in partial expression of the E1LA protein and a mutant allele at one or more of the other of the E1, Docket No.83142-CN-REG-ORG-P1 E2, E3, E4, and E1LB loci resulting in loss of expression of the one or more other proteins; and f. a mutant allele at the E1LB locus resulting in partial expression of the E1LB protein and a mutant allele at one or more of the other of the E1, E2, E3, E4, and E1LA loci resulting in loss of expression of the one or more other proteins; and (vi) a mutant allele of one or more of the E1, E2, E3, E4, E1LA, or E1LB loci resulting in loss of expression of the one or more proteins and a mutant allele at one or more of the other of the E1, E2, E3, E4, E1LA, or E1LB loci resulting in loss of expression of the one or more other proteins, wherein the combination of alleles may be selected from: a. a mutant allele at the E1 locus resulting in loss of expression of the E1 protein and a mutant allele at one or more of the other of the E2, E3, E4, E1LA, and E1LB loci resulting in loss of expression of the one or more other proteins; b. a mutant allele at the E2 locus resulting in loss of expression of the E2 protein and a mutant allele at one or more of the other of the E1, E3, E4, E1LA, and E1LB loci resulting in loss of expression of the one or more other proteins; c. a mutant allele at the E3 locus resulting in loss of expression of the E3 protein and a mutant allele at one or more of the other of the E1, E2, E4, E1LA, and E1LB loci resulting in loss of expression of the one or more other proteins; d. a mutant allele at the E4 locus resulting in loss of expression of the E4 protein and a mutant allele at one or more of the other of the E1, E2, E3, E1LA, and E1LB loci resulting in loss of expression of the one or more other proteins; e. a mutant allele at the E1LA locus resulting in loss of expression of the E1LA protein and a mutant allele at one or more of the other of the E1, Docket No.83142-CN-REG-ORG-P1 E2, E3, E4, and E1LB loci resulting in loss of expression of the one or more other proteins; and f. a mutant allele at the E1LB locus resulting in loss of expression of the E1LB protein and a mutant allele at one or more of the other of the E1, E2, E3, E4, and E1LA loci resulting in loss of expression of the one or more other proteins. In various embodiments: i. the wild-type E1, E1LA, E1LB, E2, E3, and E4 genes are set forth in SEQ ID NO: 7, 10, 12, 14, 18 and 23, respectively and the encoded amino acid for each is set forth in SEQ ID NO: 26, 29, 31, 33, 37, and 42; ii. the mutated E1 gene is selected from SEQ ID NO: 8 and 9 and the encoded amino acid for each is set forth in SEQ ID NO: 27 and 28, respectively; iii. the mutated E1LA gene is set forth in SEQ ID NO: 11 and the encoded amino acid is set forth in SEQ ID NO: 30; iv. the mutated E1LB gene is set forth in SEQ ID NO: 13 and the encoded amino acid is set forth in SEQ ID NO: 32; v. the mutated E2 gene is selected from SEQ ID NO: 15, 16 and 17 and the encoded amino acid for each is set forth in SEQ ID NO: 34, 35, and 36, respectively; vi. the mutated E3 gene is selected from SEQ ID NO: 19, 20, 21, and 22 and the encoded amino acid for each is set forth in SEQ ID NO: 38, 39, 40, and 41, respectively; and vii. the mutated E4 gene is selected from SEQ ID NO: 24, 25, 74, 75, and 76 and the encoded amino acid for each is set forth in SEQ ID NO: 43, 44, 77, 78, and 79, respectively. The flowering time of a soybean plant comprising any of the above-mentioned allelic combinations is modified relative to a control plant. In particular embodiments, the Docket No.83142-CN-REG-ORG-P1 control plant comprises a wild-type allele at each of E1, E2, E3, E4, E1LA, and E1LB. In other embodiments, the control plant comprises a wild-type allele at the corresponding loci of any mutated allele, optionally wherein the other alleles of the invention are either mutated or wild-type. As used herein, protein activity refers to the effect of the referenced protein on flowering time and / or maturity time. Alleles resulting in a complete loss of function encode a mutated protein having no effect on flowering / maturity time. Alleles resulting in a partial loss of function encode a mutated protein having reduced effects on flowering / maturity time relative to the wild type, unmutated protein. The present invention discloses novel E1, E2, E3, E4, E1LA, and E1LB alleles created using mutagenesis and genome editing techniques. The novel alleles are created using deletion and / or substitution of bases at positions identified corresponding to the wild-type allele. The term “corresponding to” in the context of nucleic acid sequences or amino acid sequences means that when the nucleic acid sequences or amino acid sequences are aligned with each other, the nucleic acids that “correspond to” certain enumerated positions in the present invention are those that align with these positions in a reference sequence, but that are not necessarily in these exact numerical positions relative to a particular nucleic acid or amino acid sequence of the invention. For example, an E2 allele generated via a mutation comprising a nucleotide coding sequence has a 14bp deletion of positions 81-94 relative to SEQ ID NO: 14 means that when the nucleotide sequence of the wild-type allele (SEQ ID NO: 14) is aligned with the nucleotide sequence of the mutant allele (SEQ ID NO: 16), there is a 14bp base pair gap at positions 81-94 of the wild-type sequence. In this example, the mutant allele overlaps with the wild-type allele at positions before, but not including position 81, as well as overlapping at positions after, but not including position 94. In Docket No.83142-CN-REG-ORG-P1 another example, an E3 mutant having a 256-bp deletion and a 5-bp insertion within positions 158-413 relative to SEQ ID NO: 18 means that the nucleotides corresponding to positions 158-413 in SEQ ID NO: 18 are deleted in the mutated E3 (SEQ ID NO: 20) and a 5bp insertion has been made between nucleotide positions 157 and 414 relative to SEQ NO: 18. In this example, the mutant and wild-type E3 nucleotide sequences overlap at positions before, but not including position 158, and overlap at the positions after, but not including position 413, and a 5bp insertion has been made in mutant allele after position 157. Optimal alignment of sequences for comparison can be conducted by computerized implementations of known algorithms. or by visual inspection. Readily available sequence comparison and multiple sequence alignment algorithms are, respectively, the Basic Local Alignment Search Tool (BLAST) and ClustalW / ClustalW2 / Clustal Omega programs available on the Internet (e.g., the website of the EMBL-EBI). Other suitable programs include, but are not limited to, GAP, BestFit, Plot Similarity, and FASTA, which are part of the Accelrys GCG Package available from Accelrys, Inc. of San Diego, Calif., United States of America. See also Smith & Waterman, 1981; Needleman & Wunsch, 1970; Pearson & Lipman, 1988; Ausubel et al., 1988; and Sambrook & Russell, 2001. In some embodiments, the alleles result in variants and fragments of the above- described E1, E2, E3, E4, E1LA, or E1LB proteins and the variants and fragments result in a modified flowering time profile when expressed in a plant, plant part, or seed. Alleles that result in fragments of the E1, E2, E3, E4, E1LA, or E1LB proteins that modify flowering time profile when expressed in a plant, plant part, or seed include those that are shorter than the full-length sequences, either due to the use of an alternate downstream start site, or due to processing that produces a shorter protein Docket No.83142-CN-REG-ORG-P1 having the activity. An allele encoding a fragment of a protein that modifies flowering time profile when expressed in a plant can be a polypeptide that is, for example, 10, 25, 50, 100, 150, 200, 250 or more amino acids in length of any one of SEQ ID NOS: 27, 28, 30, 32, 34, 35, 36, 38, 39, 40, 41, 43, 44, 77, 78, or 79. As used herein, a fragment comprises at least 8 contiguous amino acids of SEQ ID NO: 27, 28, 30, 32, 34, 35, 36, 38, 39, 40, 41, 4344, 77, 78, or 79. Unless otherwise stated, identity and similarity will be calculated by the Needleman- Wunsch global alignment and scoring algorithms (Needleman and Wunsch (1970) J. Mol. Biol.48(3):443-453) as implemented by the "needle" program, distributed as part of the EMBOSS software package (Rice, P., Longden, I., and Bleasby, A., EMBOSS: The European Molecular Biology Open Software Suite, 2000, Trends in Genetics 16, (6) pp276-277, versions 6.3.1 available from EMBnet at embnet.org / resource / emboss and emboss.sourceforge.net, among other sources) using default gap penalties and scoring matrices (EBLOSUM62 for protein and EDNAFULL for DNA). Equivalent programs may also be used. By "equivalent program" is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by needle from EMBOSS version 6.3.1. Additional mathematical algorithms are known in the art and can be utilized for the comparison of two sequences. See, for example, the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877. Such an algorithm is incorporated into the BLAST programs of Altschul et al. (1990) J. Mol. Biol.215:403. BLAST nucleotide searches can be performed with the BLASTN program (nucleotide query searched against nucleotide sequences) to obtain nucleotide sequences homologous to nucleic acid molecules of the invention, or with the BLASTX program (translated Docket No.83142-CN-REG-ORG-P1 nucleotide query searched against protein sequences) to obtain protein sequences homologous to nucleic acid molecules of the invention. BLAST protein searches can be performed with the BLASTP program (protein query searched against protein sequences) to obtain amino acid sequences homologous to protein molecules of the invention, or with the TBLASTN program (protein query searched against translated nucleotide sequences) to obtain nucleotide sequences homologous to protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST (in BLAST 2.0) can be utilized as described in Altschul et al. (1997) Nucleic Acids Res.25:3389. Alternatively, PSI-Blast can be used to perform an iterated search that detects distant relationships between molecules. See Altschul et al. (1997) supra. When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the respective programs (e.g., BLASTX and BLASTN) can be used. Alignment may also be performed manually by inspection. Two sequences are "optimally aligned" when they are aligned for similarity scoring using a defined amino acid or nucleotide substitution matrix (e.g., BLOSUM62), gap existence penalty and gap extension penalty so as to arrive at the highest score possible for that pair of sequences. Amino acid substitution matrices and their use in quantifying the similarity between two sequences are well-known in the art and described, e.g., in Dayhoff et al. (1978) "A model of evolutionary change in proteins." In "Atlas of Protein Sequence and Structure," Vol.5, Suppl.3 (ed. M. O. Dayhoff), pp.345-352. Natl. Biomed. Res. Found., Washington, D.C. and Hemkoff et al. (1992) Proc. Natl. Acad. Sci. USA 89: 10915-10919. The BLOSUM62 matrix is often used as a default scoring substitution matrix in sequence alignment protocols. The gap existence penalty is imposed for the introduction of a single amino acid gap in one of the aligned sequences, and the gap extension penalty is imposed for each additional empty amino acid position inserted into an already opened gap. The alignment is defined by the amino acid positions of each sequence at which the alignment begins and ends, and optionally by the insertion of a gap or multiple gaps in one or both Docket No.83142-CN-REG-ORG-P1 sequences, so as to arrive at the highest possible score. While optimal alignment and scoring can be accomplished manually, the process is facilitated by the use of a computer-implemented alignment algorithm, e.g., gapped BLAST 2.0, described in Altschul et al. (1997) Nucleic Acids Res.25:3389-3402, and made available to the public at the National Center for Biotechnology Information Website (www.ncbi.nlm.nih.gov). Optimal alignments, including multiple alignments, can be prepared using, e.g., PSI- BLAST, available through www.ncbi.nlm.nih.gov and described by Altschul et al. (1997) Nucleic Acids Res.25:3389-3402. II. Gene editing The flowering time associated sequences provided herein, that is E1, E2, E3, E4, E1LA, or E1LB, can be targeted within the genome of a recipient plant cell to create the novel allele sequences. Such methods include, but are not limited to, meganucleases designed against the plant genomic sequence of interest CRISPR- Cas9, TALENs, and other technologies for precise editing of genomes (Feng, et al. Cell Research 23: 1229-1232, 2013, WO 2013 / 026740); Cre-lox site-specific recombination; FLP-FRT recombination (Li et al. (2009) Plant Physiol 151:1087- 1095); Bxbl -mediated integration (Yau et al. Plant J (2011) 701: 147-166); zinc- finger mediated integration (Wright et al. (2005) Plant J 44:693-705); Cai et al. (2009) Plant Mol Biol 69:699-709); and homologous recombination (Lieberman-Lazarovich and Levy (2011) Methods Mol Biol : 51-65); prime editing and transposases (Anzalone, A. et al., Nat Biotechnol.2020 Jul;38(7):824-844); translocation; and inversion. Various embodiments of the methods described herein use gene editing. In some embodiments, gene editing is used to mutagenize the genome of a plant to produce plants having novel alleles at the E1, E2, E3, E4, E1LA, and / or E1LB loci that confer a modified flowering time. The novel alleles may be created by targeted introduction of mutations in the genome of a plant at the E1, E2, E3, E4, E1LA, or E1LB loci. Docket No.83142-CN-REG-ORG-P1 Editing may be achieved through the use of editing expression cassettes. The expression cassette will include in the 5'-3' direction of transcription, a transcriptional and translational initiation region (i.e., a promoter), a polynucleotide of interest, and a transcriptional and translational termination region (i.e., termination region) functional in the organism of interest, i.e., a plant or bacteria. The promoters of the invention are capable of directing or driving transcription and expression of a coding sequence in a host cell. The regulatory regions (i.e., promoters, transcriptional regulatory regions, and translational termination regions) may be endogenous or heterologous to the host cell or to each other. As used herein, a chimeric gene or a chimeric nucleic acid molecule comprises a coding sequence operably linked to a transcription initiation region that is heterologous to the coding sequence. A variety of transcriptional terminators are available for use in expression cassettes. These are responsible for the termination of transcription beyond the transgene and correct mRNA polyadenylation. The termination region may be native with the transcriptional initiation region, may be native with the operably linked DNA sequence of interest, may be native with the plant host, or may be derived from another source (i.e., foreign or heterologous to the promoter, the DNA sequence of interest, the plant host, or any combination thereof). Appropriate transcriptional terminators are those that are known to function in plants and include the CAMV pSOY1 terminator, the tml terminator, the nopaline synthase terminator and the pea rbcs E9 terminator. These can be used in both monocotyledons and dicotyledons. In addition, a gene's native transcription terminator may be used. Termination regions used in the expression cassettes can be obtained from, e.g., the Ti-plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions. See also Guerineau et al. (1991) Mol. Gen. Genet.262: 141-144; Proudfoot (1991) Cell 64:671-674; Sanfacon et al. (1991) Genes Dev.5: 141-149; Mogen et al. (990) Plant Cell 2: 1261-1272; Munroe et al. (1990) Gene 91: 151-158; Ballas et al. (1989) Docket No.83142-CN-REG-ORG-P1 Nucleic Acids Res.17:7891-7903; and Joshi et al. (1987) Nucleic Acids Res. 15:9627-9639. Additional regulatory signals include, but are not limited to, transcriptional initiation start sites, operators, activators, enhancers, other regulatory elements, ribosomal binding sites, an initiation codon, termination signals, and the like. See, for example, U. S. Pat. Nos.5,039,523 and 4,853,331; EPO 0480762A2; Sambrook et al. (1992) Molecular Cloning: A Laboratory Manual, ed. Maniatis et al. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), hereinafter “Sambrook 11”; Davis et al, eds. (1980). In preparing the expression cassette, the various DNA fragments may be manipulated, so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame. Toward this end, adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites, or the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g., transitions and transversions, may be involved. A number of promoters can be used in the practice of the invention. The promoters can be selected based on the desired outcome. The nucleic acids can be combined with constitutive, inducible, tissue-preferred, or other promoters for expression in the organism of interest. See, for example, promoters set forth in WO 99 / 43838 and in US Patent Nos: 8,575,425; 7,790,846; 8,147,856; 8,586832; 7,772,369; 7,534,939; 6,072,050; 5,659,026; 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,611; herein incorporated by reference. In some embodiments, the promoter used herein comprises an exogenous promoter. The term “exogenous promoter,” refers to a promoter that is not found in plants in nature, for example, a synthetic promoter. Docket No.83142-CN-REG-ORG-P1 In some embodiments, provided herein are plants transformed with and expressing gene-editing machinery as described above, which, when crossed with a target plant, result in gene editing in the target plant. In general, gene editing may involve transient, inducible, or constitutive expression of the gene editing components or systems. Gene editing may involve genomic integration or episomal presence of the gene editing components or systems. Gene editing generally refers to the use of a site-directed nuclease (including but not limited to CRISPR / Cas, zinc fingers, meganucleases, and the like) to cut a nucleotide sequence at a desired location. This may be to cause an insertion / deletion (“indel”) mutation, (i.e., “SDN1”), a base edit (i.e., “SDN2”), or allele insertion or replacement (i.e., “SDN3”). SDN2 or SDN3 gene editing may comprise the provision of one or more recombination templates (e.g., in a vector) comprising a gene sequence of interest that can be used for homology directed repair (HDR) within the plant (i.e., to be introduced into the plant genome). In some embodiments, the gene or allele of interest is one that is able to confer to the plant an improved trait, e.g., modified flowering time profile. The recombination template can be introduced into the plant to be edited either through transformation or through breeding with a donor plant comprising the recombination template. Breaks in the plant genome may be introduced within, upstream, and / or downstream of a target sequence. In some embodiments, a double strand DNA break is made within or near the target sequence locus. In some embodiments, breaks are made upstream and downstream of the target sequence locus, which may lead to its excision from the genome. In some embodiments, one or more single strand DNA breaks (nicks) are made within, upstream, and / or downstream of the target sequence (e.g., using a nickase Cas9 variant). Any of these DNA breaks, as well as those introduced via other methods known to one of skill in the art, may induce HDR. Through HDR, the target sequence Docket No.83142-CN-REG-ORG-P1 is replaced by the sequence of the provided recombination template comprising an allele of interest, e.g., SEQ ID NOS: 7, 10, 12, 14, 18 or 23, or a polynucleotide encoding a polypeptide having the sequence of any one of SEQ ID NOS: 26, 29, 31, 33, 37 and 42 may be provided on / as a template. By designing the system such that one or more single strand or double strand breaks are introduced within, upstream, and / or downstream of the corresponding region in the genome of a plant not comprising the gene sequence of interest, this region can be replaced with the template. In embodiments, the site directed nuclease is selected from the group consisting of meganucleases (MNs), zinc-finger nucleases (ZFNs), transcription- activator like effector nucleases (TALENs), Cas9 nuclease, Cfp1 nuclease, dCas9-Fokl, dCpf1 - Fokl, chimeric Cas9-cytidine deaminase, chimeric Cas9-adenine deaminase, chimeric FEN1 -Fokl, and Mega- TALs, a nickase Cas9 (nCas9), chimeric dCas9 non-Fokl nuclease and dCpfl non-Fokl nuclease. In embodiments, the editing is performed by transforming a plant cell with an expression cassette comprising (i) a nucleic acid that encodes the site-directed nuclease; and (ii) a nucleic acid that encodes at least one guide RNA (gRNA) directed to a target sequence. In embodiments of the editing expression cassette, the nucleic acid that encodes the site-directed nuclease is operably linked to a first promoter while the nucleic acid that encodes the at least one gRNA is operably linked to a second promoter, which may be the same or different from the first promoter. In some embodiments, the expression cassette may further comprise one or more additional regulatory elements, such as an enhancer operably linked to the first promoter or the second promoter. In some embodiments, mutations in the genes or wild-type alleles of interest described herein may be generated without the use of a recombination template via Docket No.83142-CN-REG-ORG-P1 targeted introduction of DNA double strand breaks. Such breaks may be repaired through the process of non-homologous end joining (NHEJ), which can result in the generation of small insertions or deletions (indels) at the repair site. Such indels may lead to frameshift mutations causing premature stop codons or other types of loss-of- function mutations in the targeted genes. In some embodiments, gene editing may involve transient, inducible, or constitutive expression of the gene editing components or systems in the target plant. Gene editing may also involve genomic integration or episomal presence of the gene editing components or systems in the target plant. In certain embodiments, the nucleic acid modification or mutation is effected by a (modified) zinc-finger nuclease (ZFN) system. The ZFN system uses artificial restriction enzymes generated by fusing a zinc finger DNA-binding domain to a DNA-cleavage domain that can be engineered to target desired DNA sequences. Exemplary methods of genome editing using ZFNs can be found for example in U.S. Patent Nos.6,534,261; 6,607,882; 6,746,838; 6,794,136; 6,824,978; 6,866,997; 6,933,113; and 6,979,539. In certain embodiments, the nucleic acid modification is effected by a (modified) meganuclease, which are endodeoxyribonucleases characterized by a large recognition site (double-stranded DNA sequences of 12 to 40 base pairs). Exemplary method for using meganucleases can be found in US Patent Nos: 8,163,514; 8,133,697; 8,021,867; 8,119,361; 8,119,381; 8,124,369; and 8,129,134, which are specifically incorporated by reference. In certain embodiments, the nucleic acid modification is effected by a (modified) CRISPR / Cas complex or system. In certain embodiments, the CRISPR / Cas system or complex is a class 2 CRISPR / Cas system. In certain embodiments, said CRISPR / Cas Docket No.83142-CN-REG-ORG-P1 system or complex is a type II, type V, or type VI CRISPR / Cas system or complex. The CRISPR / Cas system does not require the generation of customized proteins to target specific sequences but rather a single Cas protein can be programmed by an RNA guide (gRNA) to recognize a specific nucleic acid target, in other words the Cas enzyme protein can be recruited to a specific nucleic acid target locus (which may comprise or consist of RNA and / or DNA) of interest using said short RNA guide. In general, the CRISPR / Cas or CRISPR system is as used herein foregoing documents refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene and one or more of, a tracr (trans-activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a“spacer” in the context of an endogenous CRISPR system), or“RNA(s)” as that term is herein used (e.g., RNA(s) to guide Cas, such as Cas9, e.g. CRISPR RNA and, where applicable, transactivating (tracr) RNA or a single guide RNA (sgRNA) (chimeric RNA)) or other sequences and transcripts from a CRISPR locus. In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system). In the context of formation of a CRISPR complex, “target sequence” refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. In certain embodiments, the gRNA is a chimeric guide RNA or single guide RNA (sgRNA). In certain embodiments, the gRNA comprises a guide sequence and a tracr mate sequence (or direct repeat). In certain embodiments, the gRNA comprises a guide sequence, a tracr mate sequence (or direct repeat), and a tracr sequence. In certain embodiments, the CRISPR / Cas system or complex as described herein does Docket No.83142-CN-REG-ORG-P1 not comprise and / or does not rely on the presence of a tracr sequence (e.g. if the Cas protein is Cas12a). The Cas protein as referred to herein, such as but not limited to Cas9, Cas12a (formerly referred to as Cpf1), Cas12b (formerly referred to as C2c1), Cas13a (formerly referred to as C2c2), C2c3, Cas13b protein, may originate from any suitable source, and hence may include different orthologues, originating from a variety of (prokaryotic) organisms, as is well documented in the art. In certain embodiments, the Cas protein is (modified) Cas9, preferably (modified) Staphylococcus aureus Cas9 (SaCas9) or (modified) Streptococcus pyogenes Cas9 (SpCas9). In certain embodiments, the Cas protein is Cas12a, optionally from Acidaminococcus sp., such as Acidaminococcus sp. BV3L6 Cpf1 (AsCas12a) or Lachnospiraceae bacterium Cas12a , such as Lachnospiraceae bacterium MA2020 or Lachnospiraceae bacterium MD2006 (LBCas12a). See U.S. Pat. No.10,669,540, incorporated herein by reference in its entirety. Alternatively, the Cas12a protein may be from Moraxella bovoculi AAX08_00205 [Mb2Cas12a] or Moraxella bovoculi AAX11_00205 [Mb3Cas12a]. See WO 2017 / 189308, incorporated herein by reference in its entirety. In certain embodiments, the Cas protein is (modified) C2c2, preferably Leptotrichia wadei C2c2 (LwC2c2) or Listeria newyorkensis FSL M6-0635 C2c2 (LbFSLC2c2). In certain embodiments, the (modified) Cas protein is C2c1. In certain embodiments, the (modified) Cas protein is C2c3. In certain embodiments, the (modified) Cas protein is Cas13b. Other Cas enzymes are available to a person skilled in the art. Gene editing methods and compositions are also disclosed in US Pat. Nos.10,519,456 and 10,285,34882, the entire content of which is herein incorporated by reference. The gene-editing machinery (e.g., the DNA modifying enzyme) introduced into the plants can be controlled by any promoter that can drive recombinant gene expression in plants. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is a tissue-specific promoter, e.g., a pollen-specific Docket No.83142-CN-REG-ORG-P1 promoter or a sperm cell specific promoter, a zygote specific promoter, or a promoter that is highly expressed in sperm, eggs and zygotes (e.g., prOsActin1). Suitable promoters are disclosed in U.S. Pat. No.10,519,456, the entire content of which is herein incorporated by reference. In another aspect, provided herein is a method of editing plant genomic DNA. In some embodiments, the method comprises using a first soybean plant expressing a DNA modification enzyme and at least one optional guide nucleic acid as described above to pollinate a target plant comprising genomic DNA to be edited. In some embodiments, the method of creating novel alleles and allelic combinations comprises, editing, via a site directed nuclease, at one or more of an E1, E2, E3, E4, E1La and / or an E1Lb locus of a genome of a soybean plant. III. Selection of plants with novel alleles and improved traits. In addition to the phenotypic traits, the genetic characteristic of the plant as represented by its genetic marker profile can be used to select plants of desired traits. The term “marker-based selection” refers to the use of genetic markers to detect one or more nucleic acids from the plant, where the nucleic acid is associated with a desired trait to identify plants that carry genes or alleles for desirable (or undesirable) traits. Markers include but are not limited to Restriction Fragment Length Polymorphisms (RFLPs), Randomly Amplified Polymorphic DNAs (RAPDs), Arbitrarily Primed Polymerase Chain Reaction (AP-PCR), DNA Amplification Fingerprinting (DAF), Sequence Characterized Amplified Regions (SCARs), Amplified Fragment Length Polymorphisms (AFLPs), Simple Sequence Repeats (SSRs) which are also referred to as Microsatellites, and Single Nucleotide Polymorphisms (SNPs). There are known sets of public markers that are being examined by ASTA and other industry groups for their applicability in standardizing determinations of what constitutes an essentially derived variety under the US Plant Docket No.83142-CN-REG-ORG-P1 Variety Protection Act. However, these standard markers do not limit the type of marker and marker profile which can be employed in breeding or developing backcross conversions, or in distinguishing varieties or plant parts or plant cells or verify a progeny pedigree. Primers and PCR protocols for assaying these and other markers are disclosed in the Soybase (sponsored by the USDA Agricultural Research Service and Iowa State University) located at the world wide web at 129.186.26.94 / SSR.html. The term “associated with” as used herein refers to a recognizable and / or detectable relationship between two entities. For example, the phrase “associated with modified flowering time” refers to a trait, locus, gene, allele, marker, phenotype, etc., or the expression product thereof, the presence or absence of which can influence or indicate an extent and / or degree to which a plant or its progeny exhibits a change in its flowering time and / or maturity value as compared to a control plant. As such, a marker is “associated with” a trait when it is linked to it and when the presence of the marker is an indicator of whether and / or to what extent the desired trait or trait form will occur in a plant / germplasm comprising the marker. Similarly, a marker is “associated with” an allele when it is linked to it and when the presence (or absence) of the marker is an indicator of whether the allele is present (or absent) in a plant, germplasm, or population comprising the marker. For example, “a marker associated with a novel E1, E2, E3, E4, E1LA, or E1LB allele that confers a modified flowering time profile” refers to a marker whose presence or absence can be used to determine whether the novel allele is present in a plant, and / or to what extent the plant will display an alteration in the flowering time as compared to a control plant. The term “allele(s)” refer to any of one or more alternative forms of a gene, all of which relate to at least one trait or characteristic. In a diploid cell, the two alleles of a given gene occupy corresponding loci on a pair of homologous chromosomes. Docket No.83142-CN-REG-ORG-P1 The term “genotype” and variants thereof refer to the genetic composition of an organism, including, for example, whether a diploid organism is heterozygous (i.e., has two different alleles for a given gene or QTL) or homozygous (i.e., has the same allele for a given gene or QTL) for one or more genes or loci (e.g., a SNP, a haplotype, a gene mutation, an insertion, or a deletion). In one embodiment, the markers used to identify the plants comprising the alleles disclosed herein are SNPs. Non-limiting examples of SNP genotyping methods include hybridization, primer extension, oligonucleotide ligation, nuclease cleavage, minisequencing and coded spheres. Such methods are well known and disclosed in e.g., Gut, I.G., Hum. Mutat.17: 475-492 (2001); Shi, Clin. Chem.47(2): 164-172 (2001); Kwok, Pharmacogenomics 1(1): 95-100 (2000); and Bhattramakki and Rafalski, Discovery and application of single nucleotide polymorphism markers in plants, in PLANT GENOTYPING: THE DNA FINGERPRINTING OF PLANTS, CABI Publishing, Wallingford (2001). A wide range of commercially available technologies utilize these and other methods to interrogate SNPs, including Masscode SupTM / Sup (Qiagen, Germantown, MD, (Hologic, Madison, WI), (Applied Biosystems, Foster City, CA), (Applied Biosystems, Foster City, CA) and Beadarrays SupTM / Sup (Illumina, San Diego, CA). In some embodiments, an assay (e.g., generally a two-step allelic discrimination assay or similar), a KASP SupTM / Sup assay (generally a one-step allelic discrimination assay defined below or similar), or both can be employed to identify the SNPs that associate with modified flowering time profile. In an exemplary two-step assay, a forward primer, a reverse primer, and two assay probes that recognize two different alleles at the SNP site (or hybridization oligos) are employed. The forward and reverse primers are employed to amplify genetic loci that comprise SNPs that are associated with modified flowering time (FT) profile. The particular nucleotides that are present at the SNP positions are then assayed using the probes. In some Docket No.83142-CN-REG-ORG-P1 embodiments, the assay probes and the reaction conditions are designed such that an assay probe will only hybridize to the reverse complement of a 100% perfectly matched sequence, thereby permitting identification of which allele (s) that are present based upon detection of hybridizations. In some embodiments, the probes are differentially labeled with, for example, fluorophores to permit distinguishing between the two assay probes in a single reaction. Exemplary methods of amplifying include employing a polymerase chain reaction (PCR) or ligase chain reaction (LCR) using a nucleic acid isolated from a soybean plant or germplasm as a template in the PCR or LCR. In some embodiments, a number of SNP alleles together within a sequence, or across linked sequences, can be used to describe a haplotype for any particular genotype. Ching et al., BMC Genet.3: 19 (2002) (14 pages); Gupta et al., (2001) Curr Sci. 80:524–535, Rafalski, Plant Sci.162: 329-333 (2002). In some cases, haplotypes can be more informative than single SNPs and can be more descriptive of any particular genotype. For example, a single SNP may be allele “T” for a specific disease resistant line or variety, but the allele “T” might also occur in the soybean breeding population being utilized for recurrent parents. In this case, a combination of alleles at linked SNPs may be more informative. Once a unique haplotype has been assigned to a donor chromosomal region, that haplotype can be used in that population or any subset thereof to determine whether an individual has a particular gene. The use of automated high throughput marker detection platforms known to those of ordinary skill in the art makes this process highly efficient and effective. These SNP markers can be used in a marker assisted breeding program to move traits, such as native traits or traits conferred by transgenes or traits conferred by genome editing, into a desired plant background. As used herein, the term “native trait” refers to a trait already existing in germplasm, including wild relatives of crop species, or that can be produced by recombination of existing traits. For example, progeny plants Docket No.83142-CN-REG-ORG-P1 from a cross between a donor soybean plant comprising in its genome a nucleic acid sequence encoding the alleles of SEQ ID NOS: 8, 9, 11, 13, 15, 16, 17, 19, 20, 21, 22, 24, 25, 74, 75, or 76 and a recipient soybean plant not comprising said nucleic acid sequence can be screened to detect the presence of the markers associated with modified FT profile. Plants comprising said markers can be selected and verified for modified FT profile as compared to control plants. IV. Plant Transformation Once the gene editing cassette has been cloned into an expression system, it is transformed into a plant cell. The receptor and target expression cassettes of the present invention can be introduced into the plant cell in a number of art-recognized ways. The term “introducing” in the context of a polynucleotide, for example, a nucleotide construct of interest, is intended to mean presenting to the plant the polynucleotide in such a manner that the polynucleotide gains access to the interior of a cell of the plant. Where more than one polynucleotide is to be introduced, these polynucleotides can be assembled as part of a single nucleotide construct, or as separate nucleotide constructs, and can be located on the same or different transformation vectors. Accordingly, these polynucleotides can be introduced into the host cell of interest in a single transformation event, in separate transformation events, or, for example, in plants, as part of a breeding protocol. The methods of the invention do not depend on a particular method for introducing one or more polynucleotides into a plant, only that the polynucleotide(s) gains access to the interior of at least one cell of the plant. Methods for introducing polynucleotides into plants are known in the art including, but not limited to, transient transformation methods, stable transformation methods, and virus-mediated methods. “Transient transformation” in the context of a polynucleotide is intended to mean that a polynucleotide is introduced into the plant and does not integrate into the genome of the plant. Docket No.83142-CN-REG-ORG-P1 By “stably introducing” or “stably introduced” in the context of a polynucleotide introduced into a plant is intended the introduced polynucleotide is stably incorporated into the plant genome, and thus the plant is stably transformed with the polynucleotide. “Stable transformation” or “stably transformed” is intended to mean that a polynucleotide, for example, a nucleotide construct described herein, introduced into a plant integrates into the genome of the plant and is capable of being inherited by the progeny thereof, more particularly, by the progeny of multiple successive generations. Numerous transformation vectors available for plant transformation are known to those of ordinary skill in the plant transformation arts, and the genes pertinent to this invention can be used in conjunction with any such vectors. The selection of vector will depend upon the preferred transformation technique and the target species for transformation. For certain target species, different antibiotic or herbicide selection markers may be preferred. Selection markers used routinely in transformation include the nptll gene, which confers resistance to kanamycin and related antibiotics (Messing & Vierra Gene 19: 259-268 (1982); Bevan et al., Nature 304:184-187 (1983)), the pat and bar genes, which confer resistance to the herbicide glufosinate (also called phosphinothricin; see White et al., Nucl. Acids Res 18: 1062 (1990), Spencer et al. Theor. Appl. Genet 79: 625-631 (1990) and U.S. Pat. Nos.5,561,236 and 5,276,268), the hph gene, which confers resistance to the antibiotic hygromycin (Blochinger & Diggelmann, Mol. Cell Biol.4: 2929-2931), and the dhfr gene, which confers resistance to methatrexate (Bourouis et al., EMBO J.2(7): 1099-1104 (1983)), the EPSPS gene, which confers resistance to glyphosate (U.S. Pat. Nos.4,940,935 and 5,188,642), the glyphosate N-acetyltransferase (GAT) gene, which also confers resistance to glyphosate (Castle et al. (2004) Science, 304:1151-1154; U.S. Patent App. Pub. Nos.20070004912, 20050246798, and 20050060767); and the mannose-6- Docket No.83142-CN-REG-ORG-P1 phosphate isomerase gene, which provides the ability to metabolize mannose (U.S. Pat. Nos.5,767,378 and 5,994,629). Methods for regeneration of plants are also well known in the art. For example, Ti plasmid vectors have been utilized for the delivery of foreign DNA, as well as direct DNA uptake, liposomes, electroporation, microinjection, and microprojectiles. In addition, bacteria from the genus Agrobacterium can be utilized to transform plant cells. Below are descriptions of representative techniques for transforming both dicotyledonous and monocotyledonous plants, as well as a representative plastid transformation technique. Many vectors are available for transformation using Agrobacterium tumefaciens. These typically carry at least one T-DNA border sequence and include vectors such as pBIN19 (Bevan, Nucl. Acids Res. (1984)). For the construction of vectors useful in Agrobacterium transformation, see, for example, US Patent Application Publication No.2006 / 0260011, herein incorporated by reference. Transformation without the use of Agrobacterium tumefaciens circumvents the requirement for T-DNA sequences in the chosen transformation vector and consequently vectors lacking these sequences can be utilized in addition to vectors such as the ones described above which contain T-DNA sequences. Transformation techniques that do not rely on Agrobacterium include transformation via particle bombardment, protoplast uptake (e.g. PEG and electroporation) and microinjection. The choice of vector depends largely on the preferred selection for the species being transformed. For the construction of such vectors, see, for example, US Application No.20060260011, herein incorporated by reference. Transformation techniques for dicotyledons are well known in the art and include Agrobacterium-based techniques and techniques that do not require Agrobacterium. Docket No.83142-CN-REG-ORG-P1 Non-Agrobacterium techniques involve the uptake of exogenous genetic material directly by protoplasts or cells. This can be accomplished by PEG or electroporation mediated uptake, particle bombardment-mediated delivery, or microinjection. Examples of these techniques are described by Paszkowski et al., EMBO J.3: 2717- 2722 (1984), Potrykus et al., Mol. Gen. Genet.199: 169-177 (1985), Reich et al., Biotechnology 4: 1001-1004 (1986), and Klein et al., Nature 327: 70-73 (1987). In each case the transformed cells are regenerated to whole plants using standard techniques known in the art. Agrobacterium-mediated transformation is a preferred technique for transformation of dicotyledons because of its high efficiency of transformation and its broad utility with many different species. Agrobacterium transformation typically involves the transfer of the binary vector carrying the foreign DNA of interest (e.g. pCIB200 or pCIB2001) to an appropriate Agrobacterium strain which may depend of the complement of vir genes carried by the host Agrobacterium strain either on a co-resident Ti plasmid or chromosomally (e.g. strain CIB542 for pCIB200 and pCIB2001 (Uknes et al. Plant Cell 5: 159-169 (1993)). The transfer of the recombinant binary vector to Agrobacterium is accomplished by a triparental mating procedure using E. coli carrying the recombinant binary vector, a helper E. coli strain which carries a plasmid such as pRK2013 and which is able to mobilize the recombinant binary vector to the target Agrobacterium strain. Alternatively, the recombinant binary vector can be transferred to Agrobacterium by DNA transformation (Hofgen & Willmitzer, Nucl. Acids Res.16: 9877 (1988)). Transformation of the target plant species by recombinant Agrobacterium usually involves co-cultivation of the Agrobacterium with explants from the plant and follows protocols well known in the art. Transformed tissue is regenerated on selectable medium carrying the antibiotic marker present between the binary plasmid T-DNA borders. Docket No.83142-CN-REG-ORG-P1 Another approach to transforming plant cells with a gene involves propelling inert or biologically active particles at plant tissues and cells. This technique is disclosed in U.S. Pat. Nos.4,945,050, 5,036,006, and 5,100,792 all to Sanford et al. Generally, this procedure involves propelling inert or biologically active particles at the cells under conditions effective to penetrate the outer surface of the cell and afford incorporation within the interior thereof. When inert particles are utilized, the vector can be introduced into the cell by coating the particles with the vector containing the desired gene. Alternatively, the target cell can be surrounded by the vector so that the vector is carried into the cell by the wake of the particle. Biologically active particles (e.g., dried yeast cells, dried bacterium or a bacteriophage, each containing DNA sought to be introduced) can also be propelled into plant cell tissue. Transformation of most monocotyledon species has now also become routine. Preferred techniques include direct gene transfer into protoplasts using PEG or electroporation techniques, and particle bombardment into callus tissue. Transformations can be undertaken with a single DNA species or multiple DNA species (i.e. co-transformation) and both of these techniques are suitable for use with this invention. Co-transformation may have the advantage of avoiding complete vector construction and of generating transgenic plants with unlinked loci for the gene of interest and the selectable marker, enabling the removal of the selectable marker in subsequent generations, should this be regarded desirable. However, a disadvantage of the use of co-transformation is the less than 100% frequency with which separate DNA species are integrated into the genome (Schocher et al. Biotechnology 4: 1093- 1096 (1986)). Patent Applications EP 0292435, EP 0392225, and WO 93 / 07278 describe techniques for the preparation of callus and protoplasts from an elite inbred line of maize, transformation of protoplasts using PEG or electroporation, and the regeneration of maize plants from transformed protoplasts. Gordon-Kamm et al. Docket No.83142-CN-REG-ORG-P1 (Plant Cell 2: 603-618 (1990)) and Fromm et al. (Biotechnology 8: 833-839 (1990)) have published techniques for transformation of A188-derived maize line using particle bombardment. Furthermore, WO 93 / 07278 and Koziel et al. (Biotechnology 11: 194-200 (1993)) describe techniques for the transformation of elite inbred lines of maize by particle bombardment. This technique utilizes immature maize embryos of 1.5-2.5 mm length excised from a maize ear 14-15 days after pollination and a PDS- 1000He Biolistics device for bombardment. Transformation of monocotyledons using Agrobacterium has also been described. See, WO 94 / 00977 and U.S. Pat. No.5,591,616, both of which are incorporated herein by reference. See also, Negrotto et al., Plant Cell Reports 19: 798-803 (2000), incorporated herein by reference. The genetic properties engineered into the genome-edited or transgenic seeds and plants described above are passed on by sexual reproduction or vegetative growth and can thus be maintained and propagated in progeny plants. Generally, maintenance and propagation make use of known agricultural methods developed to fit specific purposes such as tilling, sowing or harvesting. Use of the advantageous genetic properties of the genome-edited or transgenic plants and seeds according to the invention can further be made in plant breeding. Depending on the desired properties, different breeding measures are taken. The relevant techniques are well known in the art and include but are not limited to hybridization, inbreeding, backcross breeding, multi-line breeding, variety blend, interspecific hybridization, aneuploid techniques, etc. Thus, the genome edited or transgenic seeds and plants according to the invention can be used for the breeding of improved plant lines that, for example, increase the geographical range of cultivation. Docket No.83142-CN-REG-ORG-P1 Many suitable methods for transformation using suitable selection markers such as kanamycin, binary vectors such as from Agrobacterium and plant regeneration as, for example, from tobacco leaf discs are well known in the art. V. Establishment of cultivation region based on altered flowering time profile. Methods are provided for establishing where a plant having genome edits in one or more of the E1, E2, E3, E4, E1LA, or E1LB loci should be cultivated. Particularly, the methods enable establishment of where a soybean plant, or seed thereof, should be grown, wherein the soybean plant has genome edits at one or more of the E1, E2, E3, E4, E1LA, or E1LB loci, resulting in a novel allelic combination, different from the allelic combination of a control plant comprising wild-type versions of the alleles. The method requires determination of the specific allelic combination followed by comparison of the altered flowering time resulting from the specific allelic combination. In example embodiments, assigning a changing in flowering time comprises assigning a duration, such as a number of hours, days, or weeks, by which the flowering time is changed (e.g, advanced or delayed) for the soybean plant relative to the control plant. For example, an allelic combination that results in a flowering time (e.g., duration from VE to R1) of 50 days, as compared to a control plant with a flowering time of 45 days is assigned a change (particularly, advancement) in flowering time of (50-45) 5 days or (5x24) 120 hours. In some embodiments an advancement of 5 days is associated with a defined relative maturity group shift. In other embodiments, an advancement of 10 days is associated with a defined relative maturity group shift. However, it will be appreciated that the relation between degree and direction of change in flowering time and change in relative maturity group may not be linear and may be based on additional factors such as ambient weather conditions (e.g., temperature and humidity), cultivation location (indoors or outdoors), watering and chemical treatment frequency, etc. Docket No.83142-CN-REG-ORG-P1 As a first non-limiting example, a change in flowering time from a first time of ~90- 100 days to a second time of ~87-97 (e.g., 87 to 95) days may be correlated with a change in maturity group from RM 5.5 to RM 5. As a second non-limiting example, a change in flowering time from a first time of ~90-100 days to a second time of ~83-84 days may be correlated with a change in maturity group from RM 5.5 to RM 4. As a third non-limiting example, a change in flowering time from a first time of ~90- 100 days to a second time of ~70-72 days may be correlated with a change in maturity group from RM 5.5 to RM 3. As a fourth non-limiting example, a change in flowering time from a first time of ~90- 100 days to a second time of ~58-62 days may be correlated with a change in maturity group from RM 5.5 to RM 2. As a fifth non-limiting example, a change in flowering time from a first time of ~90- 100 days to a second time of ~43-44 days may be correlated with a change in maturity group from RM 5.5 to RM 0 or RM 1.0. As a sixth non-limiting example, a change in flowering time from a first time of ~90- 100 days to a second time of ~37-41 days may be correlated with a change in maturity group from RM 5.5 to RM 00. As a seventh non-limiting example, a change in flowering time from a first time of ~90-100 days to a second time of ~30-31 days may be correlated with a change in maturity group from RM 5.5 to RM 000. Docket No.83142-CN-REG-ORG-P1 In embodiments, the altered flowering time can be used to establish an altered maturity value, or relative maturity group of the edited plant. Based on the change in flowering time, a geographic region (e.g., latitude, temperature region, etc.) may be selected. In embodiments, selecting a region may further comprise determining whether to grow the plant indoors (e.g., in a greenhouse) or outdoors (e.g., in fields). As an example, based on the allelic combination, a soybean plant may be transitioned from growth in a first region to a second region. As used herein, transitioning the growth of the plant from a first region to a second region means that the edited plant can additionally or optionally be grown in the second region while the unedited control plant, from which the edited plant is derived or relative to which the change in flowering time is measured, continues to be grown in the first region only, and wherein the control plant cannot be grown in the second region. As an example, based on the allelic combination, an edited non-naturally occurring soybean plant may be transitioned from growth in a first region between 40°N and 50°N (e.g., between 40°N and 45°N, or between 45°N and 50°N) to a second region between 30°N and 40°N (e.g., between 30°N and 35°N, or between 35°N and 40°N), or between 20°N and 30°N (e.g., between 20°N and 25°N, or between 25°N and 30°N). As another example, based on the allelic combination, an edited non-naturally occurring soybean plant may be transitioned from growth in a first region between 30°N and 40°N (e.g., between 30°N and 35°N, or between 35°N and 40°N) to a second region between 20°N and 30°N (e.g., between 20°N and 25°N, or between 25°N and 30°N). Herein, the transition is from a region with a longer day to a shorter day. In particular embodiments, a transition to a region with a shorter day may be achieved as a result of an allelic combination that increases the flowering time of an edited plant relative to the control plant. Docket No.83142-CN-REG-ORG-P1 As an example, based on the allelic combination, an edited non-naturally occurring soybean plant may be transitioned from growth in a first region between 20°N and 30°N (e.g., between 20°N and 25°N, or between 25°N and 30°N) to a second region between 30°N and 40°N (e.g., between 30°N and 35°N, or between 35°N and 40°N), or between 40°N and 50°N (e.g., between 40°N and 45°N, or between 45°N and 50°N). As another example, based on the allelic combination, an edited non-naturally occurring soybean plant may be transitioned from growth in a first region between 30°N and 40°N (e.g., between 30°N and 35°N, or between 35°N and 40°N) to a second region between 40°N and 50°N (e.g., between 40°N and 45°N, or between 45°N and 50°N). Herein, the transition is from a region with a shorter day to a longer day. In particular embodiments, a transition to a region with a longer day may be achieved as a result of an allelic combination that decrease the flowering time of an edited plant relative to the control plant. One example embodiment of a method of establishing where a soybean plant, or seed thereof, should be grown, comprises: (a) introducing, via genome modification using a site directed nuclease, a mutation at an E1, E2, E3, E4, E1LA, or E1LB locus of a genome of a soybean plant; (b) selfing the plant for one or more generations to generate a progeny plant that is homozygous at each of the E1, E2, E3, E4, E1LA, and E1LB loci; (c) obtaining DNA from said progeny plant; (d) determining an allelic combination of said progeny plant via a first assay of the DNA indicative of a type of mutation introduced at one of an E1, E2, E3, E4, E1LA, or E1LB locus and a second and, optionally subsequent, assay of the DNA indicative of a type of mutation introduced at a second, and optionally subsequent, of an E1, E2, E3, E4, E1LA, or E1LB locus; and (e) assigning a change in flowering time of the plant based on the determined allelic combination, wherein the change in flowering time is relative to a control plant not comprising the allelic combination. Docket No.83142-CN-REG-ORG-P1 Another example embodiment of the method comprises editing, via a site directed nuclease, at two or more of an E1, E2, E3, E4, E1LA, or E1LB loci of a genome of a soybean plant; isolating DNA from an edited progeny of the soybean plant; determining an allelic combination of said edited progeny plant via a first DNA assay indicative of a type of mutation introduced at one of the loci and a second, and optionally subsequent, DNA assay indicative of a type of mutation introduced at a second of the loci; and assigning a change in flowering time of the progeny based on the determined allelic combination, wherein the change in flowering time is relative to a control plant not comprising the allelic combination. A further embodiment of the method comprises editing at least a first and a second endogenous E1, E2, E3, E4, E1LA, and / or E1LB gene of a genome of a soybean plant; selfing the plant for one or more generations to generate a progeny plant that is homozygously edited at the at least a first and a second endogenous E1, E2, E3, E4, E1LA, or E1LB loci; obtaining DNA from said progeny plant; determining an allelic combination of said progeny plant via a first assay of the DNA indicative of a type of mutation introduced the first edited loci and a second assay of the DNA indicative of a type of mutation introduced second edited loci; and assigning a change in flowering time of the plant based on the determined allelic combination, wherein the change in flowering time is relative to a control plant not comprising the allelic combination. Another example embodiment of a method of establishing where a soybean plant, or seed thereof, should be grown, comprises: a. introducing, via genome modification using a site directed nuclease, a mutation at an E1, E2, E3, E4, E1La and / or an E1Lb locus of a genome of a soybean plant; b. selfing the plant for one or more generations to generate a progeny plant that is homozygous for the mutation at each mutated loci; c. obtaining DNA from said progeny plant; d. determining an allelic combination of said progeny plant via an assay indicative of the mutation introduced at each of the mutated loci; and e. assigning a change in flowering time and / or maturity time to the Docket No.83142-CN-REG-ORG-P1 progeny plant based on the determined allelic combination, wherein the change in flowering time and / or maturity time is relative to a control plant not comprising the determined allelic combination. In particular examples, the mutation comprises: . In embodiments, the introducing comprises transforming a plant cell with an expression cassette comprising: (i) a nucleic acid that encodes the site-directed nuclease; and (ii) a nucleic acid that encodes at least one guide RNA (gRNA) directed to a target sequence at said E1, E2, E3, E4, E1LA, and / or E1LB loci. In some examples, the nucleic acid that encodes the site-directed nuclease is operably linked to a first promoter of the expression cassette and the nucleic acid that encodes the at least one gRNA is operably linked to a second promoter of the expression cassette, wherein the first promoter and the second promoter are different promoter sequences or have a common promoter sequence. In embodiments, the expression cassette further comprises an enhancer operably linked to the first promoter or the second promoter for enhancing the transcription of sequence operably linked to the promoter. As non-limiting examples, the site directed nuclease is selected from the group consisting of meganucleases (MNs), zinc-finger nucleases (ZFNs), transcription- activator like effector nucleases (TALENs), Cas9 nuclease, Cfp1 nuclease, dCas9- Fokl, dCpf1 -Fokl, chimeric Cas9-cytidine deaminase, chimeric Cas9-adenine deaminase, chimeric FEN1 -Fokl, and Mega- TALs, a nickase Cas9 (nCas9), chimeric dCas9 non-Fokl nuclease and dCpfl non-Fokl nuclease. In some examples, the mutation introduced into the E1, E2, E3, E4, E1LA, and / or E1LB locus is selected from the group consisting of an allele replacement, one or a plurality of base insertions, and one or a plurality of base deletions. In embodiments, the progeny plant has a modified flowering time and / or maturity time relative to the control plant, and wherein the control plant comprises a wild-type allele at each of the corresponding E1, E2, E3, E4, E1LA, or E1LB loci. In some Docket No.83142-CN-REG-ORG-P1 examples, assigning a changing in flowering time and / or maturity time comprises assigning a number of days by which the flowering time and / or maturity time is shortened for the progeny plant relative to the control plant. In particular embodiments, assigning a change in the flowering time comprises reducing a number of days between a VE stage and an R1 stage of the progeny plant relative to the control plant, and / or wherein assigning a change in the maturity time comprises reducing a number of days between an R1 stage and an R7 (or R8) stage of the progeny plant relative to the control plant. In embodiments, introducing the mutations further comprises regenerating a transformed T0 plant from the transformed plant cell, the transformed T0 plant having a plurality of T1 seed, wherein the plurality of T1 seed contain a plurality of unique edits in the E1, E2, E3, E4, E1LA, and / or E1LB loci; growing a plurality of T1 plants from the T1 seed; and selfing the T1 plants for one or more generations to obtain a progeny plant that is homozygous for the introduced mutation at the respective loci, wherein determining the allelic combination comprises sequencing the E1, E2, E3, E4, E1LA, and / or E1LB loci of the progeny plant; sequencing the E1, E2, E3, E4, E1LA, and / or E1LB loci of the T0 plant; and aligning the sequence of the progeny plant with the corresponding sequence of the progenitor (T0) plant to determine the mutation introduced into the E1, E2, E3, E4, E1LA, and / or E1LB loci. Non-limiting embodiments of the invention comprise methods of establishing where a soybean plant, or seed thereof, should be grown. In embodiments, the method comprises: a. introducing, via genome modification using a site directed nuclease, a mutation at an E1, E2, E3, E4, E1LA, and / or E1LB locus of a genome of a soybean plant; b. selfing the plant for one or more generations to generate a progeny plant that is homozygous at each of the mutated loci; c. obtaining DNA from said progeny plant; d. determining an allelic combination of said progeny plant via a first assay of the DNA indicative of a type of mutation introduced at a first E1, E2, E3, E4, E1LA, Docket No.83142-CN-REG-ORG-P1 or E1LB locus and a second, and optionally subsequent, assay of the DNA indicative of a type of mutation introduced at a second, and optionally subsequent, E1, E2, E3, E4, E1LA, or E1LB locus; and e. assigning a change in flowering time of the plant based on the determined allelic combination, wherein the change in flowering time is relative to a control plant not comprising the allelic combination. In embodiments, the assigning a change in flowering time comprises assigning a relative maturity group value relative to the control plant not comprising the allelic combination, wherein optionally the control plant comprises a corresponding wild- type allele at each of the mutated loci. In other embodiments, assigning a changing in flowering time comprises assigning a number of days by which the flowering time is advanced or delayed for the soybean plant relative to the control plant. Non-limiting embodiments of the invention also comprise expression cassettes used for editing the plant cell. Example embodiments comprise transforming a plant cell with an expression cassette comprising (i) a nucleic acid that encodes the site-directed nuclease; and (ii) a nucleic acid that encodes at least one guide RNA (gRNA) directed to a target sequence. In embodiments, the nucleic acid that encodes the site-directed nuclease is operably linked to a first promoter and wherein the nucleic acid that encodes the at least one gRNA is operably linked to a second promoter. In further embodiments of the expression cassette, an enhancer is operably linked to the first promoter or the second promoter. In embodiments, the site directed nuclease is selected from the group consisting of meganucleases (MNs), zinc-finger nucleases (ZFNs), transcription- activator like effector nucleases (TALENs), Cas9 nuclease, Cfp1 nuclease, dCas9-Fokl, dCpf1 -Fokl, chimeric Cas9-cytidine deaminase, chimeric Cas9-adenine deaminase, chimeric FEN1 -Fokl, and Mega- TALs, a nickase Cas9 (nCas9), chimeric dCas9 non-Fokl nuclease and dCpfl non-Fokl nuclease. Docket No.83142-CN-REG-ORG-P1 Non-limiting embodiments of the invention also comprise methods of editing plants at the E1, E2, E3, E4, E1LA, and / or E1LB loci to create novel alleles and plants with novel allelic combinations which confer to the plant an altered flowering time profile relative to a control plant not comprising the novel allelic combination. Example embodiments of the method of editing comprise introducing into the E1, E2, E3, E4, E1LA, and / or E1LB locus a mutation selected from the group consisting of an allele replacement, one or a plurality of base insertions, and one or a plurality of base deletions. In further embodiments, the method comprises regenerating a transformed T0 plant from the transformed plant cell, the transformed T0 plant having a plurality of T1 seed, wherein the plurality of T1 seed contain a plurality of unique edits in the mutated loci; growing a plurality of T1 plants from the T1 seed; and selfing the T1 plants for one or more generations to obtain a progeny plant that is homozygous at the mutated loci. In particular embodiments, the flowering time of the edited progeny plant is shorter than the flowering time of the control plant. In further embodiments, a relative maturity group value of the edited progeny plant is different from the relative maturity group value of the control plant. Non-limiting embodiments of the invention further include the edited progeny plant created by the methods disclosed above, as well as a further progeny plants of the edited progeny plant, such as those obtained by breeding or selfing. In embodiments, the flowering time of the edited progeny plant is modified (e.g., shorter or longer) than the flowering time of the control plant. In embodiments, a relative maturity group value of the edited progeny plant is different from the relative maturity group value of the control plant. Non-limiting embodiments further comprise a method of breeding comprising: Docket No.83142-CN-REG-ORG-P1 crossing the non-naturally occurring soybean plant disclosed above with a different soybean plant not comprising the allele combination of the non-naturally occurring soybean plant; and selecting a progeny plant having the modified flowering. EXAMPLES The following examples provide illustrative embodiments. In light of the present disclosure and the general level of skill in the art, those of skill will appreciate that the following examples are intended to be exemplary only and that numerous changes, modifications, and alterations can be employed without departing from the scope of the presently disclosed subject matter. Experimental Example A: Mutagenesis of GmE1 and GmE2 mediated by CRISPR / Cas9 accelerates flowering in soybean A.1 CRISPR / Cas9-mediated targeted mutagenesis of gme1 accelerates flowering in soybean A.1.1 SgRNA design and construction of the CRISPR / Cas9 expression vector The genomic sequence of GmE1 (SEQ ID NO:1) was obtained from Phytozome database according to the Glyma.06G207800 gene, which was located on chromosome 6. The target site of GmE1 (GmE1-TS) was designed by CRISPR-P software (on the internet at cbi.hzau.edu.cn / cgi-bin / CRISPR). The sequence of GmE1-TS was GAGCAACCCTTCAGATGAAAGGG (SEQ ID NO:45). To get the CRISPR / Cas9-GmE1 vector, the primers of GmE1-TS (GmE1-sense: 5'-TTGGAGCAACCCTTCAGATGAAA-3' (SEQ ID NO:46); GmE1-anti: 5'- AACTTTCATCTGAAGGGTTGCTC-3' (SEQ ID NO:47), and the underlined stands for target sites) were synthesized and polymerized to form double chains, and then subcloned into the CRISPR / Cas9 vector (ViewSolid Biotech, VK005-15, Beijing) with the help of T4 ligase. The recombinant vector was confirmed by sequencing and Docket No.83142-CN-REG-ORG-P1 named as CRISPR / Cas9-GmE1. And then, the CRISPR / Cas9-GmE1 was transformed EHA105 strain by electro transformation which was verified by PCR and sequencing. The PCR reaction system was as follows: 2×Taq Master Mix, 12.5 μL; bacterial fluid (200 ng / μL), 1 μL; Cas9-F (10 pmol / μL), 1 μL; Cas9-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. The PCR reaction was set as follows: 94°C for 3^min; 94^°C for 30^s, 55^°C for 30 s, and 72^°C for 1^min, for 35 cycles; and a final extension at 72^°C for 10^min. A.1.2 Transformation of CRISPR / Cas9-GmE1 in soybean A.1.2.1. Plant materials The soybean Jack variety was utilized for Agrobacterium-mediated transformation. Healthy seeds were surface-sterilized by exposure to chlorine gas for 16 h. Sterilized seeds were placed in germination culture medium (GCM) containing 3.1 g / L Gamborgs Basal Salt Mixture (Phytotech, G768), 20 g / L sugar, 1mL / LGamborgs Vitamin Solution (Phytotech, G219) and 7 g / L agar (Sigma), pH 5.8, and the seeds were germinated at 25°C for 18 ~ 20 h on the light. A.1.2.2. Agrobacterium strain and vector A. tumefaciens strain EHA105 was used in the experiments. The CRISPR / Cas9 vector (ViewSolid Biotech, VK005-15, Beijing) carried T-DNA and the bar gene acted as an herbicide resistance marker. A.1.2.3. Agrobacterium preparation Agrobacterium strain stocks of EHA105 stored at -80°C were streaked on solidified YEP medium plates containing 5 g / L NaCl, 10 g / L tryptone, 5 g / L yeast extract, and 15 g / L agar, with 50 mg / L kanamycin, 75 mg / L chloromycetin and 50 mg / L rifampicin. Plates streaked with Agrobacterium were incubated at 28°C for approximately 2 days until colony formation. The colonies were collected by a Docket No.83142-CN-REG-ORG-P1 spreader, daubed onto new solidified YEP medium plates with the same antibiotics and incubated overnight at 28°C. The fresh Agrobacterium were resuspended in liquid co-cultivation medium (LCCM) containing 1 / 2 Murashige&Skoog Basal Salt Mixture (Phytotech, M524, Lenexa, KS, USA), 3.9 g / L2-(N-Morpholino) ethanesulfonic acid(MES), 30 g / L sugar, 1mL / L Gamborgs Vitamin Solution, 150 mg / L dl- Dithiothreitol (DTT), 2 mg / L zeatin and 40 mg / L 3′,5′-dimethoxy-4- hydroxyacetophenone(AS), pH 5.4.Next, a final optical density of 0.6 was measured at 600 nm, and the Agrobacterium cultures were prepared for transformation. A.1.2.4. Infection and co-cultivation Explants were prepared from one-day-old seedlings. A longitudinal cut along the hilum was made to separate the cotyledons, and the seed coat was removed. The embryonic axis found at the junctions of the hypocotyls and the cotyledon was excised to obtain the half-seed explants. The explant cuttings were immersed in Agrobacterium for 2 h at 50 rpm. After inoculation, each of the 9 cotyledons were placed in solid co-culture medium (CCM) containing 1 / 2 Murashige&Skoog Basal Salt Mixture, 3.9 g / L MES, 30 g / L sugar, 1mL / L Gamborgs Vitamin Solution, 150 mg / L DTT, 40 mg / L AS, 2 mg / L zeatin and 7 g / L agar, pH 5.4, with a piece of Whatman filter paper and then incubated at 22°C in the dark for 5 days. A.1.2.5. Recovery culture and selection culture After co-cultivation, explants were then transferred to recovery medium (SIM0) containing 3.1 g / L Gamborgs Basal Salt Mixture, 0.98 g / L MES, 30 g / L sucrose, 1 mL / L Gamborgs Vitamin Solution, 150 mg / L cefotaxime, 450 mg / L timentin, 1 mg / L 6-Benzylaminopurine (6-BA), and 7 g / L agar, pH 5.7, and incubated at 28 °C for 7 days. Seven days after recovery, the explants were transferred to selection culture medium (SIM6) containing 3.1 g / L Gamborgs Basal Salt Mixture, 0.98 g / L MES, 30 g / L sucrose, 1 mL / L Gamborgs Vitamin Solution, 150 mg / L cefotaxime, 450 mg / L Docket No.83142-CN-REG-ORG-P1 timentin, 1 mg / L 6-BA, 7 g / L agar, and 6 mg / L glufosinate, pH 5.7, and incubated at 28 °C for 21 days. A.1.2.6. Shoot Elongation and Rooting After selection culture, the cotyledons and brown leaves were cut from the explants, and the remaining tissues were transferred to shoot elongation medium (SEM) containing 4.0 g / L Murashige&Skoog Basal Salt Mixture, 0.6 g / L MES, 30 g / L sucrose, 1 mL / L Gamborgs Vitamin Solution, 150 mg / L cefotaxime, 450 mg / L timentin, 0.1 mg / L 3-Indoleacetic acid (IAA), 0.5 mg / L Gibberellic acid (GA), 1 mg / L zeatin, 7 g / L agar, and 6 mg / L glufosinate, pH 5.6, and incubated at 28 °C. The culture medium was changed every two weeks. Simultaneous with changing the SEM, the elongated shoots (5–8 cm) were cut from the base of the buds, and the stems were dipped in 1 mg / L Indole-3-Butytric acid (IBA) for 1 min, placed in a rooting culture medium (RCM) containing 1 / 2 Murashige&Skoog Basal Salt Mixture, 0.6 g / L MES, 20 g / L sucrose, 1 mL / L Gamborgs Vitamin Solution, and 7 g / L agar,3 mg / L glufosinate, pH 5.7, and incubated at 28 °C for 7 days. After root production, the plants were transferred to pots and grown in the greenhouse. A.1.3 Screening for gme1 mutant plants by sequencing analysis Genomic DNA was extracted from the leaves of each individual plant in the T0 generation, and then the regions spanning the target sites were amplified by PCR using Phanta®Super Fidelity DNA Polymerase (Vazyme Biotech) with the GmE1 forward primer (5’- ACACTCAAAACACTCAAATTAAGCC-3’, SEQ ID NO: 48) and reverse primer (5’- AGGACACAGAAATTGAAAACGCA-3’, SEQ ID NO: 49), purified using Zymoclean™ Gel DNA Recovery Kit and sequenced by TSINGKE (Beijing). Different types of gene editing can be identified via sequence peaks. Short base insertions or deletions (not multiples of three) induced by CRISPR / Cas9 can lead to frameshift mutations. The heterozygous mutations showed overlapping peaks from the target sites to the end. The wild-type and homozygous mutations had no Docket No.83142-CN-REG-ORG-P1 overlapping peaks at the target sites. Then, the homozygous mutant types were identified by sequence alignment with the wild-type sequence. This method was also used in the T1 and T2 generations. In this study, we detected only one type of homozygous mutations at the target site of GmE1 in the T1 generation. The type of the mutations (SEQ ID NO: 8) is 1-bp insertion (199 to 200 bp, the A of initiation codon ATG is considered as the position 1). A.1.4 The phenotypes of the gme1 mutant plants under different photoperiod conditions To verify whether GmE1 is involved in the regulation of photoperiodic flowering, the wild type (WT) plants and gme1 mutants were grown under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) photoperiodic conditions. The flowering time of each soybean plant was recorded as days from emergence to the R1 stage (the first flower appears at any node in the main stem). The maturity time was recorded as days from the emergence to the R7 stage (any pod becomes to the mature color) and R8 stage (95% pod becomes to the mature color). Statistical analyses and significant difference test were performed using Microsoft Excel. The significance of differences between controls and treatments at the 0.01 probability level. The flowering time and maturity time are shown as the mean values ± standard deviation. Under SD conditions, the flowering time of gme1 mutants were almost the same as WT plants (21.4±0.5 DAE for gme1 mutants vs.21.0±0.5 DAE for WT). The maturity time of gme1 mutants in R7 stage were 66.4±1.2 DAE for gme1 mutants vs. 67.3±1.0 DAE for WT. The maturity time of gme1 mutants in R8 stage were 73.0±0.5 DAE for gme1 mutants vs.72.6±0.5 DAE for WT (Table A.1.1). By contrast, under LD conditions and compared to WT plants, gme1 mutants showed earlier flowering time by about 12 days (31.9±1.1 DAE for gme1 mutants vs.43.6±1.4 DAE for WT). The gme1 mutants showed earlier maturity time by about 36 days in R7 stage (109.4±3.5 DAE for gme1 mutants vs.147.0±2.5 DAE for WT), and about 41 days in R8 stage (122.8±3.1 DAE for gme1 mutants vs.163.1±4.1 DAE for WT) (Table Docket No.83142-CN-REG-ORG-P1 A.1.2). These results indicated that CRISPR / Cas9-mediated targeted mutagenesis of gme1 accelerates flowering and maturity in soybean under LD conditions. Table A.1.1 The phenotypes of WT and gme1 plants under SD conditions. Table A.1.2 The phenotypes of WT and gme1 plants under LD conditions. ** represent p<0.01. Example A.2: CRISPR / Cas9-mediated targeted mutagenesis of gme2 accelerates flowering in soybean A.2.1 SgRNA design and construction of the CRISPR / Cas9 expression vector The genomic sequence of GmE2 (SEQ ID NO: 2) was obtained from Phytozome database according to the Glyma.10G221500 gene, which was located on chromosome 10. The target site of GmE2 (GmE2-TS) was designed by CRISPR-P software (on the internet at cbi.hzau.edu.cn / cgi-bin / CRISPR. The sequence of GmE2- TS was TCTTTGTTGACCATCTGGTGGGG (SEQ ID NO: 50). To get the CRISPR / Cas9-GmE2 vector, the primers of GmE2-TS (GmE2-sense: 5'-TTGTCTTTGTTGACCATCTGGTG-3' (SEQ ID NO: 51); GmE2-anti: 5'- AACCACCAGATGGTCAACAAAGA-3', SEQ ID NO: 52, and the underlined stands for target sites) were synthesized and polymerized to form double chains, and then subcloned into the CRISPR / Cas9 vector (ViewSolid Biotech, VK005-15, Beijing) with the help of T4 ligase. The recombinant vector was confirmed by sequencing and named as CRISPR / Cas9-GmE1. And then, the CRISPR / Cas9-GmE2 was transformed into Agrobacterium EHA105 strain by electro transformation which Docket No.83142-CN-REG-ORG-P1 was verified by PCR and sequencing. The PCR reaction system was as follows: 2×Taq Master Mix, 12.5 μL; bacterial fluid (200 ng / μL), 1 μL; Cas9-F (10 pmol / μL), 1 μL; Cas9-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. The PCR reaction was set as follows: 94°C for 3^min; 94^°C for 30^s, 55^°C for 30 s, and 72^°C for 1^min, for 35 cycles; and a final extension at 72^°C for 10^min. A.2.2 Transformation of CRISPR / Cas9-GmE2 in soybean Refer to A.1.2 A.2.3 Screening for gme2 mutant plants by sequencing analysis Genomic DNA was extracted from the leaves of each individual plant in the T0 generation, and then the regions spanning the target sites were amplified by PCR using Phanta®Super Fidelity DNA Polymerase (Vazyme Biotech) with the GmE2 forward primer (5’- AAGCTGCATAGGAGGGCAAC-3’, SEQ ID NO: 53) and reverse primer (5’- ATGCACCAAGAACCAAAT-3’, SEQ ID NO: 54), purified using Zymoclean™ Gel DNA Recovery Kit and sequenced by TSINGKE (Beijing). Different types of gene editing can be identified via sequence peaks. Short base insertions or deletions (not multiples of three) induced by CRISPR / Cas9 can lead to frameshift mutations. The heterozygous mutations showed overlapping peaks from the target sites to the end. The wild-type and homozygous mutations had no overlapping peaks at the target sites. Then, the homozygous mutant types were identified by sequence alignment with the wild-type sequence. This method was also used in the T1 and T2 generations. In this study, we detected only one type of homozygous mutations at the target site of GmE2 in the T1 generation. The type of the mutant (SEQ ID NO: 16) is a 14-bp deletion (81 to 94 bp, the A of initiation codon ATG is considered as the position 1). A.2.4 The phenotypes of the gme2 mutant plants under different photoperiod conditions Docket No.83142-CN-REG-ORG-P1 To verify whether GmE2 is involved in the regulation of photoperiodic flowering, the wild type (WT) plants and gme1 mutants were grown under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) photoperiodic conditions. The flowering time of each soybean plant was recorded as days from emergence to the R1 stage (the first flower appears at any node in the main stem). The maturity time was recorded as days from the emergence to the R7 stage (any pod becomes to the mature color) and R8 stage (95% pod becomes to the mature color). Statistical analyses and significant difference test were performed using Microsoft Excel. The significance of differences between controls and treatments at the 0.01 probability level. The flowering time and maturity time are shown as the mean values ± standard deviation. Under SD conditions, the flowering time of gme2 mutants were almost the same as WT plants (20.9±0.6 DAE for gme2 mutants vs.21.0±0.5 DAE for WT). The maturity time of gme2 mutants in R7 stage were 63.9±1.3 DAE for gme2 mutants vs.67.3±1.0 DAE for WT. The maturity time of gme2 mutants in R8 stage were 70.0±2.2 DAE for gme2 mutants vs.72.6±0.5 DAE for WT (Table A.2.1). By contrast, under LD conditions and compared to WT plants, gme2 mutants showed earlier flowering time by about 11 days (32.9±1.0 DAE for gme2 mutants vs. 43.6±1.4 DAE for WT). The gme2 mutants showed earlier maturity time by about 33 days in R7 stage (114.5±2.9 DAE for gme2 mutants vs.147.0±2.5 DAE for WT), and about 38 days in R8 stage (125.4±3.7 DAE for gme2 mutants vs.163.1±4.1 DAE for WT) (Table A.2.2). These results indicated that CRISPR / Cas9-mediated targeted mutagenesis of gme2 accelerates flowering and maturity in soybean under LD conditions. Table A.2.1 The phenotypes of WT and gme2 plants under SD conditions. Docket No.83142-CN-REG-ORG-P1 Table A.2.2 The phenotypes of WT and gme2 plants under LD conditions. ** represent p<0.01. Example A.3: CRISPR / Cas9-mediated targeted mutagenesis of gme1 e2 exhibits an extreme early in soybean A.3.1 SgRNA design and construction of the CRISPR / Cas9 expression vector for gme1 e2 The genomic sequence of Gme1 (Glyma.06G207800, SEQ ID NO: 1) and Gme2 (Glyma.10G221500, SEQ ID NO: 4), was obtained from Phytozome database according to the gene, The target sites were designed by CRISPR-P software (on the internet at cbi.hzau.edu.cn / cgi-bin / CRISPR. The target sequence of GmE1 (GmE1- TS) was GAGCAACCCTTCAGATGAAAGGG (SEQ ID NO: 45), and the target sequence of GmE2 (GmE2-TS) was TCTTTGTTGACCATCTGGTGGGG (SEQ ID NO: 50). First, to get the CRISPR / Cas9-GmE1E2 vector, the primers of GmE1-TS (GmE1- sense: 5'-TTGGAGCAACCCTTCAGATGAAA-3', SEQ ID NO: 46; GmE1-anti: 5'- AACTTTCATCTGAAGGGTTGCTC-3', SEQ ID NO: 47, and the underlined stands for target sites), and the primers of GmE2-TS (GmE2-sense: 5'- TTGTCTTTGTTGACCATCTGGTG-3', SEQ ID NO: 51; GmE2-anti: 5'- AACCACCAGATGGTCAACAAAGA-3', SEQ ID NO: 52 were synthesized and polymerized to form double chains, and then subcloned into the CRISPR / Cas9 vector (ViewSolid Biotech, VK005-15, Beijing) with the help of T4 ligase. The recombinant vector was confirmed by sequencing and named as CRISPR / Cas9-GmE1 and CRISPR / Cas9-GmE2, respectively. Second, the plasmid of CRISPR / Cas9-GmE1 was digested with Asc I and Spe I, the fragment about 570 bp was extracted using Zymoclean™ Gel DNA Recovery Kit (D4008). while the plasmid of CRISPR / Cas9- Docket No.83142-CN-REG-ORG-P1 GmE2 was digested with Asc I and Avr Ⅱ, the fragment of about 14000 bp was extracted using Zymoclean™ Gel DNA Recovery Kit (D4008). Third, the two linearized fragments were then integrated by T4 DNA Ligase, the CRISPR / Cas9- GmE1E2 vector was constructed and transformed into Agrobacterium EHA105 strain by electro transformation which was verified by PCR and sequencing. The PCR reaction system was as follows: 2×Taq Master Mix, 12.5 μL; bacterial fluid (200 ng / μL), 1 μL; Cas9-F (10 pmol / μL), 1 μL; Cas9-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. The PCR reaction was set as follows: 94°C for 3^min; 94^°C for 30^s, 55^°C for 30 s, and 72^°C for 1^min, for 35 cycles; and a final extension at 72^°C for 10^min. A.3.2 Transformation of CRISPR / Cas9-GmE1E2 in soybean Refer to A.1.2 A.3.3 Screening for gme1 e2 mutant plants by sequencing analysis Genomic DNA was extracted from the leaves of each individual plant in the T0 generation, and then the regions spanning the target sites were amplified by PCR using Phanta®Super Fidelity DNA Polymerase (Vazyme Biotech) with both GmE1 and GmE2 primers. The GmE1 forward primer (5’- ACACTCAAAACACTCAAATTAAGCC-3’, SEQ ID NO: 48) and reverse primer (5’- AGGACACAGAAATTGAAAACGCA-3’, SEQ ID NO: 49), the GmE2 forward primer (5’- AAGCTGCATAGGAGGGCAAC-3’, SEQ ID NO: 53) and reverse primer (5’- ATGCACCAAGAACCAAAT-3’, SEQ ID NO: 54), were purified using Zymoclean™ Gel DNA Recovery Kit and sequenced by TSINGKE (Beijing). Different types of gene editing can be identified via sequence peaks. Short base insertions or deletions (not multiples of three) induced by CRISPR / Cas9 can lead to frameshift mutations. The heterozygous mutations showed overlapping peaks from the target sites to the end. The wild-type and homozygous mutations had no overlapping peaks at the target sites. Then, the homozygous mutant types were identified by sequence alignment with the wild-type sequence. This method was also Docket No.83142-CN-REG-ORG-P1 used in the T1 and T2 generations. In this study, we detected only one type of homozygous gme1e2 mutations in the T1 generation. The type of the gme1 mutations (SEQ ID NO: 8) is 1bp insertion at position 199, the type of the gme2 mutations is 1bp deletion (SEQ ID NO: 15; 88 to 89 bp, the A of initiation codon ATG is considered as the position 1). A.3.4 The phenotypes of the gme1 e2 mutant plants under different photoperiod conditions To verify whether GmE1 and GmE2 are involved in the regulation of photoperiodic flowering, the wild type (WT) plants and gme1 e2 mutants were grown under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) photoperiodic conditions. The flowering time of each soybean plant was recorded as days from emergence to the R1 stage (the first flower appears at any node in the main stem). The maturity time was recorded as days from the emergence to the R7 stage (any pod becomes to the mature color) and R8 stage (95% pod becomes to the mature color). Statistical analyses and significant difference test were performed using Microsoft Excel. The significance of differences between controls and treatments at the 0.01 probability level. The flowering time and maturity time are shown as the mean values ± standard deviation. Under SD conditions, the flowering time of gme1 e2 mutants were almost the same as WT plants (20.8±0.5 DAE for gme1 e2 mutants vs.21.0±0.5 DAE for WT). The maturity time of gme1e2 mutants in R7 stage were 65.8±0.5 DAE for gme1 e2 mutants vs.67.3±1.0 DAE for WT. The maturity time of gme1 e2 mutants in R8 stage were 72.3±0.5 DAE for gme1 e2 mutants vs.72.6±0.5 DAE for WT (Table A.3.1). By contrast, under LD conditions and compared to WT plants, gme1 e2 mutants showed earlier flowering time by about 15 days (28.3±0.5 DAE for gme1 e2 mutants vs.43.6±1.4 DAE for WT). The gme1 e2 mutants showed earlier maturity time by about 44 days in R7 stage (103.6±1.5 DAE for gme1 e2 mutants vs.147.0±2.5 DAE for WT), and about 50 days in R8 stage (113.4±1.3 DAE for gme1 e2 mutants vs.163.1±4.1 DAE for WT) (Table A.3.2). These results Docket No.83142-CN-REG-ORG-P1 indicated that CRISPR / Cas9-mediated targeted mutagenesis of gme1 e2 accelerates flowering and maturity in soybean under LD conditions. Table A.3.1 The phenotypes of WT and gme1 e2 plants under SD conditions. Table A.3.2 The phenotypes of WT and gme1 e2 plants under LD conditions. ** represent p<0.01.

