Compositions and methods for expressing recombinant proteins and rnas in seed, pod and root plastids

Abstract

Compositions and methods for the rapid and efficient production of transgenic soybean expressing heterologous proteins or RNAs of interest in seed, pod and root plastids are disclosed.

Description

[0001] Compositions and Methods for Expressing Recombinant Proteins and RNAs in Seed, Pod and Root Plastids

[0002] By Pal Maliga Malihe Mirzaee

[0003] Cross-reference to Related Application

[0004] This application claims priority to US Provisional Application No. 63 / 620,037 filed January 11, 2024, the entire contents being incorporated herein by reference as though set forth in full.

[0005] Government Support Statement

[0006] This invention was made with government support under grant number 2224861 awarded by the National Science Foundation. The government has certain rights in the invention.

[0007] Field of the Invention

[0008] The present invention relates to the fields of plant biology and plastid transformation. More specifically, the invention pertains to expression of recombinant proteins in seed and nongreen plastids.

[0009] Background of the Invention

[0010] Several publications and patent documents are cited throughout the specification in order to describe the state of the art to which this invention pertains. Each of these citations is incorporated by reference herein as though set forth in full.

[0011] Plastids are semi-autonomous plant organelles with thousands of copies of the ~155-kb genome localized in 10 to 100 plastids per cell. The plastid genome of flowering plants encodes about one hundred genes, the products of which assemble with -3,000 nucleus-encoded proteins to form the plastid transcription and translation machinery and carry out complex metabolic functions, including photosynthesis, fatty acid and amino acid biosynthesis. Transformation of the plastid genome in flowering plants was first accomplished in tobacco (Nicotiana tabacum), the current model species of plastid engineering1 2. The soybean is the most important source of vegetable protein for human and animal consumption as well as ingredients for many chemical products. 90% of US oilseed production is from soybeans (USDA).

[0012] Expression of recombinant proteins in soybean chloroplasts have the advantages of high- level protein accumulation, expression of multiple genes in operons, and natural biocontainment due to lack of the transmission of transgenes by pollen3-5. In current plastid transformation techniques, the recombinant proteins are generally produced in perishable leaves that require extraction and purification of the recombinant proteins before they can be used or lyophilized for storage6’7. In contrast, seeds naturally store accumulated proteins and continue to protect these proteins during long term storage. However, reliable production of recombinant proteins in seed plastids has not been demonstrated, particularly in soybean. Clearly, there is a need for reliable techniques for the expression of recombinant proteins from plastids in seed.

[0013] Summary of the Invention

[0014] Expression of recombinant proteins or RNAs in plant seeds removes the need for costly procedures to accumulate and store the recombinant proteins. In accordance with the present invention, compositions and methods for transforming soybean seed, pod or root plastids are provided for cost-effective and large-scale production of recombinant proteins or RNAs conferring beneficial agricultural properties. The method is also applicable for regulated expression of recombinant proteins in nongreen plastids of fruits, roots, tubers, storage organs and reproductive cell types.

[0015] In accordance with the present invention, a two-component expression system for high level production of one or more proteins or RNAs of interest in seed proplastids and non-green plastids of target plants is provided. An exemplary expression system comprises as the first component: i) a plastid transformation vector comprising a nucleic acid construct encoding: a) an RNA polymerase promoter operably linked to a leader sequence selected from a T7gl0 leader and a Cry9Aa2 leader, said promoter- leader sequence being operably linked to one or more nucleic acids encoding one or more heterologous proteins or RNA of interest; b) at least one plastid specific promoter operably linked to a selectable marker sequence; and c) a 3’ UTR sequence operably linked to a) and b); said construct comprising flanking sequences which facilitate homologous recombination of said plastid transformation vector into the trnV and 3 ’rps!2 / 7 intergenic region of the plastid genome upstream and divergent to the said trnV gene. The second component of the system includes: ii) a nuclear transformation vector comprising a nucleic acid construct encoding a plant codon optimized RNA polymerase operably linked to a seed specific promoter, and a plastid targeting sequence, expression of said construct transporting said RNA polymerase protein into seed plastids where it binds to the RNA polymerase promoter of step a), thereby activating transcription of sequence encoding said one or more heterologous proteins of interest. In certain embodiments, the RNA polymerase promoter is selected from a T7, a T3 or a SP6 promoter and the recombinant protein or RNA of interest can be one or more of GFP, mScarlet, RFP, GUS, a vaccine, an antibody, a fusion protein, a protein conferring abiotic resistance, an enzyme, a fungicidal protein, an insecticidal protein and a RNA that confers insect resistance. In some embodiments, the selectable marker nucleic acid confers resistance to spectinomycin, streptomycin, kanamycin, gentamycin, tobramycin or chloramphenicol or to the herbicides phosphinothricin, glyphosate, and sulfonylurea. Plastid promoters useful in the expression system can include, without limitation, Prm, PrbcL for example, and said seed specific promoter can be AtPl, AtP2, AtP3, AtP4, AtP5, AtP6, napin, glycinin, phaseolin, alpha-zein seed-specific promoters, tomato ethylene responsive fruit ripening promoter, sugar beet major latex-like root protein promoter, potato patatin and sweet potato SRD1 tuber-specific promoter. Promoters suitable for expression in pods and roots are also disclosed. Suitable plastid transformation vectors for delivery of said heterologous proteins or RNAs of interest include TVV1 of SEQ ID NO: 3 and GPV1 of SEQ ID NO: 4, each comprising a multicloning site for insertion of a sequence encoding said heterologous protein of interest.

[0016] Also disclosed is method for production of one or more heterologous proteins or RNAs of interest in seed plastids of a target plant. An exemplary method comprises introducing the two- component expression system described above into the target plant; selecting plant cells surviving selection pressure and expressing said at least one nucleic acid encoding said heterologous protein or RNA of interest; and c) regenerating a homoplastomic plant from the surviving plant cells. In a preferred embodiment, the plant is selected from a soybean plant and said plastid transformation vector is GPV1 of SEQ ID NO: 4. In other embodiments, the plant is tobacco and said plastid transformation vector is TVV1 of SEQ ID NO: 3 In yet another embodiment, the target plant is maize and the plastid transformation vector is a variant of GPV1 SEQ ID NO: 4 where soybean plastid targeting sequences are replaced with plastid targeting sequences functional in maize. The vectors on the invention can be introduced into plant cells using method which include, but are not limited to, Agrobacterium mediated transformation and bombardment with biolistic particles. Finally, transgenic plants produced by the methods described above are also within the scope of the invention, particularly transgenic soybean plants.

[0017] Brief Description of the Drawings

[0018] Figures 1A - IB: Two-component systems for seed-specific expression of recombinant proteins. Fig. 1A: In the leaf, the nuclear T7RNAP is not expressed because it’s seed specific promoter is inactive. Fig. IB: In the seed, the T7RNAP is transcribed from the seed specific promoter. The mRNA is exported to the cytoplasm where it is translated. The plastid-targeted T7RNAP enters the seed plastids where it transcribes the gfp coding sequence from the phage T7gl0 promoter and the mRNA is translated on plastid ribosomes. PT7L is the 5’ regulatory sequence comprising the T7gl0 promoter fused with different leader sequences; Th / t is the 3’ regulatory region containing the 77 colt histidine / threonine attenuators that serve as transcription terminators and stabilize the mRNA; PrbcL and TrbcL are the plastid rbcL gene promoter / leader and 3’UTR, respectively. T7RNAP is symbolized by open circles; GFP by circles with a halo. Note aadA (spectinomycin resistance) marker gene on the transformation vector. For TVV1 vector sequences see SEQ ID No: 3; for reporter gene cassettes SEQ ID No: 1 and 2 in Table 1.

[0019] Figure 2: Plastid transgenes with T7 phage gene 10 promoter (PT7glO) for expression by a seed specific nuclear T7RNAP. The constructs differ in the leader fused with the PT7glO promoter: pMM7 has the T7gl0 leader (LglO, SEQ ID NO: 1) and pMM33 has LCry9Aa2 (SEQ ID NO: 2). The gfp genes have His / Thr terminator at the 3’ end to stabilize the mRNA. The Sacl- Hindlll fragments are cloned in the Sacl-Hindlll sites in vector TVV1 (SEQ ID NO: 3). The TVV vectors carry the spectinomycin resistance (aadA) marker gene fused with the c-Myc epitope. VT7glO is the T7 phage gene 10 promoter; Histidine / Threonine attenuator and psbA 3' UTR His / Thre Atten and ~ psbA) are symbolized as stem-loops. trnP is a tRNA gene known to be efficiently processed in polycistronic mRNAs.The marker gene is flanked by attB (34 bp) / r / / / / J(39 bp) sequences, which are target sites for the PhiC31 phage-site-specific integrase for posttransformation excision of the marker gene. The target insertion site in the plastid genome is between the trnV and 3"-rpsl2 genes. Figure 3: The T-DNA region of pBIN19 Agrobacterium nuclear transformation vector. The pBIN19 vector has a kanamycin resistance (NPTII) gene as selective marker8. The promoters (EcoRI-NcoI fragments) are cloned upstream of the plastid-targeted T7 RNA polymerase (SEQ ID NO: 5- 11). The T7RNA polymerase is translationally fused with the Rubisco small subunit transit peptide (TP) at the N terminus and transcriptionally fused with the octopine synthase 3’ UTR (Toes) for the stabilization of the mRNA. LB and RB are the T-DNA left and right borders.

[0020] Figures 4A - 4B: Transgenes with the T7RNAP promoter are not transcribed in the chloroplast. (Fig. 4A) Southern blots show uniform transformation of all plastid genome copies with reporter genes pMM7 and pMM33. The probe is the targeting region, including part of rrnl6 and 3 ’rps!2 region. (Fig. 4B) On the Northern blots there is no signal with the gfp probe, indicating lack of transcription from the T7 promoter. The aadA probe confirms transcription of the aadA (spectinomycin resistance) selective marker.

[0021] Figures 5A - 5B: Western blots to detect GFP accumulation in seed and leaf protein extracts. GFP accumulation is shown from the (Fig. 5A) T7gl0, (Fig. 5B) the cry9aA2 leader in the seed and in the leaf. 5 pg (T7gl0) and 25 pg (cry9aA2) protein was loaded per lane. The chloroplast reporter genes and the T7RNAP nuclear gene were combined by transforming the transplastomic reporter plants (Nt-pMM7, Nt-PMM33) with Agrobacterium carrying binary plasmid pMM64.

[0022] Detailed Description of the Invention

[0023] Provided herein are systems for expression of recombinant proteins in seed plastids and non-green plastids. In case of posttranscriptional regulation, tissue specificity is ensured by controlling translation of plastid mRNAs from the nucleus with a native seed-specific promoter. In certain embodiments, we employ an engineered nuclear PPR10 RNA binding protein, PPRIO*3*3, which does not recognize the native binding sites on plastid mRNAs. This PPRIO*3*3only interacts with the engineered BSGGbinding sites, which controls the expression of the gene of interest in the plastid genome. This system has been described in a publication by Mirzaee et al.9. In another approach, the seed-specific promoters drive the expression of a phage T7 RNA polymerase (T7RNAP) that is targeted to chloroplasts. When T7RNAP enters the chloroplast, transcribes the gene of interest from a cognate T7 promoter. In certain embodiments, the plastid genes with the T7 promoter have the T7 Phage gene 1010or the Bacillus thuringi crisis Cry9Aa211leader sequences facilitating translation on general translation machinery (Figure 1).

[0024] Definitions

[0025] Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art. In addition to definitions included in this sub-section, further definitions of terms are interspersed throughout the text.

[0026] In this invention, “a”, “or” and “an” can mean “at least one” or “one or more,“ etc., unless clearly indicated otherwise by context. The term “or” means “and / or” unless stated otherwise. In the case of a multiple-dependent claim, however, use of the term “or” refers back to more than one preceding claim in the alternative only.

[0027] Furthermore, a compound “selected from the group consisting of’ refers to one or more of the compounds in the list that follows, including mixtures (i.e. combinations) of two or more of the compounds. According to the present invention, an isolated, or biologically pure molecule is a compound that has been removed from its natural milieu. As such, "isolated" and "biologically pure" do not necessarily reflect the extent to which the compound has been purified. An isolated compound of the present invention can be obtained from its natural source, can be produced using laboratory synthetic techniques or can be produced by any such chemical synthetic route.

[0028] The phrase "consisting essentially of' when referring to a particular nucleotide or amino acid means a sequence having the properties of a given SEQ ID NO. For example, when used in reference to an amino acid sequence, the phrase includes the sequence per se and molecular modifications that would not affect the functional and novel characteristics of the sequence.

[0029] The terms, “decrease”, “decreased”, and “decreasing” or “increase”, “increased,” and “increasing” are intended to refer to a change in measurement of a parameter by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200% or more when compared to the measurement of that parameter in a suitable control. Heteroplastomic refers to the presence of a mixed population of different plastid genomes within a single plastid or in a population of plastids contained in plant cells or tissues.

[0030] Homoplastomic refers to a pure population of plastid genomes, either within a plastid or within a population contained in plant cells and tissues. Homoplastomic plastids, cells or tissues are genetically stable because they contain only one type of plastid genome. Hence, they remain homoplastomic even after the selection pressure has been removed, and selfed progeny are also homoplastomic.

[0031] Plastome refers to the genome of a plastid.

[0032] Transplastome refers to a transformed plastid genome.

[0033] “Promoter” refers to a DNA sequence capable of controlling the transcription of a coding sequence or functional RNA. Functional RNA is including, but not limited to, transfer RNA (tRNA) and ribosomal RNA (rRNA). The promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. Exemplary plastid promoters include for example Prm, rbcl etc.

[0034] Accordingly, an “enhancer” is a DNA sequence which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue-specificity of a promoter. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. Promoters which cause a gene to be transcribed in most cell types at most times are commonly referred to as “constitutive promoters”.

[0035] Among the most commonly used promoters are the nopaline synthase (NOS) promoter, the octapine synthase (OCS) promoter, caulimovirus promoters such as the cauliflower mosaic virus (CaMV) 19S promoter, the CaMV 35S promoter, and the figwort mosaic virus 35S promoter, the light inducible promoter from the small subunit of rubisco, the Adh promoter, the sucrose synthase promoter), the R gene complex promoter, the chlorophyll a / b binding protein gene promoter, etc.

[0036] Examples of a seed-specific promoter include, but are not limited to, the promoter for - conglycinin, the napin promoter, and the phaseolin promoter. Other tissue-specific promoters that may be used to accomplish the invention include, but are not limited to, the chloroplast glutamine synthase (GS2) promoter, the chloroplast fructose- 1,6-biophosphatase promoter, the nuclear photosynthetic (ST-LS1) promoter, the serine / threonine kinase (PAL) promoter, the glucoamylase promoter, the promoters for the Cab genes (cab6, cab-1, and cab-1, and the promoters for the thylakoid membrane genes (psaD, psaF, psaE, PC, FNR, atpC, atpD), etc.