[0002] Docket No.83142-CN-REG-ORG-P1 Example B. Mutagenesis of GmE1 and GmE3 mediated by CRISPR / Cas9 accelerates flowering in soybean B.1: CRISPR / Cas9-mediated targeted mutagenesis of gme1 accelerates flowering in soybean B.1.1 SgRNA design and construction of the CRISPR / Cas9 expression vector The genomic sequence of GmE1 was obtained from Phytozome database according to the Glyma.06G207800 gene, which was located on chromosome 6. The target site of GmE1 (GmE1-TS) was designed by CRISPR-P software (on the internet at cbi.hzau.edu.cn / cgi-bin / CRISPR. The sequence of GmE1-TS was GAGCAACCCTTCAGATGAAAGGG (SEQ ID NO: 45). To get the CRISPR / Cas9-GmE1 vector, the primers of GmE1-TS (GmE1-sense: 5'-TTGGAGCAACCCTTCAGATGAAA-3', SEQ ID NO: 46; GmE1-anti: 5'- AACTTTCATCTGAAGGGTTGCTC-3', SEQ ID NO: 47, and the underlined stands for target sites) were synthesized and polymerized to form double chains, and then subcloned into the CRISPR / Cas9 vector (ViewSolid Biotech, VK005-15, Beijing) with the help of T4 ligase. The recombinant vector was confirmed by sequencing and named as CRISPR / Cas9-GmE1. And then, the CRISPR / Cas9-GmE1 was transformed EHA105 strain by electro transformation which was verified by PCR and sequencing. The PCR reaction system was as follows: 2×Taq Master Mix, 12.5 μL; bacterial fluid (200 ng / μL), 1 μL; Cas9-F (10 pmol / μL), 1 μL; Cas9-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. The PCR reaction was set as follows: 94°C for 3^min; 94^°C for 30^s, 55^°C for 30 s, and 72^°C for 1^min, for 35 cycles; and a final extension at 72^°C for 10^min. B.1.2.1. Plant materials The soybean Jack variety was utilized for Agrobacterium-mediated transformation. Healthy seeds were surface-sterilized by exposure to chlorine gas for 16 h. Sterilized seeds were placed in germination culture medium (GCM) containing Docket No.83142-CN-REG-ORG-P1 3.1 g / L Gamborgs Basal Salt Mixture (Phytotech, G768), 20 g / L sugar, 1mL / LGamborgs Vitamin Solution (Phytotech, G219) and 7 g / L agar (Sigma), pH 5.8, and the seeds were germinated at 25°C for 18 ~ 20 h on the light. B.1.2.2. Agrobacterium strain and vector A. tumefaciens strain EHA105 was used in the experiments. The CRISPR / Cas9 vector (ViewSolid Biotech, VK005-15, Beijing) carried T-DNA and the bar gene acted as an herbicide resistance marker. B.1.2.3. Agrobacterium preparation Agrobacterium strain stocks of EHA105 stored at -80°C were streaked on solidified YEP medium plates containing 5 g / L NaCl, 10 g / L tryptone, 5 g / L yeast extract, and 15 g / L agar, with 50 mg / L kanamycin, 75 mg / L chloromycetin and 50 mg / L rifampicin. Plates streaked with Agrobacterium were incubated at 28°C for approximately 2 days until colony formation. The colonies were collected by a spreader, daubed onto new solidified YEP medium plates with the same antibiotics and incubated overnight at 28°C. The fresh Agrobacterium were resuspended in liquid co-cultivation medium (LCCM) containing 1 / 2 Murashige&Skoog Basal Salt Mixture (Phytotech, M524, Lenexa, KS, USA), 3.9 g / L2-(N-Morpholino) ethanesulfonic acid(MES), 30 g / L sugar, 1mL / L Gamborgs Vitamin Solution, 150 mg / L dl- Dithiothreitol (DTT), 2 mg / L zeatin and 40 mg / L 3′,5′-dimethoxy-4- hydroxyacetophenone(AS), pH 5.4.Next, a final optical density of 0.6 was measured at 600 nm, and the Agrobacterium cultures were prepared for transformation. B.1.2.4. Infection and co-cultivation Explants were prepared from one-day-old seedlings. A longitudinal cut along the hilum was made to separate the cotyledons, and the seed coat was removed. The embryonic axis found at the junctions of the hypocotyls and the cotyledon was excised to obtain the half-seed explants. The explant cuttings were immersed in Agrobacterium for 2 h at 50 rpm. After inoculation, each of the 9 cotyledons were placed in solid co-culture medium (CCM) containing 1 / 2 Murashige&Skoog Basal Salt Mixture, 3.9 g / L MES, 30 g / L sugar, 1mL / L Gamborgs Vitamin Solution, 150 Docket No.83142-CN-REG-ORG-P1 mg / L DTT, 40 mg / L AS, 2 mg / L zeatin and 7 g / L agar, pH 5.4, with a piece of Whatman filter paper and then incubated at 22°C in the dark for 5 days. B.1.2.5. Recovery culture and selection culture After co-cultivation, explants were then transferred to recovery medium (SIM0) containing 3.1 g / L Gamborgs Basal Salt Mixture, 0.98 g / L MES, 30 g / L sucrose, 1 mL / L Gamborgs Vitamin Solution, 150 mg / L cefotaxime, 450 mg / L timentin, 1 mg / L 6-Benzylaminopurine (6-BA), and 7 g / L agar, pH 5.7, and incubated at 28 °C for 7 days. Seven days after recovery, the explants were transferred to selection culture medium (SIM6) containing 3.1 g / L Gamborgs Basal Salt Mixture, 0.98 g / L MES, 30 g / L sucrose, 1 mL / L Gamborgs Vitamin Solution, 150 mg / L cefotaxime, 450 mg / L timentin, 1 mg / L 6-BA, 7 g / L agar, and 6 mg / L glufosinate, pH 5.7, and incubated at 28 °C for 21 days. B.1.2.6. Shoot Elongation and Rooting After selection culture, the cotyledons and brown leaves were cut from the explants, and the remaining tissues were transferred to shoot elongation medium (SEM) containing 4.0 g / L Murashige&Skoog Basal Salt Mixture, 0.6 g / L MES, 30 g / L sucrose, 1 mL / L Gamborgs Vitamin Solution, 150 mg / L cefotaxime, 450 mg / L timentin, 0.1 mg / L 3-Indoleacetic acid (IAA), 0.5 mg / L Gibberellic acid (GA), 1 mg / L zeatin, 7 g / L agar, and 6 mg / L glufosinate, pH 5.6, and incubated at 28 °C. The culture medium was changed every two weeks. Simultaneous with changing the SEM, the elongated shoots (5–8 cm) were cut from the base of the buds, and the stems were dipped in 1 mg / L Indole-3-Butytric acid (IBA) for 1 min, placed ina rooting culture medium (RCM) containing 1 / 2 Murashige&Skoog Basal Salt Mixture, 0.6 g / L MES, 20 g / L sucrose, 1 mL / L Gamborgs Vitamin Solution, and 7 g / L agar,3 mg / L glufosinate, pH 5.7, and incubated at 28 °C for 7 days. After root production, the plants were transferred to pots and grown in the greenhouse. B.1.3 Screening for gme1 mutant plants by sequencing analysis Genomic DNA was extracted from the leaves of each individual plant in the T0 generation, and then the regions spanning the target sites were amplified by PCR Docket No.83142-CN-REG-ORG-P1 using Phanta®Super Fidelity DNA Polymerase (Vazyme Biotech) with the GmE1 forward primer (5’- ACACTCAAAACACTCAAATTAAGCC-3’, SEQ ID NO: 48) and reverse primer (5’- AGGACACAGAAATTGAAAACGCA-3’, SEQ ID NO: 49), purified using Zymoclean™ Gel DNA Recovery Kit and sequenced by TSINGKE (Beijing). Different types of gene editing can be identified via sequence peaks. Short base insertions or deletions (not multiples of three) induced by CRISPR / Cas9 can lead to frameshift mutations. The heterozygous mutations showed overlapping peaks from the target sites to the end. The wild-type and homozygous mutations had no overlapping peaks at the target sites. Then, the homozygous mutant types were identified by sequence alignment with the wild-type sequence. This method was also used in the T1 and T2 generations. In this study, we detected only one type of homozygous mutations at the target site of GmE1 in the T1 generation. The type of the mutations (SEQ ID NO: 9) is 1-bp insertion (199 to 200 bp, the A of initiation codon ATG is considered as the position 1). B.1.4 The phenotypes of the gme1 mutant plants under different photoperiod conditions To verify whether GmE1 is involved in the regulation of photoperiodic flowering, the wild type (WT) plants and gme1 mutants were grown under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) photoperiodic conditions. The flowering time of each soybean plant was recorded as days from emergence to the R1 stage (the first flower appears at any node in the main stem). The maturity time was recorded as days from the emergence to the R7 stage (any pod becomes to the mature color) and R8 stage (95% pod becomes to the mature color). Statistical analyses and significant difference test were performed using Microsoft Excel. The significance of differences between controls and treatments at the 0.01 probability level. The flowering time and maturity time are shown as the mean values ± standard deviation. Under SD conditions, the flowering time of gme1 mutants were almost the same as WT plants (21.4±0.5 DAE for gme1 mutants vs.21.0±0.5 DAE for Docket No.83142-CN-REG-ORG-P1 WT). The maturity time of gme1 mutants in R7 stage were 66.4±1.2 DAE for gme1 mutants vs.67.3±1.0 DAE for WT. The maturity time of gme1 mutants in R8 stage were 73.0±0.5 DAE for gme1 mutants vs.72.6±0.5 DAE for WT (Table B.1.1). By contrast, under LD conditions and compared to WT plants, gme1 mutants showed earlier flowering time by about 12 days (31.9±1.1 DAE for gme1 mutants vs. 43.6±1.4 DAE for WT). The gme1 mutants showed earlier maturity time by about 36 days in R7 stage (109.4±3.5 DAE for gme1 mutants vs.147.0±2.5 DAE for WT), and about 41 days in R8 stage (122.8±3.1 DAE for gme1 mutants vs.163.1±4.1 DAE for WT) (Table B.1.2). These results indicated that CRISPR / Cas9-mediated targeted mutagenesis of gme1 accelerates flowering and maturity in soybean under LD conditions. Table B.1.1 The phenotypes of WT and gme1 plants under SD conditions. Table B.1.2 The phenotypes of WT and gme1 plants under LD conditions. ** represent p<0.01. Example B.2: CRISPR / Cas9-mediated targeted mutagenesis of gme3 accelerates flowering in soybean B.2.1 SgRNA design and construction of the CRISPR / Cas9 expression vector The genomic sequence of GmE3 (SEQ ID NO: 5) was obtained from Phytozome database according to the Glyma.19G224200 gene, which was located on chromosome 19. The target site of GmE3 (GmE3-TS) was designed by CRISPR-P Docket No.83142-CN-REG-ORG-P1 software (on the internet at cbi.hzau.edu.cn / cgi-bin / CRISPR. The sequence of GmE3- TS was TGATTGGCTGGGCCTTGAAGAGG (SEQ ID NO: 55). To get the CRISPR / Cas9-GmE3 vector, the primers of GmE3-TS (GmE3-sense: 5'-TTGTGATTGGCTGGGCCTTGAAG-3', SEQ ID NO: 56; GmE3-anti: 5'- AACCTTCAAGGCCCAGCCAATCA-3', SEQ ID NO: 57, and the underlined stands for target sites) were synthesized and polymerized to form double chains, and then subcloned into the CRISPR / Cas9 vector (ViewSolid Biotech, VK005-15, Beijing) with the help of T4 ligase. The recombinant vector was confirmed by sequencing and named as CRISPR / Cas9-GmE3. And then, the CRISPR / Cas9-GmE3 was transformed into Agrobacterium EHA105 strain by electro transformation which was verified by PCR and sequencing. The PCR reaction system was as follows: 2×Taq Master Mix, 12.5 μL; bacterial fluid (200 ng / μL), 1 μL; Cas9-F (10 pmol / μL), 1 μL; Cas9-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. The PCR reaction was set as follows: 94°C for 3^min; 94^°C for 30^s, 55^°C for 30 s, and 72^°C for 1^min, for 35 cycles; and a final extension at 72^°C for 10^min. B.2.2 Transformation of CRISPR / Cas9-GmE3 in soybean Refer to B.1.1 B.2.3 Screening for gme3 mutant plants by sequencing analysis Genomic DNA was extracted from the leaves of each individual plant in the T0 generation, and then the regions spanning the target sites were amplified by PCR using Phanta®Super Fidelity DNA Polymerase (Vazyme Biotech) with the E3 forward primer (5’- ACTAGAGCAAACAGTTTCCA-3’, SEQ ID NO: 58) and reverse primer (5’- CTAGAATGGGGTTATGAAGTG-3’, SEQ ID NO: 59), purified using Zymoclean™ Gel DNA Recovery Kit and sequenced by TSINGKE (Beijing). Different types of gene editing can be identified via sequence peaks. Short base insertions or deletions (not multiples of three) induced by CRISPR / Cas9 can lead to frameshift mutations. The heterozygous mutations showed overlapping peaks from the target sites to the end. The wild-type and homozygous mutations had no Docket No.83142-CN-REG-ORG-P1 overlapping peaks at the target sites. Then, the homozygous mutant types were identified by sequence alignment with the wild-type sequence. This method was also used in the T1 and T2 generations. In this study, we detected only one type of homozygous mutations at the target site of E3 in the T1 generation. The type of the mutations (SEQ ID NO: 22) is 1-bp insertion (between 10 and 11 bp, the A of initiation codon ATG is considered as the position 1). B.2.4 The phenotypes of the gme3 mutant plants under different photoperiod conditions To verify whether GmE3 is involved in the regulation of photoperiodic flowering, the wild type (WT) plants and gme3 mutants were grown under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) photoperiodic conditions. The flowering time of each soybean plant was recorded as days from emergence to the R1 stage (the first flower appears at any node in the main stem). The maturity time was recorded as days from the emergence to the R7 stage (any pod becomes to the mature color) and R8 stage (95% pod becomes to the mature color). Statistical analyses and significant difference test were performed using Microsoft Excel. The significance of differences between controls and treatments at the 0.01 probability level. The flowering time and maturity time are shown as the mean values ± standard deviation. Under SD conditions, the flowering time of gme3 mutants were almost the same as WT plants (20.4±1.1 DAE for gme3 mutants vs.21.0±0.5 DAE for WT). The maturity time of gme3 mutants in R7 stage were 68.0±2.4 DAE for gme3 mutants vs. 67.3±1.0 DAE for WT. The maturity time of gme3 mutants in R8 stage were 72.9±0.6 DAE for gme3 mutants vs.72.6±0.5 DAE for WT (Table B.2.1). By contrast, under LD conditions and compared to WT plants, gme3 mutants were almost the same as WT plants (42.3±0.9 DAE for gme3 mutants vs.43.6±1.4 DAE for WT). The gme3 mutants showed earlier maturity time by about 6 days in R7 stage (141.8±2.8 DAE for gme3 mutants vs.147.0±2.5 DAE for WT), and about 8 days in R8 stage (155.6±3.9 DAE for gme3 mutants vs.163.1±4.1 DAE for WT) (Table B.2.2). These results Docket No.83142-CN-REG-ORG-P1 indicated that CRISPR / Cas9-mediated targeted mutagenesis of gme3 accelerates flowering and maturity in soybean under LD conditions. Table B.2.1 The phenotypes of WT and gme3 plants under SD conditions. Table B.2.2 The phenotypes of WT and gme3 plants under LD conditions. ** represent p<0.01. Example B.3: The e1 e3 double mutants exhibit an extreme early flowering phenotype under LD conditions. B.3.1 SgRNA design and construction of the CRISPR / Cas9 expression vector The genomic sequence of GmE1 (Glyma.06G207800) and GmE3 (Glyma.19G224200) was obtained from Phytozome database according to the gene, The target sites were designed by CRISPR-P software (on the internet at cbi.hzau.edu.cn / cgi-bin / CRISPR. The target sequence of GmE1-TS was GAGCAACCCTTCAGATGAAAGGG, SEQ ID NO: 45, and the target sequence of GmE3-TS was TGATTGGCTGGGCCTTGAAGAGG, SEQ ID NO: 55. First, to get the CRISPR / Cas9-GmE1E3 vector, the primers of GmE1-TS (GmE1- sense: 5'-TTGGAGCAACCCTTCAGATGAAA-3', SEQ ID NO: 46; GmE1-anti: 5'- AACTTTCATCTGAAGGGTTGCTC-3', SEQ ID NO: 47, and the underlined stands for target sites), and the primers of GmE3-TS (GmE3-sense: 5'- TTGTGATTGGCTGGGCCTTGAAG-3', SEQ ID NO: 48; GmE3-anti: 5'- AACCTTCAAGGCCCAGCCAATCA-3', SEQ ID NO: 49, were synthesized and polymerized to form double chains, and then subcloned into the CRISPR / Cas9 vector Docket No.83142-CN-REG-ORG-P1 (ViewSolid Biotech, VK005-15, Beijing) with the help of T4 ligase. The recombinant vector was confirmed by sequencing and named as CRISPR / Cas9-GmE1 and CRISPR / Cas9-GmE3, respectively. Second, the plasmid of CRISPR / Cas9-GmE1 was digested with Asc I and Spe I, the fragment about 570 bp was extracted using Zymoclean™ Gel DNA Recovery Kit (D4008). while the plasmid of CRISPR / Cas9-GmE3 was digested with Asc I and Avr Ⅱ, the fragment of about 14000 bp was extracted using Zymoclean™ Gel DNA Recovery Kit (D4008). Third, the two linearized fragments were then integrated by T4 DNA Ligase, the CRISPR / Cas9-GmE1E3 vector was constructed and transformed into Agrobacterium EHA105 strain by electro transformation which was verified by PCR and sequencing. The PCR reaction system was as follows: 2×Taq Master Mix, 12.5 μL; bacterial fluid (200 ng / μL), 1 μL; Cas9-F (10 pmol / μL), 1 μL; Cas9-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. The PCR reaction was set as follows: 94°C for 3^min; 94^°C for 30^s, 55^°C for 30 s, and 72^°C for 1^min, for 35 cycles; and a final extension at 72^°C for 10^min. B.3.2 Transformation of CRISPR / Cas9-GmE1E3 in soybean Refer to B.1.1 B.3.3 Screening for gme1 e3 mutant plants by sequencing analysis Genomic DNA was extracted from the leaves of each individual plant in the T0 generation, and then the regions spanning the target sites were amplified by PCR using Phanta®Super Fidelity DNA Polymerase (Vazyme Biotech) with both GmE1 and GmE3 primers. The GmE1 forward primer (5’- ACACTCAAAACACTCAAATTAAGCC-3’, SEQ ID NO: 48) and reverse primer (5’- AGGACACAGAAATTGAAAACGCA-3’, SEQ ID NO: 49), the GmE3 forward primer (5’- ACTAGAGCAAACAGTTTCCA-3’, SEQ ID NO: 58) and reverse primer (5’- CTAGAATGGGGTTATGAAGTG-3’, SEQ ID NO: 59), purified using Zymoclean™ Gel DNA Recovery Kit and sequenced by TSINGKE (Beijing). Different types of gene editing can be identified via sequence peaks. Short base Docket No.83142-CN-REG-ORG-P1 insertions or deletions (not multiples of three) induced by CRISPR / Cas9 can lead to frameshift mutations. The heterozygous mutations showed overlapping peaks from the target sites to the end. The wild-type and homozygous mutations had no overlapping peaks at the target sites. Then, the homozygous mutant types were identified by sequence alignment with the wild-type sequence. This method was also used in the T1 and T2 generations. In this study, we detected only one type of homozygous e1e3 mutations in the T1 generation. The type of the e1 mutations is 1- bp insertion (199 to 200 bp, the A of initiation codon ATG is considered as the position 1), the type of the e3 mutations (SEQ ID NO: 20) is 256-bp deletion and 5-bp insertion (158 to 413 bp deletion, 158-162 bp insertion, the A of initiation codon ATG is considered as the position 1). B.3.4 The phenotypes of the gme1 e3 mutant plants under different photoperiod conditions To verify whether GmE1 and GmE3 are involved simultaneously in the regulation of photoperiodic flowering, the wild type (WT) plants and gme1 e3 mutants were grown under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) photoperiodic conditions. The flowering time of each soybean plant was recorded as days from emergence to the R1 stage (the first flower appears at any node in the main stem). The maturity time was recorded as days from the emergence to the R7 stage (any pod becomes to the mature color) and R8 stage (95% pod becomes to the mature color). Statistical analyses and significant difference test were performed using Microsoft Excel. The significance of differences between controls and treatments at the 0.01 probability level. The flowering time and maturity time are shown as the mean values ± standard deviation. Under SD conditions, the flowering time of gme2 mutants were almost the same as WT plants (20.3±0.9 DAE for gme1 e3 mutants vs.21.0±0.5 DAE for WT). The maturity time of gme1 e3 mutants in R7 stage were 68.1±1.0 DAE for gme1 e3 mutants vs.67.3±1.0 DAE for WT. The maturity time of gme1 e3 mutants in R8 stage were 73.1±0.6 DAE for gme1 e3 mutants vs.72.6±0.5 DAE for WT (Table B.3.1). By contrast, under LD conditions Docket No.83142-CN-REG-ORG-P1 and compared to WT plants, gme1 e3 mutants showed earlier flowering time by about 14 days (29.0±0.8 DAE for gme1 e3 mutants vs.43.6±1.4 DAE for WT). The gme1 e3 mutants showed earlier maturity time by about 42 days in R7 stage (105.3±2.4 DAE for gme1 e3 mutants vs.147.0±2.5 DAE for WT), and about 51 days in R8 stage (112.8±1.6 DAE for gme1 e3 mutants vs.163.1±4.1 DAE for WT) (Table B.3.2). These results indicated that CRISPR / Cas9-mediated targeted mutagenesis of gme1 e3 accelerates flowering and maturity in soybean under LD conditions. Table B.3.1 The phenotypes of WT and gme1 e3 plants under SD conditions. Table B.3.2 The phenotypes of WT and gme1 e3 plants under LD conditions. ** represent p<0.01.