[0037] The “translation leader sequence” refers to a DNA sequence located between the promoter sequence of a gene and the coding sequence. The translation leader sequence is present in the fully processed mRNA upstream of the translation start sequence. The translation leader sequence may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency.

[0038] The “3' non-coding sequences” refer to DNA sequences located downstream of a coding sequence and include polyadenylation recognition sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or nuclear gene expression. The polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3' end of the nuclear mRNA precursor. Plastid mRNAs have no polyA tail, but a stem-loop structure to protect the mRNAs from degradation.

[0039] “RNA transcript” refers to a product resulting from RNA polymerase-catalyzed transcription of a DNA sequence. When an RNA transcript is a perfect complementary copy of a DNA sequence, it is referred to as a primary transcript or it may be a RNA sequence derived from posttranscriptional processing of a primary transcript and is referred to as a mature RNA.

[0040] “Messenger RNA” (“mRNA”) refers to RNA that is without introns and that can be translated into protein by the cell. “cDNA” refers to a DNA that is complementary to and synthesized from an mRNA template using the enzyme reverse transcriptase.

[0041] A “selectable marker gene” sequence refers to a gene that upon expression confers a selective advantage to the plastids and a phenotype by which successfully transformed plastids or cells or tissues carrying the transformed plastid can be identified. Selectable markers include without limitation sequences which confer resistance of transformed plants to spectinomycin, kanamycin, gentamycin etc.

[0042] A reporter sequence encodes a detectable molecule. Exemplary reporter sequences encoding reporters including GFP, RFP, mScarlet, GUS, etc, Applicability of the Technology

[0043] Seed protein expression in plastids would be useful in any crop where the seed, or plant part other than leaf, is consumed as food, serves as feed to livestock, or is the source of pharmaceutical proteins or industrial raw materials. Plastids are present in all plant cell types each of which have an identical genome. Different tissue types may include chloroplasts in leaves, proplastids in seed, chromoplasts in tomato and pumpkin fruit and carrot root, amyloplasts in potato tuber tissue.

[0044] Plants of interest, include without limitation, Leguminosae (alfalfa, soybean, clover, etc.), Umbelliferae (carrot, celery, parsnip), Cruciferae (cabbage, radish, canola / rapeseed, etc.), Cucurbitaceae (melons and cucumber), Gramineae (wheat, barley, rice, maize, etc.), Solanaceae (potato, tobacco, tomato, peppers), various floral crops, such as sunflower, and nut-bearing trees, such as almonds, cashews, walnuts, and pecans. Such regeneration techniques are known to those of skill in the art. Methods and compositions for transforming plants by introducing a transgenic DNA construct into a plant genome in the practice of this invention can include any of the well-known and demonstrated methods.

[0045] One of skill will recognize that after the expression cassette or vector is stably incorporated in transgenic plants and confirmed to be operable, it can be introduced into other plants by sexual crossing. Any of number of standard breeding techniques can be used, depending upon the species to be crossed.

[0046] Plant transformants containing a desired genetic modification as a result of any of the above-described methods resulting in decreased or increased expression of the seed protein of interest can be selected by various methods known in the art. These methods include, but are not limited to, methods such as SDS-PAGE analysis, immunoblotting using antibodies which bind to the seed protein of interest, single nucleotide polymorphism (SNP) analysis, or assaying for the products of a reporter or marker gene, and the like.

[0047] As used herein, the term "plant" includes reference to whole plants, plant organs (e.g., leaves, stems, roots, etc.), seeds and plant cells and progeny of same. Plant cell, as used herein includes, without limitation, plant cells within or isolated from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores. The present invention may be used for expression of proteins in any plant species, including, but not limited to, soybean Glycine max), com Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B. Juncea), particularly those Brassica species useful as sources of seed oil, alfalfa (Medicago sativa), rice (Oryza sativa), rye {Secale cereale), sorghum {Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl millet {Pennisetum glaucum), proso millet {Panicum miliaceum), foxtail millet {Setaria italica), finger millet {Eleusine coracana)), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat {Triticum aestivum), tobacco {Nicotiana tabacum), potato {Solanum tuberosum), peanuts (Arachis hypogaea), cotton {Gossypium barbadense, Gossypium hirsutum), sweet potato {Ipomoea batatus), cassava {Manihot esculenta), coffee (Coffea spp ), coconut {Cocos nucifera), pineapple {Ananas comosus), citrus trees {Citrus spp ), cocoa {Theobroma cacao , tea {Camellia sinensis), banana {Musa spp.), avocado {Per sea americana), fig {Ficus casica), guava (Psidium guajava), mango (Mangifera indica), olive {Olea europaea), papaya {Carica papaya), cashew (Anacardium occidentale), macadamia {Macadamia integrifolia), almond {Prunus amygdalus), sugar beets {Beta vulgaris), sugarcane {Saccharum spp ), oats, barley, vegetables, ornamentals, and conifers.

[0048] Vegetables include tomatoes {Lycopersicon esculentum), lettuce (e.g., Lactuca sativa), green beans {Phaseolus vulgaris), lima beans {Phaseolus limensis), peas (Lathyrus spp.), and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo). Ornamentals include azalea {Rhododendron spp ), hydrangea {Macrophylla hydrangea , hibiscus {Hibiscus rosasanensis), roses {Rosa spp.), tulips {Tulipa spp.), daffodils {Narcissus spp ), petunias {Petunia hybrida), carnation {Dianthus caryophyllus), poinsettia (Euphorbia pulcherrima), and chrysanthemum. Conifers that may be employed in practicing the present invention include, for example, pines such as loblolly pine {Pinus taeda), slash pine {Pinus elliotii), ponderosa pine (Pinus ponderosa), lodgepole pine {Pinus contorta), and Monterey pine {Pin us radiata),' Douglas-fir (Pseudotsuga menziesii),' Western hemlock {Tsuga canadensis),' Sitka spruce (Picea glaucdy, redwood {Sequoia sempervirensj, true firs such as silver fir {Abies amabilis) and balsam fir (Abies balsamed), and cedars such as Western red cedar (Thuja plicata) and Alaska yellow-cedar (Chamaecyparis nootkatensis). Preferably, plants of the present invention are crop plants (for example, corn, alfalfa, sunflower, Brassica, soybean, cotton, safflower, peanut, sorghum, wheat, millet, tobacco, etc.), more preferably soybean plants. A "clone" or "clonal cell population" is a population of cells derived from a single cell or common ancestor by mitosis.

[0049] A "cell line" is a clone of a primary cell or cell population that is capable of stable growth in vitro for many generations.

[0050] The materials and methods below are provided to facilitate the practice of the present invention.

[0051] Plant Material

[0052] Tobacco seeds (Nicotiana tabacum var. Petit Havana) were sown on Murashige and Skoog (MS) medium, 0.7% agar (7 g / L) and 3% sucrose (30 g / L). The plants were maintained by growing cuttings on the same medium. The plants were incubated in a growth chamber at 28 °C with 16 hour light / 8 hour dark cycles. The regenerated shoots were rooted on the same medium and transplanted to soil to collect seed and for crossing.

[0053] For experiments with soybean (Glycine max), the strain cv. Jack was used, as it is known for its suitability for tissue culture and plastid transformation12'15.

[0054] Transformation of the Plastid Genome

[0055] Plastid transformation is carried out by the biolistic process. Bombardment of leaves, selection of transplastomic events on spectinomycin medium, and characterization of the tobacco plants is carried out as previously described2, 16, 17

[0056] Transplastomic soybean plants are obtained by the bombardment of embryogenic cell cultures of cv Jack or Williams 82. Transplastomic soybean are selected by spectinomycin resistance according to the protocol published by Dubald et al.18. Plastid transformation vectors and sequences are listed in Table 1.

[0057] Table 1. Listing of constructs and DNA Sequences with SEQ ID NO.

[0058] SEQ ID NO: 1 pMM7 Plastid reporter gene PT7LglO:gfp:This / thre in Sacl- Hindlll fragment

[0059] Gagctcacttcgaaattaatacgactcactatagggagaccacaacggtttcccactagaaataattttgtttaactttaagaagg agatatacccatggctagcagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaat tttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccttggcca acacttgtcactactttctcttatggtgttcaatgcttttcaagatacccagatcatatgaagcggcacgacttcttcaagagcgccatgcctgag ggatacgtgcaggagaggaccatctctttcaaggacgacgggaactacaagacacgtgctgaagtcaagtttgagggagacaccctcgtc aacaggatcgagcttaagggaatcgatttcaaggaggacggaaacatcctcggccacaagttggaatacaactacaactcccacaacgtat acatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagacca ttatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacg aaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactgtacaaataaatctagaacgcgtt caatttaaacaccaccatcatcaccatcatcctgactagactttcaggcgatgtgtgctggaagacattcggatcttccagtggtgcatgaacg catgagaaagcccccggaagatcatcttccgggggctttttttttggcgcgtgacgcgtacaggaaacacagaaaaaagcccgcacctgac agtgcgggcttttttttcgaccaaaggtaacgaggtaacaaccatgcgcaattcaagctt

[0060] SEQ ID NO: 2 pMM33 Plastid reporter gene PT7LCry9Aa2:gfp:This / thre in Sacl- Hindlll fragment gagctcacttcgaaattaatacgactcactataaaacccaaataatgttttaaaattttaaaaataatgtaggaggaaaaattatgg ctagcagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggag agggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccttggccaacacttgtcactactt tctcttatggtgttcaatgcttttcaagatacccagatcatatgaagcggcacgacttcttcaagagcgccatgcctgagggatacgtgcagga gaggaccatctctttcaaggacgacgggaactacaagacacgtgctgaagtcaagtttgagggagacaccctcgtcaacaggatcgagctt aagggaatcgatttcaaggaggacggaaacatcctcggccacaagttggaatacaactacaactcccacaacgtatacatcacggcagac aaacaaaagaatggaatcaaagctaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatac tccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagacca catggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactgtacaaataaatctagaacgcgttcaatttaaacacca ccatcatcaccatcatcctgactagactttcaggcgatgtgtgctggaagacattcggatcttccagtggtgcatgaacgcatgagaaagccc ccggaagatcatcttccgggggctttttttttggcgcgtgacgcgtacaggaaacacagaaaaaagcccgcacctgacagtgcgggctttttt tttcgaccaaaggtaacgaggtaacaaccatgcgcaattcaagctt

[0061] SEQ ID NO: 3 TVV1 tobacco plastid transformation vector, targeting region in pPRVl-II backbone cttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacg gttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttg ctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaa gataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcggg aagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgtt cagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggta acaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggt atctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttg tttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaact cacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatat gagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactcccc gtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatt tatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgg gaagctagagtaagtagtcgccagtaatagttgcgcaacgtgttgccattgctacaggcatcgtggtgtcacgctcgtcgttggtatggc ttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgtt gtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtga ctggtgagtattcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgcca catagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgt aacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaa agggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggata catatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatca tgacattaacctataaaaataggcgtatcacgaggccctttcgtctcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcc cggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcgggg ctggcttaactatgcggcatcagagcagattgtactgagagtgcaccataaaattgtaaacgttaatattttgttaaaattcgcgttaaatttttgtt aaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagcccgagatagggttgagtgttgttccagtt tggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaacca tcacccaaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaa agccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcg cgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtactatggttgctttgacgtatgcggtgtgaaataccgcacagat gcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctatt acgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggc cagtgaattaattcaccgccgtatggctgaccggcgattactagcgattccggcttcatgcaggcgagttgcagcctgcaatccgaactgag gacgggttttggggtagctcaccctcgcgggatcgcgaccctttgtcccggccattgtagcacgtgtgtcgcccagggcataaggggcat gatgacttgacgtcatcctcaccttcctccggcttatcaccggcagtctgttcagggttccaaactcaacgatggcaactaaacacgagggtt gcgctcgttgcgggacttaacccaacaccttacggcacgagctgacgacagccatgcaccacctgtgtccgcgttcccgaaggcacccct ctctttcaagaggattcgcggcatgtcaagccctggtaaggttcttcgctttgcatcgaattaaaccacatgctccaccgcttgtgcgggcccc cgtcaattcctttgagtttcattcttgcgaacgtactccccaggcgggatacttaacgcgttagctacagcactgcacgggtcgatacgcacag cgcctagtatccatcgtttacggctaggactactggggtatctaatcccattcgctcccctagctttcgtctctcagtgtcagtgtcggcccagc agagtgctttcgccgttggtgttctttccgatctctacgcatttcaccgctccaccggaaattccctctgcccctaccgtactccagcttggtagtt tccaccgcctgtccagggttgagccctgggatttgacggcggacttaaaaagccacctacagacgctttacgcccaatcattccggataacg cttgcatcctctgtattaccgcggctgctggcacagagttagccgatgcttattccccagataccgtcattgcttcttctccgggaaaagaagtt cacgacccgtgggccttctacctccacgcggcattgctccgtcaggctttcgcccattgcggaaaattccccactgctgcctcccgtaggag tctgggccgtgtctcagtcccagtgtggctgatcatcctctcggaccagctactgatcatcgccttggtaagctattgcctcaccaactagcta atcagacgcgagcccctcctcgggcggattcctccttttgctcctcagcctacggggtattagcagccgtttccagctgttgttcccctcccaa gggcaggtctacgcgttactcacccgtccgccactggaaacaccacttcccgtccgactgcatgtgtaagcatgccgccagcgttcatc ctgagccaggatcgaactctccatgagattcatagttgcattacttatagcttccttgttcgtagacaaagcggattcggaattgtctttcattcca aggcataacttgtatccatgcgcttcatattcgcccggagttcgctcccagaaatatagccatccctgccccctcacgtcaatcccacgagcct cttatccattctcattgaacgacggcgggggagctttcgaggcctcgaaatccaactagaaaaactcacattgggcttagggataatcaggct cgaactgatgacttccaccacgtcaaggtgacactctaccgctgagttatatcccttccccgccccatcgagaaatagaactgactaatccta agtcaaagggtcgagaaactcaacgccactattcttgaacaacttggagccgggccttcttttcgcactattacggatatgaaaataatggtca aaatcggattcaattgtcaaagtcctttaattaagaattcgagctcggtacccggggatcctctagagtcgacctgcaggcatgcaagcttaag tctttacaatgacaatggaaaccgatgtaaagggatgtagcgcagcttggtagcgcgtttgttttgggtacaaaatgtcacaggttcaaatcct gtcatccctatccctaacttgtagttatcgtatcagcagtaacaatagatgtgccagggcgtgcccttgggctccccgggcgcgttgggttgc gctatatatatgaaagagtatacaataatgatgtatttgagttgtagggagggatttatgggggaagcggtgatcgccgaagtatcgactcaac tatcagaggtagttggcgtcatcgagcgccatctcgaaccgacgttgctggccgtacatttgtacggctccgcagtggatggcggcctgaa gccacacagtgatattgatttgctggttacggtgaccgtaaggcttgatgaaacaacgcggcgagctttgatcaacgaccttttggaaacttcg gcttcccctggagagagcgagattctccgcgctgtagaagtcaccattgttgtgcacgacgacatcattccgtggcgttatccagctaagcg cgaactgcaatttggagaatggcagcgcaatgacattcttgcaggtatcttcgagccagccacgatcgacattgatctggctatcttgctgac aaaagcaagagaacatagcgttgccttggtaggtccagcggcggaggaactctttgatccggttcctgaacaggatctatttgaggcgctaa atgaaaccttaacgctatggaactcgccgcccgactgggctggcgatgagcgaaatgtagtgcttacgttgtcccgcatttggtacagcgca gtaaccggcaaaatcgcgccgaaggatgtcgctgccgactgggcaatggagcgcctgccggcccagtatcagcccgtcatacttgaagct agacaggcttatcttggacaagaagaagatcgcttggcctcgcgcgcagatcagttggaagaatttgtccactacgtgaaaggcgagatca ccaaggtagtgggcaaagaacaaaaactcatttctgaagaagacttgtgagatcctggcctagtctataggaggttttgaaaagaaaggagc aataatcattttcttgttctatcaagagggtgctattgctcctttctttttttctttttatttatttactagtattttacttacatagacttttttgtttacattata gaaaaagaaggagaggttattttcttgcatttattcatgccccaactggggtaacctttgagttctctcagttggggggcggccgcaggacttt aactgcccctatcggaaataggattgactaccgattccgaaggaactggagttacatctcttttccattcaagagttcttatgcgtttccacgccc ctttgagaccccgaaaaatggacaaattccttttcttaggaacacatacaagattcgtcactacaaaaaggataatggtaaccctaccattaact acttcatttatgaatttcatagtaatagaaatacatgtcctaccgagacagaatttggaacttgctatcctcttgcctagcaggcaaagatttacct ccgtggaaaggatgattcattcggatcgacatgagagtccaactacattgccagaatccatgttgtatatttgaaagaggttgacctccttgctt ctctcatggtacactcctcttcccgccgagccccttttctcctcggtccacagagacaaaatgtaggactggtgccaacaattcatcagactca ctaagtcgggatcactaactaatactaatctaatataatagtctaatatatctaatataatagaaaatactaatataatagaaaagaactgtcttttct gtatactttccccggttccgttgctaccgcgggctttacgcaatcgatcggattagatagatatcccttcaacataggtcatcgaaaggatctcg gagacccaccaaagtacgaaagccaggatctttcagaaaacggattcctattcaaagagtgcataaccgcatggataagctcacactaacc cgtcaatttgggatccaaattcgagattttccttgggaggtatcgggaaggatttggaatggaataatatcgattcatacagaagaaaaggttct ctattgattcaaacactgtacctaacctatgggatagggatcgaggaaggggaaaaaccgaagatttcacatggtacttttatcaatctgattta tttcgtacctttcgttcaatgagaaaatgggtcaaattctacaggatcaaacctatgggacttaaggaatgatataaaaaaaagagagggaaa atattcatattaaataaatatgaagtagaagaacccagattccaaatgaacaaattcaaacttgaaaaggatcttccttattcttgaagaatgagg ggcaaagggattgatcaagaaagatcctctagctagagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaat tccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgc ccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgct

[0062] SEQ ID NO: 4 GPV1 Soybean (Glycine max) plastid transformation vector in pUCl 19 backbone tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccg ggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactg agagtgcaccataaaattgtaaacgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaatagaccgaaatcggc aaaatcccttataaatcaaaagaatagcccgagatagagttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactcca acgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcacccaaatcaagttttttggggtcgaggtgccgtaa agcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaa agcgaaaggagcgggcgctaaggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgcta cagggcgcgtactatggttgctttgacgtatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgcc attcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagcgatcctttgtcccgtccattgtagcacgtgt gtcgcccagggcataaggggcatgatgacttgacgtcatcctcaccttcctccggcttatcaccggcagtctgctcagggttccaaactaaat gttggcaactaaacacgagggttgcgctcgttgcgggacttaacccaacaccttacggcacgagctgacgacagccatgcaccacctgtgt ccgcgttcccgaaggcacccctctctttcaagaggattcgcggcatgtcaagccctggtaaggttcttcgctttgcatcgaattaaaccacatg ctccaccgcttgtgcgggcccccgtcaattcctttgagtttcattcttgcgaacgtactccccaggcgggatacttaacgcgttagctacagca ttgcacgggtcgatacgcacagcgcctagtatccatcgtttacggctaggactactggggtatctaatcccattcgctcccctagctttcgtctc tcagtgtcagtgtcggcccagcagagtgctttcgccgttggtgttctttccgatctctacgcatttcaccgctccaccggaaattccctctgccc ctaccgtactccagcttggtagtttccaccgcctgtccagggttgagccctgggatttgacggcgaacttaaaaagccacctacagacgcttt acgcccaatcattccggataacgcttgcatcctctgtcttaccgcggctgctggcacagagttagccgatgcttattccccggataccgtcatt gcttcttctccgggaaaagaagttcatgacccgtaggccttctaccttcacgcggcattgctccgtcaggctttcgcccattgcggaaaattcc ccactgctgcctcccgtaggagtctgggccgtgtctcagtcccagtgtggctgatcatcctctcggaccagctactgatcatcgccttggtaa gctattgcctcaccaactagctaatcagacgcgagcccctcctcgggcggattcctccttttgctcctcagcctacggggtattagcagccgtt tccagctgttgttcccctcccaagggtaggttcttacgcgttactcacccgtccgccactggaaacaccacttcccgtccgacttgcatgtgta aggcatgccgccagcgttcatcctgagccaggatcgaactctccatgagattcctagttgcattacttatagcttccttgttcgtagacaaagct gattcggaattctcttccattccaaggcataacttgtatccaggcgcttcatattcgactggagttcgctcccagaaatatagcccccccacccc tcgtgtaatcccacgagcctcttatccattctcaattattattcgatcacggcatacaaatagaaaaacttacattgggtttagggataatcaggct cgaactgataacttccaccacgtcaaggtgacactctaccgctgagtatatcccttgcctccatcgagaaatagaactgactaatcctaaggc aaagggtcaagaaactcaacgccactattcttaaacaacttcttggagttaggctttcttttcacactattacggatacgaaaattatgggaaaa attggattccattgtcatttcctttaattaacaattggaattcgagctcggtacccggggatcctctagagtcgacctgcaggcatgcaagcttaa gtctttacaatgacaatggaaaccgatgtaaagggatgtagcgcagcttggtagcgcgtttgttttgggtacaaaatgtcacaggttcaaatcc tgtcatccctatccctaacttgtagttatcgtatcagcagtaacaatagatgtgccagggcgtgcccttgggctccccgggcgcggctccccc gccgtcgttcaatgagaatggataagaggctcgtgggattgacgtgagggggcagggatggctatatttctgggagaattaaccgatcgac gtgcaagcggacatttattttaaattcgataatttttgcaaaaacatttcgacatatttatttattttattattatgagaatcaatcctactacttctggtt ctggggtttccacggctactagcgaagcggtgatcgccgaagtatcgactcaactatcagaggtagttggcgtcatcgagcgccatctcga accgacgttgctggccgtacatttgtacggctccgcagtggatggcggcctgaagccacacagtgatattgatttgctggttacggtgaccgt aaggcttgatgaaacaacgcggcgagctttgatcaacgaccttttggaaacttcggcttcccctggagagagcgagattctccgcgctgtag aagtcaccattgttgtgcacgacgacatcattccgtggcgttatccagctaagcgcgaactgcaatttggagaatggcagcgcaatgacattc ttgcaggtatcttcgagccagccacgatcgacattgatctggctatcttgctgacaaaagcaagagaacatagcgttgccttggtaggtccag cggcggaggaactctttgatccggttcctgaacaggatctatttgaggcgctaaatgaaaccttaacgctatggaactcgccgcccgactgg gctggcgatgagcgaaatgtagtgcttacgttgtcccgcatttggtacagcgcagtaaccggcaaaatcgcgccgaaggatgtcgctgccg actgggcaatggagcgcctgccggcccagtatcagcccgtcatacttgaagctagacaggcttatcttggacaagaagaagatcgcttggc ctcgcgcgcagatcagttggaagaatttgtccactacgtgaaaggcgagatcaccaaggtagtgggcaaagaacaaaaactcatttctgaa gaagacttgtaactagaaaacagtagacattagcagataaattagcaggaaataaagaaggataaggagaaagaactcaagtaattatcctt cgttctcttaattgaattgcaattaaactcggcccaatcttttactaaaaggattgagccgaatacaacaaagattctattgcatatattttgactaa gtatatacttacctagatatacaagatttgaaatacaaaatctaccccaactggggtaacctttgagttctctcagttggggggcggccgcagg aaataactgctcctatcggaaataggattgaccacggattcgagcaatagcacatgatttcataaaaccatatgatttcccgatctaaataaag caggttttccatgaagaagatttggctaagcatgttctattcgatacgggtaggagaagaacccgactcgattttattaaaaaatagagaaatc agaaccaagtcaagatgatacggatcaacccctcctcttgcgttcttgcgccaaagatcttaccatttccgaagtaactggagttacatctatttt tccatttcaattcaagagttcttatgtgtttccacgccccttcgagaccccgaaaaaatggacaaattgcttttcttaggaacacatattcgttacc acaaaaaggataatggtaaccccaccattaactacttcaatttaatagtaataaaaatacatgccctaccaagacagaatttgtaatttgctatac tcttgcctagcaggcaaagatttacctccgtggaaaggatgattcattcagatcgacatgagagtccaaccacattgcattgccagaacccat gttgtatatttgaaaaaggttgacctccttgcttctctcatgttacaatcctcttgccgctgagctccctttctcctcggtccacagagacaaaatgt aagacaggtgccaacagttcatcacgaaagaaaggactagctgagccgagatcactaactaaaacgaatttaatactaatcgaaaatactaa tagaatagaaatagaactgtcttttcatatagatatcccttcaacacaacataggtcatcgaaaggatctcgaagacccaccaacgcacgaaa gccgggatctttcagaaaatggattcctattcgaagggtgcataaccgcatggataagctcacactaacccgtcaatttgggatccaattcggt tccttaggaggtatcgggaaggaattttggaatgtaataatatcgattcatacagatacagaagaaagggttctctattgattcaaacgctctac ctacgagatagggatagagaaagaggaaaaaaccgaggatttcacatagtacttttggtcgaaaaatcgatctgatttttttcgtacttttcgctc aatgatgaaatgggtcagattctacaggaccaaaccttgtgggagttaaggaatgatggaagaaaagaaataaaaaaaagtaaataaaaat gcagtagaagagtcctgattccaaacgaaaaaattcaaacttgattgaaaaggatctttctgattattgaagaatgggacaaaaggattgatcg ctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggt cgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtg agcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcaca aaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcc tgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagtt cggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagt ccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagt tcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttgg tagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaaga agatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttca cctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggc acctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggcc ccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcaga agtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgtt gttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatc ccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggca gcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcgg cgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgtcttcg gggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcac cagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactctt cctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgc gcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggccctttcg tc

[0063] SEQ ID NO: 5 AtPl promoter of at3g03230 in EcoRI-NcoI gaattctgtcacatatatatattttgttacaattaaattcattttactactaaatccagattttatatctgagtgtttttaatgtgtaattaataa tgatatattatcaggtgttatagtttgtgtcaataaattttacttagcgctggagatatatacaatcTtggttgacaaatgtgggtcaccgtgcaag aaagtctataatcttttgctttgaaactgctaccaccgtgccacgacacttggatcaaagttacaaagcagtttcttaaaatctatgaagataagtt tgtttttctttctcttacagattctaaaaatgaaaatgtctaataaatccaaaaaatattcaatatgcaatataaataataaaggggagttacacaatt gatataaatgcaaaaggacaaccaattcaataatagtaatgcaagataagttatcaagacatgtgtaacaaagagagaaggacaaaaagaa atttgtaaacaaaagtggtcatgctttacttgccaacaaaaataaatagtactacattattaagttgcttggaccaaagataccattacatcagcg catttttctctctaataattgttgaaattgttaaacatatattagttcctgagtttcttcttctttcattttctttaaatcaattctagtcttttggttccaagac ttataggctaaaccatgg

[0064] SEQ ID NO: 6 AtPl promoter of At4g31830 in EcoRI-NcoI gaattcttgtgtggtttatataaaggtagaggacttggaaactagccgtttaggaattacgaaaaattaaaaggaaaaaatggtaaa tgttaatgtatccgttggagagatgataaaggcaacgtaacggttaggattgagcgacaaaacttgaactctgatagagaaagtgatttcacg gtcttctaggaagactggtcaagctaagctgtttctgttttttgtttttgtactttactttttgtttgctagtgggaactgggtttattgggccttgaagtt gataaaagatgaataaaagacatatcgcctaaagcccatatgagaagcagaagacaaaaacctccaactttgggcataaattttgattatagtt aaaagtccagacccaatttggcacctggcttagttacgattctaaggcatgacacctgcctaatatgtttattacagaaaataaagagaatcag ctaggtgtcccttattgaacacattaacaaactccaacgacactacgtgtcttcgtgactcttactatatccaaaaacctatagctaaagctgaat tttccatgattagtatagtcccaaccaaaaaaatactgaagaaggcataaccatgg