[0003] Docket No.83142-CN-REG-ORG-P1 Example C: Mutagenesis of GmE1la and GmE1lb mediated by CRISPR / Cas9 accelerates flowering in soybean C.1: The gme1la e1lb double mutants exhibit an extreme early flowering and maturity phenotype under LD conditions. C.1.1 SgRNA design and construction of the CRISPR / Cas9 expression vector The genomic sequence of GmE1la (SEQ ID NO: 2) was obtained from Phytozome database according to the Glyma.04G156400 gene, which was located on chromosome 4. The genomic sequence of GmE1lb (SEQ ID NO: 3) was obtained from Phytozome database according to the Glyma.04G143300 gene, which was located on chromosome 4. The target site of both GmE1la and GmE1lb (GmE1laE1lb-TS) was designed by CRISPR-P software (on the internet at cbi.hzau.edu.cn / cgi-bin / CRISPR. The sequence of GmE1laE1lb-TS was GCGTCTTCTTGATCTTCCAAGGG (SEQ ID NO: 60). To get the CRISPR / Cas9-GmE1laE1lb vector, the primers of GmE1laE1lb-TS (GmE1laE1lb-sense: 5'-TTGGCGTCTTCTTGATCTTCCAA-3', SEQ ID NO: 61; GmE1-anti: 5'-AACTTGGAAGATCAAGAAGACGC-3' SEQ ID NO: 62, and the underlined stands for target sites) were synthesized and polymerized to form double chains, and then subcloned into the CRISPR / Cas9 vector (ViewSolid Biotech, VK005-15, Beijing) with the help of T4 ligase. The recombinant vector was confirmed by sequencing and named as CRISPR / Cas9-GmE1laE1lb. And then, the CRISPR / Cas9-GmE1laE1lb was transformed into Agrobacterium EHA105 strain by electro transformation which was verified by PCR and sequencing. The PCR reaction system was as follows: 2×Taq Master Mix, 12.5 μL; bacterial fluid (200 ng / μL), 1 μL; Cas9-F (10 pmol / μL), 1 μL; Cas9-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. The PCR reaction was set as follows: 94°C for 3^min; 94^°C for 30^s, 55^°C for 30 s, and 72^°C for 1^min, for 35 cycles; and a final extension at 72^°C for 10^min. Docket No.83142-CN-REG-ORG-P1 C.1.2 Transformation of CRISPR / Cas9-GmE1laE1lb in soybean C.1.2.1. Plant materials The soybean Jack variety was utilized for Agrobacterium-mediated transformation. Healthy seeds were surface-sterilized by exposure to chlorine gas for 16 h. Sterilized seeds were placed in germination culture medium (GCM) containing 3.1 g / L Gamborgs Basal Salt Mixture (Phytotech, G768, Lenexa, KS, USA), 20 g / L sugar, 1mL / LGamborgs Vitamin Solution (Phytotech, G219, Lenexa, KS, USA) and 7 g / L agar (Sigma, St. Louis, MO, USA), pH 5.8, and the seeds were germinated at 25°C for 18 ~ 20 h on the light. C.1.2.2. Agrobacterium strain and vector A. tumefaciens strain EHA105 was used in the experiments. The CRISPR / Cas9 vector (ViewSolid Biotech, VK005-15, Beijing) carried T-DNA and the bar gene acted as an herbicide resistance marker. C.1.2.3. Agrobacterium preparation Agrobacterium strain stocks of EHA105 stored at -80°C were streaked on solidified YEP medium plates containing 5 g / L NaCl, 10 g / L tryptone, 5 g / L yeast extract, and 15 g / L agar, with 50 mg / L kanamycin, 75 mg / L chloromycetin and 50 mg / L rifampicin. Plates streaked with Agrobacterium were incubated at 28°C for approximately 2 days until colony formation. The colonies were collected by a spreader, daubed onto new solidified YEP medium plates with the same antibiotics and incubated overnight at 28°C. The fresh Agrobacterium were resuspended in liquid co-cultivation medium (LCCM) containing 1 / 2 Murashige&Skoog Basal Salt Mixture (Phytotech, M524, Lenexa, KS, USA), 3.9 g / L2-(N-Morpholino) ethanesulfonic acid(MES), 30 g / L sugar, 1mL / L Gamborgs Vitamin Solution, 150 mg / L dl- Dithiothreitol (DTT), 2 mg / L zeatin and 40 mg / L 3′,5′-dimethoxy-4- hydroxyacetophenone(AS), pH 5.4.Next, a final optical density of 0.6 was measured at 600 nm, and the Agrobacterium cultures were prepared for transformation. Docket No.83142-CN-REG-ORG-P1 C.1.2.4. Infection and co-cultivation Explants were prepared from one-day-old seedlings. A longitudinal cut along the hilum was made to separate the cotyledons, and the seed coat was removed. The embryonic axis found at the junctions of the hypocotyls and the cotyledon was excised to obtain the half-seed explants. The explant cuttings were immersed in Agrobacterium for 2 h at 50 rpm. After inoculation, each of the 9 cotyledons were placed in solid co-culture medium (CCM) containing 1 / 2 Murashige&Skoog Basal Salt Mixture, 3.9 g / L MES, 30 g / L sugar, 1mL / L Gamborgs Vitamin Solution, 150 mg / L DTT, 40 mg / L AS, 2 mg / L zeatin and 7 g / L agar, pH 5.4, with a piece of Whatman filter paper and then incubated at 22°C in the dark for 5 days. C.1.2.5. Recovery culture and selection culture After co-cultivation, explants were then transferred to recovery medium (SIM0) containing 3.1 g / L Gamborgs Basal Salt Mixture, 0.98 g / L MES, 30 g / L sucrose, 1 mL / L Gamborgs Vitamin Solution, 150 mg / L cefotaxime, 450 mg / L timentin, 1 mg / L 6-Benzylaminopurine (6-BA), and 7 g / L agar, pH 5.7, and incubated at 28 °C for 7 days. Seven days after recovery, the explants were transferred to selection culture medium (SIM6) containing 3.1 g / L Gamborgs Basal Salt Mixture, 0.98 g / L MES, 30 g / L sucrose, 1 mL / L Gamborgs Vitamin Solution, 150 mg / L cefotaxime, 450 mg / L timentin, 1 mg / L 6-BA, 7 g / L agar, and 6 mg / L glufosinate, pH 5.7, and incubated at 28 °C for 21 days. C.1.2.6. Shoot Elongation and Rooting After selection culture, the cotyledons and brown leaves were cut from the explants, and the remaining tissues were transferred to shoot elongation medium (SEM) containing 4.0 g / L Murashige&Skoog Basal Salt Mixture, 0.6 g / L MES, 30 g / L sucrose, 1 mL / L Gamborgs Vitamin Solution, 150 mg / L cefotaxime, 450 mg / L timentin, 0.1 mg / L 3-Indoleacetic acid (IAA), 0.5 mg / L Gibberellic acid (GA), 1 Docket No.83142-CN-REG-ORG-P1 mg / L zeatin, 7 g / L agar, and 6 mg / L glufosinate, pH 5.6, and incubated at 28 °C. The culture medium was changed every two weeks. Simultaneous with changing the SEM, the elongated shoots (5–8 cm) were cut from the base of the buds, and the stems were dipped in 1 mg / L Indole-3-Butytric acid (IBA) for 1 min, placed ina rooting culture medium (RCM) containing 1 / 2 Murashige&Skoog Basal Salt Mixture, 0.6 g / L MES, 20 g / L sucrose, 1 mL / L Gamborgs Vitamin Solution, and 7 g / L agar,3 mg / L glufosinate, pH 5.7, and incubated at 28 °C for 7 days. After root production, the plants were transferred to pots and grown in the greenhouse. C.1.3 Screening for gme1la e1lb mutant plants by sequencing analysis Genomic DNA was extracted from the leaves of each individual plant in the T0 generation, and then the regions spanning the target sites were amplified by PCR using Phanta®Super Fidelity DNA Polymerase (Vazyme Biotech) with the E1la forward primer (5’- TTCAACATTTCGTTTCTACAA-3’, SEQ ID NO: 63) and reverse primer (5’- AATTCTCTGGCATAGCTCGT-3’, SEQ ID NO: 64), the E1lb forward primer (5’- CCCGGTTAAATGTATAATTTATAACT-3’, SEQ ID NO: 65) and reverse primer (5’- GCAATAAGAACATAGCTCTTGGAA-3’, SEQ ID NO: 66), purified using Zymoclean™ Gel DNA Recovery Kit and sequenced by TSINGKE (Beijing). Different types of gene editing can be identified via sequence peaks. Short base insertions or deletions (not multiples of three) induced by CRISPR / Cas9 can lead to frameshift mutations. The heterozygous mutations showed overlapping peaks from the target sites to the end. The wild-type and homozygous mutations had no overlapping peaks at the target sites. Then, the homozygous mutant types were identified by sequence alignment with the wild-type sequence. This method was also used in the T1 and T2 generations. In this study, we detected only one type of homozygous gme1la e1lb mutations in the T1 generation. The type of the gme1la mutations (SEQ ID NO: 11) is 1-bp insertion (167 to 168 bp, the A of initiation codon ATG is considered as the position 1), the type of the gme1lb mutations (SEQ ID NO: 13) is 1-bp insertion (167 to 168 bp, the A of initiation codon ATG is considered as the position 1). Docket No.83142-CN-REG-ORG-P1 C.1.4 The phenotypes of the gme1la e1lb mutant plants under different photoperiod conditions To verify whether GmE1la and GmE1lb are involved simultaneously in the regulation of photoperiodic flowering, the wild type (WT) plants and gme1la e1lb mutants were grown under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) photoperiodic conditions. The flowering time of each soybean plant was recorded as days from emergence to the R1 stage (the first flower appears at any node in the main stem). The maturity time was recorded as days from the emergence to the R7 stage (any pod becomes to the mature color) and R8 stage (95% pod becomes to the mature color). Statistical analyses and significant difference test were performed using Microsoft Excel. The significance of differences between controls and treatments at the 0.01 probability level. The flowering time and maturity time are shown as the mean values ± standard deviation. Under SD conditions, the flowering time of gme1la e1lb mutants were almost the same as WT plants (20.3±0.5 DAE for gme1la e1lb mutants vs.21.0±0.5 DAE for WT). The maturity time of gme1la e1lb mutants in R7 stage were 64.5±1.0 DAE for gme1la e1lb mutants vs.67.3±1.0 DAE for WT. The maturity time of gme1la e1lb mutants in R8 stage were 69.8±0.5 DAE for gme1la e1lb mutants vs.72.6±0.5 DAE for WT (Table C.1.1). By contrast, under LD conditions and compared to WT plants, gme1la e1lb mutants showed earlier flowering time by about 4 days (39.4±1.2 DAE for gme1la e1lb mutants vs.43.6±1.4 DAE for WT). The gme1la e1lb mutants showed earlier maturity time by about 15 days in R7 stage (128.5±2.4 DAE for gme1la e1lb mutants vs.147.0±2.5 DAE for WT), and about 18 days in R8 stage (145.4±4.2 DAE for gme1la e1lb mutants vs. 163.1±4.1 DAE for WT) (Table C.1.2). These results indicated that CRISPR / Cas9- mediated targeted mutagenesis of gme1la e1lb accelerates flowering and maturity in soybean under LD conditions. Table C.1.1 The phenotypes of WT and gme1la e1lb plants under SD conditions. Docket No.83142-CN-REG-ORG-P1 Table C.1.2 The phenotypes of WT and gme1la e1lb plants under LD conditions. ** represent p<0.01. Example D: Mutagenesis of GmE2 and GmE3 mediated by CRISPR / Cas9 accelerates flowering in soybean D.1: CRISPR / Cas9-mediated targeted mutagenesis of gme2 accelerates flowering in soybean D.1.1 SgRNA design and construction of the CRISPR / Cas9 expression vector The genomic sequence of GmE2 was obtained from Phytozome database according to the Glyma.10G221500 gene, which was located on chromosome 10. The target site of GmE2 (GmE2-TS) was designed by CRISPR-P software (on the internet at cbi.hzau.edu.cn / cgi-bin / CRISPR. The sequence of GmE2-TS was TCTTTGTTGACCATCTGGTGGGG (SEQ ID NO: 50). To get the CRISPR / Cas9-GmE2 vector, the primers of GmE2-TS (GmE2-sense: 5'-TTGTCTTTGTTGACCATCTGGTG-3', SEQ ID NO: 51; GmE2-anti: 5'- AACCACCAGATGGTCAACAAAGA-3', SEQ ID NO: 52, and the underlined stands for target sites) were synthesized and polymerized to form double chains, and then subcloned into the CRISPR / Cas9 vector (ViewSolid Biotech, VK005-15, Beijing) with the help of T4 ligase. The recombinant vector was confirmed by sequencing and named as CRISPR / Cas9-GmE1. And then, the CRISPR / Cas9-GmE2 was transformed into Agrobacterium EHA105 strain by electro transformation which Docket No.83142-CN-REG-ORG-P1 was verified by PCR and sequencing. The PCR reaction system was as follows: 2×Taq Master Mix, 12.5 μL; bacterial fluid (200 ng / μL), 1 μL; Cas9-F (10 pmol / μL), 1 μL; Cas9-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. The PCR reaction was set as follows: 94°C for 3^min; 94^°C for 30^s, 55^°C for 30 s, and 72^°C for 1^min, for 35 cycles; and a final extension at 72^°C for 10^min. D.1.2 Transformation of CRISPR / Cas9-GmE2 in soybean D.1.2.1 Plant materials The soybean Jack variety was utilized for Agrobacterium-mediated transformation. Healthy seeds were surface-sterilized by exposure to chlorine gas for 16 h. Sterilized seeds were placed in germination culture medium (GCM) containing 3.1 g / L Gamborgs Basal Salt Mixture (Phytotech, G768), 20 g / L sugar, 1mL / LGamborgs Vitamin Solution (Phytotech, G219) and 7 g / L agar (Sigma), pH 5.8, and the seeds were germinated at 25°C for 18 ~ 20 h on the light. D.1.2.2 Agrobacterium strain and vector A. tumefaciens strain EHA105 was used in the experiments. The CRISPR / Cas9 vector (ViewSolid Biotech, VK005-15, Beijing) carried T-DNA and the bar gene acted as an herbicide resistance marker. D.1.2.3 Agrobacterium preparation Agrobacterium strain stocks of EHA105 stored at -80°C were streaked on solidified YEP medium plates containing 5 g / L NaCl, 10 g / L tryptone, 5 g / L yeast extract, and 15 g / L agar, with 50 mg / L kanamycin, 75 mg / L chloromycetin and 50 mg / L rifampicin. Plates streaked with Agrobacterium were incubated at 28°C for approximately 2 days until colony formation. The colonies were collected by a spreader, daubed onto new solidified YEP medium plates with the same antibiotics and incubated overnight at 28°C. The fresh Agrobacterium were resuspended in liquid co-cultivation medium (LCCM) containing 1 / 2 Murashige&Skoog Basal Salt Mixture (Phytotech, M524, Lenexa, KS, USA), 3.9 g / L2-(N-Morpholino) ethanesulfonic Docket No.83142-CN-REG-ORG-P1 acid(MES), 30 g / L sugar, 1mL / L Gamborgs Vitamin Solution, 150 mg / L dl- Dithiothreitol (DTT), 2 mg / L zeatin and 40 mg / L 3′,5′-dimethoxy-4- hydroxyacetophenone(AS), pH 5.4.Next, a final optical density of 0.6 was measured at 600 nm, and the Agrobacterium cultures were prepared for transformation. D.1.2.4 Infection and co-cultivation Explants were prepared from one-day-old seedlings. A longitudinal cut along the hilum was made to separate the cotyledons, and the seed coat was removed. The embryonic axis found at the junctions of the hypocotyls and the cotyledon was excised to obtain the half-seed explants. The explant cuttings were immersed in Agrobacterium for 2 h at 50 rpm. After inoculation, each of the 9 cotyledons were placed in solid co-culture medium (CCM) containing 1 / 2 Murashige&Skoog Basal Salt Mixture, 3.9 g / L MES, 30 g / L sugar, 1mL / L Gamborgs Vitamin Solution, 150 mg / L DTT, 40 mg / L AS, 2 mg / L zeatin and 7 g / L agar, pH 5.4, with a piece of Whatman filter paper and then incubated at 22°C in the dark for 5 days. D.1.2.5 Recovery culture and selection culture After co-cultivation, explants were then transferred to recovery medium (SIM0) containing 3.1 g / L Gamborgs Basal Salt Mixture, 0.98 g / L MES, 30 g / L sucrose, 1 mL / L Gamborgs Vitamin Solution, 150 mg / L cefotaxime, 450 mg / L timentin, 1 mg / L 6-Benzylaminopurine (6-BA), and 7 g / L agar, pH 5.7, and incubated at 28 °C for 7 days. Seven days after recovery, the explants were transferred to selection culture medium (SIM6) containing 3.1 g / L Gamborgs Basal Salt Mixture, 0.98 g / L MES, 30 g / L sucrose, 1 mL / L Gamborgs Vitamin Solution, 150 mg / L cefotaxime, 450 mg / L timentin, 1 mg / L 6-BA, 7 g / L agar, and 6 mg / L glufosinate, pH 5.7, and incubated at 28 °C for 21 days. D.1.2.6 Shoot Elongation and Rooting Docket No.83142-CN-REG-ORG-P1 After selection culture, the cotyledons and brown leaves were cut from the explants, and the remaining tissues were transferred to shoot elongation medium (SEM) containing 4.0 g / L Murashige&Skoog Basal Salt Mixture, 0.6 g / L MES, 30 g / L sucrose, 1 mL / L Gamborgs Vitamin Solution, 150 mg / L cefotaxime, 450 mg / L timentin, 0.1 mg / L 3-Indoleacetic acid (IAA), 0.5 mg / L Gibberellic acid (GA), 1 mg / L zeatin, 7 g / L agar, and 6 mg / L glufosinate, pH 5.6, and incubated at 28 °C. The culture medium was changed every two weeks. Simultaneous with changing the SEM, the elongated shoots (5–8 cm) were cut from the base of the buds, and the stems were dipped in 1 mg / L Indole-3-Butytric acid (IBA) for 1 min, placed ina rooting culture medium (RCM) containing 1 / 2 Murashige&Skoog Basal Salt Mixture, 0.6 g / L MES, 20 g / L sucrose, 1 mL / L Gamborgs Vitamin Solution, and 7 g / L agar,3 mg / L glufosinate, pH 5.7, and incubated at 28 °C for 7 days. After root production, the plants were transferred to pots and grown in the greenhouse. D.1.3 Screening for gme2 mutant plants by sequencing analysis Genomic DNA was extracted from the leaves of each individual plant in the T0 generation, and then the regions spanning the target sites were amplified by PCR using Phanta®Super Fidelity DNA Polymerase (Vazyme Biotech) with the GmE2 forward primer (5’- AAGCTGCATAGGAGGGCAAC-3’, SEQ ID NO: 53) and reverse primer (5’- ATGCACCAAGAACCAAAT-3’, SEQ ID NO: 54), purified using Zymoclean™ Gel DNA Recovery Kit and sequenced by TSINGKE (Beijing). Different types of gene editing can be identified via sequence peaks. Short base insertions or deletions (not multiples of three) induced by CRISPR / Cas9 can lead to frameshift mutations. The heterozygous mutations showed overlapping peaks from the target sites to the end. The wild-type and homozygous mutations had no overlapping peaks at the target sites. Then, the homozygous mutant types were identified by sequence alignment with the wild-type sequence. This method was also used in the T1 and T2 generations. In this study, we detected only one type of Docket No.83142-CN-REG-ORG-P1 homozygous mutations at the target site of GmE2 in the T1 generation. The type of the mutant is 14-bp deletion (81 to 94 bp, the A of initiation codon ATG is considered as the position 1). D.1.4 The phenotypes of the gme2 mutant plants under different photoperiod conditions To verify whether GmE2 is involved in the regulation of photoperiodic flowering, the wild type (WT) plants and gme2 mutants were grown under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) photoperiodic conditions. The flowering time of each soybean plant was recorded as days from emergence to the R1 stage (the first flower appears at any node in the main stem). The maturity time was recorded as days from the emergence to the R7 stage (any pod becomes to the mature color) and R8 stage (95% pod becomes to the mature color). Statistical analyses and significant difference test were performed using Microsoft Excel. The significance of differences between controls and treatments at the 0.01 probability level. The flowering time and maturity time are shown as the mean values ± standard deviation. Under SD conditions, the flowering time of gme2 mutants were almost the same as WT plants (20.9±0.6 DAE for gme2 mutants vs.21.0±0.5 DAE for WT). The maturity time of gme2 mutants in R7 stage were 63.9±1.3 DAE for gme2 mutants vs.67.3±1.0 DAE for WT. The maturity time of gme2 mutants in R8 stage were 70.0±2.2 DAE for gme2 mutants vs.72.6±0.5 DAE for WT (Table D.1.1). By contrast, under LD conditions and compared to WT plants, gme2 mutants showed earlier flowering time by about 11 days (32.9±1.0 DAE for gme2 mutants vs. 43.6±1.4 DAE for WT). The gme2 mutants showed earlier maturity time by about 33 days in R7 stage (114.5±2.9 DAE for gme2 mutants vs.147.0±2.5 DAE for WT), and about 38 days in R8 stage (125.4±3.7 DAE for gme2 mutants vs.163.1±4.1 DAE for WT) (Table D.1.2). These results indicated that CRISPR / Cas9-mediated targeted Docket No.83142-CN-REG-ORG-P1 mutagenesis of gme2 accelerates flowering and maturity in soybean under LD conditions. Table D.1.1 The phenotypes of WT and gme2 plants under SD conditions. Table D.1.2 The phenotypes of WT and gme2 plants under LD conditions. ** represent p<0.01. D.2: CRISPR / Cas9-mediated targeted mutagenesis of gme3 accelerates flowering in soybean D.2.1 SgRNA design and construction of the CRISPR / Cas9 expression vector The genomic sequence of GmE3 (SEQ ID NO: 5) was obtained from Phytozome database according to the Glyma.19G224200 gene, which was located on chromosome 19. The target site of GmE3 (GmE3-TS) was designed by CRISPR-P software (on the internet at cbi.hzau.edu.cn / cgi-bin / CRISPR. The sequence of GmE3- TS was TGATTGGCTGGGCCTTGAAGAGG (SEQ ID NO: 55). To get the CRISPR / Cas9-GmE3 vector, the primers of GmE3-TS (GmE3-sense: 5'-TTGTGATTGGCTGGGCCTTGAAG-3', SEQ ID NO: 56; GmE3-anti: 5'- AACCTTCAAGGCCCAGCCAATCA-3', SEQ ID NO: 57, and the underlined stands for target sites) were synthesized and polymerized to form double chains, and then subcloned into the CRISPR / Cas9 vector (ViewSolid Biotech, VK005-15, Beijing) with the help of T4 ligase. The recombinant vector was confirmed by sequencing and Docket No.83142-CN-REG-ORG-P1 named as CRISPR / Cas9-GmE3. And then, the CRISPR / Cas9-GmE3 was transformed into Agrobacterium EHA105 strain by electro transformation which was verified by PCR and sequencing. The PCR reaction system was as follows: 2×Taq Master Mix, 12.5 μL; bacterial fluid (200 ng / μL), 1 μL; Cas9-F (10 pmol / μL), 1 μL; Cas9-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. The PCR reaction was set as follows: 94°C for 3^min; 94^°C for 30^s, 55^°C for 30 s, and 72^°C for 1^min, for 35 cycles; and a final extension at 72^°C for 10^min. D.2.2 Transformation of CRISPR / Cas9-GmE3 in soybean Refer to D.1.1 D.2.3 Screening for gme3 mutant plants by sequencing analysis Genomic DNA was extracted from the leaves of each individual plant in the T0 generation, and then the regions spanning the target sites were amplified by PCR using Phanta®Super Fidelity DNA Polymerase (Vazyme Biotech) with the E3 forward primer (5’- ACTAGAGCAAACAGTTTCCA-3’, SEQ ID NO: 58) and reverse primer (5’- CTAGAATGGGGTTATGAAGTG-3’, SEQ ID NO: 59), purified using Zymoclean™ Gel DNA Recovery Kit and sequenced by TSINGKE (Beijing). Different types of gene editing can be identified via sequence peaks. Short base insertions or deletions (not multiples of three) induced by CRISPR / Cas9 can lead to frameshift mutations. The heterozygous mutations showed overlapping peaks from the target sites to the end. The wild-type and homozygous mutations had no overlapping peaks at the target sites. Then, the homozygous mutant types were identified by sequence alignment with the wild-type sequence. This method was also used in the T1 and T2 generations. In this study, we detected only one type of homozygous mutations at the target site of E3 in the T1 generation. The type of the mutations is 1-bp insertion (between 10 and 11 bp, the A of initiation codon ATG is considered as the position 1). D.2.4 The phenotypes of the gme3 mutant plants under different photoperiod conditions Docket No.83142-CN-REG-ORG-P1 To verify whether GmE3 is involved in the regulation of photoperiodic flowering, the wild type (WT) plants and gme3 mutants were grown under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) photoperiodic conditions. The flowering time of each soybean plant was recorded as days from emergence to the R1 stage (the first flower appears at any node in the main stem). The maturity time was recorded as days from the emergence to the R7 stage (any pod becomes to the mature color) and R8 stage (95% pod becomes to the mature color). Statistical analyses and significant difference test were performed using Microsoft Excel. The significance of differences between controls and treatments at the 0.01 probability level. The flowering time and maturity time are shown as the mean values ± standard deviation. Under SD conditions, the flowering time of gme3 mutants were almost the same as WT plants (20.4±1.1 DAE for gme3 mutants vs.21.0±0.5 DAE for WT). The maturity time of gme3 mutants in R7 stage were 68.0±2.4 DAE for gme3 mutants vs. 67.3±1.0 DAE for WT. The maturity time of gme3 mutants in R8 stage were 72.9±0.6 DAE for gme3 mutants vs.72.6±0.5 DAE for WT (Table D.2.1). By contrast, under LD conditions and compared to WT plants, gme3 mutants were almost the same as WT plants (42.3±0.9 DAE for gme3 mutants vs.43.6±1.4 DAE for WT). The gme3 mutants showed earlier maturity time by about 6 days in R7 stage (141.8±2.8 DAE for gme3 mutants vs.147.0±2.5 DAE for WT), and about 8 days in R8 stage (155.6±3.9 DAE for gme3 mutants vs.163.1±4.1 DAE for WT) (Table D.2.2). These results indicated that CRISPR / Cas9-mediated targeted mutagenesis of gme3 accelerates flowering and maturity in soybean under LD conditions. Table D.2.1 The phenotypes of WT and gme3 plants under SD conditions. Table D.2.2 The phenotypes of WT and gme3 plants under LD conditions. Docket No.83142-CN-REG-ORG-P1 ** represent p<0.01. D.3: The gme2 e3 double mutants exhibit an extreme early flowering phenotype under LD conditions. D.3.1 SgRNA design and construction of the CRISPR / Cas9 expression vector The genomic sequence of Gme2 (Glyma.10G221500) and Gme3 (Glyma.19G224200) was obtained from Phytozome database according to the gene, The target sites were designed by CRISPR-P software (on the internet at cbi.hzau.edu.cn / cgi-bin / CRISPR. The target sequence of GmE2-TS was TCTTTGTTGACCATCTGGTGGGG (SEQ ID NO: 50), and the target sequence of GmE3-TS was TGATTGGCTGGGCCTTGAAGAGG (SEQ ID NO: 55). First, To get the CRISPR / Cas9-GmE2E3 vector, the primers of GmE2-TS (GmE2-sense: 5'-TTGTCTTTGTTGACCATCTGGTG-3', SEQ ID NO: 51; GmE2- anti: 5'- AACCACCAGATGGTCAACAAAGA -3', SEQ ID NO: 52, and the underlined stands for target sites), and the primers of GmE3-TS (GmE3-sense: 5'- TTGTGATTGGCTGGGCCTTGAAG -3', SEQ ID NO: 56; GmE3-anti: 5'- AACCTTCAAGGCCCAGCCAATCA -3', SEQ ID NO: 57, and the underlined stands for target sites) were synthesized and polymerized to form double chains, and then subcloned into the CRISPR / Cas9 vector (ViewSolid Biotech, VK005-15, Beijing) with the help of T4 ligase. The recombinant vector was confirmed by sequencing and named as CRISPR / Cas9-GmE2 and CRISPR / Cas9-GmE3, respectively. Second, the plasmid of CRISPR / Cas9-GmE2 was digested with Asc I and Spe I, the fragment about 570 bp was extracted using Zymoclean™ Gel DNA Recovery Kit (D4008). while the plasmid of CRISPR / Cas9-GmE3 was digested with Asc I and Avr Ⅱ, the fragment of about 14000 bp was extracted using Zymoclean™ Gel DNA Recovery Kit (D4008). Third, the two linearized fragments were then integrated by T4 DNA Ligase, the CRISPR / Cas9-GmE2E3 vector was constructed Docket No.83142-CN-REG-ORG-P1 and transformed into Agrobacterium EHA105 strain by electro transformation which was verified by PCR and sequencing. The PCR reaction system was as follows: 2×Taq Master Mix, 12.5 μL; bacterial fluid (200 ng / μL), 1 μL; Cas9-F (10 pmol / μL), 1 μL; Cas9-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. The PCR reaction was set as follows: 94°C for 3^min; 94^°C for 30^s, 55^°C for 30 s, and 72^°C for 1^min, for 35 cycles; and a final extension at 72^°C for 10^min. D.3.2 Transformation of CRISPR / Cas9-GmE2E3 in soybean Refer to D.1.1 D.3.3 Screening for gme2 e3 mutant plants by sequencing analysis Genomic DNA was extracted from the leaves of each individual plant in the T0 generation, and then the regions spanning the target sites were amplified by PCR using Phanta®Super Fidelity DNA Polymerase (Vazyme Biotech) with both GmE2 and GmE3 primers. The GmE2 forward primer (5’- AAGCTGCATAGGAGGGCAAC -3’, SEQ ID NO: 53) and reverse primer (5’- ATGCACCAAGAACCAAAT -3’, SEQ ID NO: 54), the GmE3 forward primer (5’- ACTAGAGCAAACAGTTTCCA -3’, SEQ ID NO: 58) and reverse primer (5’- CTAGAATGGGGTTATGAAGTG -3’, SEQ ID NO: 59), purified using Zymoclean™ Gel DNA Recovery Kit and sequenced by TSINGKE (Beijing). Different types of gene editing can be identified via sequence peaks. Short base insertions or deletions (not multiples of three) induced by CRISPR / Cas9 can lead to frameshift mutations. The heterozygous mutations showed overlapping peaks from the target sites to the end. The wild-type and homozygous mutations had no overlapping peaks at the target sites. Then, the homozygous mutant types were identified by sequence alignment with the wild-type sequence. This method was also used in the T1 and T2 generations. In this study, we detected only one type of homozygous gme2 e3 mutations in the T1 generation. The type of the e2 mutations (SEQ ID NO: 17) is 8-bp deletion (89 to 96 bp, the A of initiation codon ATG is considered as the position 1), the type of the e3 mutations (SEQ ID NO: 21) is 4-bp Docket No.83142-CN-REG-ORG-P1 deletion (178 to 181 bp, the A of initiation codon ATG is considered as the position 1). D.3.4 The phenotypes of the gme2 e3 mutant plants under different photoperiod conditions To verify whether GmE2 and GmE3 are involved simultaneously in the regulation of photoperiodic flowering, the wild type (WT) plants and gme2 e3 mutants were grown under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) photoperiodic conditions. The flowering time of each soybean plant was recorded as days from emergence to the R1 stage (the first flower appears at any node in the main stem). The maturity time was recorded as days from the emergence to the R7 stage (any pod becomes to the mature color) and R8 stage (95% pod becomes to the mature color). Statistical analyses and significant difference test were performed using Microsoft Excel. The significance of differences between controls and treatments at the 0.01 probability level. The flowering time and maturity time are shown as the mean values ± standard deviation. Under SD conditions, the flowering time of gme2 mutants were almost the same as WT plants (20.5±0.9 DAE for gme2 e3 mutants vs.21.0±0.5 DAE for WT). The maturity time of gme2 e3 mutants in R7 stage were 64.1±1.5 DAE for gme2 e3 mutants vs.67.3±1.0 DAE for WT. The maturity time of gme2 e3 mutants in R8 stage were 70.6±1.4 DAE for gme2 e3 mutants vs.72.6±0.5 DAE for WT (Table D.3.1). By contrast, under LD conditions and compared to WT plants, gme2 e3 mutants showed earlier flowering time by about 10 days (33.4±0.9 DAE for gme2 e3 mutants vs.43.6±1.4 DAE for WT). The gme2 e3 mutants showed earlier maturity time by about 40 days in R7 stage (105.3±2.4 DAE for gme2 e3 mutants vs.147.0±2.5 DAE for WT), and about 50 days in R8 stage (113.4±1.8 DAE for gme2 e3 mutants vs.163.1±4.1 DAE for WT) (Table D.3.2). These results indicated that CRISPR / Cas9-mediated targeted mutagenesis of gme2 e3 accelerates flowering and maturity in soybean under LD conditions. Table D.3.1 The phenotypes of WT and gme2 e3 plants under SD conditions. Docket No.83142-CN-REG-ORG-P1 Table D.3.2 The phenotypes of WT and gme2 e3 plants under LD conditions. ** represent p<0.01. Example E: Mutagenesis of GmE3 and GmE4 mediated by CRISPR / Cas9 accelerates flowering in soybean E.1.1 SgRNA design and construction of the CRISPR / Cas9 expression vector The genomic sequence of GmE3 was obtained from Phytozome database according to the Glyma.19G224200 gene, which was located on chromosome 19. The target site of GmE3 (GmE3-TS) was designed by CRISPR-P software (on the internet at cbi.hzau.edu.cn / cgi-bin / CRISPR. The sequence of GmE3-TS was TGATTGGCTGGGCCTTGAAGAGG (SEQ ID NO: 55). To get the CRISPR / Cas9-GmE3 vector, the primers of GmE3-TS (GmE3-sense: 5'-TTGTGATTGGCTGGGCCTTGAAG-3, SEQ ID NO: 56; GmE3-anti: 5'- AACCTTCAAGGCCCAGCCAATCA-3', SEQ ID NO: 57, and the underlined stands for target sites) were synthesized and polymerized to form double chains, and then subcloned into the CRISPR / Cas9 vector (ViewSolid Biotech, VK005-15, Beijing) with the help of T4 ligase. The recombinant vector was confirmed by sequencing and named as CRISPR / Cas9-GmE3. And then, the CRISPR / Cas9-GmE3 was transformed into Agrobacterium EHA105 strain by electro transformation which was verified by PCR and sequencing. The PCR reaction system was as follows: 2×Taq Master Mix, 12.5 μL; bacterial fluid (200 ng / μL), 1 μL; Cas9-F (10 pmol / μL), 1 μL; Cas9-R (10 Docket No.83142-CN-REG-ORG-P1 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. The PCR reaction was set as follows: 94°C for 3^min; 94^°C for 30^s, 55^°C for 30 s, and 72^°C for 1^min, for 35 cycles; and a final extension at 72^°C for 10^min. E.1.2 Transformation of CRISPR / Cas9-GmE3 in soybean E.1.2.1. Plant materials The soybean Jack variety was utilized for Agrobacterium-mediated transformation. Healthy seeds were surface-sterilized by exposure to chlorine gas for 16 h. Sterilized seeds were placed in germination culture medium (GCM) containing 3.1 g / L Gamborgs Basal Salt Mixture (Phytotech, G768, Lenexa, KS, USA), 20 g / L sugar, 1mL / LGamborgs Vitamin Solution (Phytotech, G219, Lenexa, KS, USA) and 7 g / L agar (Sigma, St. Louis, MO, USA), pH 5.8, and the seeds were germinated at 25°C for 18 ~ 20 h on the light. E.1.2.2. Agrobacterium strain and vector A. tumefaciens strain EHA105 was used in the experiments. The CRISPR / Cas9 vector (ViewSolid Biotech, VK005-15, Beijing) carried T-DNA and the bar gene acted as an herbicide resistance marker. E.1.2.3. Agrobacterium preparation Agrobacterium strain stocks of EHA105 stored at -80°C were streaked on solidified YEP medium plates containing 5 g / L NaCl, 10 g / L tryptone, 5 g / L yeast extract, and 15 g / L agar, with 50 mg / L kanamycin, 75 mg / L chloromycetin and 50 mg / L rifampicin. Plates streaked with Agrobacterium were incubated at 28°C for approximately 2 days until colony formation. The colonies were collected by a spreader, daubed onto new solidified YEP medium plates with the same antibiotics and incubated overnight at 28°C. The fresh Agrobacterium were resuspended in liquid co-cultivation medium (LCCM) containing 1 / 2 Murashige&Skoog Basal Salt Mixture Docket No.83142-CN-REG-ORG-P1 (Phytotech, M524, Lenexa, KS, USA), 3.9 g / L2-(N-Morpholino) ethanesulfonic acid(MES), 30 g / L sugar, 1mL / L Gamborgs Vitamin Solution, 150 mg / L dl- Dithiothreitol (DTT), 2 mg / L zeatin and 40 mg / L 3′,5′-dimethoxy-4- hydroxyacetophenone(AS), pH 5.4.Next, a final optical density of 0.6 was measured at 600 nm, and the Agrobacterium cultures were prepared for transformation. E.1.2.4. Infection and co-cultivation Explants were prepared from one-day-old seedlings. A longitudinal cut along the hilum was made to separate the cotyledons, and the seed coat was removed. The embryonic axis found at the junctions of the hypocotyls and the cotyledon was excised to obtain the half-seed explants. The explant cuttings were immersed in Agrobacterium for 2 h at 50 rpm. After inoculation, each of the 9 cotyledons were placed in solid co-culture medium (CCM) containing 1 / 2 Murashige&Skoog Basal Salt Mixture, 3.9 g / L MES, 30 g / L sugar, 1mL / L Gamborgs Vitamin Solution, 150 mg / L DTT, 40 mg / L AS, 2 mg / L zeatin and 7 g / L agar, pH 5.4, with a piece of Whatman filter paper and then incubated at 22°C in the dark for 5 days. E.1.2.5. Recovery culture and selection culture After co-cultivation, explants were then transferred to recovery medium (SIM0) containing 3.1 g / L Gamborgs Basal Salt Mixture, 0.98 g / L MES, 30 g / L sucrose, 1 mL / L Gamborgs Vitamin Solution, 150 mg / L cefotaxime, 450 mg / L timentin, 1 mg / L 6-Benzylaminopurine (6-BA), and 7 g / L agar, pH 5.7, and incubated at 28 °C for 7 days. Seven days after recovery, the explants were transferred to selection culture medium (SIM6) containing 3.1 g / L Gamborgs Basal Salt Mixture, 0.98 g / L MES, 30 g / L sucrose, 1 mL / L Gamborgs Vitamin Solution, 150 mg / L cefotaxime, 450 mg / L timentin, 1 mg / L 6-BA, 7 g / L agar, and 6 mg / L glufosinate, pH 5.7, and incubated at 28 °C for 21 days. E.1.2.6. Shoot Elongation and Rooting Docket No.83142-CN-REG-ORG-P1 After selection culture, the cotyledons and brown leaves were cut from the explants, and the remaining tissues were transferred to shoot elongation medium (SEM) containing 4.0 g / L Murashige&Skoog Basal Salt Mixture, 0.6 g / L MES, 30 g / L sucrose, 1 mL / L Gamborgs Vitamin Solution, 150 mg / L cefotaxime, 450 mg / L timentin, 0.1 mg / L 3-Indoleacetic acid (IAA), 0.5 mg / L Gibberellic acid (GA), 1 mg / L zeatin, 7 g / L agar, and 6 mg / L glufosinate, pH 5.6, and incubated at 28 °C. The culture medium was changed every two weeks. Simultaneous with changing the SEM, the elongated shoots (5–8 cm) were cut from the base of the buds, and the stems were dipped in 1 mg / L Indole-3-Butytric acid (IBA) for 1 min, placed ina rooting culture medium (RCM) containing 1 / 2 Murashige&Skoog Basal Salt Mixture, 0.6 g / L MES, 20 g / L sucrose, 1 mL / L Gamborgs Vitamin Solution, and 7 g / L agar,3 mg / L glufosinate, pH 5.7, and incubated at 28 °C for 7 days. After root production, the plants were transferred to pots and grown in the greenhouse. E.1.3 Screening for gme3 mutant plants by sequencing analysis Genomic DNA was extracted from the leaves of each individual plant in the T0 generation, and then the regions spanning the target sites were amplified by PCR using Phanta®Super Fidelity DNA Polymerase (Vazyme Biotech) with the E3 forward primer (5’- ACTAGAGCAAACAGTTTCCA-3’, SEQ ID NO: 58) and reverse primer (5’- CTAGAATGGGGTTATGAAGTG-3’, SEQ ID NO: 59), purified using Zymoclean™ Gel DNA Recovery Kit and sequenced by TSINGKE (Beijing). Different types of gene editing can be identified via sequence peaks. Short base insertions or deletions (not multiples of three) induced by CRISPR / Cas9 can lead to frameshift mutations. The heterozygous mutations showed overlapping peaks from the target sites to the end. The wild-type and homozygous mutations had no overlapping peaks at the target sites. Then, the homozygous mutant types were identified by sequence alignment with the wild-type sequence. This method was also used in the T1 and T2 generations. In this study, we detected only one type of homozygous mutations at the target site of E3 in the T1 generation. The type of the Docket No.83142-CN-REG-ORG-P1 mutations is 1-bp insertion (between 10 and 11 bp, the A of initiation codon ATG is considered as the position 1). E.1.4 The phenotypes of the gme3 mutant plants under different photoperiod conditions To verify whether GmE3 is involved in the regulation of photoperiodic flowering, the wild type (WT) plants and gme3 mutants were grown under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) photoperiodic conditions. The flowering time of each soybean plant was recorded as days from emergence to the R1 stage (the first flower appears at any node in the main stem). The maturity time was recorded as days from the emergence to the R7 stage (any pod becomes to the mature color) and R8 stage (95% pod becomes to the mature color). Statistical analyses and significant difference test were performed using Microsoft Excel. The significance of differences between controls and treatments at the 0.01 probability level. The flowering time and maturity time are shown as the mean values ± standard deviation. Under SD conditions, the flowering time of gme3 mutants were almost the same as WT plants (20.4±1.1 DAE for gme3 mutants vs.21.0±0.5 DAE for WT). The maturity time of gme3 mutants in R7 stage were 68.0±2.4 DAE for gme3 mutants vs. 67.3±1.0 DAE for WT. The maturity time of gme3 mutants in R8 stage were 72.9±0.6 DAE for gme3 mutants vs.72.6±0.5 DAE for WT (Table E.1.1). By contrast, under LD conditions and compared to WT plants, gme3 mutants were almost the same as WT plants (42.3±0.9 DAE for gme3 mutants vs.43.6±1.4 DAE for WT). The gme3 mutants showed earlier maturity time by about 6 days in R7 stage (141.8±2.8 DAE for gme3 mutants vs.147.0±2.5 DAE for WT), and about 8 days in R8 stage (155.6±3.9 DAE for gme3 mutants vs.163.1±4.1 DAE for WT) (Table E.1.2). These results indicated that CRISPR / Cas9-mediated targeted mutagenesis of gme3 accelerates flowering and maturity in soybean under LD conditions. Table E.1.1 The phenotypes of WT and gme3 plants under SD conditions. Docket No.83142-CN-REG-ORG-P1 Table E.1.2 The phenotypes of WT and gme3 plants under LD conditions. ** represent p<0.01. E.2: CRISPR / Cas9-mediated targeted mutagenesis of gme4 accelerates flowering in soybean E.2.1 SgRNA design and construction of the CRISPR / Cas9 expression vector The genomic sequence of GmE4 (SEQ ID NO: 6) was obtained from Phytozome database according to the Glyma.20G090000 gene, which was located on chromosome 20. The target site of GmE4 (GmE4-TS) was designed by CRISPR-P software (on the internet at cbi.hzau.edu.cn / cgi-bin / CRISPR. The sequence of GmE4- TS was TCCAGTTCGGTGCGCATCTCTGG (SEQ ID NO: 67). To get the CRISPR / Cas9-GmE4 vector, the primers of GmE4-TS (GmE4-sense: 5'-TTGTCCAGTTCGGTGCGCATCTC-3’, SEQ ID NO: 68; GmE4-anti: 5'- AACGAGATGCGCACCGAACTGGA-3', SEQ ID NO: 69, and the underlined stands for target sites) were synthesized and polymerized to form double chains, and then subcloned into the CRISPR / Cas9 vector (ViewSolid Biotech, VK005-15, Beijing) with the help of T4 ligase. The recombinant vector was confirmed by sequencing and named as CRISPR / Cas9-GmE4. And then, the CRISPR / Cas9-GmE4 was transformed into Agrobacterium EHA105 strain by electro transformation which was verified by PCR and sequencing. The PCR reaction system was as follows: 2×Taq Master Mix, 12.5 μL; bacterial fluid (200 ng / μL), 1 μL; Cas9-F (10 pmol / μL), 1 μL; Cas9-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. The PCR reaction was set as follows: 94°C for 3^min; 94^°C for 30^s, 55^°C for 30 s, and 72^°C for 1^min, for 35 cycles; and a final extension at 72^°C for 10^min. Docket No.83142-CN-REG-ORG-P1 E.2.2 Transformation of CRISPR / Cas9-GmE4 in soybean Refer to E.1.1 E.2.3 Screening for gme4 mutant plants by sequencing analysis Genomic DNA was extracted from the leaves of each individual plant in the T0 generation, and then the regions spanning the target sites were amplified by PCR using Phanta®Super Fidelity DNA Polymerase (Vazyme Biotech) with the E4 forward primer (5’- TCTTGAGAAGGTGTTGGA-3’, SEQ ID NO: 70) and reverse primer (5’- TAAGGACAGGGTTAAGAAGCA-3’, SEQ ID NO: 71), purified using Zymoclean™ Gel DNA Recovery Kit and sequenced by TSINGKE (Beijing). Different types of gene editing can be identified via sequence peaks. Short base insertions or deletions (not multiples of three) induced by CRISPR / Cas9 can lead to frameshift mutations. The heterozygous mutations showed overlapping peaks from the target sites to the end. The wild-type and homozygous mutations had no overlapping peaks at the target sites. Then, the homozygous mutant types were identified by sequence alignment with the wild-type sequence. This method was also used in the T1 and T2 generations. In this study, we detected only one type of homozygous mutations at the target site of GmE4 in the T1 generation. The type of the mutations (SEQ ID NO: 25) is 2-bp deletion (151 to 152 bp, the A of initiation codon ATG is considered as the position 1). E.2.4 The phenotypes of the gme4 mutant plants under different photoperiod conditions To verify whether GmE4 is involved in the regulation of photoperiodic flowering, the wild type (WT) plants and gme4 mutants were grown under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) photoperiodic conditions. The flowering time of each soybean plant was recorded as days from emergence to the R1 stage (the first flower appears at any node in the main stem). The maturity time was recorded as days from the emergence to the R7 stage (any pod becomes to the mature Docket No.83142-CN-REG-ORG-P1 color) and R8 stage (95% pod becomes to the mature color). Statistical analyses and significant difference test were performed using Microsoft Excel. The significance of differences between controls and treatments at the 0.01 probability level. The flowering time and maturity time are shown as the mean values ± standard deviation. Under SD conditions, the flowering time of gme3 mutants were almost the same as WT plants (20.9±1.2 DAE for gme4 mutants vs.21.0±0.5 DAE for WT). The maturity time of gme4 mutants in R7 stage were 63.3±1.8 DAE for gme4 mutants vs. 67.3±1.0 DAE for WT. The maturity time of gme4 mutants in R8 stage were 69.1±1.5 DAE for gme4 mutants vs.72.6±0.5 DAE for WT (Table E.2.1). By contrast, under LD conditions and compared to WT plants, gme4 mutants were almost the same as WT plants (42.3±0.9 DAE for gme4 mutants vs.43.6±1.4 DAE for WT). The gme4 mutants showed earlier maturity time by about 6 days in R7 stage (141.8±2.8 DAE for gme4 mutants vs.147.0±2.5 DAE for WT), and about 8 days in R8 stage (155.6±3.9 DAE for gme4 mutants vs.163.1±4.1 DAE for WT) (Table E.2.2). These results indicated that CRISPR / Cas9-mediated targeted mutagenesis of gme4 accelerates flowering and maturity in soybean under LD conditions. Table E.2.1 The phenotypes of WT and gme4 plants under SD conditions. Table E.2.2 The phenotypes of WT and gme4 plants under LD conditions. ** represent p<0.01. Docket No.83142-CN-REG-ORG-P1 E.3: The gme3 e4 double mutants exhibit an extreme early flowering phenotype under LD conditions. E.3.1 SgRNA design and construction of the CRISPR / Cas9 expression vector The genomic sequence of GmE3 (Glyma.19G224200, SEQ ID NO: 5) and GmE4 (Glyma.20G090000, SEQ ID NO: 6) was obtained from Phytozome database according to the gene, The target sites were designed by CRISPR-P software (on the internet at cbi.hzau.edu.cn / cgi-bin / CRISPR. The target sequence of GmE3-TS was TGATTGGCTGGGCCTTGAAGAGG (SEQ ID NO: 55), and the target sequence of GmE4-TS was TCCAGTTCGGTGCGCATCTCTGG (SEQ ID NO: 67). First, to get the CRISPR / Cas9-GmE3E4 vector, the primers of GmE3-TS (GmE3- sense: 5'- TTGTGATTGGCTGGGCCTTGAAG -3', SEQ ID NO: 56; GmE3-anti: 5'- AACCTTCAAGGCCCAGCCAATCA -3', SEQ ID NO: 57, and the underlined stands for target sites), and the primers of GmE4-TS (GmE4-sense: 5'- TTGTCCAGTTCGGTGCGCATCTC -3', SEQ ID NO: 68; GmE4-anti: 5'- AACGAGATGCGCACCGAACTGGA -3', SEQ ID NO: 69, were synthesized and polymerized to form double chains, and then subcloned into the CRISPR / Cas9 vector (ViewSolid Biotech, VK005-15, Beijing) with the help of T4 ligase. The recombinant vector was confirmed by sequencing and named as CRISPR / Cas9-GmE3 and CRISPR / Cas9-GmE4, respectively. Second, the plasmid of CRISPR / Cas9-GmE3 was digested with Asc I and Spe I, the fragment about 570 bp was extracted using Zymoclean™ Gel DNA Recovery Kit (D4008). while the plasmid of CRISPR / Cas9-GmE4 was digested with Asc I and Avr Ⅱ, the fragment of about 14000 bp was extracted using Zymoclean™ Gel DNA Recovery Kit (D4008). Third, the two linearized fragments were then integrated by T4 DNA Ligase, the CRISPR / Cas9-GmE3E4 vector was constructed and transformed into Agrobacterium EHA105 strain by electro transformation which was verified by PCR and sequencing. The PCR reaction system was as follows: 2×Taq Master Mix, 12.5 μL; bacterial fluid (200 ng / μL), 1 μL; Cas9-F (10 pmol / μL), 1 μL; Cas9-R (10 pmol / μL), 1 μL; ddH2O Docket No.83142-CN-REG-ORG-P1 9.5 μL, total volume 25 μL. The PCR reaction was set as follows: 94°C for 3^min; 94^°C for 30^s, 55^°C for 30 s, and 72^°C for 1^min, for 35 cycles; and a final extension at 72^°C for 10^min. E.3.2 Transformation of CRISPR / Cas9-GmE3E4 in soybean Refer to E.1.1 E.3.3 Screening for gme3 e4 mutant plants by sequencing analysis Genomic DNA was extracted from the leaves of each individual plant in the T0 generation, and then the regions spanning the target sites were amplified by PCR using Phanta®Super Fidelity DNA Polymerase (Vazyme Biotech) with both GmE3 and GmE4 primers. The E3 forward primer (5’- ACTAGAGCAAACAGTTTCCA - 3’, SEQ ID NO: 58) and reverse primer (5’- CTAGAATGGGGTTATGAAGTG -3’, SEQ ID NO: 59), the E4 forward primer (5’- TCTTGAGAAGGTGTTGGA -3’, SEQ ID NO: 70) and reverse primer (5’- TAAGGACAGGGTTAAGAAGCA -3’, SEQ ID NO: 71), were purified using Zymoclean™ Gel DNA Recovery Kit and sequenced by TSINGKE (Beijing). Different types of gene editing can be identified via sequence peaks. Short base insertions or deletions (not multiples of three) induced by CRISPR / Cas9 can lead to frameshift mutations. The heterozygous mutations showed overlapping peaks from the target sites to the end. The wild-type and homozygous mutations had no overlapping peaks at the target sites. Then, the homozygous mutant types were identified by sequence alignment with the wild-type sequence. This method was also used in the T1 and T2 generations. In this study, we detected only one type of homozygous e3 e4 mutations in the T1 generation. The type of the e3 mutation (SEQ ID NO: 19) is 1-bp insertion (between 181 and 182 bp, the A of initiation codon ATG is considered as the position 1), the type of the e4 mutations (SEQ ID NO: 24) is 3-bp deletion (150 to 152 bp, the A of initiation codon ATG is considered as the position 1). Docket No.83142-CN-REG-ORG-P1 E.3.4 The phenotypes of the gme3 e4 mutant plants under different photoperiod conditions To verify whether GmE3 and GmE4 are involved simultaneously in the regulation of photoperiodic flowering, the wild type (WT) plants and gme3 e4 mutants were grown under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) photoperiodic conditions. The flowering time of each soybean plant was recorded as days from emergence to the R1 stage (the first flower appears at any node in the main stem). The maturity time was recorded as days from the emergence to the R7 stage (any pod becomes to the mature color) and R8 stage (95% pod becomes to the mature color). Statistical analyses and significant difference test were performed using Microsoft Excel. The significance of differences between controls and treatments at the 0.01 probability level. The flowering time and maturity time are shown as the mean values ± standard deviation. Under SD conditions, the flowering time of gme3 e4 mutants were almost the same as WT plants (21.5±1.3 DAE for gme3 e4 mutants vs.21.0±0.5 DAE for WT). The maturity time of gme3 e4 mutants in R7 stage were 69.0±1.8 DAE for gme3 e4 mutants vs.67.3±1.0 DAE for WT. The maturity time of gme3 e4 mutants in R8 stage were 73.5±0.6 DAE for gme3 e4 mutants vs.72.6±0.5 DAE for WT (Table E.3.1). By contrast, under LD conditions and compared to WT plants, gme1 e3 mutants showed earlier flowering time by about 4 days (39.4±1.2 DAE for gme3 e4 mutants vs.43.6±1.4 DAE for WT). The gme3 e4 mutants showed earlier maturity time by about 15 days in R7 stage (128.5±2.4 DAE for gme3 e4 mutants vs.147.0±2.5 DAE for WT), and about 18 days in R8 stage (145.4±4.2 DAE for gme3 e4 mutants vs.163.1±4.1 DAE for WT) (Table E.3.2). These results indicated that CRISPR / Cas9-mediated targeted mutagenesis of gme3 e4 accelerates flowering and maturity in soybean under LD conditions. Table E.3.1 The phenotypes of WT and gme3 e4 plants under SD conditions. Docket No.83142-CN-REG-ORG-P1 Table E.3.2 The phenotypes of WT and gme3 e4 plants under LD conditions. ** represent p<0.01. E.4.1. Creation of additional GmE4 mutants based on CRISPR / Cas9 gene editing technology E.4.1.1. Plant materials and growth conditions Soybean cultivar Jack was used for genetic transformation in this study. Jack (as a control) and all seeds harvested from E4-CRISPR / Cas9 T0 plants were planted under natural conditions (ND) in Beijing, China. T2plants of homozygous GmE4 mutants were planted in greenhouse under long-day (LD, 16 h light / 8 h dark) and short-day (SD, 12 h light / 12 h dark) conditions at 27, 50% relative humidity. E.4.1.2 SgRNA design and construction of the CRISPR / Cas9 expression vector The expression cassette of sgRNA was driven by the AtU6 promoter of Arabidopsis, while the expression cassette of Cas9 protein was driven by the CaMV35s promoter. The bar gene driven by the CaMV35s promoter served as a screening marker. The sequences were synthesized by Qingke (Beijing, China). Two sgRNAs (20 bp) followed by 5’-NGG (PAM, protospacer adjacent motif) were designed using the web tool CRISPR-P (on the worldwide web at crispr.hzau.edu.cn / CRISPR2 / ), named as E4-SG1 and E4-SG2, respectively. The sgRNA for E4-SG1 (5’-GAGATCAAGACGTAGTGCTA-3’, SEQ ID NO: 72) and E4-SG2 (5’- TCCAGTTCGGTGCGCATCTC-3’, SEQ ID NO: 73) primers were synthesized and subsequently integrated into a vector and placed after the AtU6 promoter. The Docket No.83142-CN-REG-ORG-P1 CRISPR / Cas9 expression vectors were transformed into Agrobacterium tumefaciens strain EHA105 by electroporation and used for subsequent soybean transformation. E.4.1.3 Agrobacterium tumefaciens mediated soybean genetic transformation experiment According to the protocol previously reported (Chen, et al. (2018) Int. J. Mol. Sci.19, 3039), the soybean cultivar Jack was used for genetic transformation. E.4.1.4 Screening for homozygous and transgene-free mutant Genomic DNA was extracted from the leaves of each individual plant, and then the regions spanning the target sites were amplified by PCR using Taq Plus 2x Master Mix (CW Biotech) with the E4 specific primer (forward primer (5’- TCTTGAGAAGGTGTTGGA-3’, SEQ ID NO: 70) and reverse primer (5’- TAAGGACAGGGTTAAGAAGCA-3’, SEQ ID NO: 71)), purified and sequenced. The types of gene editing can be identified by sequence peaks. The heterozygous mutants showed overlapping peaks from the target sites to the end. The wild-type and homozygous mutants had no overlapping peaks at the target sites. Then, the homozygous mutant types were identified by sequence alignment with the WT sequence. E.4.1.5 Phenotypic statistics The flowering time of each soybean plants was recorded as days from emergence to the R1 stage (the first flower appears at any node in the main stem) and R7 stage (a pod with a normal luster when it reaches maturity on the main stem) (Fehr, et al. (1971) Crop Sci.11, 929). For quantitative analyses of flowering time, at least 8 individual soybean plants were analyzed per genotype. Statistical analyses were performed using Microsoft Excel. A one-way analysis of variance least significant difference test was used to compare the significance of differences between controls Docket No.83142-CN-REG-ORG-P1 and treatments at the 0.05 probability level. GraphPad Prism was used for drawing histograms. The flowering time is shown as the mean values ± standard error. E.4.1.6 Real-Time quantitative PCR analysis of gene expression The WT plants and T2homozygous GmE4 mutants grown under LD and SD conditions were used to compare the expression levels of GmFT2a, GmFT5a, GmFT4 and GmFT1a. Every 9 individual plants and 18 individual GmE4 mutants were grown under LD and SD conditions, respectively. Pieces of fully developed trifoliate leaves were sampled at 4 h after light every 5 days beginning at 10 DAE. These leaves were immediately frozen in liquid nitrogen. Total RNA was isolated using FastPure® Plant Total RNA Isolation Kit (Vazyme Biotech). Reverse transcription was used for synthesis of single stranded cDNA. All qPCR reactions were repeated using three biological and technical replicates. Data were analyzed using the 2-△△Ctmethod with the mRNA level of GmActin (Glyma18g52780) gene as an internal control. E.4.2. Results E.4.2.1 Creation of GmE4 mutants by CRISPR / Cas9 The CRISPR / Cas9-mediated genome-editing tool was utilized to knockout the soybean endogenous gene E4. Two target sites (named E4-SG1 and E4-SG2) in the first exon of E4 were chosen, and the corresponding sgRNA / Cas9 vectors were transformed into the soybean cultivar Jack via Agrobacterium tumefaciens-mediated transformation. DNA extracted from leaf tissue was used to examine CRISPR / Cas9-induced mutations at the target sites using PCR and DNA sequencing analysis. The T0 transgenic lines harboring the T-DNA of the sgRNA / Cas9 vectors were identified, and it was determined that 15.39% (2 of 13) and 56.25% (9 of 16) T-DNA-positive T0 lines at the two target sites had heterozygous-targeted mutations of GmE4, respectively. Subsequently, all seeds collected from these self-pollinated T0lines were planted. Docket No.83142-CN-REG-ORG-P1 PCR and DNA sequencing analysis were used to detect GmE4 targeted mutations in T1lines. At the E4-SG1 target site, a total of 27 plants were obtained from two T0generation edited plants. Two homozygous GmE4 mutants were detected with an editing type of a 1-bp insertion, and 12 heterozygous GmE4 plants were detected in the E4-SG1-2 line and 6 heterozygous plants were detected in the E4- SG1-5 line. At E4-SG2 target site, a total of 82 plants were obtained from the different T0generation plants, of which 12 plants were detected as homozygous GmE4 mutants. One homozygous GmE4 mutant was obtained from the E4-SG2-4 line, three homozygous mutants from the E4-SG2-6 line, two homozygous mutants from the each of the E4-SG2-10 and E4-SG2-13 lines, and four homozygous mutants from the E4-SG2-16 line. Four editing types were detected at the target site: 2-bp deletion, 7- bp deletion, 61-bp deletion, and 1-bp insertion. The editing types had all undergone code shift mutations, resulting in premature translation termination codons. The nucleotide coding sequences for the 2-bp deletion, 7-bp deletion, 61-bp deletion, and 1-bp insertion are set forth in SEQ ID NO: 24 (as described in Example E.3), 74, 75, and 76, respectively. The encoded amino acid sequences are set forth in SEQ ID NO: 43 (as described in Example E.3), 77, 78, and 79, respectively. E.4.2.2 Transgene-free mutants of GmE4 gene To obtain homozygous E4 mutant plants in soybean without any transgenic elements containing the sgRNA / Cas9 vector, bar gene strip tests were used for Bar detection, and Cas9 specific primers were to detect sgRNA / Cas9 on T-DNA by PCR and gel electrophoresis. Among the 10 homozygous mutant plants, 7 plants were detected without T-DNA. E.4.2.3. Position off-target analysis To detect potential off target variants of CRISPR / Cas9 in soybean and to avoid the effects of off-target sites on the phenotype statistics, five GmE4 target sites were selected that were most likely to deviate from the target using the online website Docket No.83142-CN-REG-ORG-P1 CRISPR-P (crispr.hzau.edu.cn / CRISPR2 / ). The potential off target sites detected were only 2-4 bp mismatches. In this study, using the identified homozygous GmE4 mutants in the T1generation, no mutations were detected at potential off-target sites through site-specific genomic PCR and sequencing. E.4.2.4 Promoting early maturity of GmE4 mutant plant In the T2generation, homozygous GmE4 mutants with two editing types (61-bp deletion and 7-bp deletion, referred to herein as GmE4-1 and GmE4-2, respectively) were selected from the T1 generation under LD and SD conditions. PCR and sequencing analysis showed that the homozygous plants from the T1generation were stably inherited in the T2 generation. The flowering and maturity time of the homozygous GmE4 mutants with the wild-type (WT) plants were compared. Under SD condition, there was no significant difference in flowering time between GmE4 mutants and the WT plants, while GmE4 mutants matured earlier than the WT plants. The average flowering time of GmE4-1, GmE4-2 and WT plants was 22 DAE, 21.1 DAE and 21.9 DAE, respectively (FIG.2A, bottom). However, the maturity time of GmE4 mutant plants were earlier than WT. The average maturity time of WT was 66.8 DAE, and the average maturity time of the GmE4-1 and GmE4- 2 mutants was 63.5 DAE and 63.2 DAE, respectively (FIG.2B, bottom). Under LD condition, there was also no significant difference in flowering time between GmE4-1 mutant and WT plant, while the GmE4-2 mutant blooms slightly earlier than the WT plant. The average flowering time of WT plants was 45.9 DAE, and the average flowering time of the GmE4-1 and GmE4-2 mutants was 43.8 DAE and 42.5 DAE, respectively (FIG.2A, top). Although not significant, the flowering time of the mutants was 2-3 days earlier than WT plants under LD condition. However, when the GmE4 mutant started to mature, the WT plant was still in a bulging state. The average maturity time of the GmE4-1, GmE4-2 and WT plants was 138.4 DAE, 136.2 DAE and 149.3 DAE, respectively, where the maturity time in the mutants was advanced by 10.9 days and 13.1 days, respectively (FIG.2B, top). The Docket No.83142-CN-REG-ORG-P1 results showed that the GmE4 mutants exhibited an earlier maturity under SD and LD conditions compared to the WT plants. E.4.2.5 Expression analysis of the flowering related genes of homozygous GmE4 mutations The expression levels of flowering related genes (GmFT2a, GmFT5a, GmFT1a and GmFT4) were compared between WT plants and T2homozygous GmE4 mutants grown under LD and SD conditions. Under SD conditions, there were no significant changes in the expression levels of GmFT2a, GmFT5a, GmFT1a and GmFT4 (FIG. 3A). Under LD conditions, there were no significant effects in expression levels of GmFT2a, GmFT5a and GmFT4, while the expression level of GmFT1a was significantly down regulated (FIG.3B). While not bound by any particular theory or mechanism, this downregulation of expression may play a role in promoting maturity of GmE4 mutants under LD conditions.