[0065] SEQ ID NO: 7 AtP3 promoter of At5gl0120 in EcoRI-NcoI caattgcgggaaccgtgcggagtttccgatctcgattttctttttttggactcgcgtttttcgaaatcacaattattaaattaaagcatta aagtgagactggagagatatctcagtggtcccactacttactgagataaaaaatcattaataaagcccaatagttttgaaattaataagcccatt ataaacttactgggcttgatacatacgtatcagaagggatcatatgggcctgaccttattttgaagttttgaacccgagtttccaagtaaccgac aaatcccaaaattatgtttttgtttacatatttattccatgtattattttttattttttactgtaattaactatttgttagttttcattttgaaacgaataagttgt aattaaatccattccccaaaatataaaaagacatttaagatggtaagaaaaacgtacaagtttcttaggtaagtaagcttacgtaaactcgatcg taataatatttgctgatatcaataatccctgTattccctcgcttacgatcaaattcaatgctttcagtttcatcttatgccatctctcgctcgtaaataa aatcttttttcttaaacagctaaaatccttttaatcttcttgtctattaatatacttatcatcacctataggtcttatattatgcagtgtgcacacatgtatt atccacaattctacaaatatgtattatgtattatcagatttgtagtaaaattcttgacgacaaaactatacttttctattgctaaaaaccagatattgtt ggaaatatacttatgtggtaagaaaacgatgttgttgaaatacacaaatactaaaatacaattcatgcgtcttgttttctaagatggaaagttccc atgaattttctttccggctttgactatcttaaggcggccattttaaaaatataccaaccatgcttaaaagaaaaaaataggtacaatttacaaaaac attcctatattatgcgcaaagtgacaagaaaaagaaacagccctatcaaaagttttagttagatatatattaattaagtcggtgcaatcaactctc gttatccatcgagtatgatgcaaccgaagaacaagttttttttgttgttgttgtaaatgttaaataccgaagaaaaagttttagtaacgtccggcgt cgtgatgcccggagataactcttatccacctaaaaaacataaatatttccgccacaaatttccaaatactcttacaacttatgtttagctcagacc aaaccaaaccaggagattttgacacgtccttcatatcacatgcacaccatcctcctcccaccaaaaaatcatatacaatttgtgatcttcacatat aaataagcaatcaattttaacaaaggtggtcgtgttacatcgagtatatccttctacgtacggacaataacctcaatcacgtataataatatatag atatatatcaatttagtccatgactcgaaatataatggactaacataaaccatgg

[0066] SEQ ID NO: 8 AtP4 promoter of At5gl6460 in EcoRI-NcoI gaattcgttggggaattgaaaaccctaaccctaattttgcgatttgagagagaacgatttgggggctacggagtttcgatgcgaga ttatttatctttagttaaaaaaaagtattaaaataaataaaaaaaggaatattttcctatttcctgaaaaggtatttatagagtgtagtacggtgcata ttaagacttttgcgcccattttcctaatatatattcgttcaaatccacttgctttattctttttatcgctttgcaaattcaaacataaaaatagtaaagaat tttatgaccaaatgtatgaattaaataataataaatagactgtacattttgtacattcatgcacgactagacttttttgtttcgtacatgatctctaata gagctttgacaaaaaaaaatgacctctaagagaaaattagaaacttattatatcttattgcaaaaagttaagattttaatccatttgggttttgatttt tctggatcaattatctctattttccagtatgaattatacggaaaacaacattataataatatcactttactttgtaaactatactctataagttaaaaaa aaatactatttttgttaatatgtgtttttttttgttaagggttttatttttgtttatatgttacatgatataacatgttaacatatgttaatgtagatacaaaga gctgaataccggaactaaaatccagatccaacacttcaggataagctaatttacccatacaatttttttccttcatatgaaatgattctggtataat cactatgatctcattgcaccaacgtggcactactcaagaacacgaaccaacacgtatcaattttctcatgcaaatgaaaaacatattttatatga ctctatgacagcgacttttatctatccatattttatcgatcatttcataaaacagaaacaccatgg

[0067] SEQ ID NO: 9 AtP5 promoter of At5g53100 in EcoRI-NcoI gaattcgacctcaaagctgcattacactacacagtctacactatgcacattctaaacgatcaagtattagggaatatagctttcataa atcaatctaacggccataaactcacatttattataccatcattttaaacacataggttgcataacaacaacgtaaacgttacctgaaaaaaaaaa aaaagagaggcaggatcttgataaaccaaagaaatcaaataaataatctttctataacgtgacaatggagtgaaaacaaacaattaagacatt caagtcgttactaaattattcaaaattctaaccaagaatttgcaaacacacatattatacgaaaaaggcgggttctcatgtagtaatagtaataac aataattagtactagtaattagttaatggtcaattaatgaccaactaattatattgttgtaagttgtaacggcagacgaagtacgtataccaacaa gtccgaggcgtcacaggctttaactaacccaaaaatgtttatcatgttccttgatttcgacgtaataattatctttatataacaggcttttgtctttaat tctctctatagatgtgttgtgatttgtgaacActagagagaagaagaagatgagtagtgccatgg

[0068] SEQ ID NO: 10 AtP6 promoter of At5g54000 in EcoRI-NcoI gaattcggttttcgaaggagagcttgagcggtgcggtcaggtctgtgatggacagagatagcgagctcgggaattgggcgagg aggaaccacgtaaagtggaaggagtctctgcttcgtcatggactaatgagtggttatcttaataagttcgtagaagcattggagaaactagtcc aaaatataaatcttgaatgaaaaactttgtaaagagcagctttgatcgataagagtcataacggtaaaaaaagtagaccaccaagtagttgttc gtttctcgtctatgttctgttcaagcttcacttactagctaggaaataattttatatcatcaaatataacctgattgaactcatcttgatatattactattt ttgaataaatgttttgggtgaaataggtagatgactcaatttgagatggaaattaggtagattgccttacaaaaaagatttgcttctaattcttttgg tgttaaaaaagaaatatataataaaactttgggagtaatgcaaaaaaatatttatagccgagacatacttaaatttaggtttgttgacatcaaccct aaactctaaatatatattaagtaacattatatactaagcatagtgtattttcttaatatcaaagatatcttttagtttcttaccaagaaaaatatatattttt agtttttttttgctatttgttaattgtcctttaaattttggccacaatcaaaagctacaaaaaaaaaagagaggataactgttagtttgtaaactaaatt ctctcttgagataaatgttacgaaacggcattttttgtcatgttacgtatcatagtgtttatctttgggccgggtttggatataccaagcaagaccat aaattcaagatcgtgtctagctacgtgtaatacaaaagttcttctgaccaaaaggatcatcaaacaaagatcctccgaaaccatgg

[0069] SEQ ID NO: 11 G1W82 promoter in EcoRLNcoI gaattcttattgtgatataatttaatcaaaataaccacaaactttcataaaaggttcttattaagcatggcatttaataagcaaaaacaa ctcaatcactttcatataggaggtagcctaagtacgtactcaaaatgccaacaaataaaaaaaaagttgctttaataatgccaaaacaaattaat aaaacacttacaacaccggattttttttaattaaaatgtgccatttaggataaatagttaatatttttaataattatttaaaaagccgtatctactaaaa tgatttttatttggttgaaaatattaatatgtttaaatcaacacaatctatcaaaattaaactaaaaaaaaaataagtgtacgtggttaacattagtac agtaatataagaggaaaatgagaaattaagaaattgaaagcgagtctaatttttaaattatgaacctgcatatataaaaggaaagaaagaatcc aggaagaaaagaaatgaaaccatgcatggtcccctcgtcatcacgagtttctgccatttgcaatagaaacactgaaacacctttctctttgtca cttaattgagatgccgaagccacctcacaccatgaacttcatgaggtgtagcacccaaggcttccatagccatgcatactgaagaatgtctca agctcagcaccctacttctgtgacgtgtccctcattcaccttcctctcttccctataaataaccacgcctcaggttctccgcttcacaactcaaac attctctccattggtccttaaacactcatcagtcatcaccatgg

[0070] SEQ ID NO: 12 pMM64 SSU-TP-T7RNAP-Tocs in Ncol-Hindlll fragment, encoding codon optimized T7RNAP. ccatggcttcctcagttctttcctccgcagcagttgccacccgcagcaatgttgctcaagctaacatggttgcacctttcactggcct taagtca ctgcctcattccct tttcaaggaagcaaaaccttgacatcacttccattgccagcaacggcggaagagtgcaatgcat caggt gtggccaatgaacacaattaatattgctaagaacgatttctcagatatcgaactcgccgcaattccattcaacactcttgcagatcattatggag agaggctcgcaagagagcagcttgcacttgagcatgaatctt^ aggtgaaggcaaagaggggtaagagacccacagctttccaattcttgcaagaaattaaaccagaagcagttgcttatattactattaagacta ctctcgcatgcctcacaag.cgcagataataccaccgttc.aagctgtcg.cctccgctatcggaagggctattgaagatgaagctaggtttggtc gtatcgtgagctcgaggcgaaacattttaagaagaatgtggaagagcgactaaataagagagtggggcacgtgtataagaaagcatgatg caagtggtcgaagcagatatgctgtctaaaggacttctcggaggtgaagcatggtcatcatggcataaagaagatagcatacatgttggagt gagatgtattgagalgcttattgagtcgaccggaatggtttccct^ acttgctccagaatatgctgaagctattgcgacacga ctggtgcactagctggtattagtcctat.gtccagccgtgtgttgtcccccctaagc ctggagaggcatcactgggggaggttactgggcgaacggacgaagagcgcttgcacttgtgagaactcactcaaagaaggcgttaatga ggt.atgagga.cgt.ct.a.t.atgcccg.aagttataagg> > > gccaacgtcattaccaagtggaagcattgtccggtggaggacattcccgccatcgagagagaagagcttccaatga acatgaatcccgaggcattgactgcctggaaaagagcagcagctgctgtttacaggaaggataaagcacgcaagagccgccgtatatcgtt ggagtttatgttggaacaagcaaataagtttgccaatcataaagccatctggtttccctataacatggactggcggggga^ > gagtatgtttaatcctcaagggaacgatatgactaaaggtttgctcacactagcaaaaggtaaaccaattggtaaagaaggttac.tart aagatccacggggcaaattgcgccggagtcgataaggttccgtttcctgagcgaattaaattcatagaagagaaccatgagaacattatggc ttgcgcaaagagtccattagaaaatacatggtgggccgagcaagactctccattttgtttcctcgctttctgttttgaatatgcaggagttcagca tcatgga£tagt.aca.actgctcac.tacccctagcatt^^^ > ggggggcgagcag.t.a.a.atttgttacc.t.agtgaga.c.ag.tgc.a.ag.atatttatggtatcgttgc gctattaacgggacggacaatgaggtggttacagtaacggatgagaatactggtgagatttcagagaaggtcaaacttggaacaaaggcttt agctggacagtggcttgcctatggagtcactcgatctgttacaaagagaagtgtgatgactcttgct^ >

[0071] .caacaagtgttagaggataccatcc.agccagcaatagactcaggaaaaggcc.ttatgtttactcaacc.taaccaagccgc.agga aaagctgatctggg.agagtgtgt.cagt.ca.c.agttgt.tgcagc.agtggaggc.tatgaattggctt.aagt.cgg.ccgctaa.attactcgccgc.cg aagttaaagacaagaaaacaggagagattttgaggaaaagatgcgctgttcactgggtgacccctgatgggttcccagtttggcaagaatat aagaaaccaatccaaactcgtttaaacttgatgttccttgggcaattccgattgcaacctacaatcaatacaaacaaagm^ > ctcacaagcaagagtcaggaatagccccgaattttgtccattcgcaagatggttcacatcttcgaaagaccgtcgtgtgggctcatgagaaat atggaatagagtcgtttgcccttatacatgacagcttcgggacaatacctgcagatgcagctaaccttttcaaagccgtcagagagacaatgg tggatacatacgagagctgtgatgtgcttgctgacttttatgatcaatttgctgaccaacttcacgagtctcagttagataaaatgcctgctcttcc .ag.caa.a.agga.aaccttaacct.tcgtgatatt.cttgaaagtg.a.ctt.cg.catt.cg.cttgattctagactagagtcgacctgcaggcatgccctgctt taatgagatatgcgagacgcctatgatcgcatgatatttgctttcaattctgttgtgcacgttgtaaaaaacctgagcatgtgtagctcagatcctt accgccggtttcggttcattctaatgaatatatcacccgttactatcgtatttttatgaataatattctccgttcaatttactgatgtccaagctt

[0072] SEQ ID NO: 13: To increase transcription activity of standard T7gl0 promoter, use GGGATAAT

[0073] SEQ ID NO: 14 To increase transcription activity of standard T7gl0 promoter, use GGGAAATA

[0074] SEQ ID NO: 15 To reduce transcription activity of T7gl0 promoter, use GGGTTCC

[0075] SEQ ID NO: 16 Cryl4Ab coding sequence in Ncol-Xbal fragment cccATGGATTGTAATTTACAATCACAACAAAATATTCCATATAATGTATTAGCAATAC

[0076] CAGTATCTAATGTTAATTCGTTGACTGATACAGTTGGAGATTTAAAAAAAGCATGGG

[0077] AAGAATTTCAAAAAACTGGTTCTTTTTCATTAACAGCTTTACAACAAGGATTTTCTGC

[0078] TTCACAAGGAGGAACATTCAATTATTTAACATTACTACAATCAGGAATATCATTAGC

[0079] TGGTTCTTTTGTTCCTGGAGGTACTTTTGTAGCACCTATTATTAATATGGTTATTGGTT

[0080] GGTTATGGCCACATAAAAACAAAAATGCGGATACAGAAAATTTAATAAATTTAATT

[0081] GATTCAGAAATTCAAAAACAATTAAACAAAGCcTTATTAGATGCAGATAGAAATGA

[0082] GTGGtctTCTTATTTAGAATCTATATTTGATTCTTCAAATAACCTAAATGGTGCAATTG

[0083] TAGATGCACAGTGGTCAGGCACTGTAAATACTACAAATAGAACACTAAGAAATCCA

[0084] ACAGAATCAGATTATACAAATGTTGTTACAAATTTTATTGCAGCGGATGGTGACATT

[0085] GCAAATAATGAAAATCACATAATGAATGGCAACTTTGACGTAGCTGCAGCACCTTAT

[0086] TTTGTTATAGGAGCAACAGCACGTTTTGCAGCAATGCAATCTTATATTAAATTTTGTA

[0087] ATGCTTGGATTGATAAAGTTGGATTGAGTGACGCACAGCTTACTACACAAAAGGCTA

[0088] ATTTAGATCGCACGAAACAAAATATGCGTAATGCAATTCTTAACTATACACAACAAG

[0089] TTATGAAAGTTTTTAAAGATTCCAAAAATATGCCTACAATAGGTACTAATAAATTTA

[0090] GTGTTGATACCTATAATGTATATATTAAAGGAATGACATTAAATGTTTTAGATATTG

[0091] TAGCAATATGGCCTTCATTATATCCAGATGATTATACTTCACAAACAGCCTTAGAAC

[0092] AAACACGTGTCACTTTTTCAAATATGGTTGGCCAAGAAGAAGGTACAGATGGAAGC

[0093] CTAAGAATTTACAATACTTTTGATTCTTTTAGTTATCAACATAGTCCAATACCTAATA

[0094] ATAATGTTAATTTAATTTCTTATTATAATGATGAATTACAAAATCTtGAATTAGGAGT

[0095] ATATACCCCTCCTAAAAAAGGAAGTGGATACTCTTATCCTTATGGATTTGTTTTAAAT

[0096] TATGCAAACAGTAAATATAAATATGGTGATAGCAATGATCCAGAATCTCTAGGAGG

[0097] ATTATCTACACTATCTGCACCTATACAACAAGTTAATGCAGCAACTCAAAACAGTAA

[0098] ATATCTtGATGGAGAAATCCTAAATGGAATAGGAGCATCCTTACCTGGTTATTGTACT

[0099] ACAGGATGTTCACCAACAGAACCACCTTTTAGTTGTACTTCTACCGCTAATGGCTAT

[0100] AAAGCAAGCTGTAATCCTTCAGATACAAATCAAAAAATTAACGCTTTATATCCTTTT

[0101] ACACAAGCTAATGTAAAGGGAAACACAGGAAAATTAGGAGTACTGGCAAGTCTTGT

[0102] TTCtTATGATTTgAATCCTAAAAATGTATTTGGTGAATTAGATTCAGATACAAATAAT

[0103] GTTATCTTAAAAGGtATTCCTGCAGAAAAAGGATATTTTCCTAATAATGCGCGTCCTA

[0104] CTGTTGTAAAAGAATGGATTAATGGTGCAAGTGCTGTACCACTTGATTCAGGAAATA

[0105] CCTTATTTATGACGGCTACGAATTTAACAGCTACTCAATATAGAATTAGAATACGTT ATGCAAATCCAAATTCAAATACTCAAATCGGTGTACGAATTACACAAAATGGTTCTC

[0106] TAATTTCCAGTAGTAATCTAACACTTTATAGTACTACTGATATGAATAATACTTTACC

[0107] ACTAAATGTATATGTAATAGGAGAAAATGGAAATTATACACTTCAAGATTTATATAA

[0108] TACTACTAATGTTTTATCAACAGGAGATATTACATTACAAATTACAGGAGGAGATCA

[0109] AAAAATATTTATTGATCGAATAGAATTTGTTCCTACTATGCCTGTACCTGGTAATACT

[0110] AACAACAATAACGGTAATAATAACGGTAATAATAATCCCCCACACCACGTTTGTGC

[0111] AATAGCTGGTACACAACAATCTTGTTCTGGACCGCCCAAATTTGAACAAGTAAGTGA

[0112] TTTAGAAAAAATTACAACACAAGTATATATGTTATTCAAATCTTCTCCGTATGAAGA

[0113] ATTAGCTCTtGAAGTTTCCAGCTATCAAATTAGTCAAGTAGCATTAAAAGTTATGGCA

[0114] TTATCTGATGAACTATTTTGTGAAGAAAAAAACGTATTACGAAAATTAGTCAATAAA

[0115] GCAAAACAATTATTAGAAGCAAGTAACTTACTAGTAGGTGGAAATTTTGAAACAAC

[0116] TCAAAATTGGGTACTTGGAACAAATGCTTATATAAATTATGATTCGTTTTTATTTAAT

[0117] GGAAATTATTTATCTTTACAACCAGCAAGTGGATTTTTCACATCTTATGCTTATCAAA

[0118] AAATAGATGAGTCAACATTAAAACCATATACACGATATAAAGTTTCTGGGTTCATTG

[0119] GGCAAAGTAATCAAGTAGAACTTATTATTTCTCGTTATGGAAAAGAAATTGATAAAA

[0120] TATTAAATGTTCCtTATGCAGGACCTCTTCCTATCACTGCTGATGCATCAATAACTTG

[0121] TTGTGCACCAGAAATAGGCCAATGTGATGGGGAACAATCTGATTCTCATTTCTTTAA

[0122] CTATAGCATCGATGTAGGTGCACTTCACCCAGAATTAAACCCTGGCATTGAAATTGG

[0123] TCTTAAAATTGTGCAATCAAATGGTTATATAACAATTAGTAATttaGAAATTATTGAAG

[0124] AACGTCCACTTACAGAAATGGAAATTCAAGCAGTCAATCGAAAAAATCAAAAATGG

[0125] GAAAGAGAAAAACTTttaGAATGTGCAAGTATTAGTGAACTTTTACAACCAATTATTA

[0126] ATCAAATCGATTCATTGTTTAAAGATGGAAACTGGTATAATGATATTCTTCCTCATGT

[0127] CACATATCAAGATTTAAAAAATATTATAATACCCGAGTTACCAAAATTAAAACATTG

[0128] GTTCATAGAGAATCTCCCAGGTGAATATCATGAAATTGAACAAAAAATGAAAGAAG

[0129] CTCTAAAATATGCATTTACACAATTAGACGAGAAAAATTTAATCCACAATGGTCACT

[0130] TTACAACTAACTTAATAGATTGGCAAGTAGAAGGTGATGCTCAAATGAAAGTATTA

[0131] GAAAATGATGCTCTTGCATTACAACTTTTCAACTGGGATGCTAGTGCTTCACAATCT

[0132] ATAAATATATTAGAATTTGATGAAGATAAGGCATATAAACTTCGCGTATATGCTCAA

[0133] GGAAGCGGAACAATCCAATTTGGAAACTGTGAAGATGAAGCTATCCAATTTAATAC

[0134] AAACTCATTCATATATCAAGAAAAAATAGTCTATTTCGATACCCCATCAGTTAATTT ACACATACAATCAGAAGGTTCTGAATTTATTGTAAGTAGTATCGATCTAATTGAATT ATCAGACGACCAATAAatctaga

[0135] SEQ ID NO: 17 Pod-specific Msg promoter in Sacl-Ncol fragment (AJ239127) gagctcCGAGTTTAATCACAAGCACAACGAGTTAAAATGATTTTGAAAATAATTGAGTA GTTGTGTGTATTGCATAGTTCATAGGTAAAGTGTGTGTGATTCATGAAATGTGATGA CATGTTAAATTGAGATTATACTATTGTGATTGAGATCGAGTGTATGTGATAAATTGA GTATGTACGTGATTGTGATGTTGTTTGCATTGAGTTATGAACTATGAATTGTACAATC ATATGACTTTAAGACCCTTTAAGGGCGGCGAGTTAATTATAAGACCCTTAAAGGGCG GTGAGTTAATTATAAGACCCTTTAAGTGCGGTGAGTTAATTATAAGACCCTTTAAGG GCGGTGAGTTAATGCTAAGACCCTTTAAGGGTGACGAGTTAAAACTATTTTTGAGAA TAATTGAGGACTCGTGTGTTTTGTACAGTTCATAGATAGAGTTTGTGTGCTAAAATG TTTTCTGAGTTGGACCTGAATCAGGAGGGAGAGGCCCTGACGGACTCTTCGGAGTGT AGGCCTTGGGGGTCACCCGATTTGAGTGTTTCTTTAAGCCTATGTTGATCCCATATGA TTGGAGCATTCTCGTAAAACACTGTGATCCTGACTGGTCTCCCTATGATATTACCTAG TGAGAGTTACTTGACTTACTAGTGTGTGGTTTGTCTTGTCATGTACTCCTAGGCGCCC GACGAGATTTTTCACTGACATGGTACCACATTGCATATAGACTTGAGTTTTAGCATA ACTGTTGCATACGCTTGCTAATTGTTTATCATGAAATTGATGTGTTATTATGTCTTGA TCAGAGTGTGTGATTCTTGTATATTGTGATGGATGATTGAAAGGTGTGATTGATTGA AAAGTGAATTTTGAATGACAAAGTGGTGAAATAATGTGAGCTATGCTAAGTAGATT GTATTTGGCTACTATATGTTATCTCGTTTCTCTCTAGTAGTTAGGAATGTGATAACTC ACTCTCGGTTTGCTGGTATTTGAATCCTGTGATGATCCTGAATTTTGTATTCAAGGAG CGAGATGACTAGATGAACTGCTTTAAGGAATATTGTGCTGAAGGATGTCGGGACAC AATGCTCTGATAGGATGTGACATTGGATAATAAGTTTTTATATTAATTTTATCATGTT AATCTATTTTATTTTACCTCACTGATTTAACAAAATATTTTTATAAATTTGTGACGGA CTTATTTTGAGCCGAATATGTTTTTAATAAGTTTTAATTGATAATAGTGCAGTGGATG TGAACCTTTTAGCCATGTGAATTTGTTTTCCAATATTTTTATATATTTTATTTATATAT ACATATATGTCGGGGTAGAGGATGTCACATCTTCACTCCAAACATCTCATTAATATC AATCATATTCTTCTTGATTATCATATCTAGCCACCCTTTTATCTCATTTCTTTCACTAG GTGTCCAATAATTTTTTAGTGTCTACCAATCCATTTTTATATATAGATATATATTGTT GATTATGGTATTGATATAAAATAATTACTATTGAAAGTAACGATTAATATTCATTAG AAATCGTGAGCACACTTAAGGTAAGTACTCTCCTTTCATTATGATTTATTTTATATCC AAAGTCAGAATTCAAATTCTATATCGCTTGCTTATTAAACACAAACTTATTTTTTACA TATATATTTCACTGAAAATAAACATAAAAATGACACTTAATAATAATTGTTTTCTTTC TATTTTTTGAAATACCAAAACTTTGTTTCATATGTAAAGGGAAAAGGAATAATACTA TTAAGCTACACCATGAAATCAAACAAAAATTATCATTGGGAATGATATAAAAAAAT CAATAAATTTATCCACATATTATAATTTATGATTTCATACACAATAGGATAATAGTTT TACACTTTCATTGCAACAGTATATAATATGACATATTTATTTCTACGTTGTGTGCCCA CTTATTCTTTAATAATAGTAGAAGAGGAAAGGGAAATTCAATATTTACTTCTTCATTT TCCCTTTTAGCCGTTCATCATTTTTTCAACTTTGAAAGTTTTTTTTTGTCTTTTTTCAA AAGAAATTCTCATTGTATTAATACATTGAGAAAAGAAGACAAAGATAAAACAATGT TAAGTTTAAGATGTGAAAAACCACGACCATTTGAGCCTCTATATATAGGTGTCTCGT ATGCTCAAACATGACAAGCCAGTGATAGTTGCTTTCAGATAACTGATAGTTGTGTGC

[0136] AATTATTTGAATTCAAccatgg

[0137] SEQ ID NO: 18 Plastid dual promoter (ptDP) dsRNA construct to target vATPase A in

[0138] EcoRI-Hindlll fragment gaattctaatacgactcactatagggagaTATCCAGCGACCCCTGAAGGATATTAACGAAATCTCTAA CAGTATTTACATCCCGAAGGGTGTCAACATCCCTGCGTTGTCGAGAACTGCTGCTTG GGAGTTTCAGCCCACTAACATCAAGGTCGGAAGCCACATTACCGGAGGTGATCTTTA TGGAGTTGTCCATGAGAACACCCTCGTCAAACACAAAATGATCCTGCCGCCGAGAG CTAAGGGCACAGTGACCTATCTCGCTGCCCCCGGTAACTACACTGTCGATGATGTCG TCCTT GAAAC AGAGTTT GAT GGT GAGAA AACTAAtctccctatagtgagtcgtattaaagctt

[0139] SEQ ID NO: 19 MDK4-20 root-specific promoter, EcoRI-NcoI 934 nt gaattcGGATAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAAGGTCGCGTGTTCG ATCCACGCTCACCGCATTTTTCTTTTTGTTTTTGAAATTTTATTTCTCGTTGCAAAACC AAACGACGCCGTATAAATATAAAAGAACAAATTGACTTGGAGCGACGTTGCTTCGT TAGAACGTTAGGTCGCACGTGTAATTGACTTCTCTAAGAATCAAATTCATTGGGTTT CAGAAAAAAAAAGTTATAAACTTTCCATAGAGAATAATACAAGGTCGAAAAATGAC AAATTCTTAATTCTTTACATGAAATTTAATATTTCTGAAATTATAATACTTGGTTCAC GTATAAAATCATCCATAGATAAGTAATAACACCGTCCATGCATGAACCAATATTATA AGATTCTAACAGGTAACAGATTACATATAACACATGCTCAACAAAATGGCATAGTC ATATTTATGAGGACCGAGAAATGTGGATCACTCTGCTTTCTTTGTAACAATTTAGAA CTTCGTTCATACATGATACATATCGAAATCTACAATGTCTATAATTTTTTTTTTCTTG ACATATATATGTATTTACCGTTGTATAAAACATTAAATATCTGGATTTATGATACAGT TTGTTGTCATTACAAAATTAATCTTAAAACGATACCTTAAACTGGAGAAATAGTCAT ACTTTAATTTTACTTTGAAACGAAGTCAACGAAGGTTAAGTAAAATTGTTAATGGTG TCACCGCGAAGTTCGTCCAAAGGCACACAGTCTCCAACATGTATCTCAATAATTAAT TAACATAATAGCCCCTTTATTAAGCAAGGATTTGACTTTTCACCACTATAAATTCAC AATCAACAATTCTCATTATCATCAAAACAAACCAACTTTCCTTCTCTAATCAAAACA AGAAAGACACAAccATGg