[0004] Docket No.83142-CN-REG-ORG-P1 Claims 1. A method of generating a soybean plant having a modified maturity time or modified flowering time comprising introducing a mutation at a first loci selected from the E1, E2, E3, E4, E1La and E1Lb loci of a genome of a soybean plant and selecting a plant that has a modified maturity time or modified flowering time relative to a control plant. 2. The method of claim 1, wherein the method further comprises introducing a mutation at a second loci selecting from the E1, E2, E3, E4, E1La and E1Lb loci of the genome of the soybean plant and selecting a plant having a mutation at the first and the second loci. 3. The method of claim 1, wherein the mutation is selected from: i. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; ii. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; iii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; iv. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; v. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; vi. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; vii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; Docket No.83142-CN-REG-ORG-P1 viii. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; ix. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; x. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xi. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xii. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xiii. a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xiv. a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xv. a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; xvi. a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23. 4. The method of claim 2, wherein the mutation is selected from: i. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; ii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a Docket No.83142-CN-REG-ORG-P1 mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; iii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; iv. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; v. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; vi. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; vii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; viii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; ix. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a Docket No.83142-CN-REG-ORG-P1 mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; x. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xi. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xiii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; xiv. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; xv. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; xvi. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a Docket No.83142-CN-REG-ORG-P1 mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; xvii. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; xviii. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; xix. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; xx. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; xxi. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; xxii. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xxiii. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a Docket No.83142-CN-REG-ORG-P1 mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xxiv. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xxv. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xxvi. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; xxvii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; xxviii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; xxix. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; x...