[0140] SEQ ID No: 20 PRP3 root-specific promoter in EcoRI-AcoI fragment 1952 nt gaattcATTGCCATTAAATTGAAGCAAGACACAAAAACTGCAAAACGATAAGAAGATT AACCAAAACTATTTGGCTAAACCAAATCAATTACTCTTATTTTGAGGGCTTTTTGTCT GGCCATTGTCTCGTGATAATCACACTCATTTCCGTTCATGTCGTCAAACCTGTTGAAT CCACGAAGTCAAATTAAAATGTACGGAGATGATGAAGAAGAGAAACAAGATAGAA GAGTTGTAACGCAAGCTGTGGTTGTGGGTGACGATCTTCCTTATTTCGATATTGGCT ATCCATTCAAGTTTAGGTTGTTGCTTTGTTCTACTATTAATATAGCTCGGCCTTGTGA TTATCTAGTTACGTTTATTGCTGTGTCTTTTGTTCATGCATATTATTTCATTGCTTTAT AATGATACATAGTATCATACTTTGGTAATTACTTAGGGATGTCTTTTTGAAATTATTA ATCAGTCATAGAACATATATATTCATCCAACTCTAATAGATGGTATATGATATGAAT GTTTACCATACCACACAACATACGATGGAAAAATGATGAGTTGATGACAGGTCATA TATTATTATGTATCTTGGCATGCCATATGTTTTGGGCTCACAATTATATTTCAATTCTT AACCAAATTGGGCTTCTTAAACATTCACCAGGCCCATTGACATAATCATTTCGATTC AGTTTTCAGAAGGGTTTTTGACTCTAGGATCCCTTTCTCTAAAGCTCATTGCCATTAA CGTTAAACAAAAACACTAGAAATCAACAAAAACTATTTACCTAAACCAAAACAATC ACAGTTTATACAGAGTACAAAATAGTGTCATAAAACCCAAGTAAATTAGAGAATTG ATTAGGGAATATATATGTAAGCAGAGTTACTAATAAAACACCTTCTGGGATAAAAG AGAAGAAGGTATTATCAGCGAAACTCGCAGCTTTAGTTTAGGCCTCACATGAATCAG ATAAGTACTTCATCAAACTTAGCTGGGATTAAGAAAGGCCCTTCCATCTCTCTAATT TCTCTTCTCTATTTGAAAACAACTTTTAAACTATGAATCAAACTGCGAGCCTTAAAC ATTCTCTAAGCATATGAGAAAACAAAGACGAAGAACCCTAATTCTAAGATCCAACA TAAGAAAATAAACAAAAACCGAAGAGATAAATATATCGCCGAATATATATAACAAA TCTCCGATCATTAGTCAATCGCCGCTTGAGCTTGGATTTGAGGCAAAGACAAATATA TAGGATTTGCTTTTTTCATCATTAGGGTTTCCAGTTTTCAATGTTTTGGGCTTATATTA TCGGGCCTTTAGGTTTAATTGGCCCATTAGTTGAAACTATACACGGATGGTTTTCTTA CTTTCTAATTGCTACAAACAACAGACTAATCTGTTTTTACATATTTAATGGTTCAGAT GTCATCAAAGATTATCTGTCCAAATATTTATATTATAAGATACATTTTAATATTTAAT TATGATTTAGTAGAGCGGCCGATCCGTTTTGATATGTTTAGAACTAAAATTTGAAAT ATACTAAAATCAAAATTGGCAAACATTTGAACGAGTCTCATTTATATGTCCTCTGAC CATATTATTTAATGGGCCTATCACATTTCCCGAGCCCAGATAACGTCTTTTCAGTTCT CCTATCCTTTTGGTCAGCTTGTGCATGGTTGTTACTTGTTAATGATGGCCAACATGTT TTTGATCGTGCATTACACTTAGGTATGAGAATCTCAAACATACATGATTATCATCAA TTACTCACTTTTAAGATAACGTTTCTTTATTTCATATTCAAATTTTTAATACCCCAAA CATTTTCTTATAAAGCCCCATTTGGTGAAATCGTTTTCCTCATCACAATTTAAATACA AAGAACACAACAAACGAACTAGCTTAAGGCAATATACAAGCCAAGCGCTCAGCcAT GGCG

[0141] Transformation of the Nuclear Genomes

[0142] Transformation of the tobacco nuclear genome is carried out by performing the protocol described for the pPZP and related pCambia Agrobacterium binary vectors on leaf explants19’20. Kanamycin resistance will be the preferred marker, although gentamycin resistance or other markers, such as those available in the GV 19, pPZP or pCambia vector sets, are equally suitable for introducing transgenes into the nucleus.

[0143] Transformation of the soybean nucleus is accomplished by biolistic transformation of embryogenic cell cultures or by Agrobacterium-mediated transformation. Transformation of the nucleus is performed using established protocols comprising bombardment of embryogenic cell cultures with DNA-coated particles21. Protocols for Agrobacterium -mediated transformation of mature embryos are also available and are preferred over bombardment of embryogenic cell cultures. Cultivars Jack and Williams 82 are varieties that were used for the optimization of soybean half-seed transformation22-23. Nuclear transformation vectors and sequences useful for targeted expression are listed in Table 1. Single Subunit RNA Polymerases Suitable for Expression of Genes-of-Interest

[0144] The seed-specific nuclear gene promoters described here drive the expression of a plastid-targeted T7 phage RNA polymerase. The T7 RNA polymerase (T7RNAP) as an expression tool was described in Studier et al. Methods in Enzymology 185: 60-89, 199O10. We codon optimized the T7 RNA polymerase (FJ881694) coding sequence for expression in the lettuce (Lactuca saliva nucleus using the IDT codon optimization tool See the world wide web at.idtdna.com / pages / tools / codon-optimization-tool; (SEQ ID NO. 12).

[0145] The T7 RNA polymerase is a representative member of the single-subunit DNA- dependent RNAP (ssRNAP) family. Other members include phage T3 (GenBank: AJ318471.1) and SP6 RNA polymerases (NC_004831), the mitochondrial RNA polymerase and the chloroplastid ssRNAP24’23. The T3 and SP6 RNA polymerases derive from Enterobacteria phage, and are alternatives to the T7 RNA polymerase. The circle of ssRNAPs has been extended to include the P60-like viruses from Synechococcus and KMV-like viruses in Klebsiella in addition to the T7-like viruses in Enterobacteria26, 27. Table 2. Examples of tissue-specific promoters for the expression of the gene-of-interest

[0146] Protein Extraction Total leaf and seed protein were extracted from plants grown in the soil using previously established protocols with minor modifications39- 40. Briefly, this protocol is described below. About 100 mg leaf or 50 mg seed were powdered in liquid nitrogen and resuspended in either: a) 400 pl leaf extraction buffer (100 mM HEPES (pH 7), 5 mM EDTA, 10 mM dithiothreitol (DTT), 2 mM phenylmethyl sulfonyl fluoride (PMSF), 10% glycerol, and protease inhibitor cocktail (15 pl / ml; Sigma-Aldrich)), or b) 800 pl seed extraction buffer (50 Mm Tris-HCl (pH 8), 500 mM NaCl, 5 mM EDTA, 5% glycerol, 10 mM dithiothreitol (DTT), 2 mM PMSF, and protease inhibitor cocktail (15 pl / ml; Sigma-Aldrich)).

[0147] The leaf and seed supernatants were collected after centrifugation at 14,000 g for 20 min at 4 °C. The concentration of leaf and seed TSP was determined using a BSA protein standard curve.

[0148] SDS-PAGE Analysis

[0149] Protein extracts containing GFP were separated in 12% SDS-PAGE and stained with Coomassie Brilliant Blue R-250. GFP concentrations were determined in the highest expressing positive control lines using ID-Multi Lane Densitometry (Alphaimager HP, ProteinSimple, Santa Clara, CA).

[0150] Immunoblot Analysis

[0151] GFP was detected by immunoblot analysis using monoclonal antibodies. For immunoblot analysis, 200 ng leaf (total soluble protein) TSP or 5 and 25 pg seed TSP were boiled for 5 min in sample loading dye (0.5 M Tris-HCl, 10% SDS, 25% glycerol, 0.5% Bromophenol blue) and electrophoresed in a 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS- PAGE). The separated proteins were then transferred to a polyvinylidene difluoride (PVDF) membrane with a wet-transfer apparatus (Bio-Rad) for 16 h at a constant voltage of 20 V. Afterwards, the membrane was blocked with 5% non-fat dry milk in Tris-buffered saline with 0.1% Tween®' 20 detergent (TBS-T), for 90 min at room temperature. GFP was detected by 90 min incubation of membranes at room temperature using 1: 1000 dilution of anti -GFP (Living color peptide, Clontech) antibody. After three washes of 5 min in TBS-T, GFP protein membranes were incubated with a 1 :4000 dilution of horseradish peroxidase (HRP)-conjugated anti-mouse IgG (Sigma-Aldrich, USA) at room temperature for 90 min. The blots were visualized by the enhanced chemiluminescent substrate (ECL kit; Bio-Rad) and quantified using Imaged software (National Institute of Health, USA).

[0152] The following examples are provided to illustrate certain embodiments of the invention. They are not intended to limit the invention in any way.

[0153] Example 1: T7 RNA Polymerase for seed-specific expression of recombinant plastid proteins in tobacco

[0154] In the post-transcriptionally regulated system, the plastid mRNA is always present but is inefficiently translated in the absence of PPRIO00translation activator protein9. Consequently, the mRNA is translated at background level. Regulation of recombinant protein expression at the transcriptional level is more desirable, since the mRNA is made only in the target tissue, thereby avoiding unnecessary recombinant protein accumulation in non-target tissue.

[0155] The T7 phage RNA polymerase (T7RNAP) has been used to selectively transcribe transgenes in the plastid genome. In this model, the T7RNAP was translationally fused with a plastid targeting sequences. When expressed in the nucleus, the mRNA was translated in the cytoplasm and the enzyme entered the chloroplasts. When the T7RNAP enters the chloroplast, it selectively transcribes the transgenes from the T7 promoter41'46. T7RNAP in these studies was expressed in the nucleus from an ethanol-inducible gene promoter. In a different embodiment, the T7RNAP was expressed in the chloroplast from a gene incorporated in the plastid genome and driving the transcription of one or more plastid gene from a T7gl0 promoter co-introduced with the T7RNAP gene47, 48. However, there is no published example for expression of a recombinant protein in non-green plastids controlled by a T7 RNAP encoded in the nucleus from a tissue-specific promoter.

[0156] Plastid genes are transcribed by two distinct RNA polymerases: the plastid-encoded plastid RNA polymerase (PEP) and the phage-type, nuclear-encoded RNA polymerase (NEP). PEP is a multi-subunit enzyme similar to the E.coli multi-subunit RNA polymerase. NEP is a single-subunit RNA polymerase similar to phage single-subunit RNA polymerases49. However, the T7 phage promoter is not recognized by the NEP in chloroplast extracts in vitro50or in vivo41. Furthermore, as the T7RNAP does not recognize any of the plastid NEP promoters, it is suitable for application as an orthogonal expression tool. Therefore, for the seed-specific expression of plastid transgenes, we selected a T7 phage RNA polymerase (T7RNAP) expressed from a seed-specific plant nuclear transgene which drives the expression of plastid transgenes with a T7 phage gene 10 (T7gl0) promoter10. The plastid genes have leader sequences with efficient ribosome binding sites, such as the T7gl051or cry9Aa2n’52leaders. A brief description of recombinant protein expression from plastid transgenes with two leader sequences, driven by a tissue specific T7RNAP, is provided below.

[0157] Recombinant protein expression from T7gl0 leader in seed

[0158] The T7gl0 leader, transcriptionally fused with the plastid rRNA operon PEP promoter, yielded high level of recombinant protein accumulation in tobacco and lettuce chloroplasts60, 668. Therefore, we used the T7 phage gene 10 leader for translation of recombinant proteins, using constructs like pMM7 (Figure 2, SEQ ID NO: 1). The construct was introduced into the plastid genome by standard protocols.

[0159] Recombinant protein expression from the Cry9Aa2 leader in seed

[0160] The leader of Cry9Aa2 gene leader also promotes high level recombinant protein expression in chloroplasts and could be a suitable alternative to the T7gl0 leader11, 52. Therefore, we use the Cry9Aa2 gene leader for translation of recombinant proteins, using constructs like pMM33 (Figure 2, SEQ ID NO: 2). The construct was introduced into the plastid genome by standard protocols.

[0161] Uniform transformation of plastid genomes, that is the homoplastomic state, of gfp reporter genes was then confirmed by DNA gel blot analyses (Figure 4A). Also, the lack of transcription in the absence of T7 RNAP was shown on RNA gel blots in the reporter lines (Figure 4B). The nucleus of transplastomic plants was then transformed with an Agrobacterium binary vector carrying a T7RNAP gene expressed from the glycinin G1W82 seed-specific promoter (SEQ ID No: 11). 20 independent transgenic plants were then obtained by transforming the gfp reporter lines carrying the pMM7 and pMM33 constructs. The amount of GFP was than quantified on western blots in the seed and leaf of the TO plants. The protein blots are shown in Figure 5. The data are summarized in Table 3.

[0162] Table 3. GFP accumulation in the seed and leaf of gfp reporter lines transformed with the seed-specific T7RNAP gene. aSIN= SEQ ID No; Plasmid for transformationbMost GFP in seed with T7G10 leader is 126 mg / kg (line #6) andcCry9aA2 leader is 12 mg / kg (line #3)

[0163] The desirable outcome is protein accumulation in the seed, but not in the leaf. The gfp genes with the T7 l0 leader (pMM7 construct) yielded the highest amount of GFP in the seed, accumulating in the range of 64 mg / kg to 126 mg / kg fresh weight. This amount is significantly higher that obtained by the post-transcriptionally regulated system, that was 0.77 mg / kg seed weight9. Importantly, in the present case protein accumulation in the seed was obtained in the absence of detectable GFP accumulation in the leaf, the major drawback of the post- transcriptionally regulated system. Most (14) of the 20 tested lines were in this category. The T7 promoter in SEQ ID NO: 1 has the conserved GGGAGA sequence where transcription initiates from the first G nucleotide (in bold). It was shown that sequences from position +4 to +8 downstream of the transcription start site affect T7 promoter activity over a 5-fold range53.

[0164] Highest transcription activity was measured form the GGGATAAT promoter sequence (SEQ ID NO: 13), closely followed by or GGGAAATA (SEQ ID NO: 14) and the lowest.activity from GGGTTCC (SEQ ID NO. 15). Transcription activity can be boosted by replacing the GGGAGACC sequence in SEQ ID NO: 1 with SEQ ID NO: 13 or SEQ ID NO 14.

[0165] Protein accumulation from the cry9aA2 leader was lower than from the T7gl0 leader. This is likely due to less efficient transcription of the plastid transgene. T7 RNA polymerase promoter sequence is 5' TAATACGACTCACTATAG 3' and the transcription starts at the underlined G in the promoter sequence In the cry9aA2 leader construct transcription is initiated from an A nucleotide (SEQ ID NO: 2). The lOx lower protein levels in part are due to the suboptiraal T7 RNA polymerase promoter.

[0166] EXAMPLE 2: Expression of recombinant proteins io soybean seed plastids The information herein above can be applied experimentally to soybean plants for recombinant protein expression. In the compositions and methods described herein are used for expression of recombinant proteins (e.g., fusion proteins, vaccine proteins, enzymes, GFP, RFP and GUS etc.) in soybean seed plastids. For this, embryogenic cultures of soybean cv. Jack are bombarded with vectors carrying plastid transgenes with the gfp reporter gene with a T7RNAP promoter, and different leader sequences (SEQ ID NO: 1 and SEQ ID NO: 2). The transgenes are cloned as Sac\-Hm(A\\ fragments into Sac\-HinA\\\ digested GPV1 soybean transformation vector (SEQ ID NO: 4) and selected for spectinomycin resistance.

[0167] GPV1 (SEQ ID NO: 4) vector is similar to the tobacco plastid transformation vector (Tobacco Vaccine Vector) TVV1 (Figure 2), which is modified to include plastid targeting sequences derived from the soybean plastid genome. GPV1 carries a spectinomycin resistance (aadA) marker gene with a PrrnLatpB promoter instead of the PrbcL promoter, that is present in the TVV1 vector. The aadA coding region is translationally fused with a cMyc tag to facilitate quantification of aminoglicosyde-3” -adenylyl transferase (AAD), the enzyme that confers spectinomycin resistance. The marker gene is flanked by minimal attB (34 bp) lattP (39 bp) sequences, which are target sites for the PhiC31 phage-site-specific integrase for posttransformation excision of the marker gene. Between the multiple cloning site and attB site a tRNA (trnP) has been included to facilitate efficient processing in polycistronic mRNAs54. However, marker genes may also be excised by alternative site-specific recombinases

[0168] An exemplary embodiment includes a vector suitable for nuclear expression of a seedspecific T7RNA polymerase comprising the soybean seed-specific promoter G1W82 (SEQ ID NO: 11) and an octopine synthase terminator included as the Xbal-Hindlll fragment in SEQ ID NO: 12. Coding regions of plastid transgenes expressed from the T7 promoter (Sacl-Ncol fragment in SEQ ID NO: 1) are described in reference nos: 58-62. said references being incorporated herein by refemce.

[0169] In other embodiments, the soybean nucleus may be transformed by a modified half-seed transformation protocol. The transplastomic soybean plants are then transformed with nuclear genes expressing the T7RNAP from a seed specific promoter. Suitable markers for selection of nuclear transgenic events include, without limitation, kanamycin resistance, hygromycin resistance or glufosinate ammonium (bar gene). Suitable Agrobacterium vectors for soybean nuclear gene transformation include pCambia 1300 vectors which carry a hygromycin resistance marker plant marker55- 56. A seed-specific promoter will be chosen from SEQ ID NOs: 5-11. However, other seed-specific promoters may also be useful for the expression of recombinant proteins in seed plastids.

[0170] Modulating protein output in seed plastids

[0171] Protein output in seed plastids driven by the T7 RNA polymerase depends on: (1) The strength of the plant promoter, driving transcription of the gene in the plant nucleus that produces mRNA from which the plastid targeted T7 RNA polymerase s translated in the cytoplasm. (2) The T7 promoter variant inside the plastid (chloroplast) driving the transcription of the plastid transgene and producing more or less of the mRNA which is translated on plastid ribosomes. In Example 1 we have shown that in tobacco seed protein output could be obtained from variants of the T7 promoter in a 40-fold range, 4 mg / kg to 120 mg / kg fresh seed. (3) The leader sequence of the transgenic mRNA in plastids recruiting plastid ribosomes for translation of the encoded protein utilizing the plastid’s translation machinery. Data are shown for the T7 l0 and the Cry9Aa2 leaders. (4) Protein levels can then be further adjusted by posttranscriptional tools, enabling predictable protein output from the same promoter in a 100-fold range57.

[0172] Expression of recombinant proteins in soybean seed plastids

[0173] We demonstrated that recombinant proteins may accumulate in seed plastids using a transcriptionally regulated, two-component expression system. Seed-based bioreactors, when the proteins are stable, enable long-term storage of the proteins of interest. Good candidates for seedspecific expression in plastids would be bacterial vaccine antigens which do not require glycosylation, such as the anthrax protective antigen58, the porcine post-weaning diarrhea vaccine59and tuberculosis antigen60, 61. More importantly, the non-photosynthetic plastids in the seed are prospective hosts for new metabolic pathways62.

[0174] Protection from damage by soybean cyst nematode (SCN)

[0175] Soybean cyst nematode (SCN) in particular is responsible for a large amount of damage to soybean. Losses due to SCN infestation have been estimated at about $1.5 billion in the U.S. alone. It was shown that a Bacillus thuringiensis delta-endotoxin, Cryl4Ab (GenBank: AGU13817.1), efficiently controls SCN in transgenic soybean by damage to the target pest’s intestine63,64High-level expression of Bt toxins from plant nuclear genes required construction of synthetic genes with an increased GC content65, 66. Since the transcription and translational machinery of the plastid is prokaryotic in origin and its genome is relatively AT reach, the native Bt toxin genes could be efficiently expressed from the native cDNA sequence67. We shall therefore express the Cryl4Ab gene from the Bacillus thuringiensis cDNA with modifications that are necessary to fit the chloroplast transformation vector (SEQ ID NO: 16).

[0176] Root-specific promoters to drive the Cryl4Ab plastid transgene will be the alcohol dehydrogenase-related 1 (GmADRl) gene68. The gene was identified in the cv. Williams 82 genome on Chromosome 12. A suitable root specific promoter would be the Arabidopsis rootcap specific promoter MDK-2034SEQ ID No: 19 or the Arabidopsis root-specific proline-rich promoter (pPRP3)35SEQ ID 20.

[0177] Protection from damage by stink bugs

[0178] Red-banded stink bug Piezodorus guildinii (P. guildinn) has been described as the most damaging stink bug regarding soybean crops, leading to seed injury, low germination percentages, and foliar retention, at low population densities. CrylAc does not seem to influence red bug development, reproduction, or feeding behaviour of red-banded stink bug69. However, RNAi could be a promising approach for the development of red-banded stink bug control strategies. To evaluate the functionality of RNAi machinery, P. guildinii adults were injected with 28 ng / mg of body weight of double stranded RNA (dsRNA) targeting the vacuolar type ATPase A (vATPase A). A mortality of 35 and 51.6% was observed after 7 and 14 days, indicating that RNAi is functional in P. guildinii and the silencing of essential genes has a significant effect in adult viability70.

[0179] RNA interference induced in insects after ingestion of plant-expressed hairpin RNA was recognized as a promising tool for managing devastating crop pests After the initial success of insect control by expressing hairpin RNA from nuclear genes71expression of silencing RNA was extended to chloroplast expression72. In addition to expression of hairpin RNA constructs (hpRNAs), in ptDP constructs the dsRNA is generated by transcription from two convergent (dual) promoters. In ptSL constructs, the dsRNA is also produced from two convergent promoters, but each strand is additionally flanked by sequences forming stem-loop secondary structures, which increase RNA stability in plastids. During the utilization of plastid-mediated RNA interference it was recognized that hpRNA constructs can cause genome instability therefore were found to be less preferable than dsRNA cassettes flanked by convergent promoters73. For reviews on chloroplast- (plastid-) expression of silencing of dsRNA see74'76.

[0180] A ptDP dsRNA construct targeting vATPase that would be suitable to control P. guildinii adults is shown SEQ ID NO: 18. The gene fragment could be cloned as EcoRI-Hindlll fragment in soybean plastid transformation vector GPV1 (SEQ ID NO: 4). The publication by Schvartzman et al.70cites publications on several different sting bug species which are susceptible to control by RNAi. This includes the brown marmorated stink bug Halyomorpha halys7, the neotropical brown stink bug Euschitus heros78, southern green stink bug Nezara viridula19and the brown-winged green sting bug Plauytia stali80. Additional insect target genes for silencing for use with could be P-Actin gene (ACT), heavy chain of dynein, acetylcholineesterase, V-ATPaseH, chitin synthase, cytochrome P450 monooxygenase, tubulin, v-ATPaseB, snf775.

[0181] To drive the expression of the ptDP dsRNAi plastid transgene, the T7RNAP in the nucleus is expressed from the pod-specific Msg promoter81(GenBank accession no. AJ239127) (SEQ ID NO: 17).

[0182] Reduction of armyworm infestation

[0183] The armyworm complex is another group of major insect pests which can also be controlled by Bt insecticidal proteins. However, change in the climatic events favored the emergence of insect resistance82. Combination of different approaches is necessary to achieve efficient pest control. Tissue specific expression of plastid transgenes using the transcriptionally regulated plastid expression system with its adjustable output should make a major impact on advancing army worm pest control.

[0184] REFERENCES

[0185] 1. Svab, Z., Hajdukiewicz, P. & Maliga, P. Stable transformation of plastids in higher plants. Proc. Natl. Acad. Set. USA 87, 8526-8530 (1990).

[0186] 2. Svab, Z. & Maliga, P. High-frequency plastid transformation in tobacco by selection for a chimeric aadA gene. Proc. Natl. Acad. Set. USA 90, 913-917 (1993).

[0187] 3. Maliga, P. & Bock, R. Plastid biotechnology: food, fuel and medicine for the 21st century . Plant Physiol. 155, 1501-1510 (2011). 4. Maliga, P. Engineering the plastid and mitochondrial genomes of flowering plants. Nat Plants 8, 996-1006 (2021).

[0188] 5. Bock, R. Engineering Plastid Genomes: Methods, Tools, and Applications in Basic Research and Biotechnology. Annu. Rev. Plant. Biol. 66, 211-241 (2015).

[0189] 6. Ma, J.K.C., Drake, P.M.W. & Christou, P. The production of recombinant pharmaceutical proteins in plants. Nature Reviews Genetics 4, 794-805 (2003).

[0190] 7. Twyman, R.M., Stoger, E., Schillberg, S., Christou, P. & Fischer, R. Molecular farming in plants: host systems and expression technology. Trends Biotechnol 21, 570-578 (2003).

[0191] 8. Bevan, M. Binary Agrobacterium vectors for plant transformation. Nucleic Acids Res. 12, 8711-8721 (1984).

[0192] 9. Mirzaee, M. et al. Seed plastids: A novel platform for recombinant protein expression. Plant Biotechnol. J. 22, 2575-2577 (2024).

[0193] 10. Studier, F.W., Rosenberg, A.H., Dunn, J. J. & Dubendorff, J.W. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60-89 (1990).

[0194] 11. Chakrabarti, S.K., Lutz, K.A., Lertwirijawong, B., Svab, Z. & Maliga, P. Expression of the cry9Aa2 B.t. gene in the tobacco chlroplasts confers resistance to potato tuber moth. Transgenic Res. 15, 481-488 (2006).

[0195] 12. Dufourmantel, N. et al. Generation of fertile transpl astomic soybean. Plant Mol. Biol. 55, 479-489 (2004).

[0196] 13. Dufourmantel, N., Tissot, G., Garcon, F., Pelissier, B. & Dubald, M. Stability of soybean recombinant plastome over six generations. Transgenic Res. 15, 305-311 (2006).

[0197] 14. Dufourmantel, N. et al. Generation and characterization of soybean and marker-free tobacco plastid transformants over-expressing a bacterial 4-hydroxyphenylpyruvate dioxygenase which provides strong herbicide tolerance. Plant Biotechnol J 5, 118-133 (2007).

[0198] 15. Dufourmantel, N. et al. Generation and analysis of soybean plastid transformants expressing Bacillus thuringiensis CrylAb protoxin. Plant Mol. Biol. 58, 659-668 (2005).

[0199] 16. Maliga, P. & Tungsuchat-Huang, T. in Chloroplast Biotechnology: Methods and Protocols, Vol. 1132. (ed. P. Maliga) 147-163 (Springer Science+Business Media, New York; 2014).

[0200] 17. Maliga, P., Tungsuchat-Huang, T. & Lutz, K.A. Transformation of the Plastid Genome in Tobacco: The Model System for Chloroplast Genome Engineering. Methods Mol Biol 2317, 135-153 (2021).

[0201] 18. Dubald, M., Tissot, G. & Pelissier, B. Plastid transformation in soybean. Methods Mol Biol 1132, 345-354 (2014).

[0202] 19. Hajdukiewicz, P., Svab, Z. & Maliga, P. The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol. Biol. 25, 989-994 (1994).

[0203] 20. Lutz, K.A., Svab, Z. & Maliga, P. Construction of marker-free transplastomic tobacco using the Cve-loxP site-specific recombination system. Nat. Protocols 1, 900-910 (2006).

[0204] 21. Finer, J. J. Generation of Transgenic Soybean (Glycine max) via Particle Bombardment of Embry ogenic Cultures. Curr Protoc Plant Biol 1, 592-603 (2016).

[0205] 22. Li, S.X. et al. Optimization of Agrobacterium -Mediated Transformation in Soybean. Front Plant Sci 8 (2017). Hada, A. et al. Improved Agrobacterium tumefaciens-mediated transformation of soybean [Glycine max (L.) Merr.] following optimization of culture conditions and mechanical techniques. In Vitro Cell Dev-Pl 54, 672-688 (2018). Mcallister, W.T. & Raskin, C.A. The Phage Rna-Polymerases Are Related to DNA- Polymerases and Reverse Transcriptases. Mol Microbiol 10, 1-6 (1993). Hedtke, B., Borner, T. & Weihe, A. Mitochondrial and chloroplast phage-type RNA polymerases vaArabidopsis. Science 277, 809-811 (1997). Drulis-Kawa, Z. et al. Isolation and characterisation of KP34— a novel phiKMV-like bacteriophage for Klebsiella pneumoniae. Applied microbiology and biotechnology 90, 1333-1345 (2011). Lu, X.L. et al. Phage KP34 RNA Polymerase and Its Use in RNA Synthesis. Front Microbiol 10 (2019). Deikman, J., Kline, R. & Fischer, R.L. Organization of ripening and ethylene regulatory regions in a fruit-specific promoter from tomato (Lycopersicon esculentum). Plant Physiol. 100, 2013-2017 (1992). He, Z.M., Jiang, X.L., Qi, Y. & Luo, D.Q. Assessment of the utility of the tomato fruitspecific E8 promoter for driving vaccine antigen expression. Genetica 133, 207-214 (2008). Timerbaev, V. & Dolgov, S. Functional characterization of a strong promoter of the early light-inducible protein gene from tomato. Planta 250, 1307-1323 (2019). Kriz, A.L., Boston, R.S. & Larkins, B.A. Structural and Transcriptional Analysis of DNA-Sequences Flanking Genes That Encode 19 Kilodalton Zeins. Mol. Gen. Genet. 207, 90-98 (1987). Requesens, D.V. et al. The maize a-zein promoter can be utilized as a strong inducer of cellulase enzyme expression in maize kernels. Transgenic Res. 28, 537-547 (2019). Oltmanns, H. et al. Taproot promoters cause tissue specific gene expression within the storage root of sugar beet. Planta 224, 485-495 (2006). Lilley, C.J., Wang, D., Atkinson, H.J. & Urwin, P.E. Effective delivery of a nematoderepellent peptide using a root-cap-specific promoter. Plant Biotechnol. J. 9, 151-161 (2011). Lee, H.H., Kim, J.S., Hoang, Q.T.N., Kim, J. I. & Kim, Y.S. Root-specific expression of defensin in transgenic tobacco results in enhanced resistance against Phytophthora parasitica var. nicotianae. Eur J Plant Pathol 151, 811-823 (2018). Farran, I., Sanchez-Serrano, J. J., Medina, J.F., Prieto, J. & Mingo-Castel, A.M. Targeted expression of human serum albumin to potato tubers. Transgenic Res. 11, 337-346 (2002). Yu, Q., Barkan, A. & Maliga, P. Engineered RNA-binding protein for transgene activation in non-green plastids. Nat Plants 5, 486-490 (2019). Noh, S.A. et al. A sweetpotato SRD1 promoter confers strong root-, taproot-, and tuberspecific expression in Arabidopsis, carrot, and potato. Transgenic Res. 21, 265-278 (2012). Lawrence, S.D., Novak, N.G. & Slack, J.M. Epitope tagging: a monoclonal antibody specific for recombinant fusion proteins in plants. Biotechniques 35, 488-492 (2003). Floss, D.M. et al. Influence of elastin-like peptide fusions on the quantity and quality of a tobacco-derived human immunodeficiency virus-neutralizing antibody. Plant Biotechnol. J. 7, 899-913 (2009). 41 . McBride, K.E., Schaaf, D.J., Daley, M. & Stalker, D.M. Controlled expression of plastid transgenes in plants based on a nuclear DNA-encoded and plastid-targeted T7 RNA polymerase. TWAS’ 91, 7301-7305 (1994).