Claims

Docket No. PAT-109896-WO-SEC-1 Claims 1. A method of generating a soybean plant having a modified maturity time or modified flowering time comprising introducing a mutation at a first loci selected from the E1, E2, E3, E4, E1La and E1Lb loci of a genome of a soybean plant and selecting a plant that has a modified maturity time or modified flowering time relative to a control plant.

2. The method of claim 1, wherein the method further comprises introducing a mutation at a second loci selecting from the E1, E2, E3, E4, E1La and E1Lb loci of the genome of the soybean plant and selecting a plant having a mutation at the first and the second loci.

3. The method of claim 1, wherein the mutation is selected from: i. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; ii. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; iii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; iv. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; v. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; vi. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; vii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; 149Docket No. PAT-109896-WO-SEC-1 viii. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; ix. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; x. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xi. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xii. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xiii. a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xiv. a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xv. a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; xvi. a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO:

23.

4. The method of claim 2, wherein the mutation is selected from: i. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; ii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a 150Docket No. PAT-109896-WO-SEC-1 mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; iii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; iv. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; v. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; vi. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; vii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; viii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; ix. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a 151Docket No. PAT-109896-WO-SEC-1 mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; x. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xi. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xiii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; xiv. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; xv. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; xvi. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a 152Docket No. PAT-109896-WO-SEC-1 mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; xvii. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; xviii. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; xix. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; xx. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; xxi. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; xxii. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xxiii. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a 153Docket No. PAT-109896-WO-SEC-1 mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xxiv. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xxv. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xxvi. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; xxvii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; xxviii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; xxix. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; xxx. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele 154Docket No. PAT-109896-WO-SEC-1 at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; xxxi. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; xxxii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xxxiii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xxxiv. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xxxv. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xxxvi. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xxxvii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele 155Docket No. PAT-109896-WO-SEC-1 at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; xxxviii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; xxxix. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; xl. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; xli. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; xlii. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; xliii. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; xliv. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele 156Docket No. PAT-109896-WO-SEC-1 at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xlv. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xlvi. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xlvii. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xlviii. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xlix. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; l. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; li. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele 157Docket No. PAT-109896-WO-SEC-1 at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; lii. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; liii. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; liv. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; lv. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; lvi. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; lvii. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; lviii. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele 158Docket No. PAT-109896-WO-SEC-1 at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; lix. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; lx. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; lxi. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; lxii. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; lxiii. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; lxiv. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; lxv. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated 159Docket No. PAT-109896-WO-SEC-1 allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; lxvi. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; lxvii. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; lxviii. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; lxix. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; lxx. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; lxxi. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; lxxii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated 160Docket No. PAT-109896-WO-SEC-1 allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; lxxiii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; lxxiv. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; lxxv. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; lxxvi. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; lxxvii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; lxxviii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; lxxix. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated 161Docket No. PAT-109896-WO-SEC-1 allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; lxxx. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; lxxxi. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; lxxxii. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; lxxxiii. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; lxxxiv. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; lxxxv. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; lxxxvi. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele 162Docket No. PAT-109896-WO-SEC-1 at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; lxxxvii. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; lxxxviii. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; lxxxix. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xc. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xci. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xcii. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 2bp deletion 163Docket No. PAT-109896-WO-SEC-1 of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xciii. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xciv. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; xcv. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; xcvi. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xcvii. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xcviii. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; 164Docket No. PAT-109896-WO-SEC-1 xcix. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; c. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; ci. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; cii. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; ciii. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; civ. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; cv. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; 165Docket No. PAT-109896-WO-SEC-1 cvi. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; cvii. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; cviii. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; cix. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; cx. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; cxi. a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; cxii. a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; and 166Docket No. PAT-109896-WO-SEC-1 cxiii. a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO:

23.

5. The method of any of claims 1-4, wherein said mutation is selected from: i. a mutated allele at the E1 locus; ii. a mutated allele at the E1 locus and a mutated allele at the E2 locus; iii. a mutated allele at the E1 locus and a mutated allele at the E3 locus; iv. a mutated allele at the E2 locus; v. a mutated allele at the E2 locus and a mutated allele at the E3 locus; vi. a mutated allele at the E3 locus; vii. a mutated allele at the E3 locus and a mutated allele at the E4 locus; viii. a mutated allele at the E1LA locus and a mutated allele at the E1LB locus; and ix. a mutated allele at the E4 locus.