[0206] 42. Latif, S. et al. Inducible expression of human papillomavirus- 16 LI capsomeres in the plastomes of Nicotiana tabacum. Transplastomic plants develop normal flowers and pollen. Biotechnol Appl Biochem, 1-16 (2021).

[0207] 43. Lossl, A. et al. Inducible trans-activation of plastid transgenes: Expression of the R. eutropha phb operon in transplastomic tobacco. Plant Cell Physiol 46, 1462-1471 (2005).

[0208] 44. Saba, K. et al. Chloroplast-based inducible expression of ESAT-6 antigen for development of a plant-based vaccine against tuberculosis. J Biotechnol 305, 1-10 (2019).

[0209] 45. Gottschamel, J. et al. Production of dengue virus envelope protein domain Ill-based antigens in tobacco chloroplasts using inducible and constitutive expression systems. Plant Mol. Biol. 91, 497-512 (2016).

[0210] 46. Magee, A.M. & Kavanagh, T.A. Plastid genes transcribed by the nucleus-encoded plastid RNA polymerase show increased transcript accumulation in transgenic plants expressing a chloroplast-localized phage T7 RNA polymerase. J Exp Bot 53, 2341-2349 (2002).

[0211] 47. Emadpour, M., Karcher, D. & Bock, R. Boosting riboswitch efficiency by RNA amplification. Nucleic Acids Res. 43, e66 (2015).

[0212] 48. Agrawal, S. et al. Riboswitch-mediated inducible expression of an astaxanthin biosynthetic operon in plastids. Plant Physiol. 188, 637-652 (2022).

[0213] 49. Toyoshima, Y., Onda, Y., Shiina, T. & Nakahira, Y. Plastid transcription in higher plants. Critical Reviews in Plant Sciences 24, 59-81 (2005).

[0214] 50. Liere, K. & Maliga, P. In vitro characterization of the tobacco rpoB promoter reveals a core sequence motif conserved between phage-type plastid and plant mitochondrial promoters. EMBO J. 18, 249-257 (1999).

[0215] 51. Kuroda, H. & Maliga, P. Complementarity of the 16S rRNA penultimate stem with sequences downstream of the AUG destabilizes the plastid mRNAs. Nucleic Acids Res. 29, 970-975 (2001).

[0216] 52. Yu, Q., Tungsuchat-Huang, T., Verma, K., Radler, M.R. & Maliga, P. Independent translation of ORFs in dicistronic operons, synthetic buiding blocks for polycistronic chloroplast gene expression. Plant J. 103, 2318-2329 (2020).

[0217] 53. Conrad, T., Plumbom, I., Alcobendas, M., Vidal, R. & Sauer, S. Maximizing transcription of nucleic acids with efficient T7 promoters. Commun Biol 3, 439 (2020).

[0218] 54. Lamanna, L., Chou, C.H., Lei, H.Q., Barton, E.R. & Maliga, P. Chloroplast transformation for bioencapsulation and oral delivery using the immunoglobulin G fragment crystallizable (Fc) domain. Sci Rep-Uk 13 (2023).

[0219] 55. Ding, S.H., Huang, L.Y., Wang, Y.D., Sun, H.C. & Xiang, Z.H. High-level expression of basic fibroblast growth factor in transgenic soybean seeds and characterization of its biological activity. Biotechnol. Lett. 28, 869-875 (2006).

[0220] 56. Hernandez-Garcia, C.M. et al. High level transgenic expression of soybean (Glycine max) GmERF and Gmubi gene promoters isolated by a novel promoter analysis pipeline. Bmc Plant Biology 10 (2010).

[0221] 57. Yu, Q., Tungsuchat-Huang, T., loannou, A., Barkan, A. & Maliga, P. Posttranscriptional tuning of gene expression over a large dynamic range in synthetic tobacco chloroplast operons. Plant J. 119, 2437-2449 (2024). 58. Gorantala, J. et al. Generation of protective immune response against anthrax by oral immunization with protective antigen plant-based vaccine. J Biotechnol 176, 1-10 (2014).

[0222] 59. Kolotilin, I. et al. Production of a subunit vaccine candidate against porcine post-weaning diarrhea in high-biomass transplastomic tobacco. PLoS One 7, e42405 (2012).

[0223] 60. Lakshmi, P.S., Verma, D., Yang, X.D., Lloyd, B. & Daniell, H. Low Cost Tuberculosis Vaccine Antigens in Capsules: Expression in Chloroplasts, Bio-Encapsulation, Stability and Functional Evaluation In Vitro. Pios One 8 (2013).

[0224] 61. Ahmad, N., Michoux, F., Lossl, A.G. & Nixon, P.J. Challenges and perspectives in commercializing plastid transformation technology. J Exp Bot 67, 5945-5960 (2016).

[0225] 62. Mellor, S.B., Behrendorff, J.B.Y.H., Nielsen, A.Z., Jensen, P.E. & Pribil, M. Nonphotosynthetic plastids as hosts for metabolic engineering. Essays Biochem 62, 41-50 (2018).

[0226] 63. Kahn, T.W. et al. A Bacillus thuringiensis Cry protein controls soybean cyst nematode in transgenic soybean plants. Nat Commun 12, 3380 (2021).

[0227] 64. Berg, R.H. et al. Immunolocalization and Ultrastructure Show Ingestion of Cry Protein Expressed in Glycine max by Heterodera glycines and Its Mode of Action. Mol Plant Microbe Interact 37 , 701-711 (2024).

[0228] 65. Perlak, F.J., Fuchs, R.L., Dean, D.A., McPherson, S.L. & Fischhoff, D.A. Modification of the coding sequence enhances plant expression of insect control protein genes. Proc. Natl. Acad. Sci. USA 88, 3324-3328 (1991).

[0229] 66. Adang, M.J. et al. The reconstruction and expression of a Bacillus thuringiensis crylllA gene in protoplasts and potato plants. Plant Mol. Biol. 21, 1131-1145 (1993).

[0230] 67. McBride, K.E. et al. Amplification of a chimeric Bacillus gene in chloroplasts leads to an extraordinary level of an insecticidal protein in tobacco. Biotechnology 13, 362-365 (1995).

[0231] 68. Xun, H. et al. Analysis of expression characteristics of soybean leaf and root tissuespecific promoters in Arabidopsis and soybean. Transgenic Res. 30, 799-810 (2021).

[0232] 69. Abbate, S. et al. Bt Soybean Cry 1 Ac Does Not Affect Development, Reproduction, or Feeding Behavior of Red-Banded Stink Bug Piezodorus guildinii (Hemiptera: Pentatomidae). Neotrop Entomol 53, 415-423 (2024).

[0233] 70. Schvartzman, C., Fresia, P., Murchio, S., Mujica, M.V. & Dalla-Rizza, M. RNAi in Piezodorus guildinii (Hemiptera: Pentatomidae): Transcriptome Assembly for the Development of Pest Control Strategies. Front Plant Sci 13, 804839 (2022).

[0234] 71. Gordon, K.H. & Waterhouse, P.M. RNAi for insect-proof plants. Nat. Biotechnol. 25, 1231-1232 (2007).

[0235] 72. Zhang, J. et al. Pest control. Full crop protection from an insect pest by expression of long double-stranded RNAs in plastids. Science 347, 991-994 (2015).

[0236] 73. Wu, M. et al. Efficient control of western flower thrips by plastid-mediated RNA interference. Proc. Natl. Acad. Sci. USA 119, e21200811 19 (2022).

[0237] 74. Zhang, J., Khan, S.A., Heckel, D.G. & Bock, R. Next-Generation Insect-Resistant Plants: RNAi-Mediated Crop Protection. Trends Biotechnol 35, 871-882 (2017).

[0238] 75. Li, S., Kim, D.S. & Zhang, J. Plastid-mediated RNA interference: A potential strategy for efficient pest control. Plant Cell Environ 46, 2595-2605 (2023).

[0239] 76. Bally, J. et al. Improved insect-proofing: expressing double-stranded RNA in chloroplasts. Pest Manag Sci 74, 1751-1758 (2018). 77. Mogilicherla, K., Howell, J.L. & Palli, S.R. Improving RNAi in the Brown Marmorated Stink Bug: Identification of target genes and reference genes for RT-qPCR. Sci Rep 8, 3720 (2018).

[0240] 78. Cagliari, D. et al. First transcriptome of the Neotropical pest Euschistus heros (Hemiptera: Pentatomidae) with dissection of its siRNA machinery. Sci Rep 10, 4856 (2020).

[0241] 79. Sharma, R., Taning, C.N.T., Smagghe, G. & Christiaens, O. Silencing of Double- Stranded Ribonuclease Improves Oral RNAi Efficacy in Southern Green Stinkbug Nezaraviridula. Insects 12 (2021).

[0242] 80. Nishide, Y. et al. Effectiveness of orally-delivered double-stranded RNA on gene silencing in the stinkbug Plautia stali. PLoS One 16, e0245081 (2021).

[0243] 81. Stromvik, M.V., Sundararaman, V.P. & Vodkin, L.O. A novel promoter from soybean that is active in a complex developmental pattern with and without its proximal 650 base pairs. Plant Mol. Biol. 41, 217-231 (1999).

[0244] 82. Bengyella, L. et al. Global challenges faced by engineered Bacillus thuringiensis Cry genes in soybean (Glycine max L.) in the twenty -first century. 3 Biotech 8, 464 (2018).

[0245] While certain features of the invention have been described herein, many modifications, substitutions, changes, and equivalents will now occur to those of ordinary skill in the art. It is, therefore, to be understood that the appended claims are intended to cover all such modifications and changes as fall within the scope of the invention.

Claims

What is claimed is:

1. A two-component expression system for high level production of one or more proteins or RNAs of interest in seed plastids and non-green plastids of target plants, comprising; i) a plastid transformation vector comprising a nucleic acid construct encoding: a) an RNA polymerase promoter operably linked to a leader sequence selected from a T7gl0 leader and a Cry9Aa2 leader, said promoter- leader sequence being operably linked to one or more nucleic acids encoding one or more heterologous proteins or RNA of interest; b) at least one plastid specific promoter operably linked to a selectable marker sequence; and c) a 3’ UTR sequence operably linked to a) and b); said construct comprising flanking sequences which facilitate homologous recombination of said plastid transformation vector into the trnV and 3 ’rps!2 / 7 intergenic region of the plastid genome upstream and divergent to the said / / 7 / kgene; and ii) a nuclear transformation vector comprising a nucleic acid construct encoding a plant codon optimized RNA polymerase operably linked to a seed specific promoter, and a plastid targeting sequence, expression of said construct transporting said RNA polymerase protein into seed plastids where it binds to the RNA polymerase promoter of step a), thereby activating transcription of sequence encoding said one or more heterologous proteins of interest.

2. The two-component expression system of claim 1, wherein said RNA polymerase promoter is selected from a T7, a T3 or a SP6 promoter.

3. The two-component expression system of claim 1, wherein said protein or RNA of interest is selected from GFP, mScarlet, RFP, GUS, a vaccine, an antibody, a fusion protein, a protein conferring abiotic resistance, an enzyme, a fungicidal protein, and a RNA that confers insect resistance.

4. The two-component expression system of claim 1, wherein said selectable marker confers resistance to spectinomycin, streptomycin, kanamycin, gentamycin, tobramycin or chloramphenicol.

5. The two-component expression system of any one of the preceding claims, wherein said plastid promoter of step b) is selected from Prrn, PrbcL and said seed specific promoter of step ii) is selected from AtPl, AtP2, AtP3, AtP4, AtP5, AtP6, napin, glycinin, phaseolin, alpha-zein seed-specific promoter, tomato ethylene responsive fruit ripening promoter, sugar beet major latex-like root protein promoter, potato patatin and sweet potato SRD1 tuber-specific promoter, a pod-specific Msg promoter, root specific promoter MDK4-20 and root specific promoter PRP3.

6. The two-component expression system of claim 1, wherein said plastid transformation vector for delivery of said heterologous protein of interest is based on TVV1 of SEQ ID NO: 3.

7. The two-component expression system of claims 1 to 5, wherein said plant is soybean and said plastid transformation vector for delivery of said heterologous protein of interest is GPV1 of SEQ ID NO:4.

8. The two-component expression system of any one of the preceding claims, wherein said plastid transformation vector comprises a multicloning site for insertion of a sequence encoding said heterologous protein of interest.

9. The two-component expression system of any one of the preceding claims wherein said plastid transformation vector comprises a dsRNA of SEQ ID NO: 18 expressing an RNAi toxic to stink bug and said RNA polymerase is operably linked to an Msg promoter of SEQ ID NO: 17 for pod-specific expression.

10. The two-component expression system of any one of the preceding claims wherein said plastid transformation vector comprises a nucleic acid encoding Cryl4Ab insecticidal protein of SEQ ID NO: 16 and said RNA polymerase is operably linked to a promoter of SEQ ID NO: 19 or SEQ ID NO: 20 for root-specific expression.

11. A method for production of one or more heterologous protein of interest in seeds of a target plant, comprising: a) introducing the two-component expression system of any one of the preceding claims into said target plant; b) selecting plant cells surviving selection pressure and expressing said at least one nucleic acid encoding said heterologous protein or RNA of interest; and c) regenerating a homoplastomic plant from the plant cells of step b).

12. The method of claim 11, wherein said plant is selected from a soybean plant and said plastid transformation vector is GPV1 of SEQ ID NO: 4.

11. The method of claim 11 wherein said plant is tobacco and said plastid transformation vector is TVV1 of SEQ ID NO: 3.

13. The method of claim 11 wherein said plant is maize and said plastid transformation vector is a variant of GPV1 (SEQ ID NO: 4), wherein soybean plastid targeting sequences are replaced with maize plastid targeting sequences.

14. The method of claim 11, wherein said vector is introduced via Agrobacterium mediated transformation.

15. The method of claim 11, wherein said vector is delivered via bombardment with biolistic particles.

16. A transgenic plant produced by the method of any one of claims 1 to 15.

Images