6. The methods of claim 5, wherein: i. the mutation allele at the E1 locus corresponds to SEQ ID NO: 8; ii. the mutated allele at the E1 locus corresponds to SEQ ID NO: 8 and the mutation at the E2 locus corresponds to SEQ ID NO: 15; iii. the mutated allele at the E1 locus corresponds to SEQ ID NO: 9 and the mutated allele at the E3 locus corresponds to SEQ ID NO: 20; iv. the mutated allele at the E2 locus corresponds to SEQ ID NO: 16; v. the mutated allele at the E2 locus corresponds to SEQ ID NO: 17 and the mutated allele at the E3 locus corresponds to SEQ ID NO: 21; vi. the mutated allele at the E3 locus corresponds to SEQ ID NO: 22; vii. the mutated allele at the E3 locus corresponds to SEQ ID NO: 19 and the mutation at the E4 locus corresponds to SEQ ID NO: 24; 167Docket No. PAT-109896-WO-SEC-1 viii. the mutation at the E1LA locus corresponds to SEQ ID NO: 11 and the mutation at the E1LB locus corresponds to SEQ ID NO: 13; and ix. the mutation at the E4 locus corresponds to SEQ ID NO: 25, 74, 75, or 76.

7. The method of any one of claims 1-6, wherein the introducing comprises transforming a plant cell with an expression cassette comprising: (i) a nucleic acid that encodes the site-directed nuclease; and (ii) a nucleic acid that encodes at least one guide RNA (gRNA) directed to a target sequence at said E1, E2, E3, E4, E1LA or E1LB locus.

8. The method of claim 8, wherein the nucleic acid that encodes the site-directed nuclease is operably linked to a first promoter of the expression cassette and wherein the nucleic acid that encodes the at least one gRNA is operably linked to a second promoter of the expression cassette.

9. The method of claim 8, wherein the expression cassette further comprises an enhancer operably linked to the first promoter or the second promoter.

10. The method of any one of claims 1-9, wherein the site directed nuclease is selected from the group consisting of meganucleases (MNs), zinc-finger nucleases (ZFNs), transcription- activator like effector nucleases (TALENs), Cas9 nuclease, Cfp1 nuclease, dCas9-Fokl, dCpf1 -Fokl, chimeric Cas9-cytidine deaminase, chimeric Cas9-adenine deaminase, chimeric FEN1 -Fokl, and Mega- TALs, a nickase Cas9 (nCas9), chimeric dCas9 non-Fokl nuclease and dCpfl non-Fokl nuclease.

11. The method of claim 1, wherein the mutation introduced into the E1, E2, E3, E4, E1LA or E1LB locus is selected from an allele replacement, one or a plurality of nucleotide insertions, one or a plurality of nucleotide deletions. 168Docket No. PAT-109896-WO-SEC-1 12. The method of any one of claims 1-11, wherein assigning a modification in flowering time and / or maturity time comprises assigning a number of days by which the flowering time and / or maturity time is shortened for the progeny plant relative to the control plant.

13. The method of claim 12, wherein assigning a change in the flowering time comprises reducing a number of days between a VE stage and an R1 stage of the progeny plant relative to the control plant, and / or wherein assigning a change in the maturity time comprises reducing a number of days between an R1 stage and an R7 or R8 stage of the progeny plant relative to the control plant.

14. The method of claim 7, wherein the introducing further comprises: regenerating a transformed T0 plant from the transformed plant cell, the transformed T0 plant having a plurality of T1 seed, wherein the plurality of T1 seed contain a plurality of unique edits in the E1, E2, E3, E4, E1LA and / or E1LB loci; growing a plurality of T1 plants from the T1 seed; and selfing the T1 plants for one or more generations to obtain a progeny plant that is homozygous for the introduced mutation at the E1, E2, E3, E4, E1LA and / or E1LB loci.

15. The method of claim 14, wherein the flowering time of the mutated progeny plant is shorter than the flowering time of the control plant.

16. The method of claim 14, wherein a relative maturity group value of the edited progeny plant is different from the relative maturity group value of the control plant.

17. The mutated progeny plant of the method of any one of claims 1-16. 169Docket No. PAT-109896-WO-SEC-1 18. A further progeny plant of the mutated progeny plant of claim 17, wherein the further progeny plant is obtained by breeding or selfing.

19. A non-naturally occurring soybean plant having a modified flowering time, comprising one or more allelic variations selected from: i. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; ii. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; iii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; iv. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; v. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; vi. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; vii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; viii. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; ix. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; x. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xi. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; 170Docket No. PAT-109896-WO-SEC-1 xii. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xiii. a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xiv. a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xv. a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; or xvi. a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO:

23.

20. The non-naturally occurring soybean plant of claim 19, wherein the allelic variation is selected from: i. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; ii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; iii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; iv. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; 171Docket No. PAT-109896-WO-SEC-1 v. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; vi. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; vii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; viii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; ix. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; x. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xi. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; 172Docket No. PAT-109896-WO-SEC-1 xii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xiii. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; xiv. a mutated allele at the E1 locus, optionally a 1bp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; xv. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; xvi. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; xvii. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; xviii. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; 173Docket No. PAT-109896-WO-SEC-1 xix. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; xx. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; xxi. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; xxii. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xxiii. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xxiv. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xxv. a mutated allele at the E1 locus, optionally a 1bp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; 174Docket No. PAT-109896-WO-SEC-1 xxvi. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; xxvii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; xxviii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; xxix. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; xxx. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; xxxi. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; xxxii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; 175Docket No. PAT-109896-WO-SEC-1 xxxiii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xxxiv. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xxxv. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xxxvi. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xxxvii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; xxxviii. a mutated allele at the E1La locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; xxxix. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; 176Docket No. PAT-109896-WO-SEC-1 xl. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; xli. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; xlii. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; xliii. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; xliv. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xlv. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xlvi. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; 177Docket No. PAT-109896-WO-SEC-1 xlvii. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xlviii. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xlix. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; l. a mutated allele at the E1Lb locus, optionally a 1bp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; li. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; lii. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; liii. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; 178Docket No. PAT-109896-WO-SEC-1 liv. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; lv. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; lvi. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; lvii. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; lviii. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; lix. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; lx. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; 179Docket No. PAT-109896-WO-SEC-1 lxi. a mutated allele at the E2 locus, optionally a 1bp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; lxii. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; lxiii. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; lxiv. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; lxv. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; lxvi. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; lxvii. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; 180Docket No. PAT-109896-WO-SEC-1 lxviii. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; lxix. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; lxx. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; lxxi. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; lxxii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; lxxiii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; lxxiv. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; 181Docket No. PAT-109896-WO-SEC-1 lxxv. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; lxxvi. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; lxxvii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; lxxviii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; lxxix. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; lxxx. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; lxxxi. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; 182Docket No. PAT-109896-WO-SEC-1 lxxxii. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; lxxxiii. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; lxxxiv. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; lxxxv. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; lxxxvi. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; lxxxvii. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; lxxxviii. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; 183Docket No. PAT-109896-WO-SEC-1 lxxxix. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xc. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xci. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xcii. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xciii. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xciv. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 61bp 184Docket No. PAT-109896-WO-SEC-1 deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; xcv. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; xcvi. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xcvii. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xcviii. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xcix. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; c. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; ci. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated 185Docket No. PAT-109896-WO-SEC-1 allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; cii. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; ciii. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; civ. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; cv. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; cvi. a mutated allele at the E3 locus, optionally a 1bp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; cvii. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; cviii. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; and a mutated 186Docket No. PAT-109896-WO-SEC-1 allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; cix. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; cx. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; cxi. a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; cxii. a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 1bp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO:

23.

21. The non-naturally occurring soybean plant of claim 19, wherein the allelic variation is selected from: i. a mutated allele at the E1 locus; ii. a mutated allele at the E1 locus and a mutated allele at the E2 locus; iii. a mutated allele at the E1 locus and a mutated allele at the E3 locus; iv. a mutated allele at the E2 locus; 187Docket No. PAT-109896-WO-SEC-1 v. a mutated allele at the E2 locus and a mutated allele at the E3 locus; vi. a mutated allele at the E3 locus; vii. a mutated allele at the E3 locus and a mutated allele at the E4 locus; viii. a mutated allele at the E1LA locus and a mutated allele at the E1LB locus; and ix. a mutated allele at the E4 locus.

22. The methods of claim 21, wherein: x. the mutation allele at the E1 locus corresponds to SEQ ID NO: 8; xi. the mutated allele at the E1 locus corresponds to SEQ ID NO: 8 and the mutation at the E2 locus corresponds to SEQ ID NO: 15; xii. the mutated allele at the E1 locus corresponds to SEQ ID NO: 9 and the mutated allele at the E3 locus corresponds to SEQ ID NO: 20; xiii. the mutated allele at the E2 locus corresponds to SEQ ID NO: 16; xiv. the mutated allele at the E2 locus corresponds to SEQ ID NO: 17 and the mutated allele at the E3 locus corresponds to SEQ ID NO: 21; xv. the mutated allele at the E3 locus corresponds to SEQ ID NO: 22; xvi. the mutated allele at the E3 locus corresponds to SEQ ID NO: 19 and the mutation at the E4 locus corresponds to SEQ ID NO: 24; xvii. the mutation at the E1LA locus corresponds to SEQ ID NO: 11 and the mutation at the E1LB locus corresponds to SEQ ID NO: 13; and xviii. the mutation at the E4 locus corresponds to SEQ ID NO: 25, 74, 75, or 76.

23. The non-naturally occurring soybean plant of any of claims 19-22, wherein the allelic variation is introduced via genome modification using a site directed nuclease.

24. A method of breeding, comprising: crossing the non-naturally occurring soybean plant of any of claims 19-23 with a different soybean plant not comprising the allele combination of the non-naturally occurring soybean plant; and 188Docket No. PAT-109896-WO-SEC-1 selecting a progeny plant having a modified flowering time.

25. The non-naturally occurring soybean plant, or plant part thereof, of any one of claims 19-23, wherein said modified plant has a smaller flowering time than that a control plant.

26. The non-naturally occurring soybean plant, or plant part thereof, of claim 25, wherein the smaller flowering time comprises a smaller number of days between a VE stage and an R1 stage of the modified plant relative to the control plant.

27. The non-naturally occurring soybean plant, or plant part thereof, of any one of claims 19-23, wherein said modified plant has a smaller maturity time than that a control plant.

28. The non-naturally occurring soybean plant, or plant part thereof, of claim 27, wherein the smaller maturity time comprises a smaller number of days between an R1 stage and an R7 stage of the modified plant relative to the control plant. 189Claims1. A method of generating a soybean plant having a modified maturity time or modified flowering time comprising introducing a mutation at a first loci selected from the El, E2, E3, E4, ElLa and EILb loci of a genome of a soybean plant and selecting a plant that has a modified maturity time or modified flowering time relative to a control plant.

2. The method of claim 1, wherein the method further comprises introducing a mutation at a second loci selecting from the El, E2, E3, E4, ElLa and EILb loci of the genome of the soybean plant and selecting a plant having a mutation at the first and the second loci.

3. The method of claim 1, wherein the mutation is selected from: i. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; ii. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; iii. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; iv. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; v. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; vi. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; vii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14;viii. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; ix. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; x. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xi. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xii. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xiii. a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xiv. a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xv. a mutated allele at the E4 locus, optionally a 6 Ibp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; xvi. a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23.

4. The method of claim 2, wherein the mutation is selected from: i. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; ii. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and amutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; iii. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; iv. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; v. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; vi. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; vii. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; viii. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; ix. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and amutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; x. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xi. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xii. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xiii. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 6 Ibp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; xiv. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; xv. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; xvi. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and amutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; xvii. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; xviii. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; xix. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; xx. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; xxi. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; xxii. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xxiii. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and amutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xxiv. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xxv. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xxvi. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; xxvii. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; xxviii. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; xxix. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; xxx. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated alleleat the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; xxxi. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; xxxii. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xxxiii. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xxxiv. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xxxv. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xxxvi. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xxxvii. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated alleleat the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; xxxviii. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; xxxix. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; xl. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; xli. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; xlii. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; xliii. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; xliv. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated alleleat the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xlv. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xlvi. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xlvii. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xlviii. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xlix. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 6 Ibp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23;1. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; li. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated alleleat the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; lii. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; liii. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; liv. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18;Iv. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18;Ivi. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18;Ivii. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23;Iviii. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated alleleat the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; lix. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; lx. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 6 Ibp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23;Ixi. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23;Ixii. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14;Ixiii. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18;Ixiv. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18;Ixv. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutatedallele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18;Ixvi. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18;Ixvii. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23;Ixviii. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23;Ixix. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23;Ixx. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 6 Ibp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23;Ixxi. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23;Ixxii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutatedallele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18;Ixxiii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18;Ixxiv. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18;Ixxv. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18;Ixxvi. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23;Ixxvii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23;Ixxviii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23;Ixxix. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutatedallele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23;Ixxx. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23;Ixxxi. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18;Ixxxii. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18;Ixxxiii. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18;Ixxxiv. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23;Ixxxv. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23;Ixxxvi. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated alleleat the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23;Ixxxvii. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 6 Ibp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23;Ixxxviii. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23;Ixxxix. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xc. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xci. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xcii. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 2bp deletionof the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xciii. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xciv. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; xcv. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; xcvi. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xcvii. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xcviii. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23;xcix. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; c. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; ci. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; cii. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; ciii. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; civ. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; cv. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 6 Ibp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23;cvi. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; cvii. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; cviii. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; cix. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 6 Ibp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; ex. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; cxi. a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; cxii. a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 6 Ibp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; andcxiii. a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23.

5. The method of any of claims 1-4, wherein said mutation is selected from: i. a mutated allele at the El locus; ii. a mutated allele at the El locus and a mutated allele at the E2 locus; iii. a mutated allele at the El locus and a mutated allele at the E3 locus; iv. a mutated allele at the E2 locus; v. a mutated allele at the E2 locus and a mutated allele at the E3 locus; vi. a mutated allele at the E3 locus; vii. a mutated allele at the E3 locus and a mutated allele at the E4 locus; viii. a mutated allele at the EILA locus and a mutated allele at the E1LB locus; and ix. a mutated allele at the E4 locus.

6. The methods of claim 5, wherein: i. the mutation allele at the El locus corresponds to SEQ ID NO: 8; ii. the mutated allele at the El locus corresponds to SEQ ID NO: 8 and the mutation at the E2 locus corresponds to SEQ ID NO: 15; iii. the mutated allele at the El locus corresponds to SEQ ID NO: 9 and the mutated allele at the E3 locus corresponds to SEQ ID NO: 20; iv. the mutated allele at the E2 locus corresponds to SEQ ID NO: 16; v. the mutated allele at the E2 locus corresponds to SEQ ID NO: 17 and the mutated allele at the E3 locus corresponds to SEQ ID NO: 21; vi. the mutated allele at the E3 locus corresponds to SEQ ID NO: 22; vii. the mutated allele at the E3 locus corresponds to SEQ ID NO: 19 and the mutation at the E4 locus corresponds to SEQ ID NO: 24;viii. the mutation at the EILA locus corresponds to SEQ ID NO: 11 and the mutation at the E1LB locus corresponds to SEQ ID NO: 13; and ix. the mutation at the E4 locus corresponds to SEQ ID NO: 25, 74, 75, or 76.

7. The method of any one of claims 1-6, wherein the introducing comprises transforming a plant cell with an expression cassette comprising:(i) a nucleic acid that encodes the site-directed nuclease; and(ii) a nucleic acid that encodes at least one guide RNA (gRNA) directed to a target sequence at said El, E2, E3, E4, EILA or E1LB locus.

8. The method of claim 8, wherein the nucleic acid that encodes the site-directed nuclease is operably linked to a first promoter of the expression cassette and wherein the nucleic acid that encodes the at least one gRNA is operably linked to a second promoter of the expression cassette.

9. The method of claim 8, wherein the expression cassette further comprises an enhancer operably linked to the first promoter or the second promoter.

10. The method of any one of claims 1-9, wherein the site directed nuclease is selected from the group consisting of meganucleases (MNs), zinc-finger nucleases (ZFNs), transcription- activator like effector nucleases (TALENs), Cas9 nuclease, Cfpl nuclease, dCas9-Fokl, dCpfl -Fokl, chimeric Cas9-cytidine deaminase, chimeric Cas9-adenine deaminase, chimeric FEN1 -Fokl, and Mega- TALs, a nickase Cas9 (nCas9), chimeric dCas9 non-Fokl nuclease and dCpfl non-Fokl nuclease.

11. The method of claim 1, wherein the mutation introduced into the El, E2, E3, E4, EILA or E1LB locus is selected from an allele replacement, one or a plurality of nucleotide insertions, one or a plurality of nucleotide deletions.

12. The method of any one of claims 1-11, wherein assigning a modification in flowering time and / or maturity time comprises assigning a number of days by which the flowering time and / or maturity time is shortened for the progeny plant relative to the control plant.

13. The method of claim 12, wherein assigning a change in the flowering time comprises reducing a number of days between a VE stage and an R1 stage of the progeny plant relative to the control plant, and / or wherein assigning a change in the maturity time comprises reducing a number of days between an R1 stage and an R7 or R8 stage of the progeny plant relative to the control plant.

14. The method of claim 7, wherein the introducing further comprises: regenerating a transformed TO plant from the transformed plant cell, the transformed TO plant having a plurality of T1 seed, wherein the plurality of T1 seed contain a plurality of unique edits in the El, E2, E3, E4, EILA and / or E1LB loci; growing a plurality of T1 plants from the T1 seed; and selfing the T1 plants for one or more generations to obtain a progeny plant that is homozygous for the introduced mutation at the El, E2, E3, E4, EILA and / or E1LB loci.

15. The method of claim 14, wherein the flowering time of the mutated progeny plant is shorter than the flowering time of the control plant.

16. The method of claim 14, wherein a relative maturity group value of the edited progeny plant is different from the relative maturity group value of the control plant.

17. The mutated progeny plant of the method of any one of claims 1-16.

18. A further progeny plant of the mutated progeny plant of claim 17, wherein the further progeny plant is obtained by breeding or selfing.

19. A non-naturally occurring soybean plant having a modified flowering time, comprising one or more allelic variations selected from: i. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; ii. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; iii. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; iv. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; v. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; vi. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; vii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; viii. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; ix. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; x. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xi. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18;xii. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xiii. a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xiv. a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xv. a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; or xvi. a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23.

20. The non-naturally occurring soybean plant of claim 19, wherein the allelic variation is selected from: i. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; ii. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; iii. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; iv. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14;v. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; vi. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; vii. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; viii. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; ix. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; x. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xi. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23;xii. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xiii. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 6 Ibp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; xiv. a mutated allele at the El locus, optionally a Ibp insertion of an A at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; xv. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; xvi. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; xvii. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; xviii. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14;xix. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; xx. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; xxi. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; xxii. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xxiii. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xxiv. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xxv. a mutated allele at the El locus, optionally a Ibp insertion of a G at the position corresponding to position 199 relative to SEQ ID NO: 7; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23;xxvi. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; xxvii. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; xxviii. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; xxix. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; xxx. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; xxxi. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; xxxii. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18;xxxiii. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xxxiv. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xxxv. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xxxvi. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xxxvii. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a 6 Ibp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; xxxviii. a mutated allele at the ElLa locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 10; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; xxxix. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14;xl. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; xli. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; xlii. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; xliii. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; xliv. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xlv. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xlvi. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23;xlvii. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xlviii. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xlix. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a 6 Ibp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23;1. a mutated allele at the EILb locus, optionally a Ibp insertion at the position corresponding to position 167 relative to SEQ ID NO: 12; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; li. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; lii. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; liii. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18;liv. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18;Iv. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18;Ivi. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18;Ivii. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23;Iviii. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; lix. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; lx. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 6 Ibp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23;Ixi. a mutated allele at the E2 locus, optionally a Ibp deletion of the position corresponding to position 89 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23;Ixii. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14;Ixiii. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18;Ixiv. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18;Ixv. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18;Ixvi. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18;Ixvii. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23;Ixviii. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23;Ixix. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23;Ixx. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23;Ixxi. a mutated allele at the E2 locus, optionally a 14bp deletion of the positions corresponding to positions 81-94 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23;Ixxii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18;Ixxiii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18;Ixxiv. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18;Ixxv. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18;Ixxvi. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23;Ixxvii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23;Ixxviii. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23;Ixxix. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a 6 Ibp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23;Ixxx. a mutated allele at the E2 locus, optionally an 8bp deletion of the positions corresponding to positions 89-96 relative to SEQ ID NO: 14; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23;Ixxxi. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18;Ixxxii. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18;Ixxxiii. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18;Ixxxiv. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23;Ixxxv. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23;Ixxxvi. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23;Ixxxvii. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 6 Ibp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23;Ixxxviii. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23;Ixxxix. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; xc. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xci. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xcii. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xciii. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; xciv. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 61bpdeletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; xcv. a mutated allele at the E3 locus, optionally a 256-bp deletion and a 5-bp insertion within the positions corresponding to positions 158-413 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; xcvi. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; xcvii. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; xcviii. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; xcix. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; c. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 6 Ibp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; ci. a mutated allele at the E3 locus, optionally a 4bp deletion of the positions corresponding to positions 178-181 relative to SEQ ID NO: 18; and a mutatedallele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; cii. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; ciii. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; civ. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; cv. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a 6 Ibp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; cvi. a mutated allele at the E3 locus, optionally a Ibp insertion at the position corresponding to position 10 relative to SEQ ID NO: 18; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; cvii. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; cviii. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; and a mutatedallele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; cix. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 61bp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; ex. a mutated allele at the E4 locus, optionally a 3bp deletion of the positions corresponding to positions 150-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23; cxi. a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 7bp deletion of the positions corresponding to positions 149-155 relative to SEQ ID NO: 23; cxii. a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 6 Ibp deletion of the positions corresponding to positions 148-208 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a 2bp deletion of the positions corresponding to positions 151-152 relative to SEQ ID NO: 23; and a mutated allele at the E4 locus, optionally a Ibp insertion of a T at the position corresponding to position 151 relative to SEQ ID NO: 23.

21. The non-naturally occurring soybean plant of claim 19, wherein the allelic variation is selected from: i. a mutated allele at the El locus; ii. a mutated allele at the El locus and a mutated allele at the E2 locus; iii. a mutated allele at the El locus and a mutated allele at the E3 locus; iv. a mutated allele at the E2 locus;v. a mutated allele at the E2 locus and a mutated allele at the E3 locus; vi. a mutated allele at the E3 locus; vii. a mutated allele at the E3 locus and a mutated allele at the E4 locus; viii. a mutated allele at the EILA locus and a mutated allele at the E1LB locus; and ix. a mutated allele at the E4 locus.

22. The methods of claim 21, wherein: x. the mutation allele at the El locus corresponds to SEQ ID NO: 8; xi. the mutated allele at the El locus corresponds to SEQ ID NO: 8 and the mutation at the E2 locus corresponds to SEQ ID NO: 15; xii. the mutated allele at the El locus corresponds to SEQ ID NO: 9 and the mutated allele at the E3 locus corresponds to SEQ ID NO: 20; xiii. the mutated allele at the E2 locus corresponds to SEQ ID NO: 16; xiv. the mutated allele at the E2 locus corresponds to SEQ ID NO: 17 and the mutated allele at the E3 locus corresponds to SEQ ID NO: 21; xv. the mutated allele at the E3 locus corresponds to SEQ ID NO: 22; xvi. the mutated allele at the E3 locus corresponds to SEQ ID NO: 19 and the mutation at the E4 locus corresponds to SEQ ID NO: 24; xvii. the mutation at the EILA locus corresponds to SEQ ID NO: 11 and the mutation at the E1LB locus corresponds to SEQ ID NO: 13; and xviii. the mutation at the E4 locus corresponds to SEQ ID NO: 25, 74, 75, or 76.

23. The non-naturally occurring soybean plant of any of claims 19-22, wherein the allelic variation is introduced via genome modification using a site directed nuclease.

24. A method of breeding, comprising: crossing the non-naturally occurring soybean plant of any of claims 19-23 with a different soybean plant not comprising the allele combination of the non-naturally occurring soybean plant; andselecting a progeny plant having a modified flowering time.

25. The non-naturally occurring soybean plant, or plant part thereof, of any one of claims 19-23, wherein said modified plant has a smaller flowering time than that a control plant.

26. The non-naturally occurring soybean plant, or plant part thereof, of claim 25, wherein the smaller flowering time comprises a smaller number of days between a VE stage and an R1 stage of the modified plant relative to the control plant.

27. The non-naturally occurring soybean plant, or plant part thereof, of any one of claims 19-23, wherein said modified plant has a smaller maturity time than that a control plant.

28. The non-naturally occurring soybean plant, or plant part thereof, of claim 27, wherein the smaller maturity time comprises a smaller number of days between an R1 stage and an R7 stage of the modified plant relative to the control plant.

Images